Abstract
Salmonella enterica serovar Typhimurium is a facultative intracellular pathogen that utilizes its type III secretion systems (T3SSs) to inject virulence factors into host cells and colonize the host. In turn, a subset of cytosolic immune receptors respond to T3SS ligands by forming multimeric signaling complexes called inflammasomes, which activate caspases that induce interleukin-1 (IL-1) family cytokine release and an inflammatory form of cell death called pyroptosis. Human macrophages mount a multifaceted inflammasome response to Salmonella infection that ultimately restricts intracellular bacterial replication. However, how inflammasomes restrict Salmonella replication remains unknown. We find that caspase-1 is essential for mediating inflammasome responses to Salmonella and restricting bacterial replication within human macrophages, with caspase-4 contributing as well. We also demonstrate that the downstream pore-forming protein gasdermin D (GSDMD) and Ninjurin-1 (NINJ1), a mediator of terminal cell lysis, play a role in controlling Salmonella replication in human macrophages. Notably, in the absence of inflammasome responses, we observed hyperreplication of Salmonella within the cytosol of infected cells as well as increased bacterial replication within vacuoles, suggesting that inflammasomes control Salmonella replication primarily within the cytosol and also within vacuoles. These findings reveal that inflammatory caspases and pyroptotic factors mediate inflammasome responses that restrict the subcellular localization of intracellular Salmonella replication within human macrophages.
Introduction
Intracellular bacterial pathogens create and maintain replicative niches within host cells. To survive inside the host, these pathogens must remodel the host cellular landscape and overcome immune defenses. Salmonella enterica serovar Typhimurium (Salmonella) is a facultative intracellular pathogen and a major cause of food-borne illness worldwide (Majowicz et al., 2010). Following ingestion, Salmonella colonizes the intestinal tract, where it can invade, replicate, and survive in host cells, including macrophages (Crowley et al., 2016; R. L. Santos & Bäumler, 2004). Salmonella employs type III secretion systems (T3SSs) that act as molecular syringes to inject virulence factors, or effectors, into the host cell cytosol . Specifically, Salmonella relies on two distinct T3SSs encoded on Salmonella Pathogenicity Islands 1 and 2 (SPI-1 and SPI-2) to invade and replicate within host cells, respectively (Mills et al., 1995; Shea et al., 1996; Hensel et al., 1998; Galan & Zhou, 2000; Galán, 1999; Galán & Collmer, 1999; Galan & Curtiss, 1989; Ochman et al., 1996; Cirillo et al., 1998). The SPI-2 T3SS translocates effectors to facilitate biogenesis and maintenance of the Salmonella- containing vacuole (SCV), wherein Salmonella resides and replicates (Cirillo et al., 1998; Takeuchi, 1967; Takeuchi & Sprinz, 1967; Kihlström & Latkovic, 1978; Garcia-del Portillo et al., 1993; Garcia-del Portillo & Finlay, 1995; Steele-Mortimer et al., 1999; Hansen-Wester et al., 2002; Steele-Mortimer, 2008; Jennings et al., 2017; Brumell, Goosney, et al., 2002; Brumell, Tang, et al., 2002; Beuzón et al., 2000; Hensel et al., 1998). In epithelial cells, Salmonella escapes its vacuolar niche and hyperreplicates in the host cell cytosol (Knodler, Crowley, et al., 2014; Knodler et al., 2010; Knodler, Nair, et al., 2014; Malik-Kale et al., 2012). While the activity of T3SSs are essential for Salmonella to infect and replicate within host cells, they also inject bacterial ligands that enable innate immune sensing of Salmonella (E. A. Miao, Mao, et al., 2010; Rayamajhi et al., 2013; Sun et al., 2007; Yang et al., 2013).
The mammalian innate immune system detects violations of cytosolic sanctity, such as the presence of intracellular bacterial pathogens, through cytosolic pattern recognition receptors (PRRs) (Janeway, 1989; Lamkanfi & Dixit, 2009; Medzhitov & Janeway, 2002). A subset of these PRRs includes the nucleotide-binding domain, leucine-rich repeat (NLR) family proteins. NLRs respond to their cognate stimuli by oligomerizing and inducing the assembly of multiprotein complexes termed inflammasomes, which activate inflammatory caspases (Broz & Dixit, 2016; Lamkanfi & Dixit, 2009, 2014; Martinon et al., 2002). Canonical inflammasomes recruit and activate caspase-1, which cleaves and activates pro-inflammatory interleukin-1 (IL-1) family cytokines and the pore-forming protein gasdermin D (GSDMD) (Kuida et al., 1995; Li et al., 1995; Agard et al., 2010; Thornberry et al., 1992; Shi et al., 2015; Kayagaki et al., 2015). Alternatively, noncanonical inflammasomes are formed by caspase-11 in mice and two orthologs in humans, caspase-4 and caspase-5, in response to cytosolic lipopolysaccharide (LPS) (Casson et al., 2015; Hagar et al., 2013; Kayagaki et al., 2011, 2013; Lagrange et al., 2018; Schmid-Burgk et al., 2015; Shi et al., 2014). These caspases directly process and activate GSDMD (Kayagaki et al., 2015; Shi et al., 2015). Liberated GSDMD N-terminal fragments oligomerize to create pores in the host plasma membrane, through which IL-1 family cytokines and other alarmins are released to promote a lytic form of inflammatory cell death termed pyroptosis (Agard et al., 2010; Ding et al., 2016; Kayagaki et al., 2015; Shi et al., 2015).
Salmonella activates several inflammasomes in human macrophages. One such inflammasome is the NLR family, apoptosis inhibitory protein (NAIP)/NLR family, CARD domain-containing protein 4 (NLRC4) inflammasome (Bierschenk et al., 2019; Gram et al., 2021; Naseer, Egan, et al., 2022). NAIP detects the cytosolic presence of T3SS structural components and flagellin (Grandjean et al., 2017; Kofoed & Vance, 2011; Kortmann et al., 2015; E. A. Miao, Mao, et al., 2010; Molofsky et al., 2006; Rauch et al., 2016; Rayamajhi et al., 2013; Ren et al., 2006; Reyes Ruiz et al., 2017; Sun et al., 2007; Yang et al., 2013; Zhao et al., 2011, 2016). Upon ligand recognition, NAIP recruits NLRC4, which oligomerizes to form the active NAIP/NLRC4 inflammasome (Diebolder et al., 2015; Z. Hu et al., 2015; Zhang et al., 2015). Salmonella also activates the NLR pyrin domain-containing protein 3 (NLRP3) inflammasome and the noncanonical caspase-4/5 inflammasome in human macrophages (Bierschenk et al., 2019; Casson et al., 2015; Gram et al., 2021; Naseer, Egan, et al., 2022). NLRP3 responds to diverse stimuli, including ionic fluxes as a result of host plasma membrane damage (Franchi et al., 2007; Hornung et al., 2008; Mariathasan et al., 2006; Muñoz- Planillo et al., 2013; Perregaux & Gabel, 1994), and can be secondarily activated by the noncanonical inflammasome (Baker et al., 2015; Casson et al., 2015; Kayagaki et al., 2013; Pilla et al., 2014; Rathinam et al., 2012; Rühl & Broz, 2015; Schmid-Burgk et al., 2015; Shi et al., 2014).
Inflammasome activation is critical for host defense against Salmonella. In mice, the NAIP/NLRC4 inflammasome is required to control Salmonella infection (Carvalho et al., 2012; Franchi et al., 2012; Hausmann et al., 2020; E. A. Miao et al., 2006; E. A. Miao, Mao, et al., 2010; Rauch et al., 2016, 2017; Sellin et al., 2014; Zhao et al., 2016).
In murine intestinal epithelial cells (IECs), NAIP/NLRC4 inflammasome activation triggers pyroptosis and expulsion of infected cells, and is both necessary and sufficient in IECs to restrict Salmonella replication and prevent bacterial dissemination to distal organ sites (Hausmann et al., 2020; Rauch et al., 2017; Sellin et al., 2014). Unlike murine IECs, human epithelial cells do not rely on NAIP/NLRC4 or caspase-1, but instead rely on caspase-4 to control Salmonella replication, in part through pyroptosis and cell extrusion (Holly et al., 2020; Knodler, Crowley, et al., 2014; Knodler et al., 2010; Naseer, Zhang, et al., 2022). Moreover, in murine macrophages, inflammasome activation controls the replication of a mutant strain of Salmonella that aberrantly invades the cytosol, but only slightly limits replication of wild-type (WT) Salmonella (Man, Ekpenyong, et al., 2014; Thurston et al., 2016). In contrast, we found that human macrophages rely on NAIP/NLRC4- and NLRP3-dependent inflammasome responses to control intracellular WT Salmonella replication (Naseer, Egan, et al., 2022). However, how inflammasome signaling restricts Salmonella replication in human macrophages remains unknown.
In this study, we show that caspase-1 is required to restrict intracellular Salmonella replication early during infection in human macrophages, and that caspase- 4 enables the restriction of Salmonella later during infection. We find that the cell lysis mediators GSDMD and ninjurin-1 (NINJ1) also contribute to bacterial restriction.
Importantly, we observed that while human macrophages unable to undergo inflammasome responses showed slightly elevated bacterial replication within SCVs, they became permissive to hyperreplication of Salmonella within the cytosolic compartment. Thus, inflammasome activation appears to preferentially restrict cytosolic Salmonella replication. Our results offer insight into how inflammasomes control Salmonella in human macrophages and restrict the distinct intracellular spatial niches that Salmonella occupies in these cells.
Results
Caspase-1 promotes the control of Salmonella replication within human macrophages
Human macrophages undergo NAIP/NLRC4- and NLRP3-dependent inflammasome activation during Salmonella infection (Bierschenk et al., 2019; Gram et al., 2021; Naseer, Egan, et al., 2022), which restricts intracellular Salmonella replication (Naseer, Egan, et al., 2022). Nonetheless, how inflammasome activation controls Salmonella replication in human macrophages remains unclear. Inflammasomes recruit and activate caspase-1 in both murine and human cells (Franchi et al., 2006; Man, Hopkins, et al., 2014; Mariathasan et al., 2004; E. A. Miao et al., 2006; Ross et al., 2022; Zamboni et al., 2006), and caspase-1 promotes the control of Salmonella both in vivo and in vitro (Broz et al., 2010, 2012; Crowley et al., 2020; Hausmann et al., 2020; Holly et al., 2020; Lara-Tejero et al., 2006; E. A. Miao, Leaf, et al., 2010; Rauch et al., 2017; Raupach et al., 2006; Sellin et al., 2014; Thurston et al., 2016). Thus, we sought to test whether caspase-1 restricts Salmonella replication specifically in human macrophages.
To first interrogate the impact of caspase activity on Salmonella replication in human macrophages, we primed macrophages derived from the human monocytic cell line, THP-1, with the TLR1/2 agonist Pam3CSK4 to upregulate the expression of inflammasome components. Then, we pretreated the cells with Ac-YVAD-cmk (YVAD), a chemical inhibitor of caspase-1 activity, or Z-VAD-FMK (ZVAD), a pan-caspase inhibitor. Upon infection with wild-type (WT) Salmonella, WT THP-1 cells pretreated with either YVAD or ZVAD had significantly reduced levels of IL-1β release and cell death compared to infected WT cells pretreated with the vehicle control (Figure 1 – figure supplement 1A-B). Since pretreatment with YVAD largely phenocopies ZVAD, these data suggest that caspase-1 is the primary caspase that responds to Salmonella infection in THP-1 cells. We next assessed intracellular Salmonella burdens by determining bacterial colony forming units (CFUs). The increase in bacterial CFUs was significantly higher in WT cells pretreated either YVAD or ZVAD compared to cells pretreated with DMSO (Figure 1 – figure supplement 1C). Microscopic analysis revealed that WT cells treated with either YVAD or ZVAD prior to infection harbored significantly higher intracellular Salmonella burdens compared to cells pretreated with DMSO (Figure 1 – figure supplement 1D). Overall, these results suggest that caspase-1 activity primarily controls Salmonella burdens in human macrophages.
Next, to genetically test the requirement of caspase-1, we used two independent CASP1-/- THP-1 single cell clones generated through CRISPR/Cas9-mediated deletion (Okondo et al., 2017). In agreement with previous reports (Bierschenk et al., 2019; Gram et al., 2021; Naseer, Egan, et al., 2022), WT THP-1 cells primed with Pam3CSK4 and then infected with WT Salmonella exhibited high levels of IL-1β, IL-18, and IL-1α release as well as cell death at 6 hpi (Figure 1A-B; Figure 1 – figure supplement 2A-B). In contrast, Pam3CSK4-primed CASP1-/- THP-1 cells released negligible levels of inflammasome-dependent cytokines and did not undergo substantial cell death upon infection (Figure 1A-B; Figure 1 – figure supplement 2A-B). Infected WT and CASP1-/- THP-1 cells released similar levels of the inflammasome-independent cytokine TNF-α (Figure 1 – figure supplement 2C). These results indicate that caspase-1 is required for inflammasome responses to Salmonella infection in human macrophages.

