Primosomal protein PriC rescues replication initiation stress by bypassing the DnaA-DnaB interaction step for DnaB helicase loading at oriC
eLife Assessment
This manuscript reports findings of fundamental significance on how bacteria might load helicase for DNA replication when normal DnaA-based loading pathway is defective. It provides convincing genetic and biochemical evidence that helicase loading at the E. coli oriC is not (as previously assumed) exclusively performed by the DnaA initiator protein but can also be executed by PriC (whether this occurs specifically at oriC has not been addressed in vivo). This is a significant step forward in our understanding of bacterial replication initiation.
https://doi.org/10.7554/eLife.103340.3.sa0Fundamental: Findings that substantially advance our understanding of major research questions
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
In Escherichia coli, replisome and replication fork assembly is initiated by DnaB helicase loading at the chromosomal origin oriC via its interactions with the DnaA initiator and the DnaC helicase loader. Upon replication fork arrest, the replisome including DnaB dissociates from the stalled fork. Replication fork progression is rescued by primosomal protein PriA- or PriC-dependent pathway in which PriA and PriC promote reloading of DnaB in different mechanisms. However, the mechanism responsible for rescue of blocked replication initiation at oriC remains unclear. Here, we found that PriC rescued blocked replication initiation in cells expressing an initiation-specific DnaC mutant, in mutant cells defective in DnaA-DnaB interactions, and in cells containing truncated oriC sequence variants. PriC rescued DnaB loading at oriC even in the absence of Rep helicase, a stimulator of the PriC-dependent replication fork restart pathway. These results of in vitro reconstituted assays concordantly suggest that this initiation-specific rescue mechanism provides a bypass of the DnaA-DnaB interaction for DnaB loading by PriC-promoted loading of DnaB to the unwound oriC region. These findings expand understanding of mechanisms sustaining the robustness of replication initiation and specific roles for PriC in the genome maintenance.
Introduction
Chromosome replication is strictly regulated to ensure successful duplication of the genetic material (Costa and Diffley, 2022; Grimwade and Leonard, 2021; Kasho et al., 2023). In Escherichia coli, the ATP-bound form of the replication initiator protein DnaA (ATP-DnaA) forms a higher-order complex with DNA-bending protein IHF at the unique chromosomal origin oriC. This complex promotes local unwinding of oriC and recruits a pair of DnaB helicases, which are successively loaded to the single-stranded (ss) DNA regions in a bidirectional manner with the aid of DnaC helicase loader. ssDNA-loaded DnaB interacts with DnaG primase and DNA polymerase III holoenzyme, resulting in assembly of the replisome (Arias-Palomo et al., 2019; Chodavarapu and Kaguni, 2016; Hayashi et al., 2020; O’Donnell et al., 2013; Sakiyama et al., 2017; Sakiyama et al., 2018; Sakiyama et al., 2022; Wegrzyn and Konieczny, 2023). Replisomes disassemble when the replication fork stalls in front of an obstacle, such as protein-DNA roadblock or single-strand breaks. PriA recognizes the abandoned fork structure, which triggers reloading of DnaB with its partner proteins, such as PriB, PriC, DnaT, and DnaC (Heller and Marians, 2005a; Masai et al., 1994; Michel and Sandler, 2017; Windgassen et al., 2018). In addition, independently of PriA, PriC binds to the abandoned fork structure, triggering reloading of DnaB with the aid of DnaC, which is supported by Rep helicase depending on the fork structure (Heller and Marians, 2005b; Sandler et al., 1999). Also, homologous recombination mechanisms can rescue the abandoned replication fork during SOS responses (Asai and Kogoma, 1994; Kogoma, 1997; Michel et al., 2001). In contrast to these well-characterized mechanisms at abandoned forks, little is known about what happens when replication initiation is impeded at oriC.
E. coli oriC comprises a Duplex-Unwinding Element (DUE) and a DnaA-Oligomerization Region (DOR) (Figure 1A; Grimwade and Leonard, 2021; Kasho et al., 2023; Wegrzyn and Konieczny, 2023). The DUE contains 13-mer AT-rich sequence repeats known as L-, M-, and R-DUEs. The M- and R-DUEs are essential for stable DUE unwinding with the specific sequences (TT[A/G]T(T)) used for DnaA-ssDNA binding (Ozaki and Katayama, 2012; Sakiyama et al., 2017). The L-DUE containing the TTATT sequence promotes efficient DnaB loading by expanding the unwound oriC region (Sakiyama et al., 2022). The DOR is divided into three subregions: the Left-, Middle-, and Right-DORs, which contain asymmetric 9-mer DnaA binding sequences (DnaA box) with the consensus sequence TTA[T/A]NCACA (Figure 1A; Noguchi et al., 2015; Ozaki and Katayama, 2012; Rozgaja et al., 2011; Sakiyama et al., 2017; Shimizu et al., 2016). The Left-DOR contains a cluster of unidirectionally aligned DnaA boxes, including high-affinity DnaA box R1, and low-affinity boxes R5M, τ1–2, and I1-2, with an IHF-binding region between R1 and R5M boxes. The Right-DOR contains an oppositely oriented DnaA box cluster including high-affinity DnaA box R4 and low-affinity boxes I3 and C1-3. These DnaA box clusters form frameworks for the Left- and Right-DnaA subcomplexes, respectively. DnaA bound to the R2 box, which solely resides in the Middle-DOR, stabilizes these DnaA subcomplexes (Miller et al., 2009; Rozgaja et al., 2011; Shimizu et al., 2016). In addition, the AT-cluster (TATTAAAAAGAA) region, which connects to the L-DUE, stimulates DnaB loading in the absence of the Right-DnaA subcomplex (Sakiyama et al., 2022).
