1. Genetics and Genomics
  2. Microbiology and Infectious Disease

Control of pili synthesis and putrescine homeostasis in Escherichia coli

  1. Iti Mehta
  2. Jacob B Hogins
  3. Sydney R Hall
  4. Gabrielle Vragel
  5. Sankalya Ambagaspitiye
  6. Philippe E Zimmern
  7. Larry Reitzer  Is a corresponding author
  1. Department of Biological Sciences, The University of Texas at Dallas, United States
  2. Department of Urology, University of Texas Southwestern Medical Center, United States
https://doi.org/10.7554/eLife.102439.3
Share this article
Cite this article
  1. Iti Mehta
  2. Jacob B Hogins
  3. Sydney R Hall
  4. Gabrielle Vragel
  5. Sankalya Ambagaspitiye
  6. Philippe E Zimmern
  7. Larry Reitzer
(2025)
Control of pili synthesis and putrescine homeostasis in Escherichia coli
eLife 13:RP102439.
https://doi.org/10.7554/eLife.102439.3
  2. Download BibTeX
  3. Download .RIS

eLife Assessment

This valuable study presents an interesting analysis of the role of the polyamine precursor putrescine in the pili-dependent surface motility of a laboratory strain of Escherichia coli. The overall data convincingly demonstrate a role in this case. This study presents interesting findings for those studying uropathogenic bacteria, and those studying bacterial polyamine function.

https://doi.org/10.7554/eLife.102439.3.sa0

Abstract

Polyamines are biologically ubiquitous cations that bind to nucleic acids, ribosomes, and phospholipids and, thereby, modulate numerous processes, including surface motility in Escherichia coli. We characterized the metabolic pathways that contribute to polyamine-dependent control of surface motility in the commonly used strain W3110 and the transcriptome of a mutant lacking a putrescine synthetic pathway that was required for surface motility. Genetic analysis showed that surface motility required type 1 pili, the simultaneous presence of two independent putrescine anabolic pathways, and modulation by putrescine transport and catabolism. An immunological assay for FimA—the major pili subunit, reverse transcription quantitative PCR of fimA, and transmission electron microscopy confirmed that pili synthesis required putrescine. Comparative RNAseq analysis of a wild type and ΔspeB mutant which exhibits impaired pili synthesis showed that the latter had fewer transcripts for pili structural genes and for fimB which codes for the phase variation recombinase that orients the fim operon promoter in the ON phase, although loss of speB did not affect the promoter orientation. Results from the RNAseq analysis also suggested (a) changes in transcripts for several transcription factor genes that affect fim operon expression, (b) compensatory mechanisms for low putrescine which implies a putrescine homeostatic network, and (c) decreased transcripts of genes for oxidative energy metabolism and iron transport which a previous genetic analysis suggests may be sufficient to account for the pili defect in putrescine synthesis mutants. We conclude that pili synthesis requires putrescine and putrescine concentration is controlled by a complex homeostatic network that includes the genes of oxidative energy metabolism.

Introduction

Polyamines are flexible aliphatic cations that are found in virtually all organisms. E. coli contains putrescine (1,4-diaminobutane) and lesser amounts of spermidine (N-(3-aminopropyl)–1,4-diaminobutane), and cadaverine (1,5-diaminopentane) (Tabor and Tabor, 1984). Both the pathways and enzymes of polyamine synthesis are redundant (Figure 1). Strains that lack eight of these genes do not contain detectable polyamines, grow slowly aerobically, and do not grow anaerobically (Chattopadhyay et al., 2009). Polyamines interact with nucleic acids and phospholipids, and can affect chromosome and ribosome structure, ribosome-mRNA interactions, and protein and nucleic acid elongation rates (Igarashi and Kashiwagi, 2000). Polyamines modulate, but are not required for, protein synthesis (Igarashi and Kashiwagi, 2015) and expression of hundreds of genes (Yoshida et al., 2004). A major mechanism of polyamine-dependent regulation is translational control of genes for 18 major transcription regulators: four of the seven σ factors – σ18 (FecI), σ24 (RpoE), σ38 (RpoS), and σ54 (RpoN); three histone-like DNA-binding proteins (Fis, H-NS, and StpA); and CpxR, Cya, Cra, and UvrY (Igarashi and Kashiwagi, 2015; Yoshida et al., 2004).

Figure 1
Download asset Open asset
Pathways and enzymes of polyamine synthesis.

Polyamines control flagella-dependent surface motility of Proteus mirabilis and pili-dependent surface motility (PDSM) of E. coli: the latter has been reported to require the polyamine spermidine (Armbruster et al., 2013; Kurihara et al., 2009). While reconstructing putrescine-deficient strains to characterize the basis for the anaerobic growth defect, we noticed that a mutant unable to synthesize spermidine moved normally, while mutants lacking enzymes of putrescine synthesis moved poorly. We characterized the role of polyamines on E. coli surface motility and pili synthesis by genetic analysis, ELISA assays, RT-qPCR, electron microscopy, and RNAseq. We showed that PDSM and pili synthesis required two independent pathways of putrescine synthesis, but did not require spermidine, and was modulated by putrescine transport and catabolism. Results from an RNAseq analysis are consistent with multiple mechanisms of putrescine-dependent control, and, unexpectedly, suggest a putrescine homeostatic network that rewires metabolism to maintain intracellular putrescine.

Results

W3110 surface motility requires pili

An assessment of surface motility for E. coli K-12 and eight derivatives showed five strains covered a plate in 12–18 hr, while four did not traverse a plate in 36 hr (Ambagaspitiye et al., 2019). The slow-moving strains generated genetically stable fast-moving variants which suggests that the former were ancestral. We chose our lab strain of W3110 for further study because (a) it exhibited the least variability in spreading diameter and generated fewer fast-moving variants, and (b) we had previously analyzed this strain for the energy requirements for surface motility (Sudarshan et al., 2021). We refer to our slow-moving lab strain hereafter as W3110 but not all W3110 strains move similarly: the W3110 from the genetic stock center is a fast-moving variant (Ambagaspitiye et al., 2019).

Several results suggested that W3110 requires pili for surface motility. First, the deletion of fimA, which codes for the major type 1 pili subunit, abolished the oscillatory pattern and reduced, but did not eliminate, surface motility, but the deletion of fliC which encodes the major flagellum subunit did not affect surface motility (Figure 2A). Second, electron microscopy confirmed that W3110 isolated from surface motility plates possessed pili (Figure 2B). None of >500 cells expressed flagella. A mixed population of elongated (3–4 µm) and non-elongated (<2 µm) cells were visible, and pili were mostly associated with elongated cells. Finally, W3110 surface motility requires glucose (Sudarshan et al., 2021) which should prevent flagella synthesis via inhibition of cyclic AMP synthesis (Yokota and Gots, 1970). We confirmed that glucose suppressed swimming motility which implies suppression of flagella synthesis in W3110 during surface motility assays (Figure 2C). A W3110 derivative with deletions of both fliC and fimA still exhibited outward movement on a surface motility plate (Figure 2A), but electron microscopy showed the absence of appendages (Figure 2C). In summary, genetics, electron microscopy, and the glucose requirement show that W3110 surface motility requires pili.

Figure 2
Download asset Open asset
Surface motility of W3110.