Caspase-1 promotes the control of Salmonella replication within human macrophages.
WT and two independent clones of CASP1-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium (A, B, C), or WT S. Typhimurium constitutively expressing GFP (D,E) at an MOI = 20. (A) Release of IL-1β into the supernatant was measured by ELISA at 6 hpi. (B) Cell death (% cytotoxicity) was measured by LDH release assay and normalized to mock-infected cells at 6 hpi. (C) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. Fold-change in CFU/well was calculated. (D, E) Cells were fixed at 6 hpi and stained for DAPI to label DNA (blue). (D) The number of bacteria per cell at 6 hpi was scored by fluorescence microscopy. Each dot represents one infected cell. 150 infected cells were scored for each genotype. (E) Representative images are shown. Scale bar represents 10 µm. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment (A, B, C, D). ***p < 0.001, ****p < 0.0001 by Dunnett’s multiple comparisons test (A, B, C, D). Data shown are representative of at least three independent experiments.
We next tested whether caspase-1 is required to restrict Salmonella replication in human macrophages. At 1 hour post-infection (hpi), we did not observe any significant differences in bacterial uptake between Pam3CSK4-primed WT and CASP1-/- THP-1 cells (Figure 1 – figure supplement 2D). However, at 6 hpi, CASP1-/- cells harbored significantly higher bacterial burdens and a significant fold-increase in bacterial CFUs compared to WT cells (Figure 1C; Figure 1 – figure supplement 2E). To assess intracellular bacterial burdens on a single-cell level, we quantified the number of WT Salmonella per cell by microscopy. WT cells contained relatively low numbers of Salmonella on average (∼5 bacteria per cell), while CASP1-/- cells harbored significantly higher numbers of Salmonella on average (∼30 bacteria per cell) at 6 hpi (Figure 1D-E). Overall, these data indicate that caspase-1 limits intracellular Salmonella replication in human macrophages.
We next examined whether caspase-1-mediated control of Salmonella replication in human macrophages requires TLR1/2 priming. At 1 hpi, we did not observe any significant differences in bacterial uptake between unprimed WT and CASP1-/- THP-1 cells (Figure 1 – figure supplement 3A). However, at 6 hpi, unprimed CASP1-/- cells harbored significantly higher bacterial burdens and a significant fold-increase in bacterial CFUs compared to unprimed WT cells (Figure 1 – figure supplement 3B-C).
Since unprimed conditions phenocopy TLR1/2-primed conditions (Figure 1C; Figure 1 – figure supplement 2D-E), these data indicate that caspase-1 promotes the restriction of Salmonella replication within human macrophages independent of TLR1/2 priming.
In the previous experiments, we infected THP-1 cells with Salmonella grown under SPI-1-inducing conditions. So, we subsequently sought to determine whether Salmonella grown to stationary phase similarly replicated in human macrophages. At 1 hpi and at 6 hpi, we did not observe any significant differences in bacterial uptake between WT and CASP1-/- THP-1 cells infected with stationary phase Salmonella (Figure 1 – figure supplement 4A-B). Strikingly, we did not observe any fold-change in the bacterial CFUs in both WT and CASP1-/- THP-1 cells (Figure 1 – figure supplement 4C). These data indicate that by 6 hours post-infection, Salmonella do not replicate efficiently in human macrophages unless grown under SPI-1-inducing conditions (Figure 1C; Figure 1 – figure supplement 2D-E).
Next, we sought to address the possibility that the caspase-1-mediated control of Salmonella replication we observed was due to an experimental artifact of gentamicin entering WT macrophages through caspase-1-dependent gasdermin D pores and subsequently killing intracellular bacteria. At 30 minutes post-infection, THP-1 cells were treated with a lower dose of 25 μg/ml of gentamicin to kill extracellular bacteria. At 1 hour post-infection (hpi), the cells were washed to remove the gentamicin, and then the media was replaced with fresh media containing no gentamicin. Alternatively, we treated cells with our standard bactericidal concentration of gentamicin (100 μg/ml), washed the cells to remove the gentamicin, and then replaced the media with fresh media containing a bacteriostatic concentration of gentamicin (10 μg/ml). At 1 hpi, we did not observe any significant differences in bacterial uptake between WT and CASP1-/- THP-1 cells treated with 25 μg/ml of gentamicin or treated with 100 μg/ml of gentamicin (Figure 1 – figure supplement 5A). However, at 6 hpi, regardless of the presence of absence of gentamicin, CASP1-/- cells harbored significantly higher bacterial burdens and a significant fold-increase in bacterial CFUs compared to WT cells (Figure 1 – figure supplement 5B-C). Altogether, these data indicate that gentamicin does not contribute to tcaspase-1-mediated restriction of Salmonella replication in human macrophages.
Caspase-4 contributes to the control of Salmonella replication within human macrophages later during infection
Caspase-4 contributes to inflammasome responses during Salmonella infection of THP-1 macrophages and primary human macrophages (Casson et al., 2015; Naseer, Egan, et al., 2022), and caspases-4/5 are required for inflammasome responses to Salmonella in THP-1 monocytes (Baker et al., 2015). In human intestinal epithelial cells (IECs), caspase-4 drives inflammasome responses during Salmonella infection and limits intracellular bacterial replication (Holly et al., 2020; Knodler, Crowley, et al., 2014; Naseer, Zhang, et al., 2022). However, whether caspase-4 contributes to restriction of intracellular Salmonella replication within human macrophages is unclear.
To genetically test the contribution of caspase-4 during Salmonella infection in THP-1 macrophages, we used CRISPR/Cas9 to disrupt the CASP4 gene. We selected and sequence-validated two independent CASP4-/- THP-1 single cell clones (Figure 2 – figure supplement 1). We observed a slight decrease in secreted IL-1β levels in CASP4-/- THP-1 macrophages infected with WT Salmonella compared to infected WT THP-1 macrophages at 6 hpi (Figure 2 – figure supplement 2A). We also observed a slight decrease in cell death at 6 hpi in infected CASP4-/- clone #2 compared to infected WT cells, whereas cytotoxicity levels were not significantly affected in infected CASP4-/- clone #6 (Figure 2 – figure supplement 2B). However, at 24 hpi, we observed a significant decrease in IL-1 release and cell death in both CASP4-/- clones infected with WT Salmonella compared to infected WT cells (Figure 2A-B; Figure 2 – figure supplement 3A-B). WT and CASP4-/- cells also released similar levels of the inflammasome-independent cytokine TNF-α upon infection with WT Salmonella at 24 hpi (Figure 2 – figure supplement 3C). Overall, these data indicate that caspase-4 contributes to inflammasome responses in THP-1 macrophages later during Salmonella infection.

Caspase-4 contributes to the control of Salmonella replication within human macrophages later during infection.
WT and two independent clones of CASP4-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium (A, B, C), or WT S. Typhimurium constitutively expressing GFP (D, E) at an MOI = 20. (A) Release of IL-1β into the supernatant was measured by ELISA at 24 hpi. (B) Cell death (% cytotoxicity) was measured by LDH release assay and normalized to mock-infected cells at 24 hpi. (C) Cells were lysed at 1 hpi and 24 hpi, and bacteria were subsequently plated to calculate CFU. Fold-change in CFU/well was calculated. (D, E) Cells were fixed at 24 hpi and stained for DAPI to label DNA (blue). (D) The number of bacteria per cell at 24 hpi was scored by fluorescence microscopy. Each dot represents one infected cell. 150 infected cells were scored for each genotype. (E) Representative images are shown. Scale bar represents 10 µm. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment (A, B, C, D). ns – not significant, *p < 0.05 by Dunnett’s multiple comparisons test (A, B, C, D). Data shown are representative of at least three independent experiments.
Since caspase-4 restricts Salmonella replication in human epithelial cells (Holly et al., 2020; Knodler, Crowley, et al., 2014; Naseer, Zhang, et al., 2022), we asked whether caspase-4 contributes to the control of Salmonella replication in human macrophages as well. Upon examination of the fold-change in bacterial CFUs at 6 hpi, we did not observe any significant differences between WT and CASP4-/- THP-1 cells (Figure 2 – figure supplement 2C). However, at 24 hpi, CASP4-/- cells harbored higher bacterial burdens and a significant fold-increase in bacterial CFUs compared to WT cells (Figure 2C; Figure 2 – figure supplement 3D). To confirm these findings, we enumerated the amount of WT Salmonella per cell by microscopy. At 6 hpi, WT and CASP4-/- THP-1 cells contained comparable numbers of Salmonella per cell (Figure 2 – figure supplement 2D-E). In contrast, at 24 hpi, CASP4-/- cells harbored significantly higher burdens of Salmonella per cell on average (∼20 bacteria per cell) compared to WT cells (∼10 bacteria per cell) (Figure 2D-E). Altogether, these results suggest that caspase-4 plays a larger role in controlling Salmonella burdens later during infection.
GSDMD promotes the control of Salmonella replication within human macrophages
Inflammasome activation triggers a lytic form of cell death known as pyroptosis (Lamkanfi & Dixit, 2014). Death of the infected host cell eliminates Salmonella’s intracellular replicative niche and thus, may contribute to restricting intracellular bacterial replication. Upon its cleavage by inflammatory caspases, GSDMD forms pores in the host plasma membrane, resulting in pyroptosis (Ding et al., 2016; Kayagaki et al., 2015; Shi et al., 2015). Whether GSDMD contributes to the control of Salmonella replication in human macrophages is unknown.
First, we asked whether GSDMD pore formation plays a role in controlling Salmonella replication in human macrophages. To do this, we pretreated THP-1 macrophages and primary human monocyte-derived macrophages (hMDMs) with the chemical inhibitor disulfiram. Disulfiram prevents cleaved GSDMD from inserting into the host plasma membrane, thereby limiting GSDMD-mediated pore formation (J. J. Hu et al., 2020). Disulfiram treatment led to the loss of IL-1β release and cytotoxicity in macrophages infected with WT Salmonella, compared to treatment with the vehicle control, DMSO (Figure 3 – figure supplement 1A-B, D-E). Next, we examined the effect of GSDMD-mediated pore formation on intracellular Salmonella burdens. The fold- increase in bacterial CFUs at 6 hpi was significantly higher in cells treated with disulfiram compared to cells treated with DMSO (Figure 3 – figure supplement 1C, F). Collectively, these results suggest that GSDMD-mediated pore formation promotes the restriction of intracellular Salmonella replication.
Consistent with our findings with disulfiram, we observed a significant decrease in IL-1 and IL-18 release in GSDMD-/- THP-1 macrophages (Okondo et al., 2017; Taabazuing et al., 2017) compared to WT THP-1 macrophages following Salmonella infection (Figure 3A; Figure 3 – figure supplement 2A-B). Interestingly, loss of GSDMD did not completely abrogate the release of IL-1 and IL-18, suggesting that there is also GSDMD-independent IL-1 and IL-18 release (Figure 3A; Figure 3 – figure supplement 2A-B). Infected WT and GSDMD-/- THP-1 cells secreted similar levels of the inflammasome-independent cytokine TNF-α (Figure 3 – figure supplement 2C).

