A lytic transglycosylase connects bacterial focal adhesion complexes to the peptidoglycan cell wall
eLife assessment
The manuscript by Ramirez Carbo et al. reports a novel role for the MltG homolog AgmT in gliding motility in M. xanthus. The authors provide convincing data to demonstrate that AgmT is a cell wall lytic enzyme (likely a lytic transglycosylase), its lytic activity is required for gliding motility, and that its activity is required for proper binding of a component of the motility apparatus to the cell wall. The findings are valuable as they contribute to our understanding of the molecular mechanisms underlying the interaction between gliding motility and the bacterial cell wall.
https://doi.org/10.7554/eLife.99273.3.sa0Valuable: Findings that have theoretical or practical implications for a subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
The Gram-negative bacterium Myxococcus xanthus glides on solid surfaces. Dynamic bacterial focal adhesion complexes (bFACs) convert proton motive force from the inner membrane into mechanical propulsion on the cell surface. It is unclear how the mechanical force transmits across the rigid peptidoglycan (PG) cell wall. Here, we show that AgmT, a highly abundant lytic PG transglycosylase homologous to Escherichia coli MltG, couples bFACs to PG. Coprecipitation assay and single-particle microscopy reveal that the gliding motors fail to connect to PG and thus are unable to assemble into bFACs in the absence of an active AgmT. Heterologous expression of E. coli MltG restores the connection between PG and bFACs and thus rescues gliding motility in the M. xanthus cells that lack AgmT. Our results indicate that bFACs anchor to AgmT-modified PG to transmit mechanical force across the PG cell wall.
Introduction
In natural ecosystems, the majority of bacteria attach to surfaces (Laventie and Jenal, 2020). Surface-associated motility is critical for many bacteria to navigate and populate their environments (Nan and Zusman, 2016). The Gram-negative bacterium Myxococcus xanthus moves on solid surfaces using two independent mechanisms: social (S-) motility and adventurous (A-) motility. S-motility, analogous to the twitching motility in Pseudomonas and Neisseria, is powered by the extension and retraction of type IV pili (Chang et al., 2016; Wu and Kaiser, 1995). A-motility is a form of gliding motility that does not depend on conventional motility-related cell surface appendages, such as flagella or pili (Nan and Zusman, 2016; Nan and Zusman, 2011). AglR, AglQ, and AglS form a membrane channel that functions as the gliding motor by harvesting proton motive force (Nan et al., 2011; Sun et al., 2011). Motor units associate with at least 14 gliding-related proteins that reside in the cytoplasm, inner membrane, periplasm, and outer membrane (Jakobczak et al., 2015; Nan et al., 2010).
In each gliding cell, two distinct populations of gliding complexes coexist: dynamic complexes move along helical paths and static complexes remain fixed relative to the substrate (Faure et al., 2016; Nan et al., 2013; Nan et al., 2014; Nan, 2017). Motors transport incomplete gliding complexes along helical tracks but form complete, force-generating complexes at the ventral side of cells that appear fixed to the substrate (Figure 1; Faure et al., 2016; Nan, 2017). Based on their functional analogy with eukaryotic focal adhesion sites, these complete gliding machineries are called bacterial focal adhesion complexes (bFACs). Despite their static appearance, bFACs are dynamic under single-particle microscopy. Individual motors frequently display move–stall–move patterns, in which they move rapidly along helical trajectories, join a bFAC where they remain stationary briefly, then move rapidly again toward the next bFAC or reverse their moving directions (Nan et al., 2013; Nan et al., 2015; Pogue et al., 2018). bFACs adhere to the gliding substrate through an outer membrane adhesin (Islam et al., 2023; Nan et al., 2014). As motors transport bFACs toward lagging cell poles, cells move forward but bFACs remain static relative to the gliding substrate.
bFAC assembly can be quantified at nanometer resolution using the single-particle dynamics of gliding motors (Nan et al., 2013; Fu et al., 2018). Single particles of a fully functional, photoactivatable mCherry (PAmCherry)-labeled AglR display three dynamic patterns, stationary, directed motion, and diffusion (Nan et al., 2013; Fu et al., 2018). The stationary population consists of the motors in fully assembled bFACs, which do not move before photobleach. In contrast, the motors moving in a directed manner carry incomplete gliding complexes along helical tracks, whereas the diffusing motors assemble to even less completeness (Faure et al., 2016; Nan et al., 2013; Nan, 2017; Fu et al., 2018). As motors only generate force in static bFACs (Faure et al., 2016), the population of nonmotile motors indicates the overall status of fully assembled bFACs.
However, how bFACs transmit force across the peptidoglycan (PG) cell wall is unclear. PG is a mesh-like single molecule of crosslinked glycan strands that surrounds the entire cytoplasmic membrane. The rigidity of PG defines cell shape and protects cells from osmotic lysis (Garner, 2021; Rohs and Bernhardt, 2021). If bFACs physically penetrate PG, their transportation toward lagging cell poles would tear PG and trigger cell lysis. To avoid breaching PG, an updated model proposes that rather than forming stable and rigid complexes, gliding-related proteins only assemble into force-generating machineries in bFACs. Outside of bFACs, these proteins could localize diffusively or move along with unengaged motor units (Faure et al., 2016; Chen and Nan, 2022). To simplify this model, we can artificially divide each gliding machinery into two subcomplexes, one on each side of the PG layer. The inner subcomplexes move freely and only assemble with the outer subcomplexes in bFACs, which transform proton motive force into mechanical propulsion on cell surfaces (Figure 1).