(A) Surface motility of parental and derivative strains lacking the major subunits of the flagella (FliC), pili (FimA), or both. (B) Transmission electron microscopy (TEM) images of cells of W3110 and W3110 ΔfliC ΔfimA were taken from the movement’s edge directly from surface motility plates. (C) Swimming motility with and without 0.5% glucose.

Results from W3110 sequencing found an IS1 insertion in fimE which could explain its greater movement that is less variable and greater genetic stability. The FimB and FimE recombinases are the major components of phase variation that determine the orientation of the promoter that initiates transcription of the fimAICDFGH operon which codes for the pili structural proteins. The FimB recombinase favors the productive ON orientation, while the more active FimE recombinase favors the unproductive OFF orientation (Conway et al., 2023; Kelly et al., 2006; O’Gara and Dorman, 2000). The insertion in fimE is the likely basis for the relative stability of W3110.

PDSM required two independent putrescine synthesis pathways

We examined PDSM requirements for polyamine anabolic pathways. A major putrescine biosynthetic pathway is ornithine decarboxylation either by the constitutive SpeC or the low-pH inducible SpeF. TheΔspeC and ΔspeF mutants moved as well as the parental strain, but a ΔspeC ΔspeF double mutant moved less well (Figure 3). SpeA (arginine decarboxylase) and SpeB (agmatinase) catalyze an alternate two-step putrescine synthetic pathway (Figure 1; Tabor and Tabor, 1985): deletion of either gene reduced surface motility (Figure 3). The ΔspeA, ΔspeB, and ΔspeC ΔspeF strains grew as well as the parental strain and had normal swimming motility (Figure 3—figure supplement 1). A ∆speE mutant, which lacks the enzyme for spermidine synthesis, moved on a surface as well as the parental strain (Figure 3).

Figure 3 with 1 supplement see all
Download asset Open asset
Genetics of surface motility.

(A) Pili-dependent surface motility (PDSM) of mutants with defects in polyamine anabolic genes. All assays were performed in triplicate, and representative images are shown. (B) Diameter of surface movement of polyamine mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. In this figure the ΔspeB mutant was IM26.

Supplemental putrescine at 1 mM restored the surface motility of a speB mutant (Figure 4A) and a speA mutant (not shown). Spermidine did not restore wild-type movement and, also, caused an unusual pattern of movement in the parental strain (Figure 4A). These exogenous concentrations of putrescine and spermidine had no effect on growth rates in a liquid motility medium (not shown). In summary, PDSM required the simultaneous presence of two independent pathways of putrescine synthesis but did not require spermidine.

Figure 4
Download asset Open asset
Nutritional supplementation of ΔspeB mutant.

(A) Putrescine and spermidine supplementation of wild-type and ΔspeB strains. (B) Diameter of surface movement of polyamine mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Sadik test of significance: *p<0.05; **p<0.01; ***p<0.001. All assays were performed in triplicates and representative images are shown. In this figure the ΔspeB mutant was IM26.

Loss of putrescine transport systems affected surface motility

E. coli has several polyamine transport systems and one has been reported to be required for surface motility (Igarashi et al., 2001; Kurihara et al., 2011). Mutants lacking the PlaP and PotF putrescine transporters had 50% and 40% reduced surface motility, respectively, and lost the concentric ring pattern (Figure 5A). Loss of the PotE and PuuP transporters affected neither the movement diameter (Figure 5B) nor concentric ring formation (Figure 5A). We note that potF and plaP are more highly expressed than potE and puuP (85, 64, 17, and 6 counts per million transcripts, respectively) for W3110 grown in a liquid motility medium (Hogins et al., 2023a). We conclude that extracellular putrescine and its transport contribute to PDSM.

Figure 5
Download asset Open asset
Putrescine transport and surface motility.

(A) Representative images of surface motility for strains defective in putrescine transport genes. (B) Diameter of surface movement of polyamine mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. All assays were performed in triplicate and representative images are shown.

Putrescine catabolism affected surface motility

Because putrescine catabolism modulates intracellular putrescine concentrations (Schneider et al., 2013; Schneider and Reitzer, 2012), we examined PDSM in putrescine catabolic mutants. The major putrescine catabolic pathway is initiated with putrescine glutamylation (Figure 6A, right column), and a second pathway initiates with putrescine deamination (Figure 6A, left column) (Schneider and Reitzer, 2012). Deletion of either puuA or patA which codes for the first enzymes of their respective pathways did not affect surface motility (Figure 6B). A double mutant moved less well which was unexpected because the proposed higher intracellular putrescine should have stimulated PDSM. Consistent with the stimulatory effect of putrescine, loss of puuR which codes for the repressor of PuuA-initiated pathway genes (Schneider and Reitzer, 2012), impaired PDSM (Figure 6B). One possible explanation to reconcile these seemingly contradictory results is that an optimal polyamine concentration stimulates PDSM, and a high concentration is inhibitory. The next section describes experiments to test this possibility.

Figure 6
Download asset Open asset
Putrescine catabolism and surface motility.

(A) Pathways and enzymes of putrescine catabolism. (B) Motility diameter of putrescine catabolic mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. All assays were performed in triplicates and representative images are shown. (C) Effect of loss of speE on the patA puuA catabolic double mutant.

High putrescine reduced the expression of pili genes

High putrescine inhibits the translation of some mRNAs, and high spermidine, a product of putrescine metabolism, inhibits growth (Fukuchi et al., 1995; Sakamoto et al., 2020). If the phenotype of the ΔpatA ΔpuuA double mutant results from spermidine toxicity, then loss of spermidine synthase (SpeE) should reverse the phenotype. This prediction was not met, which argues against spermidine toxicity (Figure 6C). For the speB mutant, 1 mM putrescine stimulated PDSM, and 4 mM putrescine was slightly inhibitory (Figure 7A and B). The concentric ring pattern was observed with 1 mM, but not 4 mM putrescine. RT-qPCR to test transcriptional regulation of pili expression by putrescine showed optimal fimA transcription at 1 mM putrescine in the speB mutant (Figure 7C). Indirect enzyme-linked immunosorbent assays (ELISAs) against FimA suggested that the level of FimA in the speB mutant at 1 mM putrescine was higher than with 4 mM putrescine, but the difference was not statistically significant (Figure 7D). Variation of supplemental putrescine did not affect FimA in the parental strain (Figure 7C and D). Transmission electron microscopy (TEM) showed that pili expression was highest for the speB mutant at 1 mM putrescine (Figure 8), moderate at 0.1- and 4 mM putrescine, and undetectable without putrescine. The cells grown with 4 mM putrescine were shorter and thinner, which suggests stress, possibly mimicking osmotic stress. From these results and those in the previous section, we conclude that pili expression requires an optimal putrescine concentration.

Figure 7
Download asset Open asset
Surface motility and pili expression in W3110 and ΔspeB.