GSDMD promotes the control of Salmonella replication within human macrophages.
WT and GSDMD-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium (A, B, C), or WT S. Typhimurium constitutively expressing GFP (D,E) at an MOI = 20. (A) Release of IL-1β into the supernatant was measured by ELISA at 6 hpi. (B) Cell death (% cytotoxicity) was measured by LDH release assay and normalized to mock-infected cells at 6 hpi. (C) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. Fold-change in CFU/well was calculated. (D, E) Cells were fixed at 6 hpi and stained for DAPI to label DNA (blue). (D) The number of bacteria per cell at 6 hpi was scored by fluorescence microscopy. Each dot represents one infected cell. 150 infected cells were scored for each genotype. (E) Representative images are shown. Scale bar represents 10 µm. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment (A, B, C, D). **p< 0.01, ***p < 0.001, ****p < 0.0001 by Šídák’s multiple comparisons test (A) or by unpaired t-test (B, C, D). Data shown are representative of at least three independent experiments.
Importantly, infected GSDMD-/- cells failed to undergo substantial cell death, in contrast to infected WT cells, indicating that GSDMD facilitates cell death during Salmonella infection (Figure 3B). Overall, these results indicate that GSDMD plays an important role in mediating inflammasome responses during Salmonella infection of human macrophages.
We next examined whether GSDMD controls intracellular Salmonella replication in human macrophages. Notably, while there were no differences in bacterial uptake between WT and GSDMD-/- cells at 1 hpi (Figure 3 – figure supplement 2D), we did observe significantly higher bacterial CFUs in GSDMD-/- cells compared to WT cells at 6 hpi (Figure 3 – figure supplement 2E). Moreover, the fold-increase in bacterial CFUs at 6 hpi was significantly higher in GSDMD-/- cells than in WT cells (Figure 3C). Next, we used microscopy to further interrogate intracellular Salmonella burdens. As expected, WT cells contained low numbers of Salmonella per cell (∼5 bacteria per cell) (Figure 3D-E). However, GSDMD-/- cells harbored significantly higher numbers of Salmonella per cell on average (∼20 bacteria per cell) at 6 hpi (Figure 3D-E). Altogether, these data indicate that GSDMD promotes the control of Salmonella replication in human macrophages.
NINJ1 contributes to the control of Salmonella replication within human macrophages
While GSDMD pores release a subset of molecules, including IL-1 family cytokines, the extensive release of cellular contents is mediated by plasma membrane rupture (Ding et al., 2016; Ruan et al., 2018). Recently, NINJ1 was identified as an executioner of terminal cell lysis (Bjanes et al., 2021; Borges et al., 2022; Degen et al., 2023; Kayagaki et al., 2021, 2023). NINJ1 is a transmembrane protein that oligomerizes in the host plasma membrane to induce lytic rupture of the cell after the initiation of pyroptosis and other forms of regulated cell death (David et al., 2024; Degen et al., 2023; Kayagaki et al., 2021). Cells can be protected from plasma membrane rupture through treatment with the amino acid glycine (Fink & Cookson, 2006; Frank et al., 2000; Heilig et al., 2018; Verhoef et al., 2005), which interferes with the clustering of NINJ1 (Borges et al., 2022). Thus, upon incubation with glycine, cells can still form GSDMD pores but cannot undergo terminal cell lysis (Fink & Cookson, 2006; Heilig et al., 2018; Tsuchiya et al., 2021; Verhoef et al., 2005). Whether NINJ1-dependent cell lysis contributes to control of Salmonella replication in human macrophages remains unknown.
First, to determine whether glycine exerts a cytoprotective effect on THP-1 macrophages, we pretreated WT and NAIP-/- THP-1 cells with glycine prior to infection with WT Salmonella and assayed for downstream inflammasome responses. Notably, WT and NAIP-/- cells pretreated with glycine exhibited significantly decreased cell death and a small defect in IL-1β release following infection compared to infected cells treated with the vehicle control (Figure 4 – figure supplement 1A-B). Release of the inflammasome-independent cytokine TNF-α was unaffected by glycine treatment (Figure 4 – figure supplement 1C). Altogether, these results indicate that glycine prevents cell lysis and limits IL-1 release in THP-1 macrophages upon Salmonella infection.
Given glycine’s cytoprotective effect on infected THP-1 macrophages, we next sought to determine whether glycine impacts intracellular Salmonella burdens in human macrophages. THP-1 macrophages pretreated with glycine retained significantly higher intracellular bacterial burdens at 6 hpi compared to cells given the vehicle control (Figure 4 – figure supplement 1D). We did not detect any significant differences in bacterial uptake (Figure 4 – figure supplement 1E). Moreover, WT and NAIP-/- THP-1 cells pretreated with glycine exhibited a greater increase in Salmonella CFUs compared to cells treated with the vehicle control (Figure 4 – figure supplement 1F), suggesting that cytoprotection by glycine interferes with the intracellular control of Salmonella in human macrophages.
Next, to genetically test the role of NINJ1, we transfected WT THP-1 macrophages with small interfering RNA (siRNA) targeting NINJ1, which led to robust knockdown of NINJ1 ranging from 77% to 85%, or control scrambled siRNA. Knockdown of NINJ1 resulted in a significant decrease, yet not complete abrogation, of IL-1β secretion and cytotoxicity in infected cells, in contrast to control siRNA treatment (Figure 4A-B). Collectively, these data imply a critical role for NINJ1 in contributing to IL- 1 release and cell death during Salmonella infection in human macrophages.

NINJ1 contributes to the control of Salmonella replication within human macrophages.
WT THP-1 monocyte-derived macrophages were treated with siRNA targeting a control scrambled siRNA or siRNA targeting NINJ1 for 72 hours prior to infection. Cells were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock) or WT S. Typhimurium at an MOI = 20. (A) Release of IL-1β into the supernatant was measured by ELISA at 6 hpi. (B) Cell death (% cytotoxicity) was measured by LDH release assay and normalized to mock-infected cells at 6 hpi. (C, D, E) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. (C) CFU/well at 1 hpi. (D) CFU/well at 6 hpi. (E) Fold-change in CFU/well was calculated. Bars represent the mean for each condition. Error bars represent the standard deviation of triplicate wells from one experiment. ns – not significant, *p< 0.05, **p< 0.01 by unpaired t-test. Data shown are representative of at least three independent experiments.
Notably, while NINJ1 knockdown did not affect bacterial uptake at 1 hpi (Figure 4C), cells treated with NINJ1 siRNA contained higher intracellular bacterial burdens than cells treated with control siRNA at 6 hpi (Figure 4D). Moreover, there was a greater fold-increase in bacterial CFUs at 6 hpi in NINJ1 siRNA-treated cells compared to control siRNA-treated cells (Figure 4E). Together, these findings indicate that NINJ1 contributes to intracellular bacterial control.
Inflammasome activation primarily controls cytosolic Salmonella replication in human macrophages
In epithelial cells, WT Salmonella can enter the cytosol and replicate in both vacuolar and cytosolic compartments, specifically hyperreplicating in the cytosol (Knodler, Crowley, et al., 2014; Knodler et al., 2010; Knodler, Nair, et al., 2014; Malik- Kale et al., 2012). However, in murine macrophages, WT Salmonella appears to replicate exclusively in vacuoles (Beuzón et al., 2002; Thurston et al., 2016). Salmonella lacking the SPI-2 effector SifA (ΔsifA), which is required for SCV membrane stability, frequently enter the cytosol and can replicate within epithelial cells, but cannot replicate efficiently in murine macrophages (Beuzón et al., 2000, 2002; Brumell, Tang, et al., 2002; Thurston et al., 2016). Whether Salmonella replicates within vacuoles or the cytosol of human macrophages remains largely unknown. One study suggested that a small but significant proportion of Salmonella are exposed to the cytosol in THP-1 macrophages (Fisch et al., 2020). Our recently published data and current findings indicate that when human macrophages fail to undergo robust inflammasome responses, Salmonella hyperreplicates to large numbers within these cells (Naseer, Egan, et al., 2022). The hyperreplication that we observed in human macrophages was reminiscent of previous reports describing Salmonella hyperreplication within the cytosol of IECs (Knodler, Crowley, et al., 2014; Knodler et al., 2010; Knodler, Nair, et al., 2014; Malik-Kale et al., 2012). Thus, we hypothesized that inflammasome activation limits Salmonella replication in both SCVs and the host cell cytosol, and that in the absence of inflammasome responses, Salmonella hyperreplicates to large numbers within the host cell cytosol and also exhibits increased replication within SCVs.
First, to test whether inflammasome activation restricts the ability of Salmonella to replicate in vacuolar and cytosolic compartments of human macrophages, we used a chloroquine (CHQ) resistance assay. As a weak base, CHQ accumulates in endosomal compartments, including the SCV, without entering the cytosol of host cells (Klein, Powers, et al., 2017; Knodler, Nair, et al., 2014; Steinberg, 1994). Thus, vacuolar bacteria are CHQ-sensitive, while cytosolic bacteria are CHQ-resistant (Knodler, Nair, et al., 2014). We infected THP-1 macrophages with WT Salmonella and treated the infected cells with CHQ. Then, we determined the bacterial CFUs at 2 hpi and 6 hpi, quantifying the numbers of vacuolar bacteria (CHQ-sensitive) and cytosolic bacteria (CHQ-resistant). At 2 hpi, we did not observe any significant differences in vacuolar or cytosolic Salmonella between WT and CASP1-/- THP-1 cells (Figure 5A). We found that WT THP-1 cells contained mostly vacuolar Salmonella while also retaining some cytosolic Salmonella at 6 hpi (Figure 5B), suggesting that a subset of Salmonella dwells in the cytosol of THP-1 macrophages, in agreement with a previous study (Fisch et al., 2020). In NAIP-/- and CASP1-/- THP-1 cells, we observed slightly higher burdens of vacuolar Salmonella compared to WT cells (Figure 5B). Strikingly, we also observed significantly larger numbers of cytosolic Salmonella in NAIP-/- and CASP1-/- cells compared to WT cells (Figure 5B). These data indicate that inflammasome signaling restricts Salmonella primarily within the host cell cytosol but also within SCVs in human macrophages.

Inflammasome activation primarily controls cytosolic Salmonella replication in human macrophages.
WT, NAIP-/- (A, B), and CASP1-/- (A, B, C) THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. (A) Cells were then infected WT S. Typhimurium (A) at an MOI = 20. At 1 hpi, cells were left untreated or treated with 500 µM CHQ for 1 hour. Then, at 2 hpi, cells were lysed, and bacteria were subsequently plated to calculate CFU. CFU/well of vacuolar (CHQ- sensitive) and cytosolic (CHQ-resistant) bacteria were calculated from the total bacteria. (B, C) Cells were then infected WT S. Typhimurium (B) or ΔsipB S. Typhimurium (C) at an MOI = 20. At 5 hpi, cells were left untreated or treated with 500 µM CHQ for 1 hour. Then, at 6 hpi, cells were lysed, and bacteria were subsequently plated to calculate CFU. CFU/well of vacuolar (CHQ-sensitive) and cytosolic (CHQ-resistant) bacteria were calculated from the total bacteria. (D,E) WT, NAIP-/-, and CASP1-/- THP-1 monocyte- derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock) or WT S. Typhimurium constitutively expressing mCherry and harboring the GFP cytosolic reporter plasmid, pNF101, at an MOI = 20. Cells were fixed at 8 hpi and stained for DAPI to label DNA (blue). (D) The number of GFP-positive, mCherry-positive bacteria (cytosolic) per cell and the number of GFP-negative, mCherry-positive bacteria (vacuolar) per cell were scored by fluorescence microscopy. Each dot represents one infected cell. 150 total infected cells were scored for each genotype. (E) Representative images from 8 hpi are shown. Scale bar represents 10 µm. White arrows indicate cytosolic bacteria (GFP-positive, mCherry-positive). Bars represent the mean for each genotype (A, B). Error bars represent the standard deviation of triplicate wells from one experiment (A, B). ns – not significant, *p< 0.05, ****p < 0.0001 by Dunnett’s multiple comparisons test (A) or by Tukey’s multiple comparisons test (B). Data shown are representative of at least three independent experiments (A, B, C).
The SPI-1 T3SS can damage the SCV (Roy et al., 2004), and the SPI-1 T3SS and its effectors contribute to Salmonella escape from the SCV and replication in the cytosol of epithelial cells (Chong et al., 2019; Klein, Grenz, et al., 2017; Knodler, Nair, et al., 2014; Röder & Hensel, 2020). So, we next assessed whether the SPI-1 T3SS was required for the cytosolic exposure of Salmonella in human macrophages. We infected WT and CASP1-/- THP-1 macrophages with Salmonella lacking the SPI-1 T3SS translocon protein SipB (ΔsipB), thus preventing SPI-1 T3SS effector translocation into host cells. While we observed a significant increase in the amount of vacuolar and cytosolic ΔsipB Salmonella in CASP1-/- cells compared to WT cells at 6 hpi, the numbers of cytosolic ΔsipB were significantly lower than vacuolar ΔsipB in both WT and CASP1-/- cells (Figure 5C). We also observed lower cytosolic ΔsipB Salmonella burdens compared to WT Salmonella in both WT and CASP1-/- THP-1 cells at 6 hpi (Figure 5B- C). Therefore, these results suggest that the SPI-1 T3SS contributes to Salmonella’s cytosolic access in human macrophages.
Since CFU assays are population-based, we next used single-cell microscopy- based methods to interrogate the subcellular localization of WT Salmonella in human macrophages. We employed a strain of WT Salmonella that constitutively expresses mCherry and maintains a reporter plasmid, pNF101, that expresses gfp-ova under the control of a promoter responsive to the host cytosolic metabolite glucose-6-phosphate (Lau et al., 2019; Spinnenhirn et al., 2014). We scored the number of GFP- positive/mCherry-positive bacteria (cytosolic) and GFP-negative/mCherry-positive bacteria (vacuolar) in WT, NAIP-/- and CASP1-/- THP-1 macrophages at 8 hpi by microscopy. We observed low numbers of both vacuolar and cytosolic populations of Salmonella in WT THP-1 cells (Figure 5D-E). In contrast, NAIP-/- and CASP1-/- THP-1 cells maintained significantly larger numbers of vacuolar Salmonella, with a substantial increase in the numbers of cytosolic Salmonella (Figure 5D-E). Taken together, these results suggest that inflammasome responses primarily restrict Salmonella replication within the host cell cytosol and also control bacterial replication within SCVs in human macrophages.
We next asked whether inflammasome responses also restrict the replication of Salmonella within the cytosol and SCV in primary human monocyte-derived macrophages (hMDMs). We pretreated hMDMs with either ZVAD, to inhibit inflammasome responses mediated by caspase activity, or the vehicle control DMSO, and then infected the cells with WT Salmonella constitutively expressing mCherry and harboring pNF101. We observed that hMDMs treated with ZVAD contained significantly more cytosolic Salmonella than hMDMs treated with DMSO at 8 hpi (Figure 5 – figure supplement 1A-B). We observed no significant differences between the vacuolar burdens of Salmonella in hMDMs pretreated with ZVAD or DMSO (Figure 5 – figure supplement 1A-B). Thus, inflammasome responses appear to primarily control Salmonella replication within the cytosol of primary human macrophages.
Inflammasome activation modulates the cytosolic exposure of Salmonella in human macrophages
Finally, to characterize the effect of inflammasomes on the subcellular niches of Salmonella in human macrophages at higher resolution, we used transmission electron microscopy (TEM). In WT THP-1 cells, TEM analysis revealed that the majority of bacteria resided in a membrane-bound compartment (vacuolar, white arrows) (Figure 6A; Figure 6 – figure supplement 1B). In CASP1-/- THP-1 cells, we observed a more mixed population of vacuolar bacteria and bacteria that were exposed to the host cell cytosol to varying extents (Figure 6B; Figure 6 – figure supplement 1B). We observed Salmonella free-living in the cytosol without a vacuolar membrane (fully cytosolic, black asterisk), as well as Salmonella exposed to the cytosol within discontinuous vacuolar membranes (partially cytosolic, cyan arrows) (Figure 6B; Figure 6 – figure supplement 1B). We observed a greater proportion of cytosol-exposed Salmonella in CASP1-/- cells compared to WT cells (Figure 6 – figure supplement 1A). Strikingly, these TEM results revealed distinct intracellular populations of Salmonella in human macrophages, providing further evidence that inflammasome signaling controls the replicative niches that Salmonella occupies in human macrophages.