The inner subcomplexes, containing the motors, are the force-generating units in bFACs. As motors reside in the fluid inner membrane, to transmit force to the cell surface, the inner subcomplexes must push against two relatively rigid structures, one on each side of the membrane, in opposite directions (Chen and Nan, 2022; Figure 1). MreB is a bacterial actin homolog that supports rod shape in many bacteria (Fu et al., 2018; Garner, 2021; Zhang et al., 2021). In M. xanthus, MreB also connects to bFACs on the cytoplasmic side and thus plays essential roles in gliding (Nan and Zusman, 2016; Nan and Zusman, 2011; Nan et al., 2011; Nan et al., 2014; Fu et al., 2018; Mauriello et al., 2010; Treuner-Lange et al., 2015). The inner subcomplexes could push against MreB filaments and PG in the cytoplasm and periplasm, respectively (Faure et al., 2016; Fu et al., 2018; Chen and Nan, 2022; Zhang et al., 2020). The interaction between the inner subcomplexes and PG not only satisfies the physical requirement for force generation but also supports bFAC stability. Without this interaction, the inner and outer subcomplexes can only form transient, ‘slippery’ association, which is predicted to produce short and aberrant cell movements (Chen and Nan, 2022). How the inner complex interacts with PG remains unknown. It was speculated that gliding motors in the inner complex could bind PG directly (Faure et al., 2016). However, such binding has not been confirmed by experiments.
In this study, we found that AgmT, a lytic transglycosylase (LTG) for PG, is required for M. xanthus gliding motility. Whereas AgmT only regulates cell morphology moderately during vegetative growth, it is essential for maintaining PG integrity under the stress from the antibiotic mecillinam. Using single-particle tracking microscopy and coprecipitation assays, we found that AgmT is essential for the inner subcomplexes to connect to PG and stall in bFACs. Importantly, expressing Escherichia coli MltG heterologously rescues the connection between PG and bFACs and thus restores gliding motility. Hence, the LTG activity of AgmT anchors bFACs to PG, potentially by modifying PG structure. Our findings reveal the long-sought connection between PG and bFACs that allows mechanical force to transmit across the PG cell wall.
Results
AgmT, a putative LTG, is required for gliding motility
To elucidate how bFACs interact with PG, we searched for potential PG-binding domains among the proteins that are required for gliding motility. A previous report identified 35 gliding-related genes in M. xanthus through transposon-mediated random mutagenesis (Youderian et al., 2003). Among these genes, agmT (ORF K1515_04910, MXAN_6607 Aramayo and Nan, 2022) was predicted to encode an inner membrane protein with a single transmembrane helix (residues 4–25) followed by a large ‘periplasmic solute-binding’ domain (Youderian et al., 2003). No other motility-related genes are found in the vicinity of agmT. After careful analysis, we found that AgmT showed significant similarity to the widely conserved YceG/MltG family LTGs. The putative active site, Glu223 (corresponding to E218 in E. coli MltG) (Yunck et al., 2016), is conserved in AgmT (Figure 2A).
To confirm the function of AgmT in gliding, we constructed an agmT in-frame deletion mutant. We further knocked out the pilA gene that encodes pilin for type IV pilus to eliminate S-motility. On a 1.5% agar surface, the pilA− cells moved away from colony edges both as individuals and in ‘flare-like’ cell groups, indicating that they were still motile with gliding motility. In contrast, the ΔaglR pilA− cells that lack an essential component in the gliding motor were unable to move outward and thus formed sharp colony edges. Similarly, the ΔagmT pilA− cells also formed sharp colony edges, indicating that they could not move efficiently with gliding (Figure 2B).
We then imaged individual ΔagmT pilA− cells on a 1.5% agar surface at 10-s intervals using bright-field microscopy. To our surprise, instead of being static, individual ΔagmT pilA− cells displayed slow movements, with frequent pauses and reversals (Video 1). To quantify the effects of AgmT, we measured the velocity and gliding persistency (the distances cells traveled before pauses and reversals) of individual cells. Compared to the pilA− cells that moved at 2.30 ± 1.33 μm/min (n = 46) and high persistency (Video 2 and Figure 2C, Figure 2—source data 1, Figure 2D, Figure 2—source data 2), ΔagmT pilA− cells moved significantly slower (0.88 ± 0.62 μm/min, n = 59) and less persistent (Video 1 and Figure 2C, Figure 2—source data 1, Figure 2D, Figure 2—source data 2). Such aberrant gliding motility is distinct from the ‘hyper reversal’ phenotype. Although the hyper reversing cells constitutively switch their moving directions, they usually maintain gliding velocity at the wild-type level (Leonardy et al., 2010). Instead, the slow and ‘slippery’ gliding of the ΔagmT pilA− cells matches the prediction that when the inner complexes of bFACs lose connection with PG, bFACs can only generate short, and inefficient movements (Chen and Nan, 2022). Our data indicate that AgmT is not an essential component in the bFACs. Thus, AgmT is likely to regulate the assembly and stability of bFACs, especially their connection with PG.
AgmT is an LTG
As AgmT is a putative LTG for PG, we then tested if its predicted active site, Glu223, is required for gliding. Because the amino acid following Glu223 is also a glutamate (Glu224), we replaced both glutamate residues with alanine (AgmTEAEA) using site-directed mutagenesis to alter their codons on the chromosome. agmTEAEA pilA− cells formed sharp colony edges on agar surface (Figure 2B). Thus, the putative LTG activity of AgmT is required for M. xanthus gliding motility.
To determine if AgmT is an LTG, we expressed the periplasmic domains (amino acids 25–339) of wild-type AgmT and AgmTEAEA in E. coli. We purified PG from wild-type M. xanthus cells, labeled it with Remazol brilliant blue (RBB), and tested if the purified AgmT variants hydrolyze labeled PG in vitro and release the dye (Uehara et al., 2010; Jorgenson et al., 2014). Similar to lysozyme that specifically cleaves the β-1,4-glycosidic bonds in PG, wild-type AgmT solubilized dye-labeled M. xanthus PG that absorbed light at 595 nm. In contrast, the AgmTEAEA variant failed to release the dye (Figure 3A, Figure 3—source data 1). Hence, AgmT displays LTG activity in vitro.