(A) W3110 ΔspeB surface motility with 0.0, 0.1, 1.0, and 4.0 mM exogenous putrescine. All assays were performed in triplicate. Representative images are shown. (B) Average diameter of three separate surface motility plates. The parental strain without putrescine is shown for reference. Significance was determined by comparing the diameters of the ΔspeB mutants in the different concentrations of putrescine compared to the parental W3110. One-way ANOVA was used with Dunnett hypothesis testing to determine p values, ***p<0.001. (C) Reverse transcriptase-quantitative PCR using primers targeting the fimA gene from cells grown in 0.0, 0.1, 1.0, and 4.0 mM of supplemented putrescine. Double deltas were generated by normalizing the parental and the ΔspeB mutant RNA libraries to rpoD t hen comparing fimA expression. Two-way ANOVA was used to determine significance followed by Sadik hypothesis testing. ***p<0.001. (D) Enzyme linked immunosorbent assays using antibodies targeting pili (FimA) from cells grown with 0.0, 0.1, 1.0, and 4.0 mM of supplemented putrescine. Two-way ANOVA was used to determine significance followed by FDR adjusting. ***p<0.001. In this figure the ΔspeB mutant was J15.

Figure 8
Download asset Open asset
Transmission electron micrographs of ΔspeB mutant cells after surface motility.

Representative images are shown and cells were removed from motility plates with the following exogenous putrescine concentrations: (A) none, (B) 0.1 mM, (C) 1.0 mM, and (D) 4.0 mM. No pili were observed with 0 and 0.1 mM putrescine. Optimal pili production was observed with 1.0 mM putrescine. The bar represents one micron. In this figure the ΔspeB mutant was J15.

RNAseq analysis identifies fim operon expression and energy metabolism as targets of putrescine control

RNAseq analysis was used to further confirm or determine whether putrescine affected (a) transcription of the fim operon that codes for the pili structural genes, (b) fim operon promoter orientation, i.e., phase variation, or (c) energy metabolism: surface motility of W3110 has been shown to require glucose metabolism and oxidative phosphorylation (Sudarshan et al., 2021).

RNAseq analysis

We grew parental W3110 and its ΔspeB derivative with and without 1 mM putrescine. R2 values of pairwise comparisons showed that the transcriptome of the speB mutant grown without putrescine differed from the other transcriptomes which were similar (summarized in Table 1 and shown graphically in Supplementary file 1). A multidimensional scaling plot and a plot of the 100 most variable genes visualize these comparisons (Figure 9A and B). When compared to the parental strain, the speB mutant grown without putrescine had 310 downregulated genes and 159 upregulated genes with at least fourfold differential expression and FDR <0.05. Transcripts for the putrescine-induced puuAP and puuDRCBE operons, which specify genes of the major putrescine catabolic pathway, were reduced from 1.6- to 14-fold (FDR ≤0.02) in the speB mutant (Supplementary file 2). Because higher intracellular putrescine results in higher catabolic gene expression, these results imply lower intracellular putrescine in the ΔspeB mutant.

Figure 9
Download asset Open asset
Visual representation of the results from transcriptomic sequencing of W3110 and the ΔspeB mutant’s gene expression in media with and without 1.0 mM putrescine.

(A) Multidimensional scaling plot of the parental and ΔspeB mutant transcriptomes. When grown with 1.0 mM putrescine (red), the ΔspeB mutant transcriptome (triangles) are nearly identical to the parental transcriptomes when grown without and with putrescine (blue and red circles, respectively). When grown without putrescine, the ΔspeB mutant transcriptome (blue triangles) is greatly skewed from transcriptomes of the parental strain and the ΔspeB mutant grown with putrescine. (B) Heatmap of the top 100 most variable genes further demonstrates the distinctiveness of the ΔspeB mutant grown without putrescine and the similarities of the ΔspeB mutant transcriptome when grown with 1.0 mM putrescine supplementation and the parental grown with or without putrescine. In this figure the ΔspeB mutant was J15.

Table 1
Pairwise statistical comparisons of transcriptomes.

Abbreviation: putr is putrescine.

Strain 1Strain 2R2
Wild-type (1 mM putr)wild-type (0 mM putr)0.950
Wild-type (1 mM putr)ΔspeB (1 mM putr)0.954
ΔspeB (0 mM putr)ΔspeB (1 mM putr)0.820
ΔspeB (0 mM putr)wild-type (0 mM putr)0.796
ΔspeB (0 mM putr)wild-type (1 mM putr)0.786

Transcription of the fim operon is reduced in the ΔspeB mutant

Deletion of speB reduced transcripts for genes of the fimA operon (Figure 10A). Numerous transcription factors activate the fim operon (Schwan, 2011; Karp et al., 2018), and, of these, loss of speB reduced hns transcripts, and increased fis, lrp, and qseB transcripts, but had no effect on ihfA and ihfB (Figure 10B). Loss of hns, ihfA, and lrp impaired PDSM (Figure 10C and D), which confirms the requirement for their products for pili synthesis in our strain background.

Figure 10
Download asset Open asset
Transcriptomic sequencing of genes for the fim region and regulators that control fim gene expression.

(A) Expression of the fim genes in the parental W3110 and the speB mutant with and without putrescine supplementation. Values were calculated by dividing the individual replicates’ counts per million (CPM) value for each gene by the mean CPM of that gene in W3110 grown without putrescine and multiplying by 100 to yield the percent expression. Arrows below the genes signify the known operons: fimB and fimE belong to single gene operons, while fimAICDFGH belongs to one operon. One-way ANOVA was used to determine significance using Dunnett hypothesis testing. **p<0.01; ***p<0.001. (B) Expression of some regulators known to affect fim gene expression. Values were calculated as described in (A). ***p<0.001. (C) Surface motility of W3110 and three regulator mutants (Δhns, ΔihfA, and Δlrp). A gene found to be significantly different by this transcriptomic analysis (hns) was confirmed to be important in surface motility. In this figure the ΔspeB mutant was J15. (D) Diameter of surface movement of regulatory mutants after 36 hr. Error bars represent standard deviations for three independent replicates. Statistical analysis was performed using the Dunnett test of significance: *p<0.05; **p<0.01; ***p<0.001. All assays were performed in triplicate.

Putrescine does not control fim operon phase variation in W3110

The phase ON-favoring FimB and phase OFF-favoring FimE recombinases control the orientation of the fim operon promoter. Our version of W3110 has an insertion in fimE which means that FimB is the major factor that controls phase variation. Loss of speB reduced transcripts from fimB which could account for loss of motility. PCR analysis with specific primers can determine the fim operon promoter orientation (Figure 11A) and showed that loss of speB, loss of hns, or the presence of putrescine did not alter the ratio of ON to OFF (Figure 11B). This experiment determines the steady state phase ON to OFF ratio, which less FimB might not affect if FimB is in excess. In strains with FimE, the rate of phase ON orientation formation will be much slower, and even small changes in FimB activity could conceivably affect the switch orientation. We conclude that putrescine does not control phase variation, at least in our strain of W3110.

Figure 11
Download asset Open asset
Phase variation in parental W3110, W3110 ΔspeB, W3110 Δhns, and MG1655.

(A) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of E. coli, such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’-CCGCGATGCTTTCCTCTATG-3’; primer 2 is 5’-TAATGACGCCCTGAAATTGC-3’; and primer 3 is 5’-TGCTAACTGGAAAGGCGCTG-3’ (shown schematically). (B) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE, is not locked in phase ON.