Inflammasome activation modulates the cytosolic exposure of Salmonella in human macrophages.
(A, B) WT and CASP1-/- THP-1 monocyte- derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with WT S. Typhimurium at an MOI = 20. At 8 hpi, cells were fixed and collected to be processed for transmission electron microscopy. Representative transmission electron micrographs are shown. Salmonella (green) in an SCV (maroon) with cytosolic or vacuolar clearance (yellow). Scale bar represents 1 µm [A(i), B(i)] or 400 nm [A(ii), B(ii)]. (A) WT THP-1s, (ii) is an inset from (i). White arrows indicate vacuolar bacteria. (B) CASP1-/- THP-1s, (ii) is an inset from (i). White arrows indicate vacuolar bacteria, cyan arrows indicate partially cytosolic bacteria, and black asterisk indicates a fully cytosolic bacterium. (C) CASP1-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with WT S. Typhimurium at an MOI = 20. At 8 hpi, cells were fixed and collected to be processed for transmission electron microscopy. Representative tomogram slices are shown, depicting Salmonella (green) in an SCV with a discontinuous vacuolar membrane (maroon).
We next sought to further characterize the cytosolic exposure of Salmonella in CASP1-/- THP-1 cells using electron tomography (ET), a technique that can reveal three- dimensional (3D) detail about SCV membranes. Indeed, we confirmed the presence of Salmonella in SCVs with varying degrees of vacuolar membrane discontinuities, yielding various extents of cytosolic exposure (Figure 6C; Figure 6 – figure supplement 1C; Video 1). These discontinuities were often numerous and found in clusters. Altogether, our TEM and ET data reveal the full spectrum of cytosolic exposure for Salmonella in CASP1-/- cells as a result of vacuolar membrane discontinuities. Overall, our findings indicate that inflammasome responses modulate the subcellular populations of Salmonella, thereby controlling the number of Salmonella able to replicate within the cytosol and SCV in human macrophages.
Discussion
Our data reveal that inflammatory caspases and downstream cell lysis mediators are required to restrict Salmonella replication in human macrophages. Furthermore, our findings indicate that inflammasomes restrict Salmonella hyperreplication within the cytosol of human macrophages. Caspase-1 is required for inflammasome responses and control of intracellular Salmonella replication early during infection. In contrast, caspase-4 contributed minimally early during infection and instead played a larger role in inflammasome responses and restriction of Salmonella replication at later timepoints. We also found that GSDMD and NINJ1 were required for cell death, IL-1 cytokine release, and control of Salmonella replication. Finally, in the absence of these inflammasome components and effectors in human macrophages, we observed a hyperreplicating population of Salmonella within the cytosol, as well as increased bacterial loads within the SCV.
There are multiple downstream consequences of inflammasome activation, including pyroptosis, cytokine secretion, phagolysosomal fusion, the formation of pore- induced intracellular traps (PITs), and the generation of reactive oxygen species (ROS), which could be singly or collectively responsible for the control of intracellular Salmonella replication in human macrophages. Previous studies reported that inflammasome activation and inflammatory caspases limit intracellular replication of WT Salmonella in human epithelial cells and murine macrophages through ROS, actin polymerization, and host cell death (Aachoui et al., 2013; Holly et al., 2020; Knodler, Crowley, et al., 2014; Man, Ekpenyong, et al., 2014). Interestingly, in murine macrophages, the restriction of a mutant strain of Salmonella that frequently enters the cytosol is dependent on caspase-1/11 but independent of IL-1 signaling and host cell death (Thurston et al., 2016). Moreover, caspase-1/11-dependent production of mitochondrial ROS and hydrogen peroxide contributes to the control of WT Salmonella replication in SCVs in murine macrophages (Man, Ekpenyong, et al., 2014). Future studies investigating the downstream consequences of inflammasome activation will help elucidate how inflammatory caspases and cell lysis mediators control intracellular Salmonella replication in human macrophages.
Whereas caspase-1 is the primary caspase that mediates inflammasome responses and control of Salmonella burdens in human macrophages, our data indicate that caspase-4 also plays a role at a later stage of infection. Whether caspase-4 is activated by vacuolar Salmonella or hyperreplicating cytosolic Salmonella remains an open question. Other host immune factors may also contribute to caspase-4-dependent inflammasome responses to Salmonella. For example, guanylate binding proteins (GBPs) can modulate inflammasome responses to intracellular LPS and impact intracellular bacterial replication (Degrandi et al., 2007; Fisch et al., 2020; Kim et al., 2011; Kutsch et al., 2020; Meunier et al., 2014; Pilla et al., 2014; J. C. Santos et al., 2020; Tietzel et al., 2009; Wandel et al., 2020).
The impact of GSDMD on the restriction of intracellular Salmonella replication may be due to downstream responses, such as IL-1 release and pyroptosis. Moreover, pyroptosis can induce PIT formation, which traps and damages intracellular bacteria, rendering them more susceptible to immune defenses, such as neutrophil-mediated killing (Jorgensen et al., 2016). It is possible that pyroptosis leads to the development of PITs in human macrophages during Salmonella infection, thereby limiting Salmonella’s intracellular replication. In addition, the cleaved N-terminal fragment of GSDMD can directly kill bacteria (Ding et al., 2016; Liu et al., 2016; Wang et al., 2019), raising the possibility that GSDMD directly targets cytosolic Salmonella to mediate restriction. A recent study revealed that GSDMD binds and permeabilizes mitochondrial membranes to mediate pyroptosis (R. Miao et al., 2023). Still, it remains unknown whether GSDMD binds or permeabilizes the SCV, thereby affecting vacuolar integrity and influencing intracellular Salmonella replication.
Our data indicate that inflammasome responses primarily control Salmonella replication within the cytosol of human macrophages and also within SCVs. How inflammasome activation inhibits Salmonella replication in the cytosol of human macrophages remains unknown. Salmonella hyperreplicates in the cytosol of human epithelial cells, which are unable to undergo caspase-1-dependent inflammasome responses (Holly et al., 2020; Knodler, Crowley, et al., 2014; Knodler et al., 2010; Knodler, Nair, et al., 2014; Naseer, Zhang, et al., 2022). Our study suggests that CASP1-/- THP-1 macrophages behave similarly to human IECs, as they support Salmonella hyperreplication in the cytosol in the absence of caspase-1. Inflammasome activation could curtail cytosolic replication of Salmonella through host cell death, direct GSDMD targeting of cytosolic Salmonella, and/or another effector mechanism. Alternatively, inflammasome activation could regulate the cytosolic access of Salmonella through host factors that directly damage the SCV, such as pore-forming proteins like GSDMD.
The bacterial factors that facilitate Salmonella’s cytosolic lifestyle in human macrophages remain largely unknown. Our findings indicate that the SPI-1 T3SS is partially required for Salmonella to access the cytosol in THP-1 macrophages. In epithelial cells, the SPI-1 T3SS SopE, SopB, and SipA enable Salmonella to escape the SCV and efficiently colonize and replicate in the cytosol (Chong et al., 2019; Klein, Grenz, et al., 2017; Röder & Hensel, 2020). Future studies will elucidate whether these same effectors also support Salmonella’s escape into the cytosol and cytosolic replication in human macrophages.
Our data also indicate that there is considerable single-cell heterogeneity in terms of total intracellular bacterial burdens as well as proportions of vacuolar and cytosolic Salmonella in human macrophages using single-cell microscopic analysis. Several factors could account for this phenotypic heterogeneity, including expression levels of inflammasome components, the amount of translocated Salmonella ligands, or the extent of inflammasome activation, all of which might differ in individual cells and are masked in bulk-population assays. Notably, heterogeneity in Salmonella gene expression, intracellular Salmonella populations, and intracellular Salmonella proliferation and viability has been previously observed in human epithelial cells and murine macrophages (Helaine et al., 2010, 2014; Knodler, Nair, et al., 2014; Malik-Kale et al., 2012; Powers et al., 2021).
In this study, we utilized tissue culture models to examine intracellular Salmonella replication in human macrophages. These in vitro systems allow for precise control of experimental conditions and, therefore, serve as powerful tools to interrogate the molecular mechanisms underlying inflammasome responses and Salmonella replication in both immortalized and primary human cells. Still, there are limitations of tissue culture models, as they lack the inherent complexity of tissues and organs in vivo. To assess whether our findings reflect Salmonella dynamics in the mammalian host, it will be important to complement our studies and extend the implications of our work using approaches that model more complex systems, such as organoids or organ explant models co-cultured with immune cells, and in vivo techniques, such as humanized mouse models.
Collectively, our results reveal that inflammasome responses restrict intracellular Salmonella replication, particularly within the cytosol of human macrophages. These findings are in contrast to mouse macrophages, where inflammasomes are activated but only marginally restrict the intracellular replication of WT Salmonella. Our findings provide insight into how human macrophages leverage inflammasomes to restrict Salmonella intracellular replication. Moreover, our work offers a basis for future studies to investigate how inflammasome activation modulates the subcellular localization of bacterial replicative niches within host cells.
Materials and methods
Ethics statement
All experiments on primary human monocyte-derived macrophages (hMDMs) were performed in compliance with the requirements of the US Department of Health and Human Services and the principles expressed in the Declaration of Helsinki. hMDMs were derived from samples obtained from the University of Pennsylvania Human Immunology Core, and they are considered to be a secondary use of deidentified human specimens and are exempt via Title 55 Part 46, Subpart A of 46.101 (b) of the Code of Federal Regulations.
Cell culture of THP-1 cells
THP-1 cells (TIB-202; American Type Culture Collection) were maintained in RPMI supplemented with 10% (vol/vol) heat-inactivated FBS, 0.05 nM β-mercaptoethanol, 100 IU/mL penicillin, and 100 μg/mL streptomycin at 37°C in a humidified incubator. Two days prior to experimentation, the cells were replated in media without antibiotics in a 48-well plate at a concentration of 2 × 105 cells/well or in a 24-well plate at a concentration of 3.5 × 105 cells per well and incubated with phorbol 12-myristate 13- acetate (PMA) for 24 hours to allow differentiation into macrophages. Then, macrophages were either left unprimed or primed with 100 ng/mL Pam3CSK4 (Invivogen) for 16 to 20 hours prior to bacterial infections. For fluorescence microscopy experiments, cells were plated on glass coverslips in a 24-well plate.
Cell culture of primary human monocyte-derived macrophages (hMDMs)
Purified human monocytes from deidentified healthy human donors were obtained from the University of Pennsylvania Human Immunology Core. The monocytes were cultured in RPMI supplemented with 10% (vol/vol) heat-inactivated FBS, 2 mM L-glutamine, 100 IU/mL penicillin, 100 μg/ml streptomycin, and 50 ng/ml recombinant human M-CSF (Gemini Bio-Products). Cells were cultured for 4 days in 10 mL of media in at a concentration of 4-5 × 105 cells/mL in 10 cm-dishes. Then, 10 mL of fresh growth media was added for an additional 2 days to promote complete differentiation into macrophages. One day prior to infection, the cells were rinsed with cold PBS, gently detached with trypsin-EDTA (0.05%) and replated in media without antibiotics and with 25 ng/mL human M-CSF in a 48-well plate at a concentration of 1 × 105 cells per well or in a 24-well plate at a concentration of 2 × 105 cells per well. For fluorescence microscopy, cells were replated on glass coverslips in a 24-well plate. For experiments involving LPS, cells were primed with 500 ng/mL LPS (Sigma-Aldrich) for 3 hours prior to bacterial infections.
Inhibitor experiments
Human macrophages were treated 1 hour prior to infection at the indicated concentrations with the following inhibitors: 20 μM of the pan-caspase inhibitor Z- VAD(OMe)-FMK (SM Biochemicals; SMFMK001), 25 μM of the caspase-1 inhibitor Ac- YVAD-cmk (Sigma-Aldrich; SML0429), and 40 μM of the GSDMD inhibitor disulfiram (Sigma). DMSO treatment was used as a vehicle control with these inhibitors. To prevent cell lysis, cells were treated with 20 mM glycine (Fisher Scientific) for 30 minutes prior to infection. Distilled water was used as a vehicle control.