Whereas AgmT does not affect growth rate (Figure 2—figure supplement 1), cells that lacked AgmT or expressed AgmTEAEA maintained rod shape but were slightly shorter and wider than the wild-type ones (Figure 3B, Figure 3—source data 2). Nevertheless, altered morphology alone does not likely account for abolished gliding. In fact, a previously reported mutant that lacks all three class A penicillin-binding proteins (Δ3) displays similarly shortened and widened morphology (Zhang et al., 2023) but is still motile by gliding (Figure 3—figure supplement 1, Figure 3—source data 2).
A recent report revealed that Vibrio cholerae MltG degrades un-crosslinked PG turnover products and prevents their detrimental accumulation in the periplasm (Weaver et al., 2022). To test if AgmT plays a similar role in M. xanthus, we used mecillinam to induce cell envelope stress. Mecillinam is a β-lactam that induces the production of toxic, un-crosslinked PG strands (Cho et al., 2014). Rather than collapsing the rod shape, mecillinam only causes bulging near the centers of wild-type M. xanthus cells, whereas large-scale cell lysis does not occur, and cell poles still maintain rod shape even after prolonged (20 hr) treatment (Figure 3C; Zhang et al., 2023). Thus, wild-type M. xanthus can largely mitigate mecillinam stress. In contrast, mecillinam-treated agmT cells increased their width drastically, displayed significant cell surface irregularity along their entire cell bodies, and lysed frequently (Figure 3C). Cells expressing AgmTEAEA as the sole source of AgmT displayed similar, but even stronger phenotypes under mecillinam stress, growing into elongated, twisted filaments that formed multiple cell poles and lysed frequently (Figure 3C). These results confirm that similar to V. cholerae MltG, M. xanthus AgmT is important for maintaining cell integrity under mecillinam stress. The different responses from agmT and agmTEAEA cells suggest that while other LTGs could partially substitute AgmT, AgmTEAEA blocks these enzymes from accessing un-crosslinked PG strands.
AgmT is the only LTG in M. xanthus that belongs to the YceG/MltG family. Besides agmT, the genome of M. xanthus contains 13 genes that encode putative LTGs (Key resources table). To test if these proteins also contribute to gliding, we knocked out each of these 13 genes in the pilA− background. The resulting mutants all retained gliding motility, indicating that AgmT is the only LTG that is required for M. xanthus gliding (Figure 2—figure supplement 2).
AgmT is essential for proper bFACs assembly
How does AgmT support gliding? We first tested if AgmT regulates the function of the gliding motor. For this purpose, we quantified the motor dynamics by tracking single particles of AglR, an essential component of the motor. We spotted the cells that express a fully functional, photo-activatable mCherry (PAmCherry)-labeled AglR (Nan et al., 2013) on 1.5% agar surfaces. We used a 405-nm excitation laser to activate the fluorescence of a few labeled AglR particles randomly in each cell and quantified their localization using a 561-nm laser at 10 Hz using single-particle tracking photo-activated localization microscopy (sptPALM) under highly inclined and laminated optical sheet (HILO) illumination (Nan et al., 2013; Fu et al., 2018; Tokunaga et al., 2008). Using this setting, only a thin section of each cell surface that was close to the coverslip was illuminated. To analyze the data, we only chose the fluorescent particles that remained in focus for 4–12 frames (0.4–1.2 s). As free PAmCherry particles diffuse extremely fast in the cytoplasm, entering and exiting the focal plane frequently, they usually appear as blurry objects that cannot be followed at 10 Hz close to the membrane (Fu et al., 2018). For this reason, the noise from any potential degradation of AglR-PAmCherry was negligible. Consistent with our previous results (Nan et al., 2013; Nan et al., 2015), 32.1% (n = 2700) of AglR-PAmCherry particles remained within one pixel (160 nm × 160 nm) before photobleach, indicating that they were immotile. The remaining 67.9% AglR-PAmCherry particles were motile, leaving trajectories of various lengths (Figure 4A, B).
bFAC assembly is sensitive to mechanical cues. As the agar concentration increases in gliding substrate, more motor molecules engage in bFACs, where they appear immotile (Nan et al., 2010; Nan et al., 2013). We exposed aglR-PAmCherry cells to 405 nm excitation (0.2 kW/cm2) for 2 s, where most PAmCherry molecules were photoactivated and used epifluorescence to display the overall localization of AglR (Nan et al., 2013; Fu et al., 2018; Zhang et al., 2023). As the agar concentration increased, bFACs increased significantly in size (Figure 4C). Accordingly, the immotile AglR particles detected by sptPALM increased from 10.7% (n = 1112) on 0.5% agar to 45.2% (n = 726) on 5.0% agar surface (Figure 4B). Thus, the stationary population of AglR-PAmCherry particles reflects the AglR molecules in fully assembled bFACs.
In contrast to the cells that expressed wild-type AgmT (agmT+), AglR particles were hyper motile in the cells that lacked AgmT or expressed AgmTEAEA. On 1.5% agar surfaces, the immotile populations of AglR particles decreased to 10.5% (n = 2989) and 11.7% (n = 1408), respectively. Consistently, AglR-containing bFACs were rarely detectable in these cells, even on 5% agar surfaces (Figure 4A–C).
To test if other components in the gliding machinery also depend on AgmT to assemble into bFACs, we tested the localization of AglZ, a cytoplasmic protein that is commonly used for assessing bFAC assembly (Faure et al., 2016; Mignot et al., 2007). In the cells that expressed wild-type AgmT, yellow fluorescent protein (YFP)-labeled AglZ formed a bright cluster at the leading cell pole and multiple static, near-evenly spaced clusters along the cell body, indicating the assembly of bFACs (Figure 4D). In contrast, AglZ-YFP only formed single clusters at cell poles in the cells that lacked AgmT or expressed AgmTEAEA (Figure 4D). Taken together, the LTG activity of AgmT is essential for proper bFACs assembly.