Evidence for a putrescine homeostatic network

Altered transcript levels in the speB mutant suggest compensatory mechanisms for low putrescine (Supplementary file 2 for transcript differences for all genes, Table 2 for selected genes, and Figure 12 for a diagrammatic representation of transcript differences). The speB mutant had more transcripts from (a) genes of arginine and ornithine carboxylase, (b) all genes of ornithine and arginine synthesis from glutamate, and (c) genes for three separate putrescine transport systems; and fewer transcripts from the sap operon which codes for a putrescine exporter (Sugiyama et al., 2016) and rpmH and rpsT, whose products inhibit ornithine and arginine decarboxylase (Keseler et al., 2017). The net effect of these changes should be to increase intracellular putrescine (solid arrows in Figure 12). In other words, these changes are compensatory for low putrescine. In addition to these changes, the speB mutant had 60-fold and sevenfold more transcripts for mgtA and phoBR which code for the major magnesium transporter and the regulators of phosphate assimilation, respectively. These changes may also be compensatory and are discussed below.

Figure 12
Download asset Open asset
The deduced diversion of metabolism in a speB mutant away from energy metabolism toward putrescine synthesis compared to the parental strain.

The effects of low putrescine are shown. Genes and processes (transport and transcriptional regulators) in red have fewer transcripts, while those in black or blue have more. The dashed lines represent the proposed reduction in metabolic flux because of fewer transcripts from genes coding for the enzymes involved. Operons are shown except for the larger operons or regulons. For example, pur is meant to represent the unlinked genes that code for enzymes of purine synthesis. Table 2 or Supplementary file 2 should be consulted for specific genes and the quantitative change in transcripts.

Table 2
Differentially expressed genes that are proposed to contribute to putrescine homeostasis.

A positive number means more transcripts in the ΔspeB (lower putrescine) strain.

Gene (function)log2FCFDR
Polyamine synthesis
speA (putrescine)0.990.003
speC (putrescine)1.433E-4
speD (spermidine)–0.830.01
speF (putrescine)1.050.007
rpmH (inhibitor of SpeA and SpeC)–2.772E-4
rpsT (inhibitor of SpeA and SpeC)–1.928E-4
Polyamine transport
potABCD* (spermidine)–2.173E-4
potE (putrescine)2.072E-4
potFGHI* (putrescine)1.414E-4
plaP (putrescine)1.110.005
sapBCDF* (putrescine export)–1.188E-4
Arginine synthesis
argA_2 (synthesis)1.770.001
argB (synthesis)1.870.002
argC (synthesis)2.860.005
argD (synthesis)1.410.001
argF (synthesis)1.630.01
argG (synthesis)2.320.002
argH (synthesis)0.970.001
argI (synthesis)1.950.018
 argR (repressor of arginine regulon)–1.354E-4
Glutamate generation
glsA (glutamine degradation)2.165E-4
glnG (regulation of ammonia assimilation)–1.590.022
TCA cycle/electron transport
acnA (TCA cycle)–1.048E-4
acnB (TCA cycle)–1.962E-4
fumA (TCA cycle)–1.506E-4
fumB (TCA cycle)–1.490.003
gltA (TCA cycle)–1.642E-4
icdA (TCA cycle)–1.320.002
sdhCDAB-sucABCD* (TCA cycle)–3.885E-5
nuo operon* (electron transport)–0.820.004
menFDHBCE* (electron transport)–0.80.005
ubiEJB* (electron transport)–0.930.004
cyoABCD* (electron transport)–1.419E-4
hemCD* (heme)–2.052E-4
Iron transport
exbBD* (transport of all iron chelates)–2.334E-5
tonB (transport of all iron chelates)–1.94E-5
entCEBA* (enterochelin iron)–5.27E-6
fecABCDE * (ferric citrate)–4.43E-5
fecIR (regulators, ferric citrate)–4.46E-6
feoABC* (ferrous iron)–3.47E-4
fur (regulator, iron assimilation)–0.400.11
Magnesium and phosphate transport
mgtA (magnesium)5.905E-6
phoQ (regulator, magnesium)0.790.009
pstSCAB* (phosphate)3.610.01
phoBR* (regulator, phosphate assimilation)2.800.02
  1. *

    Values for transcripts of the first gene of the operon are given. Results for other genes of the operon are in Supplementary file 2.

Putrescine affects energy metabolism which could account for loss of motility

Loss of speB affected transcripts for genes of the major energy metabolism pathways (Table 2): fewer transcripts for genes coding for all citric acid cycle enzymes, NADH dehydrogenase I (the entire nuo operon), cytochrome oxidase (the cyo operon), and several genes of menaquinone (the menFDHBCE operon), ubiquinone, and heme synthesis. The speB mutant also had fewer transcripts for all genes of iron acquisition, which is consistent with diminished oxidative energy generation. A speB mutant had fewer transcripts for ptsH (Hpr of the phosphotransferase system of carbohydrate transport), ptsG (enzyme IIBC component of glucose transport), gltA (citrate synthase), sdhA (a succinate dehydrogenase subunit), and sucC (a succinyl-CoA synthetase subunit), and their loss has been shown to either impair or eliminate W3110 surface motility (Sudarshan et al., 2021). The cumulative effect of these differences could account for the motility defect in the speB mutant.

Discussion

Several aspects of polyamine metabolism affect PDSM in E. coli. Strains with loss of one or two polyamine synthesis genes ― speA and speB single mutants and a speC speF double mutant ― resulted in PDSM defects. This observation is remarkable because nine enzymes and several pathways are involved in polyamine synthesis. Our putrescine synthesis mutants had no growth defect which is not unexpected since deletions of eight biosynthetic genes were required to show a strong phenotype: impaired aerobic growth and elimination of anaerobic growth (Chattopadhyay et al., 2009). Strains with defects in the two most active putrescine transport systems had altered PDSM. The specific defects suggest the involvement of extracellular putrescine and arginine in intracellular putrescine homeostasis. The PDSM defect of putrescine transport mutants not only implicates extracellular putrescine but also suggests secretion of putrescine which is not added to the medium. The PDSM defect of speA and speB mutants implicates extracellular arginine because SpeA is mostly periplasmic (Tabor and Tabor, 1969). Defective putrescine catabolism also affected PDSM. The role of both putrescine synthesis and degradation suggests rapid adjustments to fluctuating putrescine concentrations and environmental conditions: putrescine catabolism is a core response to several stresses (Schneider et al., 2013).

Results from an RNAseq analysis showed that transcription of the fim operon was reduced in the speB mutant. Of the known transcription factors that control the fim operon, only the gene for H-NS had fewer transcripts. In contrast, transcripts for other relevant transcription factor genes were elevated in the speB mutant. Our results are consistent with H-NS mediating putrescine-dependent control, but we cannot exclude a general regulatory dysfunction mediated by altered nucleoprotein complexes at the fim operon promoter. The elevated transcripts for some transcription factors may be inhibitory.

The transcriptomic results showed that the speB mutant had more transcripts for genes whose products will maintain intracellular putrescine, which suggests compensatory mechanisms for low intracellular putrescine (Figure 11). The speB mutant also had more transcripts for magnesium and phosphate transport genes. The elevated transcripts for magnesium transport genes could compensate for low putrescine to the extent that magnesium can directly replace putrescine, e.g., binding to nucleotides and RNA (Miyamoto et al., 1993). Two recent studies observed an inverse correlation between intracellular magnesium and polyamines in Salmonella and proposed that either magnesium or the polyamines maintained an overall divalent cation homeostasis (Iwadate et al., 2023; Duprey and Groisman, 2020). The rationale for an increase in anionic phosphate assimilation is less clear, although the major phosphate permease transports metal-phosphates, including magnesium-phosphate (van Veen et al., 1994), which could help to compensate for low putrescine. Regardless of the rationale, the substantial changes in gene expression due to low putrescine suggest multiple compensatory mechanisms.