Bacterial strains and growth conditions
Salmonella enterica serovar Typhimurium SL1344 WT was routinely grown shaking overnight at 37°C in Luria-Bertani (LB) broth with streptomycin (100 μg/mL). For infection of cultured cells, the overnight culture was diluted in LB with streptomycin (100 μg/mL) containing 300 mM NaCl and grown standing for 3 hours at 37°C to induce SPI-1 expression (Lee & Falkow, 1990), unless otherwise noted, when the overnight culture of Salmonella was grown to stationary phase and subseuqnelty used to infect cultured cells.
SL1344 WT glmS::Ptrc-mCherryST::FRT pNF101 (Lau et al., 2019) was kindly provided by Dr. Leigh Knodler. This strain constitutively expresses mCherry that is chromosomally encoded. It also harbors the PuhpT-gfpova plasmid, pNF101, where expression of GFP is under the control of the glucose-6-phosphate responsive uhpT promoter derived from Shigella flexneri. SL1344 WT glmS::Ptrc-mCherryST::FRT pNF101 was grown shaking overnight at 37°C in Luria-Bertani (LB) broth with streptomycin (100 μg/mL) and ampicillin (100 μg/mL). For SPI-1 induction prior to infection, the overnight culture was diluted in LB with streptomycin (100 μg/mL) and ampicillin (100 μg/mL) that also contained 300 mM NaCl and then grown standing for 3 hours at 37°C (Lee & Falkow, 1990).
Bacterial infections
Overnight cultures of Salmonella were diluted into LB broth with streptomycin (100 μg/mL) containing 300 mM NaCl and grown for 3 hours standing at 37°C to induce SPI-1 gene expression (Lee & Falkow, 1990). Bacterial cultures were then pelleted at 6,010 × g for 3 minutes, washed once with PBS, and resuspended in PBS. Human macrophages were infected with Salmonella at a multiplicity of infection (MOI) of 20.
Infected cells were centrifuged at 290 × g for 10 minutes and incubated at 37°C. At 30 minutes post-infection, the cells were treated with 100 μg/ml of gentamicin to kill any extracellular Salmonella, unless otherwise noted when the cells were treated with 25 μg/ml of gentamicin. Then, the infection proceeded at 37°C for 6 to 8 hours, as indicated. For all experiments, control cells were mock-infected with PBS.
Bacterial intracellular burden assay
Cells were infected with WT Salmonella as described above at an MOI of 20. Then, 30 minutes post-infection, cells were treated with 100 μg/ml of gentamicin to kill any extracellular bacteria. 1 hour post-infection, the media was replaced with fresh media containing 10 μg/ml of gentamicin or no gentamicin, as indicated. At the indicated time points, the infected cells were lysed with PBS containing 0.5% Triton to collect all intracellular Salmonella. Harvested bacteria were serially diluted in PBS and plated on LB agar plates containing streptomycin (100 μg/ml) to enumerate colony forming units (CFUs). Plates were incubated overnight at 37°C and CFUs were subsequently counted.
Chloroquine (CHQ) Resistance Assay
THP-1 macrophages were infected in 48-well plates as described above. For each timepoint, triplicate wells were incubated in the presence of CHQ (500 µM) and gentamicin (100 ng/mL) for 1 hour to quantify the CHQ-resistant bacteria (Bârzu et al., 1997; Fernandez et al., 2001; Klein, Powers, et al., 2017; Knodler, Nair, et al., 2014; Zychlinsky et al., 1994). Another triplicate wells were incubated with gentamicin (100 ng/mL) only to quantify the total intracellular bacteria. At the indicated time points, the infected cells were lysed with PBS containing 0.5% Triton to collect intracellular Salmonella. Harvested bacteria were serially diluted in PBS and plated on LB agar plates containing streptomycin (100 μg/ml) to enumerate colony forming units (CFUs). Plates were incubated overnight at 37°C and CFUs were subsequently counted.
ELISAs
Harvested supernatants from infected human macrophages were assayed for cytokine levels using ELISA kits for human IL-1α (R&D Systems), IL-18 (R&D Systems), IL-1β (BD Biosciences), and TNF-α (R&D Systems).
LDH cytotoxicity assays
Harvested supernatants from infected human macrophages were assayed for cytotoxicity by quantifying the loss of cellular membrane integrity via lactate dehydrogenase (LDH) activity. LDH release was measured using an LDH Cytotoxicity Detection Kit (Clontech) according to the manufacturer’s instructions and normalized to mock-infected cells.
siRNA-mediated knockdown of genes
All Silencer Select siRNA oligos were purchased from Ambion (Life Technologies). Individual siRNA targeting NINJ1 (ID# s9556) was used. The two Silencer Select negative control siRNAs (Silencer Select Negative Control No. 1 siRNA and Silencer Select Negative Control No. 2 siRNA) were used as a control. Three days prior to the infection, 30 nM of siRNA was transfected into the human macrophages using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. Then, 24 hours after transfection, the media was replaced with fresh media containing antibiotics. Finally, 16 hours before infection, the media was replaced with fresh antibiotic-free media containing 100 ng/ml Pam3CSK4.
Quantitative RT-PCR Analysis
RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) following the manufacturer’s protocol. Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen) following the manufacturer’s protocol. Quantitative PCR was conducted with the CFX96 real-time system from Bio-Rad using the SsoFast EvaGreen Supermix with Low ROX (Bio-Rad). To calculate knockdown efficiency, mRNA levels of siRNA-treated cells were normalized to the housekeeping gene HPRT and control siRNA-treated cells using the 2−ΔΔCT (cycle threshold) method (Livak & Schmittgen, 2001). The following primers from PrimerBank were used. The PrimerBank identifications are NINJ1 (148922910c1), CASP4 (73622124c2) and HPRT (164518913c1); all primers listed as 5′–3′:
NINJ1 forward: TCAAGTACGACCTTAACAACCCG NINJ1 reverse: TGAAGATGTTGACTACCACGATG CASP4 forward: TCTGCGGAACTGTGCATGATG CASP4 reverse: TGTGTGATGAAGATAGAGCCCAT HPRT forward: CCTGGCGTCGTGATTAGTGAT HPRT reverse: AGACGTTCAGTCCTGTCCATAA
Immunoblot analysis
Cell lysates were harvested for immunoblot analysis by adding 1X SDS/PAGE sample buffer to cells. All protein samples (lysates) were boiled for 5 minutes. Samples were separated by SDS/PAGE on a 12% (vol/vol) acrylamide gel and transferred to PVDF Immobilon-P membranes (Millipore). Primary antibodies specific for caspase-4 (4450S; Cell Signaling) and β-actin (4967L; Cell Signaling) and HRP-conjugated secondary antibodies anti-mouse IgG (F00011; Cell Signaling) and anti-rabbit IgG (7074S; Cell Signaling) were used. ECL Western Blotting Substrate (Pierce Thermo Scientific) was used as the HRP substrate for detection.
Fluorescent microscopy of intracellular Salmonella
Primary hMDMs or THP-1 cells were plated on glass coverslips in a 24-well plate as described above. Cells were either infected with WT Salmonella constitutively expressing GFP [Sl1344 harboring pFPV25.1 (Valdivia & Falkow, 1996)], or WT Salmonella constitutively expressing mCherry with a cytosolic GFP reporter [SL1344 glmS::Ptrc-mCherryST::FRT pNF101 (Lau et al., 2019)] at an MOI of 20 as described above. At the indicated timepoints following infection, cells were washed 2 times with PBS and then fixed with 4% paraformaldehyde for 10 minutes. Following fixation, cells were mounted on glass slides with DAPI mounting medium (Sigma Fluoroshield).
Coverslips were imaged on an inverted fluorescence microscope (IX81; Olympus), and the images were collected using a high-resolution charge-coupled-device camera (FAST1394; QImaging) at a magnification of 100×. All images were analyzed and presented using SlideBook (version 5.0) software (Intelligent Imaging Innovations, Inc.) and ImageJ software. For experiments with WT Salmonella constitutively expressing GFP, the proportion of infected cells containing GFP-expressing Salmonella (green) were scored by counting 50 infected cells per coverslip. 150 total infected cells were scored for each condition. For experiments with WT Salmonella constitutively expressing mCherry with a cytosolic GFP reporter, the proportion of infected cells containing GFP-positive Salmonella (cytosolic) and GFP-negative, mCherry-positive Salmonella (vacuolar) were scored by counting 50 infected cells per coverslip. 150 total infected cells were scored for each condition.
Transmission electron microscopy
Two days prior to experimentation, 2 × 106 cells THP-1 cells were replated in 10-cm dishes in media without antibiotics and incubated with phorbol 12-myristate 13-acetate (PMA) for 24 hours to allow differentiation into macrophages. Then, macrophages were primed with 100 ng/mL Pam3CSK4 (Invivogen) for 16 hours prior to bacterial infection. Cells were infected with WT Salmonella at an MOI of 20 as described above. At 8 hpi, the media was aspirated, and the cells were fixed with 2.5% glutaraldehyde, 2.0% paraformaldehyde in 0.1M sodium cacodylate buffer, pH 7.4. Then, at the Electron Microscopy Resource Laboratory in the Perelman School of Medicine, after subsequent buffer washes, the samples were post-fixed in 2.0% osmium tetroxide with 1.5% K3Fe(CN)6 for 1 hour at room temperature, and rinsed in dH2O. After dehydration through a graded ethanol series, the tissue was infiltrated and embedded in EMbed-812 (Electron Microscopy Sciences, Fort Washington, PA). Thin sections were stained with uranyl acetate and SATO lead and examined with a JEOL 1010 electron microscope fitted with a Hamamatsu digital camera and AMT Advantage NanoSprint500 software.
Electron tomography
Electron tomography was performed at room temperature on a ThermoFisher Krios G3i TEM equipped with a 300 keV field emission gun. Imaging was performed using the SerialEM software (Mastronarde, 2005) on a K3 direct electron detector (Xuong et al., 2007) (Gatan Inc., Pleasanton, CA, USA) operated in the electron-counted mode. We additionally used the Gatan Imaging Filter (Gatan Inc., Pleasanton, CA, USA) with a slit width of 20 eV to increase contrast by removing inelastically scattered electrons (Krivanek et al., 1995). After initially assessing the infected macrophages at lower magnifications, tilt series were collected at a magnification of 26,000X (with a corresponding pixel size of 3.38 Å) and a defocus of −6 µm. Precooking the target areas with a total dosage of 1000-1500 e/Å2 was required to minimize sample shrinking and drifting during tilt series collection. A bi-directional tilt scheme was employed with 2° increments and 120° span (−60° to +60°). The cumulative dose of each tilt-series was in the order of ∼500 e−/Å2. Once acquired, tilt series were aligned (using the patch tracking function) and reconstructed into tomograms, both using the IMOD software package (Kremer et al., 1996). After careful assessment of the 3-dimensional (3-D) tomograms, optimal 2-D slices were chosen for figure presentations. Color overlays provide additional assistance with interpretation.
Statistical analysis
Prism 9.5.0 (GraphPad Software) was utilized for the graphing of data and all statistical analyses. Statistical significance for experiments with THP-1 macrophages and hMDMs was determined using the appropriate test and are indicated in each figure legend.
Differences were considered statistically significant if the p value was <0.05.
Acknowledgements
We thank members of Igor Brodsky’s and Sunny Shin’s laboratories for their scientific discussions and continuous support. We thank Leigh Knodler for providing SL1344 glmS::Ptrc-mCherryST::FRT pNF101 and Cornelius Taabazuing for providing CASP1-/- and GSDMD-/- THP-1 cells. We thank the Human Immunology Core of the Penn Center for AIDS Research and Abramson Cancer Center for providing purified primary human monocytes. We also thank the Electron Microscopy Resource Lab (EMRL) at the Perelman School of Medicine, University of Pennsylvania for TEM specimen processing, sectioning, and staining along with microscopy training. Additionally, we thank the EMRL for allowing us access and usage of the transmission electron microscope, JEOL JEM-1010. Furthermore, we thank Gordon Ruthel at the Penn Vet Imaging Core and Ronit Schwartz for providing helpful insights on fluorescence microscopy. Lastly, we thank Marcia Goldberg and Mateusz Szczerba at Harvard Medical School for the helpful protocols and advice on the modifications of gentamicin use in the bacterial intracellular burden assay.
This work was supported by National Institutes of Health (NIH)/National Institute of Allergy and Infectious Diseases (NIAID) grants: AI151476, AI118861, and AI123243 (S.S.), AI128630, AI163596, and AI139102 (I.E.B). This work was also supported by the Burroughs-Wellcome Fund Investigators in the Pathogenesis of Infectious Disease Award (S.S. and I.E.B.), the National Science Foundation Graduate Fellowships DGE- 1321851 (M.S.E.) and DGE-1845298 (A.R.B.), the NIH/NIGMS grant T32GM07229 (E.A.O.), the David and Lucile Packard Fellowship for Science and Engineering 2019– 69645 (Y.-W.C.), and the Pennsylvania Department of Health FY19 Health Research Formula Fund (Y.-W.C.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Supporting information