AgmT does not assemble into bFACs
We first hypothesized that AgmT could assemble into bFACs, where it could generate pores in PG specifically at bFAC loci that allow the inner and outer gliding complexes to interact directly. Alternatively, it could bind to PG and recruit other components to bFACs through protein–protein interactions. Regardless, if AgmT assembles into bFACs, it should localize in bFACs. To test this possibility, we labeled AgmT with PAmCherry on its C-terminus and expressed the fusion protein as the sole source of AgmT using the native promoter and locus of agmT. agmT-PAmCherry pilA- cells displayed gliding motility that was indistinguishable from pilA− cells (Figure 2B), indicating that the fusion protein is functional. Similar to many membrane proteins that are resistant to dissociation by sodium dodecyl sulfate (SDS) (Rath et al., 2009), immunoblot using an anti-mCherry antibody showed that AgmT-PAmCherry accumulated in two bands in SDS–polyacrylamide gel electrophoresis (PAGE) that corresponded to monomers and dimers of the full-length fusion protein, respectively (Figure 5A, Figure 5—source data 1 and 2). This result is consistent with the structure of E. coli MltG that functions as homodimers (PDB: 2r1f). Importantly, AgmT-PAmCherry was about 50 times more abundant than AglR-PAmCherry (Figure 5A, Figure 5—source data 1 and 2). To test if AgmT assembles into bFACs, we first expressed AgmT-PAmCherry and AglZ-YFP together using their respective loci and promoter. We exposed agmT-PAmCherry cells to 405 nm excitation (0.2 kW/cm2) for 2 s to visualize the overall localization of AgmT. We found that on a 1.5% agar surface that favors gliding motility, AglZ formed bright clusters at cell poles and aggregated in near-evenly spaced bFACs along the cell body. In contrast, AgmT localized near evenly along cell bodies without forming protein clusters (Figure 5B). Thus, AgmT does not localize into bFACs. These results echo the fact that despite its abundance, AgmT has not been identified as a component in bFACs despite extensive pull-down experiments using various bFAC components as baits (Nan et al., 2011; Nan et al., 2010; Jolivet et al., 2023).
-
Figure 5—source data 1
- https://cdn.elifesciences.org/articles/99273/elife-99273-fig5-data1-v1.pdf
-
Figure 5—source data 2
- https://cdn.elifesciences.org/articles/99273/elife-99273-fig5-data2-v1.pdf
-
Figure 5—source data 3
- https://cdn.elifesciences.org/articles/99273/elife-99273-fig5-data3-v1.pdf
-
Figure 5—source data 4
- https://cdn.elifesciences.org/articles/99273/elife-99273-fig5-data4-v1.pdf
-
Figure 5—source data 5
- https://cdn.elifesciences.org/articles/99273/elife-99273-fig5-data5-v1.pdf
As an additional test, we used sptPALM to track the movements of AgmT-PAmCherry single particles on 1.5% agar surfaces at 10 Hz. We reasoned that if AgmT assembles into bFACs, AgmT and gliding motors should display similar dynamic patterns. Distinct from the AglR particles of which 32.1% remained stationary, AgmT moved in a diffusive manner, showing no significant immotile population. Importantly, compared to the diffusion coefficients (D) of motile AglR particles (1.8 × 10−2 ± 3.6 × 10−3 μm2/s (n = 1833)), AgmT particles diffused much faster (D = 2.9 × 10−2 ± 5.3 × 10−3 μm2/s (n = 8548)). Taken together, AgmT and the gliding motor did not display significant correlation in either their localization or dynamics. We thus conclude that AgmT does not assemble into bFACs.
AgmT connects bFACs to PG through its LTG activity
We then explored the possibility that AgmT could modify PG through its LTG activity and thus generate the anchor sites for certain components in bFACs. If this hypothesis is true, heterologous expression of a non-native LTG could rescue gliding motility in the ΔagmT strain. To test this hypothesis, we fused the E. coli mltG gene (mltGEc) to a vanillate-inducible promoter and inserted the resulting construct to the cuoA locus on M. xanthus chromosome that does not interfere gliding (Iniesta et al., 2012). We subjected the ΔagmT and agmTEAEA cells that expressed MltGEc to mecillinam (100 μg/ml) stress. Induced by 200 μM sodium vanillate, MltGEc restored cell morphology and integrity of the ΔagmT strain to the wild-type level (Figure 3C). This result confirmed that MltGEc was expressed and enzymatically active in M. xanthus. In contrast, MltGEc failed to confer mecillinam resistance to the agmTEAEA cells (Figure 3C). A potential explanation is that AgmTEAEA could still bind to PG and thus block MltGEc from accessing M. xanthus PG.
Consistent with its LTG activity, the expression of MltGEc restored gliding motility of the ΔagmT pilA− cells on both the colony (Figure 2B) and single-cell (Figure 2C, Figure 2—source data 1, Figure 2D, Figure 2—source data 2) levels. Interestingly, in the absence of sodium vanillate, the leakage expression of MltGEc using the vanillate-inducible promoter was sufficient to compensate the loss of AgmT. A plausible explanation of this observation is that as E. coli grows much faster (generation time 20–30 min) than M. xanthus (generation time ~4 hr), MltGEc could possess significantly higher LTG activity than AgmT. Induced by 200 μM sodium vanillate, the expression of MltGEc further but non-significantly increased the velocity and gliding persistency (Figure 2B, C, Figure 2—source data 1, Figure 2D, Figure 2—source data 2). Importantly, the expression of MltGEc failed to restore gliding motility in the agmTEAEA pilA cells, even in the presence of 200 μM sodium vanillate (Figure 2B). Consistent with the mecillinam resistance assay (Figure 3C), this result suggests that AgmTEAEA still binds to PG and that in the absence of its LTG activity, AgmT does not anchor bFACs to PG. As MltGEc substitutes AgmT in gliding motility, it is the LTG activity, rather than specific interactions between AgmT and bFACs, that is required for gliding.