A major observation of the RNAseq analysis is that loss of speB lowered transcripts for many genes of energy metabolism and all genes of iron acquisition. This gene expression pattern suggests that low putrescine diverts metabolism away from energy generation and toward putrescine synthesis, i.e., a prioritization of putrescine synthesis over aerobic energy metabolism. Oxidative energy metabolism and putrescine synthesis compete for α-ketoglutarate and the metabolic diversion could also be a potential compensatory mechanism for low putrescine. Another way of looking at this relationship is that intracellular putrescine positively correlates with oxidative energy metabolism. Deletion of ptsH, ptsG, gltA, sdhA, and sucC have been shown to impair W3110 PDSM which suggests that a major, possibly the primary, effect of low putrescine is reduced energy generation.

In contrast to our results, a thorough and well-designed study showed that E. coli PDSM requires spermidine instead of putrescine (Kurihara et al., 2009). The differences between the studies were strain backgrounds, media (glucose-LB vs glucose-tryptone), and incubation temperature (33° vs 37°). We found that PDSM results for 37° incubations were highly variable and resulted in numerous fast-moving variants. Since growth at the higher temperature is faster, and faster growth is associated with higher putrescine (Tweeddale et al., 1998), we propose that growth at 37° results in an inhibitory putrescine concentration. In this case, spermidine would be stimulatory because of its known inhibition of the putrescine biosynthetic enzymes SpeA and SpeC (Applebaum et al., 1977; Wu and Morris, 1973) and subsequent reduction of intracellular putrescine to an optimal concentration. Regardless of the explanation, strain differences are not unexpected because of decades of strain passage for the strains employed with resulting laboratory evolution that can affect any of the numerous factors that control the intracellular putrescine concentration.

The transcript changes observed in our study were different from those in the only other systematic study of putrescine’s effect on E. coli gene expression (Yoshida et al., 2004). Both studies had almost identical experimental designs: 1.0- or 1.14 mM putrescine was added to a speB or speB speC mutant, respectively. Differences in strains, growth media (minimal media vs tryptone-containing media), and growth temperature (33° vs 37°) could account for the discrepancy in results. The most crucial difference could be the growth media: Igarashi and colleagues grew bacteria in a minimal medium, while we grew bacteria in an amino acid-containing medium that was required for surface motility. We propose that the slower growth in minimal medium, possibly correlated with higher guanosine tetraphosphate which is associated with slower growth, counters and obscures many growth-stimulatory putrescine effects. In contrast, the growth stimulation from the amino acids in our medium would not counter putrescine effects and would essentially allow the detection of effects caused solely by changes in putrescine concentrations. Regardless of the explanation, common results can be interpreted as core responses to putrescine limitation. Both studies observed that low putrescine increased transcripts for genes of arginine synthesis and magnesium transport, and reduced transcripts for the sdhCDAB-sucABCD operon which codes for three TCA cycle enzymes. The link between putrescine and arginine synthesis is probably mediated by the ArgR repressor because argR transcripts are 2.5-fold lower (FDR = 0.0004) in the speB mutant (Supplementary file 2).

Several results implicate putrescine in E. coli virulence during urinary tract infections. First, pili-dependent binding to the urothelium is an essential step for uropathogenic E. coli (Flores-Mireles et al., 2015). Second, putrescine is present in urine from infected, but not healthy, individuals (Puebla-Barragan et al., 2020; Satink et al., 1989). Third, urinary putrescine can result from uropathogenic E. coli growth in urine (Satink et al., 1989) and urothelial pathophysiology (Keay et al., 2014). Putrescine’s possible role in virulence is seemingly contradicted by the observation that a speB mutant outcompetes the parental CFT073 in the bladder of mice, i.e., less putrescine synthesis enhanced virulence (Alteri et al., 2009). A majority of uropathogenic E. coli is associated with phylogenetic group B2―including CFT073, whereas most E. coli lab strains, such as W3110, are group A. Group B2 strains lack genes for the major putrescine catabolic pathway and have significantly higher transcripts for genes coding for SpeA and SpeB (Hogins et al., 2023a). Both observations suggest that the cytoplasmic putrescine concentration is higher in group B2 strains. We propose that the putrescine concentration in group B2 strains is normally in the inhibitory range for pili synthesis, and that loss of SpeB reduces putrescine to a level that stimulates pili synthesis. Regardless of the explanation, putrescine control of pili synthesis and other processes in uropathogenic E. coli are worth examination.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Escherichia coli)speBPMID:16738554P1 transduction construction
Gene (E. coli)various, see strain listPMID:16738554P1 transduction construction
Strain, strain background (E. coli)W3110otherLab strain; history provided in Methods
Genetic reagent (E. coli transducing virus)P1 virotherLab strain
Antibodyanti-E. coli RpoD (rabbit polyclonal)CusabioCat #: CSB-PA360419XA01ENV
RRID:AB_3678626		1:10,000
Antibodyanti-E. coli FimA (rabbit polyclonal)CusabioCat #: CSB-PA361210ZA01ENV
RRID:AB_3678627		1:10,000
AntibodyGoat anti-rabbit IgG (H+L) HRP conjugatedCusabioCat #: CSB-PA489724
RRID:AB_3678628		1:10,000
Sequence-based reagentFimA forwardThis paperPCR primersATGGTGGGACCGTTCACTTT
Sequence-based reagentFimA reverseThis paperPCR primersGGCAACAGCGGCTTTAGATG
Sequence-based reagentRpoD forwardThis paperPCR primersTCGTGTTGAAGCAGAAGAAGCG
Sequence-based reagentRpoD reverseThis paperPCR primersTCGTCATCGCCATCTTCTTCG
Sequence-based reagentPhase variation test primer 1This paperPCR primersCCGCGATGCTTTCCTCTATG
Sequence-based reagentPhase variation test primer 2This paperPCR primersTAATGACGCCCTGAAATTGC
Sequence-based reagentPhase variation test primer 3This paperPCR primersTGCTAACTGGAAAGGCGCTG
Commercial assay or kitTMB substrate kitThermoFisherCat #: 34021
Commercial assay or kitLigation sequencing DNA V14Oxford Nanopore TechnologiesCat #: SQK-LSK114
Commercial assay or kitRneasy Mini KitQiagenCat #: 74104
Commercial assay or kitRiboMinus Transcriptome Isolation Kit, bacteriaThermoFisherCat #: K155004
Commercial assay or kitRiboCop rRNA Depletion Kits for BacteriaLexogenCat #: 126.24
Commercial assay or kitLunaScript RT SuperNEBCat #: E3010
Commercial assay or kitPowerUp STBR Green Master Mix for qPCRThermoFisherCat #: A25777
Chemical compound, drugEiken AgarEiken Chemical Co., Ltd, Tokyo, JapanCat #: E-MJ00
Software, algorithmbcl2fastq (v 4.2.4)IlluminaRRID:SCR_015058
Software, algorithmGuppy basecaller (v 6.5.7)Oxford Nanopore TechnologiesRRID:SCR_023196
Software, algorithmPorechop (v 0.2.4)Oxford Nanopore TechnologiesRRID:SCR_016967
Software, algorithmFlye (v 2.9.2)PMID:27956617RRID:SCR_017016
Software, algorithmPilon (v 1.24)https://doi.org.10.1371/journal.pone.0112963RRID:SCR_014731
Software, algorithmCirculator (v 1.5.5)PMID:26714481
Software, algorithmProkka (v 1.14.6)https://doi.org.10.1093/bioinformatics/btu153RRID:SCR_014732
Software, algorithmQUAST (v 5.2.0)PMID:23422339RRID:SCR_001228
Software, algorithmCLC Genomics WorkbenchQiagenRRID:SCR_011853
Software, algorithmedgeRPMID:19910308RRID:SCR_012802