Schematic structures of oriC and DnaA and the replication initiation mechanism.
(A) Overall structure of oriC with the AT-rich cluster. oriC (245 bp) includes the Duplex-Unwinding Element (DUE, purple bar) and the DnaA-Oligomerization Region (DOR, gray bar). DUE is composed of three AT-rich 13-mer repeats termed L, M, and R. Dark purple boxes indicate the specific sequences involved in DnaA-ssDNA binding (TT[A/G]T(T)). The AT-cluster (purple dots) flanking the DUE outside oriC is a supplementary unwinding region. The DnaA-oligomerization region (DOR) contains 12 DnaA boxes (filled and open arrowheads representing sites with the full consensus TTA[A/T]NCACA sequence and sites with mismatches, respectively) and an IHF-binding region (IBR, green box). The DOR is subdivided into Left, Middle, and Right subregions. (B) Domains of DnaA. Domains I-IV are shown schematically, with amino acid residue numbers shown in each bracket. H/B motifs (V211 and R245, squares) and Arginine finger (R285, triangle) are indicated. The major functions of each domain are described on the right side of the structure. (C) DUE unwinding by the ssDUE recruitment mechanism. DnaA and IHF are indicated by red and green diagrams, respectively. When ATP-DnaA oligomerizes, DUE is unwound unstably by thermal motion and torsional stress. The M/R region of the DUE-upper strand (purple line) binds to R1-DnaA and R5M-DnaA via IHF-induced DNA bending, resulting in stable DUE unwinding. In addition to M/R-DUE, L-DUE is moderately unwound and interacts with the Right-DnaA subcomplex. (D) Mechanism for DnaB loading. Each Left-DnaA and Right-DnaA subcomplex binds to a DnaB hexamer (blue ovals) complexed with DnaC (yellow circles). (E) PriC-dependent fork rescue pathways. PriC (vivid red circle) promotes DnaB reloading to the abandoned fork, which exposes ssDNA regions. PriC binds to ssDNA at the replication fork, which remodels the single-stranded DNA binding protein (SSB)-ssDNA complex (for simplicity, SSB is omitted) for DnaC-dependent reloading of DnaB (upper panel). If the ssDNA region is accompanied with a nascent lagging strand, Rep helicase (green shape) is recruited by PriC and unwinds the lagging strand to expose the ssDNA region for DnaB loading (the lower case).
DnaA comprises four functional domains (Figure 1B). Domain I binds to multiple proteins such as DnaB helicases and the DnaA-assembly stimulator DiaA (Abe et al., 2007; Hayashi et al., 2020; Keyamura et al., 2007; Keyamura et al., 2009). Domain II is a flexible linker (Abe et al., 2007; Nozaki and Ogawa, 2008). Domain III contains AAA+ (ATPases Associated with various cellular Activities) motifs, which are involved in tight ATP/ADP binding, ATP hydrolysis, and domain III-III interactions (Duderstadt et al., 2011; Erzberger et al., 2006; Felczak and Kaguni, 2004; Kawakami et al., 2005; Ozaki et al., 2012). The arginine finger motif (Arg285) in domain III interacts with ATP bound to domain III of adjacent DnaA protomers, stimulating DnaA complex formation in a cooperative manner (Kawakami et al., 2005; Noguchi et al., 2015). In addition, H/B motifs (Val211 and Arg245) in this domain bind to ssDNA in a sequence-specific manner (Ozaki et al., 2008; Sakiyama et al., 2017). Domain IV, which comprises the helix-turn-helix motif, recognizes the DnaA box (Fujikawa et al., 2003).
For replication initiation, ATP-DnaA molecules cooperatively oligomerize at oriC to form the Left- and Right-DnaA subcomplexes (Figure 1C). Formation of these complexes is stimulated by homotetrameric DiaA protein, which binds up to four DnaA molecules via domain I, including Phe46 (Keyamura et al., 2007; Keyamura et al., 2009). In concert with DNA superhelicity and thermal energy, the DUE undergoes initial unstable unwinding, which is stabilized through specific interaction between H/B motifs of domain III in the Left-DnaA subcomplex and the upper strand of M- and R-DUEs. This interaction is facilitated by sharp DNA bending by IHF, resulting in stable DUE unwinding (Figure 1C; Ozaki et al., 2008; Sakiyama et al., 2017). When the single-stranded region is expanded to the L-DUE, the resultant single-stranded L-DUE binds the H/B motifs within the Right-DnaA subcomplex, maximizing the efficiency of the DnaB loading process (Sakiyama et al., 2022).