It is challenging to visualize how AgmT facilitates bFAC assembly through its enzymatic activity in vitro. First, the inner complex in a bFAC spans the cytoplasm, inner membrane, and periplasm and contains multiple proteins whose activities are interdependent (Jakobczak et al., 2015; Nan et al., 2010; Faure et al., 2016). It is hence difficult to purify the entire inner complex in its functional state. Second, Faure et al., 2016 hypothesized that AglQ and AglS in the gliding motor could bind PG directly. However, such binding has not been proved experimentally due to the difficulty in purifying the membrane integral AglRQS complex. To overcome these difficulties, we used AglR-PAmCherry to represent the inner complex of bFAC and investigated how bFACs bind PG in their native environment. To do so, we expressed AglR-PAmCherry in different genetic backgrounds as the sole source of AglR using the native aglR locus and promoter. We lysed these cells using sonication, subjected their lysates to centrifugation, isolated the pellets that contained PG, and detected the presence of AglR-PAmCherry in these pellets by immunoblots using an mCherry antibody. Eliminating AgmT and disabling its active site significantly reduced the amounts of AglR in the pellets (Figure 5C, Figure 5—source data 3–5). Because such pellets contain both the PG and membrane fractions, we further eliminated PG in cell lysates using lysozyme before centrifugation and determined the amount of AglR-PAmCherry in the pellets that only contained membrane fractions. Regardless of the presence and activity of AgmT, comparable amounts of AglR precipitated in centrifugation pellets after lysozyme treatment, indicating that AgmT does not affect the expression or stability of AglR (Figure 5C, Figure 5—source data 3–5). Thus, active AgmT facilitates the association between bFACs and PG. Strikingly, the heterologous expression of MltGEc enriched AglR-PAmCherry in the PG-containing pellets from the ΔagmT cells but not the agmTEAEA ones (Figure 5C, Figure 5—source data 3–5). These results indicate that AgmT connects bFACs to PG through its LTG activity.
The assembly of bFACs produces wave-like deformation on cell surface (Nan et al., 2011; Tchoufag et al., 2019,) suggesting that their assembly may require a flexible PG layer (Nan and Zusman, 2016; Nan et al., 2011; Nan et al., 2013; Nan et al., 2014). As a major contributor to cell stiffness, PG flexibility affects the overall stiffness of cells (Auer et al., 2016). To test the possibility that AgmT and MltGEc facilitate bFAC assembly by reducing PG stiffness, we adopted the general regulators affecting bacterial stiffness (GRABS) assay (Auer et al., 2016) to quantify if the lack of AgmT and the expression of MltGEc affects cell stiffness. To quantify changes in cell stiffness, we simultaneously measured the growth of the pilA−, ΔagmT pilA−, and ΔagmT Pvan-MltGEc pilA− (with 200 μM sodium vanillate) cells in a 1% agarose gel infused with CYE and liquid CYE and calculated the GRABS scores of the ΔagmT pilA−, and ΔagmT Pvan-MltGEc pilA− cells using the pilA- cells as the reference, where positive and negative GRABS scores indicate increased and decreased stiffness, respectively (see Materials and methods; Auer et al., 2016). The GRABS scores of the ΔagmT pilA−, and ΔagmT Pvan-MltGEc pilA− (with 200 μM sodium vanillate) cells were −0.06 ± 0.04 and −0.10 ± 0.07 (n = 4), respectively, indicating that neither AgmT nor MltGEc affects cell stiffness significantly. Whereas PG flexibility could still be essential for gliding, AgmT and MltGEc do not regulate bFAC assembly by modulating PG stiffness. Instead, these LTGs could connect bFACs to PG by generating structural features that are irrelevant to PG stiffness.
Discussion
Gliding bacteria adopt a broad spectrum of nanomachineries. Compared to the trans-envelope secretion system that drives gliding in Flavobacterium johnsoniae and Capnocytophaga gingivalis, the gliding machinery of M. xanthus appears to lack a stable structure that transverses the cell envelope, especially across the PG layer (Nan and Zusman, 2016; Hennell James et al., 2021; Shrivastava et al., 2018). In order to generate mechanical force from the fluid M. xanthus gliding machinery, the inner complex must establish solid contact with PG and push the outer complex to slide (Faure et al., 2016; Chen and Nan, 2022). In this work, we discovered AgmT as the long-sought factor that facilitates persistent gliding by connecting bFACs to PG.
It is surprising that AgmT itself does not assemble into bFACs and that MltGEc substitutes AgmT in gliding. Thus, rather than interacting with bFAC components directly and specifically, AgmT facilitates proper bFAC assembly indirectly through its LTG activity. LTGs usually break glycan strands and produce unique anhydro caps on their ends (Williams et al., 2018; Dik et al., 2017; Höltje et al., 1975; van Heijenoort, 2011; Weaver et al., 2023). However, because AgmT is the only LTGs that is required for gliding, it is not likely to facilitate bFAC assembly by generating such modification on glycan strands. E. coli MltG is a glycan terminase that controls the length of newly synthesized PG glycans (Yunck et al., 2016). Likewise, AgmT could generate short glycan strands and thus uniquely modify the overall structure of M. xanthus PG, such as producing small pores that retard and retain the inner subcomplexes of bFACs (Figure 6). On the contrary, the M. xanthus mutants that lack active AgmT could produce PG with increased strand length, which blocks bFACs from binding to the cell wall and precludes stable bFAC assembly. However, it would be very difficult to demonstrate how glycan length affects the connection between bFACs and PG.