Strains

All strains used for growth rate determinations and motility assays were derivatives of E. coli K-12 strain W3110 and are listed in Table 3. Great variations exist in standard lab strains, including W3110, from different labs. We initially tested nine strains derived from E. coli K-12, mostly from the Coli Genetic Stock Center (Ambagaspitiye et al., 2019), and chose our lab strain because of relative genetic stability and more quantitatively reproducible results. Our strain originated from the lab of Jon Beckwith in the 1960s via the lab of Boris Magasanik where it had been stored in a room temperature stab until the mid-1980s, at which time it was revived and frozen at –80 °C. To construct the mutant strains, the altered allele was obtained from the Keio collection in which the gene of interest had been deleted and replaced with an antibiotic-resistance gene (Baba et al., 2006). The marked deletion allele was transferred into W3110 by P1 transduction (Miller, 1972). The antibiotic gene was removed as described which generated an in-frame deletion (Datsenko and Wanner, 2000).

Table 3
Strains.
Strain nameGenotypeReference
BLS77W3110 ∆puuR::catSchneider and Reitzer, 2012
BLS80W3110 ∆puuA::catSchneider and Reitzer, 2012
BLS88W3110 ∆patA ∆puuASchneider and Reitzer, 2012
CP2W3110 ∆patASchneider and Reitzer, 2012
IM26W3110 ∆speB::kan fliC-lacZThis study
IM27W3110 ∆speE::kan fliC-lacZThis study
IM28W3110 ∆speF::cat fliC-lacZThis study
IM29W3110 ∆speC::kan fliC-lacZThis study
IM34W3110 ∆speC ∆speF::cat fliC-lacZThis study
IM60W3110 ∆cadA::kan fliC-lacZThis study
IM61W3110 ∆speA::kanThis study
IM62W3110 ∆patA ∆puuA ∆speE::kanThis study
IM63W3110 ∆potE::kanThis study
IM64W3110 ∆potF::kanThis study
IM65W3110 ∆plaP::kanThis study
IM66W3110 ∆puuP::kanThis study
J15W3110 ΔspeB ΔfliC::kanThis study
SA1W3110 ∆fliC::kanThis study
SA2W3110 ∆fimA::kanThis study
SA3W3110 ∆fliC ∆fimAThis study
SA4W3110 ∆hns::kanThis study
SA5W3110 ∆ihfA::kanThis study
SA6W3110 ∆lrp::kanThis study
W3110-LR referred to as W3110lacIqlacL8Lab strain

Media and growth conditions

Request a detailed protocol

For P1 transductions and plasmid transformation experiments, cells were grown in standard LB liquid medium (1% tryptone, 1% NaCl, and 0.5% yeast extract, pH 7.0) at 37°C. Antibiotics were used for selection at concentrations of 25 µg/mL (both chloramphenicol and kanamycin). For growth analysis, bacteria were grown in a liquid motility medium (0.5% glucose, 1% tryptone, and 0.25% NaCl) which we refer to as GT medium. Starter cultures (typically 6–12 hr incubation) were grown in GT medium, harvested by centrifugation, washed twice with phosphate-buffered saline, and re-suspended in GT medium before inoculation. The cells were then grown at 37 °C in aerobic conditions (shaking at 240 rpm) and the turbidity was measured every 30 min. Cell growth was measured in Klett units using a Scienceware Klett colorimeter with a KS-54 filter. 100 Klett units represent an OD600 value of about 0.7.

Surface motility assay

Request a detailed protocol

For a standard surface motility assay, single colonies from fresh plates (streaked out from frozen stocks a day before) were inoculated in GT medium for 6 hr at 37 °C in aerobic conditions (shaking at 240 rpm). 30 ml of autoclaved GT medium with 0.45% agar (Eiken, Tokyo, Japan) was poured into a sterile polystyrene petri dish (100 mm × 15 mm) and allowed to solidify at room temperature for approximately 6 hr. Then, 1 µL of the pre-motility growth medium was inoculated at the center of the agar plate and incubated at 33°C for 36 hr. Each experiment was performed in triplicate and pictures were taken after 36 hr. Surface motility was extremely sensitive to humidity. Opening the incubator before 36 hr resulted in movement cessation. The surface motility assay was performed at 33 °C because results from incubations at 37°C were highly variable and the cultures more frequently generated genetically stable fast-moving variants.

Swim assay

Request a detailed protocol

The media and culturing for swimming motility are identical to that for surface motility, except that the plates contained 0.25% agar and were solidified at room temperature for about 1 hr before inoculation. Then, 1 µL of the culture was stabbed in the center of this swim agar plate and incubated at 33°C for 20 hr. Each experiment was performed in triplicate.

Transmission electron microscopy

Request a detailed protocol

Cells from surface motility plates were collected and fixed with 2.5% glutaraldehyde. Bacteria were absorbed onto Foamvar carbon-coated copper grids for 1 min. Grids were washed with distilled water and stained with 1% phosphotungstic acid for 30 s. Washed and stained grids were dried at 37 °C for 10 min. Samples were viewed on a JEOL 1200 EX transmission electron microscope at the University of Texas Southwestern Medical Center (Figure 2) and the University of Texas at Dallas (Figure 8).

ELISA analysis

Request a detailed protocol

Cells were grown overnight in 5 mL GT media followed by a 2 hr growth in GT media with 0.0, 0.1, 1.0, or 4.0 mM putrescine. Cells were then lysed using a 24-gauge needle. The cell lysate was diluted to a concentration of 1 mg/mL protein (based on A280) in pH 9.6 coating buffer (3 g Na2CO3, 6 g NaHCO3, 1000 mL distilled water) and then coated onto the walls of a 96-well plate by incubating overnight at 4 °C. The wells were rinsed three times with PBS and further blocked using coating buffer with 1% bovine albumin overnight at 4 °C. The following day, wells were rinsed three times with PBS, and primary antibodies to FimA or RpoD were added following supplier directions. After a 2 hr room temperature incubation, secondary antibodies conjugated to HRP were added and incubated for a further 2 hr. HRP was activated using the TMB substrate kit (Thermo-34021) following the provided protocol. Expression was read on a BioTek plate reader based on the provided kit protocol. Data was blanked to wells only treated with bovine albumin and then normalized to RpoD. Data was generated from technical and biological triplicates.