Caspase activity promotes the control of Salmonella replication within human macrophages.
WT THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. One hour prior to infection, cells were treated with 20 μM of the pan-caspase inhibitor Z-VAD(OMe)-FMK, 25 μM of the caspase-1 inhibitor Ac-YVAD-cmk, or DMSO as a vehicle control. Then, cells were infected with PBS (Mock), WT S. Typhimurium (A, B, C), or WT S. Typhimurium constitutively expressing GFP (D) at an MOI = 20. (A) Release of IL-1β into the supernatant was measured by ELISA at 6 hpi. (B) Cell death (percentage cytotoxicity) was measured by lactate dehydrogenase release assay and normalized to mock-infected cells at 6 hpi. (C) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. Fold-change in CFU/well was calculated. (D) Cells were fixed at 6 hpi and stained for DAPI to label DNA (blue). The number of bacteria per cell at 6 hpi was scored by fluorescence microscopy. Each small dot represents one infected cell. 150 infected cells were scored for each genotype. Bars represent the mean for each condition, and error bars represent the standard deviation of triplicate wells from one experiment. ns – not significant, ***p < 0.001, ****p < 0.0001 by Dunnett’s multiple comparisons test. Data shown are representative of at least three independent experiments.

Caspase-1 promotes the control of Salmonella replication within human macrophages.
WT and two independent clones of CASP1-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium at an MOI = 20. (A, B, C) Release of IL-18, IL-1α, and TNF-α into the supernatant were measured by ELISA at 6 hpi. (D, E) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. (D) CFU/well at 1 hpi. (E) CFU/well at 6 hpi. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. ns – not significant, ***p < 0.001, ****p < 0.0001 by Dunnett’s multiple comparisons test. Data shown are representative of at least three independent experiments.

Caspase-1 promotes the control of Salmonella replication within unprimed human macrophages.
WT and one independent clone of CASP1-/- THP-1 monocyte-derived macrophages were left unprimed for 16 hours. Cells were then infected with WT S. Typhimurium at an MOI = 20. Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. (A) CFU/well at 1 hpi. (B) CFU/well at 6 hpi. (C) Fold-change in CFU/well was calculated. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. ns – not significant, **p < 0.01 by unpaired t-test. Data shown are representative of three independent experiments.

Stationary phase Salmonella does not replicate effectively in human macrophages.
WT and one independent clone of CASP1-/- THP45 1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with stationary phase WT Salmonella at an MOI = 20. Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. (A) CFU/well at 1 hpi. (B) CFU/well at 6 hpi. (C) Fold-change in CFU/well was calculated. ns – not significant by unpaired t-test. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. Data shown are representative of three independent experiments.

Gentamicin does not contribute to the control of Salmonella replication in human macrophages.
. WT and one independent clone of CASP1-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with WT Salmonella at an MOI = 20. . At 30 minutes post-infection, cells were treated with either 25 μg/ml or 100 μg/ml of gentamicin. For the 25 μg/ml gentamicin condition, at 1 hpi, cells were washed extensively with RPMI to remove the gentamicin, and then the media was replaced with fresh media containing no gentamicin. For the 100 μg/ml gentamicin condition, at 1 hpi, cells were washed extensively with RPMI to remove the gentamicin, and then the media was replaced with fresh media containing 10 μg/ml gentamicin. At 1 hpi and at 6 hpi the cells were lysed, and bacteria were subsequently plated to calculate CFU. (A) CFU/well at 1 hpi. (B) CFU/well at 6 hpi. (C) Fold-change in CFU/well was calculated. ns – not significant, ***p < 0.001 by Dunnett’s multiple comparisons test. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. Data shown are representative of three independent experiments.

Validation of CASP4 70 THP-1 clones generated with CRISPR/Cas9-mediated genome editing.
(A) Schematic representations of the CASP4 gene with exons (filled boxes) and introns (lines) The guide RNA target sequence for CASP4 is highlighted in red. (B, C) Shown are the mutations of the two alleles for CASP4 clone #2 or CASP4 clone #6 THP-1 genomic DNA by electropherogram and sequence alignment with WT THP-1 genomic DNA. The CASP4 target sequence is underlined. Nucleotide deletions are indicated by the red filled-in boxes. Nucleotide insertion or switch is marked by a red outline. Purple text represents the predicted impact of the mutation on the amino acid sequence. (D, E) qRT-PCR was performed to quantitate CASP4 mRNA levels in WT THP-1s and CASP4-/- 79 THP-1s. For the CASP4-/- 80 THP-1s, CASP4 mRNA levels were normalized to human HPRT mRNA levels and WT THP-1s. (F) Immunoblot analysis was performed on cell lysates for human CASP4 and β-actin as a loading control.

Caspase-4 is dispensable for the control of Salmonella replication within human macrophages early during infection
WT and two independent clones of CASP4-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium (A, B, C), or WT S. Typhimurium constitutively expressing GFP (D,E) at an MOI = 20. (A) Release of IL-1β into the supernatant was measured by ELISA at 6 hpi. (B) Cell death (percentage cytotoxicity) was measured by lactate dehydrogenase release assay and normalized to mock-infected cells at 6 hpi. (C) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. Fold-change in CFU/well was calculated. (D, E) Cells were fixed at 6 hpi and stained for DAPI to label DNA (blue). (D) The number of bacteria per cell at 6 hpi was scored by fluorescence microscopy. Each small dot represents one infected cell. 150 infected cells were scored for each genotype. (E) Representative images are shown. Scale bar represents 10 µm. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment (A, B, C, D). ns – not significant, *p < 0.05 by Dunnett’s multiple comparisons test (A, B, C, D). Data shown are representative of at least three independent experiments.

Caspase-4 contributes to the control of Salmonella replication within human macrophages later during infection.
WT and two independent clones of CASP4-/- THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium at an MOI = 20. (A, B, C) Release of IL-18, IL-1α, and TNF-α into the supernatant were measured by ELISA at 24 hpi. (D Cells were lysed at 1 hpi and 24 hpi, and bacteria were subsequently plated to calculate CFU. CFU/well of bacteria at 24 hpi. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. ns – not significant, *p < 0.05 by Dunnett’s multiple comparisons test. Data shown are representative of at least three independent experiments.

GSDMD-mediated pore formation promotes the control of Salmonella replication within human macrophages.
(A, B,C) WT THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. (D, E, F) Primary human monocyte-derived macrophages (hMDMs) were primed 500 ng/mL LPS for 3 hours. One hour prior to infection, cells were treated with 40 μM of disulfiram, to inhibit GSDMD pore formation, or DMSO as a vehicle control. Then, cells were infected with PBS (Mock), WT S. Typhimurium at an MOI = 20. (A, D) Release of IL-1β into the supernatant was measured by ELISA at 6 hpi. (B, E) Cell death (percentage cytotoxicity) was measured by lactate dehydrogenase release assay and normalized to mock-infected cells at 6 hpi. (C, F) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. Fold-change in CFU/well was calculated. (A, B, C) Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. Data shown are representative of at least three independent experiments. (D, E, F) The pooled results of three independent experiments using hMDMs from three different healthy human donors are shown. Each data point represents the mean of triplicate infected wells from an individual donor. ns – not significant, *p<0.05, **p< 0.01, ***p < 0.001, ****p < 0.0001 by unpaired t-test (A, B, C) or by paired t-test (D, E, F).

GSDMD promotes the control of Salmonella replication within human macrophages.
WT and GSDMD-/- 134 THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with PBS (Mock), WT S. Typhimurium at an MOI = 20. (A, B, C) Release of IL137 18, IL-1α, and TNF-α into the supernatant were measured by ELISA at 6 hpi. (D, E) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. (D) CFU/well at 1 hpi. (E) CFU/well at 6 hpi. Bars represent the mean for each genotype, and error bars represent the standard deviation of triplicate wells from one experiment. ns – not significant, **p< 0.01, ****p < 0.0001 by Šídák’s multiple comparisons test (A, B, C) or by unpaired t-test (D, E). Data shown are representative of at least three independent experiments

Cytoprotection by glycine promotes Salmonella replication within human macrophages.
WT and NAIP-/- 146 THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. 30 minutes prior to infection, cells were treated with 20 mM glycine, to prevent cell lysis, or distilled water, as a vehicle control. Cells were then infected with PBS (Mock) or WT S. Typhimurium at an MOI = 20. (A) Cell death (percentage cytotoxicity) was measured by lactate dehydrogenase release assay and normalized to mock-infected cells at 6 hpi. (B, C) Release of IL-1β and TNF-α into the supernatant was measured by ELISA at 6 hpi. (D, E, F) Cells were lysed at 1 hpi and 6 hpi, and bacteria were subsequently plated to calculate CFU. (D) CFU/well at 1 hpi. (E) CFU/well at 6 hpi. (F) Fold-change in CFU/well was calculated. Bars represent the mean for each condition. Error bars represent the standard deviation of triplicate wells from one experiment. *p < 0.05, **p< 0.01, ****p < 0.0001 by Tukey’s multiple comparisons test. Data shown are representative of at least three independent experiments.

Inflammasome activation primarily controls the cytosolic population of Salmonella in primary human macrophages.
(A, B) One hour prior to infection, human monocyte-derived macrophages (hMDMs) were treated with 20 μM of the pan-caspase inhibitor Z-VAD(OMe)-FMK or DMSO as a vehicle control. Then, cells were infected with PBS (Mock) or WT S. Typhimurium constitutively expressing mCherry and harboring the GFP cytosolic reporter plasmid, pNF101, at an MOI = 20. Cells were fixed at 8 hpi and stained for DAPI to label DNA (blue). (A) The number of GFP-positive bacteria (cytosolic) per cell and the number of GFP-negative, mCherry-positive bacteria (vacuolar) per cell were scored by fluorescence microscopy. Each small dot represents one infected cell. 100 total infected cells were scored for each genotype. (B) Representative images from 8 hpi are shown. Scale bar represents 10 µm. White arrows indicate cytosolic bacteria (GFP-positive). ns – not significant, ****p < 0.0001 by Tukey’s multiple comparisons test (B). Bars represent the mean for each condition, and error bars represent the standard deviation of triplicate wells from one experiment (B). Data shown are representative of two independent experiments using hMDMs from two different healthy human donors (A, B).