Subsequently, two DnaB helicases are loaded onto each ssDUE strand through interactions with DnaC and DnaA (Figure 1D). DnaC binding to DnaB changes the closed ring structure of the DnaB hexamer to an open spiral form to allow it to encircle ssDNA (Arias-Palomo et al., 2019; Nagata et al., 2020). Each Left- and Right-DnaA subcomplex binds a DnaB-DnaC complex via high-affinity interaction between DnaA Phe46 and DnaB Leu160 and guides the DnaB-DnaC complexes to unwound ssDUE strands via a low-affinity interaction between DnaA domain III His136 and DnaB (Figure 1B and D). Upon interaction with ssDNA, DnaC dissociates from DnaB, which enables migration of DnaB hexamer with helicase action. The pair of DnaB helicases loaded onto the ssDNA strands progress in opposite directions, forming replisomes with DnaG and Pol III holoenzyme (Chodavarapu and Kaguni, 2016; O’Donnell et al., 2013).
Replication restart pathways ensure fork progression of the entire chromosome under conditions that trigger replisome disassembly (Heller and Marians, 2005a; Lopper et al., 2007; Michel and Sandler, 2017). PriA helicase-dependent pathways predominantly facilitate DnaB reloading onto abandoned forks in vivo (Flores et al., 2002). PriA is a 3’–5’ DNA helicase and has a specific affinity for forked DNA structures comprising one parental dsDNA and two newly synthesized sister dsDNA strands. This permits PriA recognition of the abandoned replication fork and the subsequent unwinding of the nascent lagging strand (Duckworth et al., 2023; Windgassen et al., 2018; Windgassen and Keck, 2016). The resultant unwound ssDNA associates with PriB and DnaT to promote reloading of DnaB helicase with the aid of DnaC (Duckworth et al., 2023; Heller and Marians, 2005a; Lopper et al., 2007). In the absence of PriB, PriC participates in a PriA-dependent pathway (Sandler et al., 1999). In addition, PriA is required for oriC/DnaA-independent chromosomal replication called stable DNA replication (SDR) (Masai et al., 1994), which is promoted by UV irradiation (inducible iSDR) and loss of rnhA or recG (constitutive cSDR) (Kogoma, 1997). In both mechanisms, replication is initiated at triple-stranded structures comprising a dsDNA-ssDNA hybrid (D-loop) or a dsDNA-ssRNA hybrid (R-loop) generated at specific chromosomal loci. These structures mimic the abandoned fork structure, thereby allowing helicase loading to occur similarly to that during PriA-dependent fork restart (Masai et al., 1994).
Independently of PriA, PriC can restart replication from abandoned forks through its interaction with the ssDNA region and SSB (Single-Stranded DNA Binding protein) (Figure 1E; Heller and Marians, 2005a; Wessel et al., 2013; Wessel et al., 2016). PriC consists of N-terminal and C-terminal domains, which are composed of α helices and are connected by a short linker. The PriC C-terminal domain remodels the SSB-ssDNA complex, which is a prerequisite for the recruitment of DnaB helicase (Heller and Marians, 2005a; Wessel et al., 2013; Wessel et al., 2016). PriC also interacts with Rep helicase. When the length of the ssDNA gap within the abandoned fork is short, Rep helps expand the ssDNA gap, promoting PriC-mediated remodeling of the SSB-ssDNA complex (Heller and Marians, 2005a; Heller and Marians, 2005b; Nguyen et al., 2021). Notably, in addition to these functions at the abandoned forks, PriC is suggested to play a role in DnaA-oriC-dependent replication initiation under challenging conditions, as evidenced by the synthetic lethality between priC303::kan and a subgroup of temperature-sensitive dnaA mutant alleles (dnaA46 and dnaA508): i.e., priC303::kan mutants bearing dnaA46 or dnaA508, but not wild-type (WT) dnaA, can not grow even at 30 °C (Hinds and Sandler, 2004). However, the mechanisms via which PriC rescues blocked replication initiation remain elusive.
In this study, we analyzed the PriC-dependent promotion of replication initiation from oriC in the context of various replication initiation stresses. We found that PriC stimulated replication initiation in dnaC2 cells, in which DnaB helicase loading at oriC is defective, indicating that it has a role in the rescue of blocked replication initiation. Moreover, PriC stimulated the growth of cells defective in DnaA-DnaB interactions in addition to the growth of cells with oriC sequence deletions that inhibit DnaB loading. Consistent with these results, in an in vitro reconstituted system, PriC stimulated DnaB loading when the DnaA-DnaB interaction was inhibited at oriC. Furthermore, we found that PriC did not stimulate initiation of cSDR, demonstrating that PriC functions specifically in the DnaA-oriC system. Taken together, we suggest that PriC rescues blocks in replication initiation by bypassing DnaB loading at oriC-DnaA complexes.
Results
PriC stimulates DNA replication initiation in dnaA46 and dnaC2 cells
The temperature-sensitive dnaA46 and dnaA508 mutants exhibit synthetic lethality with priC303::kan even at 30 °C (Hinds and Sandler, 2004), suggesting that PriC can rescue blocks in DnaA-dependent replication initiation. However, the mechanism underlying PriC-promoted rescue of blocks in replication initiation remains a mystery. Based on previous reports demonstrating PriC binding to short oligo-ssDNA, SSB, and DnaB and its role in DnaB loading at stalled replication forks (Wessel et al., 2013; Wessel et al., 2016), we considered the possibility that PriC permits bypass of DnaA-dependent stable DUE unwinding and/or DnaB loading at the oriC ssDUE. To genetically test these ideas, we analyzed the impact of PriC on the growth of a temperature-sensitive dnaC2 mutant, which is competent for ongoing replisome progression at 37–42°C, but defective in DnaB loading specifically at the oriC ssDUE (Withers and Bernander, 1998).