DNA isolation and genome assembly and annotation for W3110

Request a detailed protocol

DNA was isolated based on previously established protocols (Hogins et al., 2023b). Short reads were sequenced at the SeqCenter (Pittsburgh, Pennsylvania) using Illumina tagmentation-based and PCR-based DNA prep and custom IDT indices targeting inserts of 280 bp without further fragmentation or size selection steps. The Illumina NovaSeq X Plus sequencer was run producing 2×151 paired-end reads. Demultiplexing, quality control, and adapter trimmer were performed with bcl-convert (v4.2.4). Total Illumina Reads (R1+R2): 4059078 with 553087045 bps >Q30.

Long reads were prepared using the PCR-free Oxford Nanopore Technologies ligation sequencing kit with the NEBNext companion module. No fragmentation or size selection was performed. Long-read libraries were performed using the R10.4.1 flow cell. The 400bps sequencing mode with a minimum read length of 200 bp was selected. Guppy (v6.5.7) was used at the super-accurate base calling, demultiplexing, and adapter removal. Total long reads: 53773 with 89.607% of bps >Q20.

To generate the completed genome, porechop (v0.2.4) was used to trim residual adapter sequences from long reads. Flye (v2.9.2) was used to generate the de novo assembly under the nano-hq model. Reads longer than the estimated N50 based on a genome size of 6Mbp initiated the assembly. Subsequent polishing using the short read data was performed using Pilon (v1.24) (RRID:SCR_014731) under default parameters. Long-read contigs with an average short-read coverage of 15 X or less were removed from the assembly. The assembled contig was confirmed to be circular via circulator (v1.5.5). Annotation was performed using prokka (v 1.14.6). Finally, statistics were recorded using QUAST (v5.2.0). The final genome contained 1 contig of 4750347 bp with a sequencing depth of 123.92 x. The N50 was 4750347. This genome can be accessed via the accession number CP165600 or via the BioProject PRJNA1142534 via NCBI. The completed genome has an estimated average nucleotide identity of 99.9694 to the W3110 genome deposited to NCBI (genome assembly ASM1024v1).

RNA isolation and quality control

Request a detailed protocol

Cells were grown for 2 hr in 1 mL GT media. 60 µL were then added to 1 mL of fresh GT, with or without 1 mM putrescine, and grown for another 2 hr. After growth, the cells were centrifuged, and frozen at –80 °C. The isolation and analysis protocol has been previously published (Hogins et al., 2023a). Cell pellets were thawed, resuspended in 0.7 mL of buffer RLT (Qiagen RNeasy kit), and mechanically lysed using a bead beater (FastPrep-24 Classic from MP Biomedical (RRID:SCR_013308)) set at the highest setting for three 45 s cycles with a 5 min rest period on ice between cycles. Cell lysates were used to isolate RNA using a Qiagen RNeasy mini kit. RNA was quantified, DNase treated, and re-quantified on a nanodrop. RNA that passed the first quality check was analyzed on RNA-IQ (Qubit). RNA with an IQ higher than 7.5 was used. RNA that passed both checks was run on an agarose gel to check for RNA integrity. RT-qPCR was used to ensure there was no DNA contamination. RNA libraries that passed all these quality checks were submitted to the genomics core facility at The University of Texas at Dallas for RNA sequencing. The core performed rRNA removal (RiboMinus Transcriptome Isolation Kit or RiboCop bacterial rRNA depletion—Lexogen), library preparation (Stranded Total RNA Prep—Illumina), and single-end Illumina sequencing.

Reverse transcription quantitative PCR

Request a detailed protocol

RNA was isolated as described above. One microgram of RNA was reverse transcribed using LunaScript RT Super Mix (NEB E3010) and another microgram was subjected to the same reaction as the reverse transcribed RNA, except without reverse transcriptase (negative control) following manufacturer instructions. The cDNA was then diluted to 10 ng/µL for qPCR. PCR reactions were composed of 10 ng cDNA, 8 µL of nuclease-free water, 10 nM primers (rpoD: Forward: TCGTGTTGAAGCAGAAGAAGCG; Reverse: TCGTCATCGCCATCTTCTTCG) (fimA: Forward: ATGGTGGGACCGTTCACTTT; Reverse: GGCAACAGCGGCTTTAGATG), and PowerUp SYBR Green 2 X master mix for qPCR (ThermoFisher A25777) in a 20 µL reaction. A Quantstudio 3 qPCR machine was used to generate critical threshold (Ct) values. The Ct values were then analyzed using the 2-ΔΔCT method (Livak and Schmittgen, 2001) using rpoD as a library control.

RNAseq analysis

Request a detailed protocol

Transcripts were aligned to the W3110 genome and CDS (CP165600) available on NCBI using the CLC genomics workbench (Qiagen version 22.00) for RNA-seq analysis. The gene expression counts generated as this output were used to perform differentially expressed gene (DEG) analysis using EdgeR (version 3.38.4) (RRID:SCR_012802) to analyze read counts (McCarthy et al., 2012; Robinson et al., 2010). DEGs had an adjusted p-value of less than 0.05.

Material availability statement

Request a detailed protocol

All strains are available upon request. All mutant alleles are readily accessible via the KEIO mutant collection (Baba et al., 2006).

Data availability

The raw RNA seq reads were deposited in GenBank: BioProject accession number PRJNA1126736. The genome was deposited in GenBank: BioProject accession number PRJNA1142534. The genome accession number is CP165600.

The following data sets were generated
    1. Hogins J
    2. Reitzer L
    (2024) NCBI BioProject
    ID PRJNA1126736. Transcriptomic Sequencing of a speB mutant in Escherichia coli W3110.
    https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1126736
    1. Hogins J
    2. Reitzer L
    (2024) NCBI BioProject
    ID PRJNA1142534. Escherichia coli str. K-12 substr. W3110 Genome sequencing.
    https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1142534
    1. Hogins J
    2. Reitzer L
    (2025) NCBI Nucleotide
    ID CP165600. Escherichia coli str. K-12 substr. W3110 chromosome, complete genome.
    https://www.ncbi.nlm.nih.gov/nuccore/CP165600

References

  26. Book
    1. Miller JH
    (1972)
    Experiments in Molecular Genetics
    Cold Spring Harbor Laboratory.
    1. Tabor H
    2. Tabor CW
    (1969)
    Partial separation of two pools of arginine in Escherichia coli; preferential use of exogenous rather than endogenous arginine for the biosynthesis of 1,4-diaminobutane
    The Journal of Biological Chemistry 244:6383–6387.

Article and author information

Author details

  1. Iti Mehta

    Department of Biological Sciences, The University of Texas at Dallas, Richardson, United States
    Contribution
    Formal analysis, Validation, Investigation, Visualization, Writing – original draft
    Contributed equally with
    Jacob B Hogins
    Competing interests
    No competing interests declared

  2. Jacob B Hogins

    Department of Biological Sciences, The University of Texas at Dallas, Richardson, United States
    Contribution
    Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    Contributed equally with
    Iti Mehta
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6041-7332

  3. Sydney R Hall

    Department of Biological Sciences, The University of Texas at Dallas, Richardson, United States
    Contribution
    Formal analysis, Investigation, Visualization, Methodology
    Competing interests
    No competing interests declared

  4. Gabrielle Vragel

    Department of Biological Sciences, The University of Texas at Dallas, Richardson, United States
    Contribution
    Formal analysis, Validation, Investigation, Visualization, Methodology
    Competing interests
    No competing interests declared

  5. Sankalya Ambagaspitiye

    Department of Biological Sciences, The University of Texas at Dallas, Richardson, United States
    Present address
    Department of Biosystems Technology, Faculty of Technology, University of Sri Jayewardenepura, Homagama, Sri Lanka
    Contribution
    Formal analysis, Validation, Investigation, Visualization
    Competing interests
    No competing interests declared

  6. Philippe E Zimmern

    Department of Urology, University of Texas Southwestern Medical Center, Dallas, United States
    Contribution
    Supervision, Funding acquisition, Writing – review and editing
    Competing interests
    No competing interests declared

  7. Larry Reitzer

    Department of Biological Sciences, The University of Texas at Dallas, Richardson, United States
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    reitzer@utdallas.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4406-6090

Funding

Cain Foundation (The Felecia and John Cain Distinguished Chair in Women’s Health, in Honor of Philippe Zimmern, M.D.)