Characterization of Salmonella subpopulations in human macrophages.
(A, B) WT and CASP1-/- 178 THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with WT S. Typhimurium at an MOI = 20. At 8 hpi, cells were fixed and collected to be processed for transmission electron microscopy. (A) The percentage of cytosol-exposed Salmonella from the total number of bacteria was quantified in 20 infected cells per genotype. (B) Unannotated representative transmission electron micrographs are shown. (C) CASP1-/- 184 THP-1 monocyte-derived macrophages were primed with 100 ng/mL Pam3CSK4 for 16 hours. Cells were then infected with WT S. Typhimurium at an MOI = 20. At 8 hpi, cells were fixed and collected to be processed for transmission electron microscopy. Unannotated representative tomogram slices are shown.
References
- Caspase-11 Protects Against Bacteria That Escape the VacuoleScience 339:975–978https://doi.org/10.1126/science.1230751Google Scholar
- Inflammatory Stimuli Regulate Caspase Substrate ProfilesMolecular & Cellular Proteomics 9:880–893https://doi.org/10.1074/mcp.M900528-MCP200Google Scholar
- Salmonella effectors: Important players modulating host cell function during infection: Salmonella effectorsCellular Microbiology 13:1858–1869https://doi.org/10.1111/j.1462-5822.2011.01701.xGoogle Scholar
- NLRP3 inflammasome activation downstream of cytoplasmic LPS recognition by both caspase-4 and caspase-5: Innate immunityEuropean Journal of Immunology 45:2918–2926https://doi.org/10.1002/eji.201545655Google Scholar
- Functional analysis of the Shigella flexneri IpaC invasin by insertional mutagenesisInfection and Immunity 65:1599–1605https://doi.org/10.1128/iai.65.5.1599-1605.1997Google Scholar
- Salmonella maintains the integrity of its intracellular vacuole through the action of SifAThe EMBO Journal 19:3235–3249https://doi.org/10.1093/emboj/19.13.3235Google Scholar
- Growth and killing of a Salmonella enterica serovar Typhimurium sifA mutant strain in the cytosol of different host cell linesMicrobiology 148:2705–2715https://doi.org/10.1099/00221287-148-9-2705Google Scholar
- The Salmonella pathogenicity island-2 subverts human NLRP3 and NLRC4 inflammasome responsesJournal of Leukocyte Biology 105:401–410https://doi.org/10.1002/JLB.MA0318-112RRGoogle Scholar
- Genetic targeting of Card19 is linked to disrupted NINJ1 expression, impaired cell lysis, and increased susceptibility to Yersinia infectionPLOS Pathogens 17:e1009967https://doi.org/10.1371/journal.ppat.1009967Google Scholar
- Glycine inhibits NINJ1 membrane clustering to suppress plasma membrane rupture in cell deatheLife 11:e78609https://doi.org/10.7554/eLife.78609Google Scholar
- Inflammasomes: Mechanism of assembly, regulation and signallingNature Reviews Immunology 16:407–420https://doi.org/10.1038/nri.2016.58Google Scholar
- Redundant roles for inflammasome receptors NLRP3 and NLRC4 in host defense against SalmonellaJournal of Experimental Medicine 207:1745–1755https://doi.org/10.1084/jem.20100257Google Scholar
- Caspase-11 increases susceptibility to Salmonella infection in the absence of caspase-1Nature 490:288–291https://doi.org/10.1038/nature11419Google Scholar
- SifA, a Type III Secreted Effector of Salmonella typhimurium, Directs Salmonella -Induced Filament (Sif) Formation Along Microtubules: Sif Formation Along MicrotubulesTraffic 3:407–415https://doi.org/10.1034/j.1600-0854.2002.30604.xGoogle Scholar
- Disruption of the Salmonella-containing vacuole leads to increased replication of Salmonella enterica serovar typhimurium in the cytosol of epithelial cellsInfection and Immunity 70:3264–3270https://doi.org/10.1128/iai.70.6.3264-3270.2002Google Scholar
- Cytosolic flagellin receptor NLRC4 protects mice against mucosal and systemic challengesMucosal Immunology 5:288–298https://doi.org/10.1038/mi.2012.8Google Scholar
- Human caspase-4 mediates noncanonical inflammasome activation against gram-negative bacterial pathogensProceedings of the National Academy of Sciences 112:6688–6693https://doi.org/10.1073/pnas.1421699112Google Scholar
- A role for the Salmonella Type III Secretion System 1 in bacterial adaptation to the cytosol of epithelial cellsMolecular Microbiology 112:1270–1283https://doi.org/10.1111/mmi.14361Google Scholar
- Macrophage-dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survivalMolecular Microbiology 30:175–188https://doi.org/10.1046/j.1365-2958.1998.01048.xGoogle Scholar
- Intestinal restriction of Salmonella Typhimurium requires caspase-1 and caspase-11 epithelial intrinsic inflammasomesPLOS Pathogens 16:e1008498https://doi.org/10.1371/journal.ppat.1008498Google Scholar
- Salmonella and the Inflammasome: Battle for Intracellular DominanceIn: Inflammasome Signaling and Bacterial Infections Springer International Publishing pp. 43–67https://doi.org/10.1007/978-3-319-41171-2_3Google Scholar
- NINJ1 mediates plasma membrane rupture by cutting and releasing membrane disksCell 187:2224–2235https://doi.org/10.1016/j.cell.2024.03.008Google Scholar
- Structural basis of NINJ1-mediated plasma membrane rupture in cell deathNature https://doi.org/10.1038/s41586-023-05991-zGoogle Scholar
- Extensive characterization of IFN-induced GTPases mGBP1 to mGBP10 involved in host defense. Journal of Immunology (BaltimoreMd 1950https://doi.org/10.4049/jimmunol.179.11.7729Google Scholar
- Cryoelectron Tomography of the NAIP5/NLRC4 Inflammasome: Implications for NLR ActivationStructure 23:2349–2357https://doi.org/10.1016/j.str.2015.10.001Google Scholar
- Pore-forming activity and structural autoinhibition of the gasdermin familyNature 535:111–116https://doi.org/10.1038/nature18590Google Scholar
- Cadaverine Prevents the Escape of Shigella flexneri from the Phagolysosome: A Connection between Bacterial Dissemination and Neutrophil Transepithelial SignalingThe Journal of Infectious Diseases 184:743–753https://doi.org/10.1086/323035Google Scholar
- Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophagesCellular Microbiology 8:1812–1825https://doi.org/10.1111/j.1462-5822.2006.00751.xGoogle Scholar
- Human GBP1 Differentially Targets Salmonella and Toxoplasma to License Recognition of Microbial Ligands and Caspase-Mediated DeathCell Reports 32:108008https://doi.org/10.1016/j.celrep.2020.108008Google Scholar
- Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1β in salmonella-infected macrophagesNature Immunology 7:576–582https://doi.org/10.1038/ni1346Google Scholar
- NLRC4-driven production of IL-1β discriminates between pathogenic and commensal bacteria and promotes host intestinal defenseNature Immunology 13:449–456https://doi.org/10.1038/ni.2263Google Scholar
- Differential Requirement of P2X7 Receptor and Intracellular K+ for Caspase-1 Activation Induced by Intracellular and Extracellular BacteriaJournal of Biological Chemistry 282:18810–18818https://doi.org/10.1074/jbc.M610762200Google Scholar
- Protection by glycine against hypoxic injury of rat hepatocytes: Inhibition of ion fluxes through nonspecific leaksJournal of Hepatology 32:58–66https://doi.org/10.1016/S0168-8278(00)80190-7Google Scholar
- Interaction of Salmonella with host cells through the centisome 63 type III secretion systemCurrent Opinion in Microbiology 2:46–50https://doi.org/10.1016/S1369-5274(99)80008-3Google Scholar
- Type III Secretion Machines: Bacterial Devices for Protein Delivery into Host CellsScience 284:1322–1328https://doi.org/10.1126/science.284.5418.1322Google Scholar
- Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cellsProceedings of the National Academy of Sciences 86:6383–6387https://doi.org/10.1073/pnas.86.16.6383Google Scholar
- Striking a balance: Modulation of the actin cytoskeleton by SalmonellaProceedings of the National Academy of Sciences 97:8754–8761https://doi.org/10.1073/pnas.97.16.8754Google Scholar
- Targeting of Salmonella typhimurium to vesicles containing lysosomal membrane glycoproteins bypasses compartments with mannose 6-phosphate receptorsJournal of Cell Biology 129:81–97https://doi.org/10.1083/jcb.129.1.81Google Scholar
- Salmonella induces the formation of filamentous structures containing lysosomal membrane glycoproteins in epithelial cellsProceedings of the National Academy of Sciences of the United States of America 90:10544–10548https://doi.org/10.1073/pnas.90.22.10544Google Scholar
- Salmonella Flagellin Activates NAIP/NLRC4 and Canonical NLRP3 Inflammasomes in Human MacrophagesThe Journal of Immunology 206:631–640https://doi.org/10.4049/jimmunol.2000382Google Scholar
- The human NAIP-NLRC4-inflammasome senses the Pseudomonas aeruginosa T3SS inner-rod proteinInternational Immunology 29:377–384https://doi.org/10.1093/intimm/dxx047Google Scholar
- Cytoplasmic LPS Activates Caspase-11: Implications in TLR4-Independent Endotoxic ShockScience 341:1250–1253https://doi.org/10.1126/science.1240988Google Scholar
- Type III Secretion of Salmonella enterica Serovar Typhimurium Translocated Effectors and SseFGInfection and Immunity 70:1403–1409https://doi.org/10.1128/IAI.70.3.1403-1409.2002Google Scholar
- Intestinal epithelial NAIP/NLRC4 restricts systemic dissemination of the adapted pathogen Salmonella Typhimurium due to site-specific bacterial PAMP expressionMucosal Immunology 13:530–544https://doi.org/10.1038/s41385-019-0247-0Google Scholar
- The Gasdermin-D pore acts as a conduit for IL-1β secretion in miceEuropean Journal of Immunology 48:584–592https://doi.org/10.1002/eji.201747404Google Scholar
- Internalization of Salmonella by macrophages induces formation of nonreplicating persisters. Science (New YorkN.y 343:204–208https://doi.org/10.1126/science.1244705Google Scholar
- Dynamics of intracellular bacterial replication at the single cell levelProceedings of the National Academy of Sciences 107:3746–3751https://doi.org/10.1073/pnas.1000041107Google Scholar
- Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophagesMolecular Microbiology 30:163–174https://doi.org/10.1046/j.1365-2958.1998.01047.xGoogle Scholar
- Salmonella enterica Infection of Murine and Human Enteroid-Derived Monolayers Elicits Differential Activation of Epithelium-Intrinsic InflammasomesInfection and Immunity 88:e00017–20https://doi.org/10.1128/IAI.00017-20Google Scholar
- Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal destabilizationNature Immunology 9:847–856https://doi.org/10.1038/ni.1631Google Scholar
- FDA-approved disulfiram inhibits pyroptosis by blocking gasdermin D pore formationNature Immunology 21:736–745https://doi.org/10.1038/s41590-020-0669-6Google Scholar
- Structural and biochemical basis for induced self-propagation of NLRC4Science 350:399–404https://doi.org/10.1126/science.aac5489Google Scholar
- Approaching the asymptote? Evolution and revolution in immunologyCold Spring Harbor Symposia on Quantitative Biology 54:1–13https://doi.org/10.1101/sqb.1989.054.01.003Google Scholar
- Salmonella SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological ConsequencesCell Host & Microbe 22:217–231https://doi.org/10.1016/j.chom.2017.07.009Google Scholar
- Pyroptosis triggers pore-induced intracellular traps (PITs) that capture bacteria and lead to their clearance by efferocytosisJournal of Experimental Medicine 213:2113–2128https://doi.org/10.1084/jem.20151613Google Scholar
- NINJ1 mediates plasma membrane rupture during lytic cell deathNature 591:131–136https://doi.org/10.1038/s41586-021-03218-7Google Scholar
- Inhibiting membrane rupture with NINJ1 antibodies limits tissue injuryNature https://doi.org/10.1038/s41586-023-06191-5Google Scholar
- Caspase-11 cleaves gasdermin D for non-canonical inflammasome signallingNature 526:666–671https://doi.org/10.1038/nature15541Google Scholar
- Non-canonical inflammasome activation targets caspase-11Nature 479:117–121https://doi.org/10.1038/nature10558Google Scholar
- Noncanonical Inflammasome Activation by Intracellular LPS Independent of TLR4Science 341:1246–1249https://doi.org/10.1126/science.1240248Google Scholar
- Ultrastructural studies on the interaction between Salmonella typhimurium 395 M and HeLa cellsInfection and Immunity 22:804–809https://doi.org/10.1128/iai.22.3.804-809.1978Google Scholar
- A family of IFN-γ-inducible 65-kD GTPases protects against bacterial infectionScience (New York, N.Y.) 332:717–721https://doi.org/10.1126/science.1201711Google Scholar
- Controlled Activity of the Salmonella Invasion-Associated Injectisome Reveals Its Intracellular Role in the Cytosolic PopulationmBio 8https://doi.org/10.1128/mBio.01931-17Google Scholar
- Measurement of Salmonella enterica Internalization and Vacuole Lysis in Epithelial CellsIn: Phagocytosis and Phagosomes New York: Springer pp. 285–296https://doi.org/10.1007/978-1-4939-6581-6_19Google Scholar
- Noncanonical Inflammasome Activation of Caspase-4/Caspase-11 Mediates Epithelial Defenses against Enteric Bacterial PathogensCell Host & Microbe 16:249–256https://doi.org/10.1016/j.chom.2014.07.002Google Scholar
- Quantitative Assessment of Cytosolic Salmonella in Epithelial CellsPLoS ONE 9:e84681https://doi.org/10.1371/journal.pone.0084681Google Scholar
- Dissemination of invasive Salmonella via bacterial-induced extrusion of mucosal epitheliaProceedings of the National Academy of Sciences 107:17733–17738https://doi.org/10.1073/pnas.1006098107Google Scholar
- Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificityNature 477:592–595https://doi.org/10.1038/nature10394Google Scholar
- Cutting Edge: Inflammasome Activation in Primary Human Macrophages Is Dependent on Flagellin. Journal of Immunology (BaltimoreMd 1950https://doi.org/10.4049/jimmunol.1403100Google Scholar
- Computer Visualization of Three-Dimensional Image Data Using IMODJournal of Structural Biology 116:71–76https://doi.org/10.1006/jsbi.1996.0013Google Scholar
- An imaging filter for biological applicationsUltramicroscopy 59:267–282https://doi.org/10.1016/0304-3991(95)00034-XGoogle Scholar
- Altered Cytokine Export and Apoptosis in Mice Deficient in Interleukin-1β Converting EnzymeScience 267:2000–2003https://doi.org/10.1126/science.7535475Google Scholar