In spotting assays performed using serial dilutions of the cell cultures and LB agar plates, the cell growth of dnaA46 cells was slightly inhibited at 37℃ (Figure 2A). Consistent with the previous report, when crossed with the ∆priC allele, the cell growth of dnaA46 cells but not WT dnaA cells was severely inhibited at 37℃ (Figure 2A). Unlike the dnaA46 priC303::kan cells, the dnaA46 ∆priC cells grew at 30 °C without prominent inhibition (Figure 2A). This difference may stem from the different strain backgrounds. Notably, the cell growth of dnaC2 mutant at 35℃ was moderately inhibited, whereas it was severely inhibited in dnaC2 ∆priC double mutant (Figure 2A). Also, the cell growth of dnaC2 cells and dnaC2 ∆priC cells was similar at 30 °C. The observed requirement of PriC for cell growth of dnaC2 cells at 35℃ supports the idea that PriC assists in the DnaC-dependent DnaB loading step at oriC.
Requirement of priC for DNA replication initiation in dnaA46 and dnaC2 strains.
(A) Cell growth abilities. MG1655 and its derivatives MIT125 (MG1655 dnaA46 tnaA::Tn10), KYA018 (MG1655 dnaC2 zjj18::cat), KRC002 (MG1655 ∆priC::frt-kan), KRC004 (MG1655 dnaA46 tnaA::Tn10 ∆priC::frt-kan), and KRC005 (MG1655 dnaC2 zjj18::cat ∆priC::frt-kan) were grown overnight. 10-fold-serial dilutions of the overnight cultures (~109 cells/mL) were incubated for 16 hr at 30℃, or for 14 hr at 35/37/42℃ on LB agar medium. Three independent experiments were performed. +, WT priC; -, ∆priC::frt-kan. The images of representative plates are shown. (B) DNA replication initiation in synchronized dnaA46 cells with or without priC. Exponentially growing MIT125 (MG1655 dnaA46 tnaA::Tn10) (+) and KRC004 (MG1655 dnaA46 tnaA::Tn10 ∆priC::frt-kan) (-) cells were synchronized to the pre-initiation stage by incubation for 90 min at 42℃ in LB medium, followed by incubation for 5 min at 30℃ to initiate DNA replication, which was further followed by incubation with rifampicin and cephalexin for 4 hr at 42℃ to allow run-out of ongoing DNA replication. Samples were withdrawn after synchronization and run-out replication. The DNA contents of these samples were measured by flow cytometry. Representative histograms of three independent experiments are shown. For each sample, the mean number of cells with more than one chromosome equivalent after a 5 min release was quantified and is shown as a percentage with standard deviations. (C) DNA replication initiation in synchronized dnaC2 cells with or without priC. Exponentially growing KYA018 (MG1655 dnaC2 zjj18::cat) (+) and KRC005 (MG1655 dnaC2 zjj18::cat ∆priC::frt-kan) (-) cells were synchronized to the pre-initiation stage by incubation for 80 min at 37℃ in LB medium, followed by incubation for 5 min at 30℃ and further incubation with rifampicin and cephalexin as described above. Samples were withdrawn and analyzed as described above.
Introduction of a priC-encoded plasmid (pBRpriC), but not an empty vector (pBR322), restored the cell growth of dnaA46 ∆priC double mutant at 37℃ (Figure 2—figure supplement 1A, B) and that of dnaC2 ∆priC double mutant at 35℃. Also, introduction of pBRpriC to dnaA46 and dnaC2 mutants with intact priC (priC+) might only slightly enhance the cell growth at these temperatures (Figure 2—figure supplement 1A, B), suggesting that the intrinsic level of PriC is functionally nearly sufficient.
To investigate replication initiation from oriC, we used flow cytometry of synchronized cells bearing dnaA46 or dnaC2 with or without ∆priC. In these experiments, cells were incubated at 42 °C or 37 °C for 80–90 min to synchronize the replication cycle at the pre-initiation step, after which incubation was continued at 30 °C for 5 min to allow initiation and then 4 hr in the presence of rifampicin and cephalexin to inhibit both replication initiation and cell division and allow replication run-out of the whole chromosome. The resultant number of chromosomes per cell, measured by flow cytometry, is known to correspond to the number of oriC copies per cell at the time of drug addition, an indicator of initiation activity.
A majority of the synchronized dnaA46 and dnaC2 cells had only a single oriC copy per cell after incubation at 42 °C or 37 °C, regardless of the presence of ∆priC (Figure 2B and C). In cells with intact priC (priC+), after release of initiation at 30 °C for 5 min, most cells had two oriC copies. However, in dnaA46 ∆priC cells, only about half of the cells had two oriC copies after the release (Figure 2B), indicating moderate inhibition of initiation. In dnaC2 ∆priC cells, the number of two-oriC cells was slightly lower than that of dnaC2 cells (Figure 2C). These observations are consistent with the cell growth ability (Figure 2A) and with our hypothesis that PriC contributes to the rescue of blocked replication initiation by assisting DnaB loading onto the oriC ssDNA.