Then how does AgmT, a protein localized diffusively, facilitate bFAC assembly into near-evenly spaced foci? The actin homolog MreB is the only protein in bFACs that displays quasiperiodic localization independent of other components (Fu et al., 2018; Mauriello et al., 2010). M. xanthus MreB assembles into bFACs and positions the latter near evenly along the cell body (Nan et al., 2011; Nan et al., 2013; Fu et al., 2018; Mauriello et al., 2010; Treuner-Lange et al., 2015; Zhang et al., 2020). MreB filaments change their orientation in accordance with local membrane curvatures and could hence respond to mechanical cues (Hussain et al., 2018; Wong et al., 2019; Ursell et al., 2014). Strikingly, M. xanthus does assemble bFACs in response to substrate hardness (Figure 4C) and the assembled bFACs could distort the cell envelope, generating undulations on the cell surface (Nan et al., 2011; Nan et al., 2010; Nan et al., 2013; Tchoufag et al., 2019; Chen et al., 2023). Taken together, whereas AgmT potentially modifies the entire PG layer, it is still the quasiperiodic MreB filaments that determine the loci for bFAC assembly in response to the mechanical cues from the gliding substrate (Figure 6).
Most bacteria encode multiple LTGs that function in PG growth, remodeling, and recycling (Dik et al., 2017; Weaver et al., 2023). This work provides an example that macro bacterial machineries domesticate non-specialized LTGs for specialized functions. Other examples include MltD in the Helicobacter pylori flagellum and MltE in the E. coli type VI secretion system (Roure et al., 2012; Santin and Cascales, 2017). Based on their catalytic folds and domain arrangements, LTGs can be categorized into six distinct families (Dik et al., 2017). Both M. xanthus AgmT and E. coli MltG belong to the YceG/MltG family, which is the first identified LTG family that is conserved in both Gram-negative and -positive bacteria (Yunck et al., 2016; Dik et al., 2017). About 70% of bacterial genomes, including firmicutes, proteobacteria, and actinobacteria, encode YceG/MltG domains (Yunck et al., 2016). The unique inner membrane localization of this family and the fact that AgmT is the only M. xanthus LTG that belongs to this family (Key resources table) could partially explain why it is the only LTG that contributes to gliding motility. It will be interesting to investigate if other LTGs, once anchored to the inner membrane, could also facilitate force generation by bFACs.
Methods
Strains and growth conditions
M. xanthus strains used in this study are listed in Key resources table. Newly created strains are available upon request to the corresponding author. Vegetative M. xanthus cells were grown in liquid CYE medium (10 mM 3-(N-morpholino)propanesulfonic acid (MOPS) pH 7.6, 1% (wt/vol) Bacto casitone (BD Biosciences), 0.5% yeast extract and 8 mM MgSO4) at 32°C, in 125 ml flasks with vigorous shaking, or on CYE plates that contains 1.5% agar. All genetic modifications on M. xanthus were made on the chromosome. Deletion and insertion mutants were constructed by electroporating M. xanthus cells with 4 μg of plasmid DNA. Transformed cells were plated on CYE plates supplemented with 100 µg/ml sodium kanamycin sulfate and 10 µg/ml tetracycline hydrochloride when needed. AgmT and AgmTEAEA were labeled with PAmCherry at their C-termini by fusing their gene to a DNA sequence that encodes PAmCherry through a KESGSVSSEQLAQFRSLD (AAGGAGTCCGGCTCCGTGTCCTCCGAGCAGCTGGCCCAGTTCCGCTCCCTGGAC) linker. All constructs were confirmed by polymerase chain reaction (PCR) and DNA sequencing.
Immunoblotting
The expression and stability of PAmCherry-labeled proteins were determined by immunoblotting following SDS–PAGE using an anti-mCherry antibody (Rockland Immunochemicals, Inc, Lot 46705) and a goat anti-Rabbit IgG (H+L) secondary antibody, horseradish peroxidase (HRP) (Thermo Fisher Scientific, catalog # 31460). MreB was detected as the loading control using an anti-MreB serum (Mauriello et al., 2010) and the same secondary antibody. The blots were developed with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific REF 32109) and a MINI-MED 90 processor (AFP Manufacturing).
Gliding assay
Five microliters of cells from overnight culture were spotted on CYE plates containing 1.5% agar at 4 × 109 colony formation units (cfu)/ml and incubated at 32°C for 48 hr. Colony edges were photographed using a Nikon Eclipse e600 phase-contrast microscope with a 10× 0.30 NA objective and an OMAX A3590U camera.
Protein expression and purification
DNA sequences encoding amino acids 25–339 of AgmT and AgmTEAEA were amplified by PCR and inserted into the pET28a vector (Novogen) between the restriction sites of EcoRI and HindIII and used to transform E. coli strain BL21(DE3). Transformed cells were cultured in 20 ml LB (Luria-Bertani) broth at 37°C overnight and used to inoculate 1 l LB medium supplemented with 1.0% glucose. Protein expression was induced by 0.1 mM isopropyl-h-D-thiogalactopyranoside when the culture reached an OD600 of 0.8. Cultivation was continued at 16°C for 10 hr before the cells were harvested by centrifugation at 6000 × g for 20 min. Proteins were purified using a NGC Chromatography System (Bio-Rad) and 5 ml HisTrap columns (Cytiva) (Pogue et al., 2018; Nan et al., 2006). Purified proteins were concentrated using Amicon Ultra centrifugal filter units (Millipore Sigma) with a 10-kDa molecular weight cutoff and stored at −80°C.