- Direct binding of polymeric GBP1 to LPS disrupts bacterial cell envelope functionsThe EMBO Journal 39:e104926https://doi.org/10.15252/embj.2020104926Google Scholar
- Human caspase-4 detects tetra-acylated LPS and cytosolic Francisella and functions differently from murine caspase-11Nature Communications 9:242https://doi.org/10.1038/s41467-017-02682-yGoogle Scholar
- Inflammasomes: Guardians of cytosolic sanctityImmunological Reviews 227:95–105https://doi.org/10.1111/j.1600-065X.2008.00730.xGoogle Scholar
- Mechanisms and Functions of InflammasomesCell 157:1013–1022https://doi.org/10.1016/j.cell.2014.04.007Google Scholar
- Role of the caspase-1 inflammasome in Salmonella typhimurium pathogenesisThe Journal of Experimental Medicine 203:1407–1412https://doi.org/10.1084/jem.20060206Google Scholar
- SopF, a phosphoinositide binding effector, promotes the stability of the nascent Salmonella-containing vacuolePLOS Pathogens 15:e1007959https://doi.org/10.1371/journal.ppat.1007959Google Scholar
- The ability of Salmonella to enter mammalian cells is affected by bacterial growth stateProceedings of the National Academy of Sciences 87:4304–4308https://doi.org/10.1073/pnas.87.11.4304Google Scholar
- Mice deficient in IL-1β-converting enzyme are defective in production of mature IL-1β and resistant to endotoxic shockCell 80:401–411https://doi.org/10.1016/0092-8674(95)90490-5Google Scholar
- Inflammasome-activated gasdermin D causes pyroptosis by forming membrane poresNature 535:153–158https://doi.org/10.1038/nature18629Google Scholar
- Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San DiegoCalif 25:402–408https://doi.org/10.1006/meth.2001.1262Google Scholar
- The Global Burden of Nontyphoidal Salmonella GastroenteritisClinical Infectious Diseases 50:882–889https://doi.org/10.1086/650733Google Scholar
- The Bimodal Lifestyle of Intracellular Salmonella in Epithelial Cells: Replication in the Cytosol Obscures Defects in Vacuolar ReplicationPLoS ONE 7:e38732https://doi.org/10.1371/journal.pone.0038732Google Scholar
- Actin polymerization as a key innate immune effector mechanism to control Salmonella infectionProceedings of the National Academy of Sciences 111:17588–17593https://doi.org/10.1073/pnas.1419925111Google Scholar
- Inflammasome activation causes dual recruitment of NLRC4 and NLRP3 to the same macromolecular complexProceedings of the National Academy of Sciences 111:7403–7408https://doi.org/10.1073/pnas.1402911111Google Scholar
- Differential activation of the inflammasome by caspase-1 adaptors ASC and IpafNature 430:213–218https://doi.org/10.1038/nature02664Google Scholar
- Cryopyrin activates the inflammasome in response to toxins and ATPNature 440:228–232https://doi.org/10.1038/nature04515Google Scholar
- The InflammasomeMolecular Cell 10:417–426https://doi.org/10.1016/S1097-2765(02)00599-3Google Scholar
- Automated electron microscope tomography using robust prediction of specimen movementsJournal of Structural Biology 152:36–51https://doi.org/10.1016/j.jsb.2005.07.007Google Scholar
- Decoding the patterns of self and nonself by the innate immune system. Science (New YorkN.y 296:298–300https://doi.org/10.1126/science.1068883Google Scholar
- Caspase-11 activation requires lysis of pathogen-containing vacuoles by IFN-induced GTPasesNature 509:366–370https://doi.org/10.1038/nature13157Google Scholar
- Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1β via IpafNature Immunology 7:569–575https://doi.org/10.1038/ni1344Google Scholar
- Caspase-1-induced pyroptosis is an innate immune effector mechanism against intracellular bacteriaNature Immunology 11:1136–1142https://doi.org/10.1038/ni.1960Google Scholar
- Innate immune detection of the type III secretion apparatus through the NLRC4 inflammasomeProceedings of the National Academy of Sciences 107:3076–3080https://doi.org/10.1073/pnas.0913087107Google Scholar
- Gasdermin D permeabilization of mitochondrial inner and outer membranes accelerates and enhances pyroptosisImmunity 56:2523–2541https://doi.org/10.1016/j.immuni.2023.10.004Google Scholar
- A 40 kb chromosomal fragment encoding Salmonella typhimurium invasion genes is absent from the corresponding region of the Escherichia coli K-12 chromosomeMolecular Microbiology 15:749–759https://doi.org/10.1111/j.1365-2958.1995.tb02382.xGoogle Scholar
- Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infectionThe Journal of Experimental Medicine 203:1093–1104https://doi.org/10.1084/jem.20051659Google Scholar
- K+ efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matterImmunity 38:1142–1153https://doi.org/10.1016/j.immuni.2013.05.016Google Scholar
- Human NAIP/NLRC4 and NLRP3 inflammasomes detect Salmonella type III secretion system activities to restrict intracellular bacterial replicationPLOS Pathogens 18:e1009718https://doi.org/10.1371/journal.ppat.1009718Google Scholar
- Salmonella enterica Serovar Typhimurium Induces NAIP/NLRC4- and NLRP3/ASC-Independent, Caspase-4-Dependent Inflammasome Activation in Human Intestinal Epithelial CellsInfection and Immunity 90:e00663–21https://doi.org/10.1128/iai.00663-21Google Scholar
- Identification of a pathogenicity island required for Salmonella survival in host cellsProceedings of the National Academy of Sciences 93:7800–7804https://doi.org/10.1073/pnas.93.15.7800Google Scholar
- DPP8 and DPP9 inhibition induces pro-caspase-1-dependent monocyte and macrophage pyroptosisNature Chemical Biology 13:46–53https://doi.org/10.1038/nchembio.2229Google Scholar
- Interleukin-1 beta maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activityThe Journal of Biological Chemistry 269:15195–15203Google Scholar
- Guanylate binding proteins promote caspase-11-dependent pyroptosis in response to cytoplasmic LPSProceedings of the National Academy of Sciences 111:6046–6051https://doi.org/10.1073/pnas.1321700111Google Scholar
- Intracellular niche-specific profiling reveals transcriptional adaptations required for the cytosolic lifestyle of Salmonella entericaPLOS Pathogens 17:e1009280https://doi.org/10.1371/journal.ppat.1009280Google Scholar
- TRIF Licenses Caspase-11-Dependent NLRP3 Inflammasome Activation by Gram-Negative BacteriaCell 150:606–619https://doi.org/10.1016/j.cell.2012.07.007Google Scholar
- NAIP-NLRC4 Inflammasomes Coordinate Intestinal Epithelial Cell Expulsion with Eicosanoid and IL-18 Release via Activation of Caspase-1 and -8Immunity 46:649–659https://doi.org/10.1016/j.immuni.2017.03.016Google Scholar
- NAIP proteins are required for cytosolic detection of specific bacterial ligands in vivoThe Journal of Experimental Medicine 213:657–665https://doi.org/10.1084/jem.20151809Google Scholar
- Caspase-1-mediated activation of interleukin-1beta (IL-1beta) and IL-18 contributes to innate immune defenses against Salmonella enterica serovar Typhimurium infectionInfection and Immunity 74:4922–4926https://doi.org/10.1128/IAI.00417-06Google Scholar
- Cutting edge: Mouse NAIP1 detects the type III secretion system needle proteinJournal of Immunology (Baltimore, Md.: 1950) 191:3986–3989https://doi.org/10.4049/jimmunol.1301549Google Scholar
- Flagellin-Deficient Legionella Mutants Evade Caspase-1- and Naip5-Mediated Macrophage ImmunityPLoS Pathogens 2:e18https://doi.org/10.1371/journal.ppat.0020018Google Scholar
- Broad detection of bacterial type III secretion system and flagellin proteins by the human NAIP/NLRC4 inflammasomeProceedings of the National Academy of Sciences 114:13242–13247https://doi.org/10.1073/pnas.1710433114Google Scholar
- Presence of SopE and mode of infection result in increased Salmonella -containing vacuole damage and cytosolic release during host cell infection by SALMONELLA ENTERICACellular Microbiology 22:5https://doi.org/10.1111/cmi.13155Google Scholar
- Inflammatory Caspases: Toward a Unified Model for Caspase Activation by InflammasomesAnnual Review of Immunology 40:249–269https://doi.org/10.1146/annurev-immunol-101220-030653Google Scholar
- A Process for Controlling Intracellular Bacterial Infections Induced by Membrane InjuryScience 304:1515–1518https://doi.org/10.1126/science.1098371Google Scholar
- Cryo-EM structure of the gasdermin A3 membrane poreNature 557:62–67https://doi.org/10.1038/s41586-018-0058-6Google Scholar
- Caspase-11 activates a canonical NLRP3 inflammasome by promoting K + effluxEuropean Journal of Immunology 45:2927–2936https://doi.org/10.1002/eji.201545772Google Scholar
- Human GBP1 binds LPS to initiate assembly of a caspase-4 activating platform on cytosolic bacteriaNature Communications 11:3276https://doi.org/10.1038/s41467-020-16889-zGoogle Scholar
- Cell tropism of Salmonella entericaInternational Journal of Medical Microbiology 294:225–233https://doi.org/10.1016/j.ijmm.2004.06.029Google Scholar
- Caspase-4 mediates non-canonical activation of the NLRP3 inflammasome in human myeloid cells: Innate immunityEuropean Journal of Immunology 45:2911–2917https://doi.org/10.1002/eji.201545523Google Scholar
- Epithelium-Intrinsic NAIP/NLRC4 Inflammasome Drives Infected Enterocyte Expulsion to Restrict Salmonella Replication in the Intestinal MucosaCell Host & Microbe 16:237–248https://doi.org/10.1016/j.chom.2014.07.001Google Scholar
- Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimuriumProceedings of the National Academy of Sciences 93:2593–2597https://doi.org/10.1073/pnas.93.6.2593Google Scholar
- Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell deathNature 526:660–665https://doi.org/10.1038/nature15514Google Scholar
- Inflammatory caspases are innate immune receptors for intracellular LPSNature 514:187–192https://doi.org/10.1038/nature13683Google Scholar
- The ubiquitin-like modifier FAT10 decorates autophagy targeted S almonella and contributes to resistance of miceJournal of Cell Science, jcs 152371https://doi.org/10.1242/jcs.152371Google Scholar
- The Salmonella-containing vacuole—Moving with the timesCurrent Opinion in Microbiology 11:38–45https://doi.org/10.1016/j.mib.2008.01.002Google Scholar
- Biogenesis of Salmonella typhimurium-containing vacuoles in epithelial cells involves interactions with the early endocytic pathwayCellular Microbiology 1:33–49https://doi.org/10.1046/j.1462-5822.1999.00003.xGoogle Scholar
- Cellular Transport of DrugsClinical Infectious Diseases 19:916–921https://doi.org/10.1093/clinids/19.5.916Google Scholar
- Injection of Flagellin into the Host Cell Cytosol by Salmonella enterica Serotype TyphimuriumJournal of Biological Chemistry 282:33897–33901https://doi.org/10.1074/jbc.C700181200Google Scholar
- Pyroptosis and Apoptosis Pathways Engage in Bidirectional Crosstalk in Monocytes and MacrophagesCell Chemical Biology 24:507–514https://doi.org/10.1016/j.chembiol.2017.03.009Google Scholar
- Electron microscope studies of experimental Salmonella infection. I. Penetration into the intestinal epithelium by Salmonella typhimuriumThe American Journal of Pathology 50:109–136Google Scholar
- Electron-Microscope Studies of Experimental Salmonella Infection in the Preconditioned Guinea Pig: II. Response of the Intestinal Mucosa to the Invasion by Salmonella typhimuriumThe American Journal of Pathology 51:137–161Google Scholar
- A novel heterodimeric cysteine protease is required for interleukin-1βprocessing in monocytesNature 356:768–774https://doi.org/10.1038/356768a0Google Scholar
- Growth inhibition of cytosolic Salmonella by caspase-1 and caspase-11 precedes host cell deathNature Communications 7:13292https://doi.org/10.1038/ncomms13292Google Scholar
- Human guanylate binding proteins potentiate the anti-chlamydia effects of interferon-gammaPloS One 4:e6499https://doi.org/10.1371/journal.pone.0006499Google Scholar
- Gasdermin D mediates the maturation and release of IL-1α downstream of inflammasomesCell Reports 34:108887https://doi.org/10.1016/j.celrep.2021.108887Google Scholar
- Bacterial genetics by flow cytometry: Rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence inductionMolecular Microbiology 22:367–378https://doi.org/10.1046/j.1365-2958.1996.00120.xGoogle Scholar
- Inhibitory effects of chloride on the activation of caspase-1, IL-1beta secretion, and cytolysis by the P2X7 receptorJournal of Immunology (Baltimore, Md.: 1950) https://doi.org/10.4049/jimmunol.175.11.7623Google Scholar
- Guanylate-binding proteins convert cytosolic bacteria into caspase-4 signaling platformsNature Immunology 21:880–891https://doi.org/10.1038/s41590-020-0697-2Google Scholar
- Gasdermin D Protects from Melioidosis through Pyroptosis and Direct Killing of BacteriaThe Journal of Immunology 202:3468–3473https://doi.org/10.4049/jimmunol.1900045Google Scholar
- Future Directions for Camera Systems in Electron MicroscopyMethods in Cell Biology 79:721–739https://doi.org/10.1016/S0091-679X(06)79028-8Google Scholar
- Human NAIP and mouse NAIP1 recognize bacterial type III secretion needle protein for inflammasome activationProceedings of the National Academy of Sciences of the United States of America 110:14408–14413https://doi.org/10.1073/pnas.1306376110Google Scholar
- The Birc1e cytosolic pattern-recognition receptor contributes to the detection and control of Legionella pneumophila infectionNature Immunology 7:318–325https://doi.org/10.1038/ni1305Google Scholar
- Cryo-EM structure of the activated NAIP2-NLRC4 inflammasome reveals nucleated polymerizationScience 350:404–409https://doi.org/10.1126/science.aac5789Google Scholar
- Genetic functions of the NAIP family of inflammasome receptors for bacterial ligands in miceThe Journal of Experimental Medicine 213:647–656https://doi.org/10.1084/jem.20160006Google Scholar
- The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatusNature 477:596–600https://doi.org/10.1038/nature10510Google Scholar
- IpaB mediates macrophage apoptosis induced by Shigella flexneriMolecular Microbiology 11:619–627https://doi.org/10.1111/j.1365-2958.1994.tb00341.xGoogle Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.90107. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2023, Egan et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 3,777
- downloads
- 305
- citations
- 11
Views, downloads and citations are aggregated across all versions of this paper published by eLife.