We further performed flow cytometry analysis to assess the role of PriC in replication initiation of the WT dnaA/dnaC cells. To estimate the number of oriC copies per unit cell mass (ori/mass) as a proxy for initiation activity (Sakiyama et al., 2017; Sakiyama et al., 2022), exponentially growing cells were subjected to run-out replication in the presence of rifampicin and cefalexin (Figure 2—figure supplement 2). When cells were grown in LB medium at 25 °C, 30 °C, or 42 °C, the ori/mass values for ∆priC mutant were comparable to those of priC+. Similar results were observed in cells grown in M9 minimal medium at 30 °C. However, when grown in M9 minimal medium at 37 °C, ∆priC mutant cells exhibited slightly reduced ori/mass values. Also, it is noteworthy that in all conditions we tested, the fraction of cells with non-2n oriC copies was slightly higher in ∆priC cells compared to priC+. The asynchronous initiations would be caused by partial inhibition of initiation of multiple origins in ∆priC cells, as representatively seen for the case of ∆priC cells growing in M9 minimal medium at 37 °C where four-oriC cells reduced and three-oriC cells increased, compared to priC+ cells. A similar case might be shown for ∆priC cells growing in LB medium at 25 °C in that eight-oriC cells reduced and asynchronous initiations (A.I. %) as well as four-oriC cells increased. As such, inhibition of replication initiation would occur intrinsically at low frequency in the WT dnaA/dnaC background. PriC function would be effective to suppress the inhibition, thereby ensuring replication initiation of multiple origins.
PriC rescues the cell growth of DnaA mutants defective in DnaB interactions
DnaA contains two regions for interactions with DnaB during DnaB loading at oriC ssDNA: one is a high-affinity region in domain I containing Phe46, and the other is a low-affinity region in domain III containing His136. To analyze the mechanism of PriC-promoted DnaB loading at oriC, we introduced a series of pING1 vector-based plasmids encoding WT DnaA (pKA234) or the DnaA F46A H136A double mutant (pFH) into dnaA46 cells with or without priC. Growth of dnaA46 cells containing pING1 was inhibited at 42℃, but the leaky expression of dnaA from pKA234 enabled the growth of these cells, as previously reported (Sakiyama et al., 2018; Figure 3). Introduction of pFH moderately supported the cell growth of dnaA46 cells at 42℃. By contrast, dnaA46 ∆priC cells carrying pFH exhibited little growth at 42℃ (Figure 3).
Role of PriC in growth of DnaA mutant defective in interactions with DnaB.
Cell growth of MIT125 (MG1655 dnaA46 tnaA::Tn10) and KRC004 (MG1655 dnaA46 tnaA::Tn10 ∆priC::frt-kan) cells bearing pING1 plasmid vector (-) or its derivatives pKA234 expressing wild-type (WT) DnaA (WT) or pFH expressing DnaA F46A H136A (F46A H136A). Cells were grown at 30 °C overnight and 10-fold serial dilutions of the cultures (~109 cells/mL) were incubated on LB agar plates containing ampicillin for 16 hr at 30 °C and for 14 hr at 42 °C, respectively. Four independent experiments were performed. +, WT priC; -, ∆priC::frt-kan.
Western blotting analysis supported that the expression levels of WT DnaA and DnaA F46A H136A proteins in dnaA46 cells bearing pKA234 or pFH were comparable, regardless of the presence or absence of priC+ (Figure 3—figure supplement 1). As DnaA46 is unstable and thermolabile (Shimuta et al., 2004), these cells were grown at 30 °C, and were incubated at 42 °C for 90 min before Western blotting analysis. The DnaA level in dnaA46 cells bearing the vector pING1 plasmid was minimum.
These results suggest that PriC is crucial for the growth of cells defective in specific DnaA-DnaB interactions, possibly because it can bypass the DnaA-DnaB interaction step required for DnaB loading onto oriC ssDNA.
PriC rescues DNA replication inhibition by DiaA overexpression in vivo
DiaA, a homotetrameric protein, binds to multiple DnaA molecules and stimulates DnaA multimer assembly at oriC (Keyamura et al., 2007). The Phe46 residue in DnaA domain I is part of the DiaA-binding site and DnaB binding site. Oversupply of DiaA inhibits timely initiation of replication in cells growing in tryptone medium at 30 °C, probably because of binding competition between DiaA and DnaB for DnaA domain I (Ishida et al., 2004; Keyamura et al., 2009). If PriC can bypass the DnaA-DnaB interaction requirement for DnaB loading onto oriC, PriC should suppress inhibition of initiation by DiaA oversupply. To test this possibility, we introduced pBR322 or its derivative encoding diaA (pNA135) into cells with or without priC (Figure 4). priC+ carrying pBR322 or pNA135 similarly grew on LB agar plates containing ampicillin between 25°C and 42°C (Figure 4A, Figure 4—figure supplement 1). However, cell growth of ΔpriC cells carrying pNA135, but not pBR322, was moderately inhibited at 25 °C (Figure 4A), supporting our conjecture that PriC can bypass the requirement for the DnaA-DnaB interaction.
PriC stimulation of DNA replication initiation inhibited by DiaA oversupply.