LTG activity (RBB) assay
PG was purified following the published protocol (Zhang et al., 2023; Alvarez et al., 2016). In brief, M. xanthus cells were grown until mid-stationary phase and harvested by centrifugation (6000 × g, 20 min, 25°C). Supernatant was discarded and the pellet was resuspended and boiled in 1× phosphate-buffered saline (PBS) with 5% SDS for 2 hr. SDS was removed by repetitive wash with water and centrifugation (21,000 × g, 10 min, 25°C). Purified PG from 100 ml culture was suspended into 1 ml 1× PBS and stored at −20°C. RBB labeling of PG was performed essentially as previously described (Uehara et al., 2010; Jorgenson et al., 2014). Purified sacculi were incubated with 20 mM RBB in 0.25 M NaOH overnight at 37°C. Reactions were neutralized by adding equal volumes of 0.25 M HCl and RBB-labeled PG was collected by centrifugation at 21,000 × g for 15 min. Pellets were washed repeatedly with water until the supernatants became colorless. RBB-labeled sacculi were incubated with purified AgmT and AgmTEAEA (1 mg/ml) at 25°C for 12 hr. Lysozyme (1 mg/ml) was used as a positive control. Dye release was quantified by the absorption at 595 nm from the supernatants after centrifugation (21,000 × g, 10 min, 25°C).
Cell stiffness (GRABS) assay
Cell stiffness was quantified using the GRABS assay (Adan-Kubo et al., 2006). Briefly, overnight cultures of pilA−, ΔagmT pilA−, and ΔagmT Pvan-MltGEc pilA− (with 200 μM sodium vanillate) cells were inoculated to liquid CYE medium or embedded in solid CYE medium with 1% agarose to OD600 0.5 in 2 ml optical spectrometer cuvettes and incubated at 32°C. Growth data were collected over 24 hr, and the GRABS scores were calculated as (ODmutant, agarose/ODpilA, agarose) − (ODmutant, liquid/ODpilA, liquid).
Co-precipitation assay
M. xanthus cells expressing AglR-PAmCherry were grown in liquid CYE to OD600 ~1, harvested by centrifugation (6000 × g, 20 min, 25°C), washed by 1× PBS, and resuspended into 1× PBS to OD600 6.0 Cells (1 ml) were lysed using a Cole-Parmer 4710 Ultrasonic Homogenizer. Unbroken cells and large debris were eliminated by centrifugation (6000 × g, 10 min, 25°C). Supernatants were subjected to centrifugation at 21,000 × g for 15 min. Pellets that contain both the PG and membrane fractions were resuspended to 1 ml in 1× PBS. To collect the pellets that do not contain PG, supernatants from sonication lysates were incubated with 5 mg/ml lysozyme at 25°C for 5 hr before centrifugation. Five microliters of each resuspended pellet were mixed with 5 μl 2× loading buffer and applied to SDS–PAGE. AglR-PAmCherry was detected using immunoblotting.
Microscopy analysis
For all imaging experiments, we spotted 5 μl of cells grown in liquid CYE medium to OD600 ~1 on agar (1.5%) pads. For the treatments with inhibitors, inhibitors were added into both the cell suspension and agar pads. The length and width of cells were determined from differential interference contrast (DIC) images using a MATLAB (MathWorks) script (Fu et al., 2018; Zhang et al., 2023). DIC and fluorescence images of cells were captured using an Andor iXon Ultra 897 EMCCD camera (effective pixel size 160 nm) on an inverted Nikon Eclipse-Ti microscope with a 100× 1.49 NA TIRF objective. For sptPALM, M. xanthus cells were grown in CYE to 4 × 108 cfu/ml and PAmCherry was activated using a 405-nm laser (0.3 kW/cm2), excited and imaged using a 561-nm laser (0.2 kW/cm2). Images were acquired at 10 Hz. For each sptPALM experiment, single PAmCherry particles were localized in at least 100 individual cells from three biological replicates. sptPALM data were analyzed using a MATLAB (MathWorks) script (Fu et al., 2018; Zhang et al., 2023). Briefly, cells were identified using DIC images. Single PAmCherry particles inside cells were fit by a symmetric 2D Gaussian function, whose center was assumed to be the particle’s position (Fu et al., 2018). Particles that explored areas smaller than 160 nm × 160 nm (within one pixel) in 0.4–1.2 s were considered immotile (Fu et al., 2018; Zhang et al., 2023). Sample trajectories were generated using the TrackMate (Ershov et al., 2022) plugin in the ImageJ suite (https://imagej.net).
Data availability
All data generated or analyzed during this study are included in the manuscript and supporting files; source data files have been provided for Figures 2, 3, and 5.