  • Philippe E Zimmern

This work was funded through private donations. PEZ received endowment support from the Cain Foundation through the Felecia and John Cain Distinguished Chair in Women's Health in honor of Philippe E Zimmern, MD. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work was funded through private donations. PEZ received endowment support from the Cain Foundation through the Felecia and John Cain Distinguished Chair in Women’s Health in honor of Philippe E Zimmern, MD. The authors declare no potential conflicts of interest.

The authors (JH, SH, GV, and LR) would like to thank Prof. Kelli Palmer of The University of Texas at Dallas for the use of her space, supplies, and tissue homogenizer. JH would like to further thank Prof. Palmer for the use of her CLC genomics program. The authors would like to thank the Genome Center at The University of Texas at Dallas for the services to support our research. The authors would like to thank the Olympus Discovery Center/Imaging Core facility at UT Dallas for providing equipment and support (Figure 8), and the UT Southwestern Medical Center for electron microscopy (Figure 2).

Version history

  1. Preprint posted:
  2. Sent for peer review:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.102439. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2024, Mehta, Hogins et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 203
    views
  • 9
    downloads
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Iti Mehta
  2. Jacob B Hogins
  3. Sydney R Hall
  4. Gabrielle Vragel
  5. Sankalya Ambagaspitiye
  6. Philippe E Zimmern
  7. Larry Reitzer
(2025)
Control of pili synthesis and putrescine homeostasis in Escherichia coli
eLife 13:RP102439.
https://doi.org/10.7554/eLife.102439.3

Share this article

https://doi.org/10.7554/eLife.102439

Categories and tags

Research organism

Further reading

    1. Genetics and Genomics

    UBR-1 deficiency leads to ivermectin resistance in Caenorhabditis elegans

    Yi Li, Long Gong ... Shangbang Gao
    Research Article

    Resistance to anthelmintics, particularly the macrocyclic lactone ivermectin (IVM), presents a substantial global challenge for parasite control. We found that the functional loss of an evolutionarily conserved E3 ubiquitin ligase, UBR-1, leads to IVM resistance in Caenorhabditis elegans. Multiple IVM-inhibiting activities, including viability, body size, pharyngeal pumping, and locomotion, were significantly ameliorated in various ubr-1 mutants. Interestingly, exogenous application of glutamate induces IVM resistance in wild-type animals. The sensitivity of all IVM-affected phenotypes of ubr-1 is restored by eliminating proteins associated with glutamate metabolism or signaling: GOT-1, a transaminase that converts aspartate to glutamate, and EAT-4, a vesicular glutamate transporter. We demonstrated that IVM-targeted GluCls (glutamate-gated chloride channels) are downregulated and that the IVM-mediated inhibition of serotonin-activated pharynx Ca2+ activity is diminished in ubr-1. Additionally, enhancing glutamate uptake in ubr-1 mutants through ceftriaxone completely restored their IVM sensitivity. Therefore, UBR-1 deficiency-mediated aberrant glutamate signaling leads to ivermectin resistance in C. elegans.

    1. Genetics and Genomics

    Dimeric R25CPTH(1–34) activates the parathyroid hormone-1 receptor in vitro and stimulates bone formation in osteoporotic female mice

    Minsoo Noh, Xiangguo Che ... Sihoon Lee
    Research Article

    Osteoporosis, characterized by reduced bone density and strength, increases fracture risk, pain, and limits mobility. Established therapies of parathyroid hormone (PTH) analogs effectively promote bone formation and reduce fractures in severe osteoporosis, but their use is limited by potential adverse effects. In the pursuit of safer osteoporosis treatments, we investigated R25CPTH, a PTH variant wherein the native arginine at position 25 is substituted by cysteine. These studies were prompted by our finding of high bone mineral density in a hypoparathyroidism patient with the R25C homozygous mutation, and we explored its effects on PTH type-1 receptor (PTH1R) signaling in cells and bone metabolism in mice. Our findings indicate that R25CPTH(1–84) forms dimers both intracellularly and extracellularly, and the synthetic dimeric peptide, R25CPTH(1–34), exhibits altered activity in PTH1R-mediated cyclic AMP (cAMP) response. Upon a single injection in mice, dimeric R25CPTH(1–34) induced acute calcemic and phosphaturic responses comparable to PTH(1–34). Furthermore, repeated daily injections increased calvarial bone thickness in intact mice and improved trabecular and cortical bone parameters in ovariectomized (OVX) mice, akin to PTH(1–34). The overall results reveal a capacity of a dimeric PTH peptide ligand to activate the PTH1R in vitro and in vivo as PTH, suggesting a potential path of therapeutic PTH analog development.

    1. Developmental Biology
    2. Genetics and Genomics

    Deficiency in DNAH12 causes male infertility by impairing DNAH1 and DNALI1 recruitment in humans and mice

    Menglei Yang, Hafiz Muhammad Jafar Hussain ... Baolu Shi
    Research Article

    Asthenoteratozoospermia, a prevalent cause of male infertility, lacks a well-defined etiology. DNAH12 is a special dynein featured by the absence of a microtubule-binding domain, however, its functions in spermatogenesis remain largely unknown. Through comprehensive genetic analyses involving whole-exome sequencing and subsequent Sanger sequencing on infertile patients and fertile controls from six distinct families, we unveiled six biallelic mutations in DNAH12 that co-segregate recessively with male infertility in the studied families. Transmission electron microscopy (TEM) revealed pronounced axonemal abnormalities, including inner dynein arms (IDAs) impairment and central pair (CP) loss in sperm flagella of the patients. Mouse models (Dnah12-/- and Dnah12mut/mut) were generated and recapitulated the reproductive defects in the patients. Noteworthy, DNAH12 deficiency did not show effects on cilium organization and function. Mechanistically, DNAH12 was confirmed to interact with two other IDA components DNALI1 and DNAH1, while disruption of DNAH12 leads to failed recruitment of DNALI1 and DNAH1 to IDAs and compromised sperm development. Furthermore, DNAH12 also interacts with radial spoke head proteins RSPH1, RSPH9, and DNAJB13 to regulate CP stability. Moreover, the infertility of Dnah12-/- mice could be overcome by intracytoplasmic sperm injection (ICSI) treatment. Collectively, DNAH12 plays a crucial role in the proper organization of axoneme in sperm flagella, but not cilia, by recruiting DNAH1 and DNALI1 in both humans and mice. These findings expand our comprehension of dynein component assembly in flagella and cilia and provide a valuable marker for genetic counseling and diagnosis of asthenoteratozoospermia in clinical practice.