(A) Cell growth of MG1655, KRC002 (MG1655 ∆priC::frt-kan), and FF001 (MG1655 ∆rep::frt-kan) cells bearing pBR322 or pNA135 (pBR322 derivatives carrying diaA). Overnight cultures (~109 cells/mL) of MG1655 and KRC002 cells bearing pBR322 or pNA135 were 10-fold serially diluted and incubated on LB agar plates containing ampicillin for 40 hr at 25℃. The results of three independent experiments were consistent, and one which is shown. (B) Flow cytometry analyses of MG1655 and KRC002 (MG1655 ∆priC::frt-kan) cells bearing pBR322 or pNA135. Cells were exponentially grown at 30℃ in LB medium with ampicillin, followed by further incubation with rifampicin and cephalexin to allow run-out of chromosomal DNA replication. DNA contents were quantified by flow cytometry, and cell size (mass) at the time of drug addition was measured by a Coulter counter. Mean mass, ori/mass ratio, doubling time (Td), and asynchrony index (A.I.: the percentage of cell numbers with non-2n copies of oriC per the cell numbers with 2n copies of oriC) of each strain are indicated at the top right of each panel with standard deviations. Three to four independent experiments were performed. +, WT priC; -, ∆priC::frt-kan. (C) Flow cytometry analyses of MG1655, KRC003 (MG1655 ∆priC::frt), SA103 (MG1655 ∆diaA::frt-kan), and KRC006 (MG1655 ∆priC::frt, ∆diaA::frt-kan) cells. Cells were grown and analyzed as described above. Three independent experiments were performed. For ‘priC’ column, +, WT priC; -, ∆priC::frt. For ‘diaA’ column, +, WT diaA; -, ∆diaA::frt-kan.
Rep helicase stimulates PriC-mediated rescue of arrested replication forks containing nascent strands (Heller and Marians, 2005b; Heller and Marians, 2005a; Sandler, 2000). To test the contribution of Rep helicase to PriC-promoted rescue of blocked replication initiation, we introduced pBR322 or pNA135 into ∆rep cells. Unlike ∆priC cells, ∆rep cells carrying pNA135 grew similarly to ∆rep cells carrying pBR322 (Figure 4A), suggesting no involvement of Rep in the PriC-promoted rescue of blocked replication initiation. This is consistent with the features of unwound oriC, which has a fork structure similar to that of the replication fork but without nascent strands, and the specific role of Rep in rescuing abandoned replication forks with nascent strands in the PriC-dependent pathway. Rep is specifically required for the unwinding of the nascent leading strand of abandoned replication forks, which is needed to expand the ssDNA region required for entry of PriC (Heller and Marians, 2005b; Heller and Marians, 2005a).
We further analyzed replication initiation in ∆priC cells carrying pNA135 at 30 °C by flow cytometry (Figure 4B). Under these conditions, priC+ bearing pBR322 mainly had eight or four oriC copies per cell with eight-oriC cells predominating (Figure 4B). The number of oriC copies per cell was similar to that in priC+-bearing pNA135, with only slight increase in asynchronous initiation, as shown by the slight increase in the number of cells with non-2n oriC copies, which is basically consistent with our previous data (Ishida et al., 2004). However, in ∆priC cells bearing pNA135, severe inhibition of initiation occurred, as shown by the substantial decrease in the number of eight-oriC cells and the large increase in the number of cells with only one to three oriC copies (Figure 4B). This result supports the proposed function of PriC at oriC mentioned above.
To test whether PriC rescues replication initiation inhibited by deletion of the diaA gene, we conducted similar flow cytometry analysis of ∆priC, ∆diaA, and ∆priC ∆diaA cells (Figure 4C). ∆diaA cells showed severe asynchrony of replication initiation, as shown by the increase in the number of five-to-seven-oriC cells, which supports the stimulatory role of DiaA in DnaA-oriC complex formation (Figure 4C). However, ∆priC ∆diaA cells did not show more asynchronization of replication initiation than ∆diaA cells, as shown by the similar asynchrony index (A.I.). These results suggest that PriC does not support or bypass DnaA-oriC complex formation.
PriC stimulates replication initiation in cells with oriC sequence truncations
Right DnaA-subcomplex plays a stimulatory role in DnaB helicase loading (Sakiyama et al., 2022; Stepankiw et al., 2009). The loading of two DnaB hexamers at oriC ssDNA regions requires multiple steps that depend on the distinct functions of two DnaA subcomplexes (Figure 1): the Left-DnaA subcomplex stably unwinds M-R regions of the DUE and the Right-DnaA subcomplex expands the unwound region to the AT-L region, supporting efficient DnaB helicase loading (Sakiyama et al., 2017; Sakiyama et al., 2022; Yoshida et al., 2023). The expanded ssDNA regions in this open oriC complex efficiently promote the loading of one DnaB hexamer onto the lower (A-rich) strand M-R region and a second DnaB hexamer onto the upper (T-rich) strand of the DUE (Fang et al., 1999; Sakiyama et al., 2022). In the absence of the Right-DnaA subcomplex, the AT region of the AT-L region assists in DnaB loading (Sakiyama et al., 2022).