References
-
De novo assembly and annotation of the complete genome sequence of myxococcus xanthus DZ2Microbiology Resource Announcements 11:e0107421.https://doi.org/10.1128/mra.01074-21
-
Flagellar motor transformed: biophysical perspectives of the Myxococcus xanthus gliding mechanismFrontiers in Microbiology 13:891694.https://doi.org/10.3389/fmicb.2022.891694
-
Mathematical modeling of mechanosensitive reversal control in Myxococcus xanthusFrontiers in Microbiology 14:1294631.https://doi.org/10.3389/fmicb.2023.1294631
-
Lytic transglycosylases: concinnity in concision of the bacterial cell wallCritical Reviews in Biochemistry and Molecular Biology 52:503–542.https://doi.org/10.1080/10409238.2017.1337705
-
Toward a mechanistic understanding of bacterial rod shape formation and regulationAnnual Review of Cell and Developmental Biology 37:1–21.https://doi.org/10.1146/annurev-cellbio-010521-010834
-
Novel type of murein transglycosylase in Escherichia coliJournal of Bacteriology 124:1067–1076.https://doi.org/10.1128/jb.124.3.1067-1076.1975
-
Surface sensing and adaptation in bacteriaAnnual Review of Microbiology 74:735–760.https://doi.org/10.1146/annurev-micro-012120-063427
-
Purification and preliminary X-ray crystallographic analysis of the ligand-binding domain of Sinorhizobium meliloti DctBBiochimica et Biophysica Acta 1764:839–841.https://doi.org/10.1016/j.bbapap.2005.10.023
-
A multi-protein complex from Myxococcus xanthus required for bacterial gliding motilityMolecular Microbiology 76:1539–1554.https://doi.org/10.1111/j.1365-2958.2010.07184.x
-
Uncovering the mystery of gliding motility in the myxobacteriaAnnual Review of Genetics 45:21–39.https://doi.org/10.1146/annurev-genet-110410-132547
-
Bacteria that glide with helical tracksCurrent Biology 24:R169–R173.https://doi.org/10.1016/j.cub.2013.12.034
-
Novel mechanisms power bacterial gliding motilityMolecular Microbiology 101:186–193.https://doi.org/10.1111/mmi.13389
-
Bacterial gliding motility: rolling out a consensus modelCurrent Biology 27:R154–R156.https://doi.org/10.1016/j.cub.2016.12.035
-
PlpA, a PilZ-like protein, regulates directed motility of the bacterium Myxococcus xanthusMolecular Microbiology 107:214–228.https://doi.org/10.1111/mmi.13878
-
Growth and division of the peptidoglycan matrixAnnual Review of Microbiology 75:315–336.https://doi.org/10.1146/annurev-micro-020518-120056
-
Peptidoglycan maturation enzymes affect flagellar functionality in bacteriaMolecular Microbiology 86:845–856.https://doi.org/10.1111/mmi.12019
-
The small G-protein MglA connects to the MreB actin cytoskeleton at bacterial focal adhesionsThe Journal of Cell Biology 210:243–256.https://doi.org/10.1083/jcb.201412047
-
Peptidoglycan hydrolases of Escherichia coliMicrobiology and Molecular Biology Reviews 75:636–663.https://doi.org/10.1128/MMBR.00022-11
-
Peptidoglycan glycosidases in bacterial growthJournal of Bacteriology 205:e0042822.https://doi.org/10.1128/jb.00428-22
-
A step-by-step in crystallo guide to bond cleavage and 1,6-anhydro-sugar product synthesis by A peptidoglycan-degrading lytic transglycosylaseThe Journal of Biological Chemistry 293:6000–6010.https://doi.org/10.1074/jbc.RA117.001095
-
Identification of MltG as a potential terminase for peptidoglycan polymerization in bacteriaMolecular Microbiology 99:700–718.https://doi.org/10.1111/mmi.13258
Article and author information
Author details
Funding
National Institutes of Health (R01GM129000)
- Carlos A Ramirez Carbo
- Olalekan G Faromiki
- Beiyan Nan
National Institutes of Health (T32GM135115)
- Carlos A Ramirez Carbo
The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.
Acknowledgements
We would like to acknowledge the Department of Biology and the College of Arts and Sciences at Texas A&M University for the support on camera purchase. We thank the members of the Nan lab for helpful comments on the project.
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.99273. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Ramirez Carbo, Faromiki et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 621
- views
-
- 40
- downloads
-
- 0
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Biochemistry and Chemical Biology
- Microbiology and Infectious Disease
Malaria parasites have evolved unusual metabolic adaptations that specialize them for growth within heme-rich human erythrocytes. During blood-stage infection, Plasmodium falciparum parasites internalize and digest abundant host hemoglobin within the digestive vacuole. This massive catabolic process generates copious free heme, most of which is biomineralized into inert hemozoin. Parasites also express a divergent heme oxygenase (HO)-like protein (PfHO) that lacks key active-site residues and has lost canonical HO activity. The cellular role of this unusual protein that underpins its retention by parasites has been unknown. To unravel PfHO function, we first determined a 2.8 Å-resolution X-ray structure that revealed a highly α-helical fold indicative of distant HO homology. Localization studies unveiled PfHO targeting to the apicoplast organelle, where it is imported and undergoes N-terminal processing but retains most of the electropositive transit peptide. We observed that conditional knockdown of PfHO was lethal to parasites, which died from defective apicoplast biogenesis and impaired isoprenoid-precursor synthesis. Complementation and molecular-interaction studies revealed an essential role for the electropositive N-terminus of PfHO, which selectively associates with the apicoplast genome and enzymes involved in nucleic acid metabolism and gene expression. PfHO knockdown resulted in a specific deficiency in levels of apicoplast-encoded RNA but not DNA. These studies reveal an essential function for PfHO in apicoplast maintenance and suggest that Plasmodium repurposed the conserved HO scaffold from its canonical heme-degrading function in the ancestral chloroplast to fulfill a critical adaptive role in organelle gene expression.
-
- Microbiology and Infectious Disease
Toxoplasma gondii is an intracellular parasite that subverts host cell functions via secreted virulence factors. Up to 70% of parasite-controlled changes in the host transcriptome rely on the MYR1 protein, which is required for the translocation of secreted proteins into the host cell. Mice infected with MYR1 knock-out (KO) strains survive infection, supporting a paramount function of MYR1-dependent secreted proteins in Toxoplasma virulence and proliferation. However, we have previously shown that MYR1 mutants have no growth defect in pooled in vivo CRISPR-Cas9 screens in mice, suggesting that the presence of parasites that are wild-type at the myr1 locus in pooled screens can rescue the phenotype. Here, we demonstrate that MYR1 is not required for the survival in IFN-γ-activated murine macrophages, and that parasites lacking MYR1 are able to expand during the onset of infection. While ΔMYR1 parasites have restricted growth in single-strain murine infections, we show that the phenotype is rescued by co-infection with wild-type (WT) parasites in vivo, independent of host functional adaptive immunity or key pro-inflammatory cytokines. These data show that the major function of MYR1-dependent secreted proteins is not to protect the parasite from clearance within infected cells. Instead, MYR-dependent proteins generate a permissive niche in a paracrine manner, which rescues ΔMYR1 parasites within a pool of CRISPR mutants in mice. Our results highlight an important limitation of otherwise powerful in vivo CRISPR screens and point towards key functions for MYR1-dependent Toxoplasma-host interactions beyond the infected cell.