To determine whether PriC rescues defects in DnaB loading when the oriC sequence is altered to prevent Right-DnaA subcomplex formation, we first assessed the cell growth of cells lacking the Middle- and Right-DOR of oriC (Left-oriC) (Figure 5A). The Left-oriC mutant formed colonies at 37 °C but showed severe growth defects at 25°C and 30°C (Figure 5B). At 37 °C, thermal energy might be sufficient to expand DUE unwinding into the AT region and allow DnaB loading in the absence of the Right-DnaA subcomplex (Sakiyama et al., 2022), but not at 25 °C or 30 °C. By contrast, the cell growth of the Left-oriC ∆priC double mutant was markedly compromised at 37 °C and moderately reduced at 25°C and 30°C (Figure 5B). These findings support the idea that PriC functions to rescue defective processes in DnaB loading caused by deletions of the oriC sequence that prevent DnaA subcomplex formation.
Stimulation of replication initiation by PriC in Right-DnaA subcomplex-defective cells.
(A) Schematic structure of Left-oriC and R4Tma oriC. AT-rich region, Duplex-Unwinding Element (DUE), and DnaA-Oligomerization Region (DOR) are indicated by a gray dotted box, a gray box, and an open box, respectively. Filled and open arrowheads in the DOR show DnaA boxes with the full consensus sequence or mismatches. In addition, a striped box indicates the IBR. The regions of each mutant oriC are indicated below the structure as open boxes. The position of the TmaDnaA box substitution is indicated by a yellow arrowhead. (B) Cell growth of WT oriC and Left-oriC cells with or without priC. Overnight cultures (~109 cells/mL) of NY20-frt (WT oriC; WT) and NY20L-frt (Left-oriC; Left) cells with (+) or without (-) priC were 10-fold serially diluted and incubated on LB agar plates for 24 hr at 25 °C, for 16 hr at 30 °C, and for 14 hr at 37 °C. +, WT priC; -, ∆priC::frt-kan. Three independent experiments were performed. (C) Cell growth of WT oriC and oriC R4-box mutant cells with or without priC. NY20-frt (WT oriC) and NY24-frt (oriC with R4Tma substitution, R4Tma) cells with (+) or without (-) priC were grown as described in panel A. +, WT priC; -, ∆priC::frt-kan. Four independent experiments were performed. (D) Flow cytometry analyses of WT and R4Tma cells with or without priC. Cells were exponentially grown at 30℃ in LB medium with ampicillin and analyzed as described in Figure 4. Representative histograms from four independent experiments are shown. Mean mass, ori/mass, and Td of each strain are indicated at the top right of each panel with standard deviations.
Next, similar experiments were performed using a mutant in which the R4 DnaA box within Right-DOR was substituted with a sequence (R4Tma) defective in binding of E. coli DnaA (Figure 5A and C; Noguchi et al., 2015; Sakiyama et al., 2022). We reasoned that formation of the Right-DnaA subcomplex would be inhibited by the introduction of R4Tma and PriC would be required for robust initiation in this context. As the Left-oriC strain, the priC+ R4 Tma strain showed normal cell growth. By contrast, cell growth of the R4Tma ΔpriC double mutant was impaired moderately at 25 °C and slightly at 30 °C (Figure 5C), indicating that PriC can rescue the blocked replication initiation caused by the absence of the R4 box. The reduced cell growth of R4Tma ∆priC strain was alleviated at higher temperatures, similar to the phenotype of the Left-oriC mutant.
Furthermore, we assessed replication initiation in R4Tma cells at 30 °C using flow cytometry (Figure 5D). R4Tma cells grew slightly slower than WT oriC cells and showed clear inhibition of initiation; in contrast to the WT oriC strain, the R4Tma mutant cell population contained more four-oriC cells and fewer eight-oriC cells, and showed severe asynchronous initiation. Notably, these negative effects of the R4Tma mutation were amplified by deletion of priC, i.e., the number of one to three-oriC cells increased and the ori/mass ratio was further reduced.
We next analyzed the role of PriC in cells lacking the AT-L region of oriC (subATL oriC) (Figure 6A). L-DUE and the flanking AT region assist in DnaB helicase loading by stimulating oriC unwinding, which is essential in a strain defective in Right-DnaA subcomplex formation (Sakiyama et al., 2022). SubATL oriC cells and WT oriC cells grew similarly on LB agar plates between 25°C and 37°C, regardless of the presence of ∆priC (Figure 6B). However, flow cytometry analysis revealed that deletion of priC specifically inhibited initiation in subATL oriC cells (Figure 6C); the number of eight-oriC cells was lower while the number of four-to-seven oriC cells was higher in subATL oriC ∆priC cells than in priC+ oriC cells. Taken together, these results are consistent with the idea that PriC restores initiation and DnaB loading at such truncated oriC sequences.
Stimulation of replication initiation by PriC in cells with a deletion in the ssDNA-expanding region of oriC.
(A) Schematic structure of subATL oriC as shown in Figure 5. The oriC region, including the subATL oriC is indicated below the structure as a white box. (B) Cell growth of wild-type (WT) oriC and oriC subATL mutant cells with or without WT priC. NY20-frt (WT oriC) and NY20ATL-frt (oriC lacking AT and L sequences, subATL) with (+) or without (-) WT priC were grown as described in Figure 5. +, WT priC; -, ∆priC::frt-kan. Three independent experiments were performed. (C) Flow cytometry analyses of WT oriC and oriC subATL mutant cells with or without WT priC. Cells were exponentially grown at 30℃ in LB medium and analyzed as described in Figure 4. Representative histograms from three independent experiments are shown. Mean mass, ori/mass, and Td of each strain are indicated at the top right of each panel with standard deviations.
PriC loads DnaB at oriC unwound by the DnaA complex in an in vitro reconstituted system
To analyze the mechanism of PriC rescue of blocked initiation at oriC, we assessed PriC activity in an in vitro reconstituted system for DnaB loading and DnaB-promoted DNA unwinding using the supercoiled circular form (form I) of the oriC plasmid pBSoriC and purified proteins, namely DnaA, N-terminally histidine-tagged DnaB (His-DnaB), DnaC, IHF, SSB, and gyrase. In this system, DnaA and IHF unwind the DUE and stimulate His-DnaB loading to the ssDUE region with the aid of DnaC. The loaded His-DnaB expands the ssDNA regions in concert with the ssDNA-binding activities of SSB. Concomitantly, the positive supercoiling generated through DNA unwinding by His-DnaB is resolved by DNA gyrase, resulting in the formation of plasmid DNA topoisomers (form I*). Form I* can be separated from form I by agarose gel electrophoresis (Baker et al., 1986; Sakiyama et al., 2022).
First, we assessed the effect of PriC on WT DnaA. WT DnaA stimulated form I* formation in the absence of PriC (Figure 7A, lanes 1 and 5) and increasing concentrations of PriC moderately inhibited WT DnaA-mediated form I* formation (Figure 7A, lanes 5–8), probably because of competition between DnaA and PriC for binding to DnaB. Next, we focused on the DnaA F46A H136A double mutant. The DnaA F46A and DnaA H136A mutant proteins alone are reported not to support form I* formation (Keyamura et al., 2009; Sakiyama et al., 2018). Consistently, the DnaA F46A H136A double mutant protein was inactive in form I* formation (Figure 7A, lane 9). However, when PriC was added to the assay, DnaA F46A H136A promoted form I* formation to a level comparable to that of WT DnaA in the presence of PriC (Figure 7A, lanes 5–12 and 7B), indicating that PriC rescues defective DnaB loading by DnaA F46A H136A-oriC complexes. These findings are consistent with the idea that PriC can bypass the strict reliance on DnaA-DnaB interactions for DnaB loading at oriC.
DnaB loading onto the ssDUE by PriC.
(A and B) In vitro reconstituted system for DnaB loading. Form I of oriC plasmid (pBSoriC; 1.6 nM) was incubated for 15 min at 30℃ with the indicated amount of PriC in the presence of ATP-DnaA or its mutant derivatives, DnaB, DnaC, IHF, gyrase, and Single-Stranded DNA Binding protein (SSB). The resulting plasmids were purified and analyzed using agarose gel electrophoresis. A representative image of three independent experiments is shown in the black/white-inverted mode (A). In panel A, the size markers of linear dsDNA (M) are also shown. Band intensities of each lane in the gel image were analyzed by densitometric scanning. The percentages of form I* oriC plasmid per input DNA are shown as ‘Form I* (%)’. Mean and standard deviations are shown (B). Abbreviations in panel B: -, no addition of DnaA; WT, wild-type DnaA; FH, DnaA F46A H136A; VA, DnaA V211A. (C and D) In vitro reconstituted system containing DiaA. Form I of pBSoriC plasmid was used as described above except for the addition of the indicated amounts of DiaA. A representative image of three independent experiments is shown in black/white-inverted mode (C). In panel C, the size markers of linear dsDNA (M) are also shown. Band intensities of each lane in the gel image were analyzed by densitometric scanning. The percentages of form I*oriC plasmid together with the mean and standard deviations are shown as described above (D).
-
Figure 7—source data 1
Original gels corresponding to Figure 7, panels A (Upper gel) and C (Lower gel).
Lambda DNA markers were employed. Each lane shown is labeled as that in the main text.
- https://cdn.elifesciences.org/articles/103340/elife-103340-fig7-data1-v1.zip
-
Figure 7—source data 2
Original gel image corresponding to Figure 7A.
- https://cdn.elifesciences.org/articles/103340/elife-103340-fig7-data2-v1.zip
-
Figure 7—source data 3
Original gel image corresponding to Figure 7B.
- https://cdn.elifesciences.org/articles/103340/elife-103340-fig7-data3-v1.zip
To corroborate this idea, we also determined whether PriC rescues blocked initiation resulting from unstable DUE unwinding. oriC complexes containing DnaA V211A cannot bind to the ssDUE and consequently fails in stable DUE unwinding (Ozaki et al., 2008). The DnaA V211A mutant was virtually inactive for form I * formation irrespective of the presence or absence of PriC (Figure 7A, lanes 13–16, and 7B), indicating that PriC cannot efficiently rescue a defect of DUE unwinding.
We further evaluated the DnaB loading activity of PriC in the presence of DiaA using a similar in vitro reconstituted system. Previously, DiaA was shown to stimulate oriC DUE unwinding, but to inhibit form I* formation, because DiaA-DnaA binding competitively inhibits DnaB-DnaA binding; DiaA and DnaB share the same binding site in DnaA domain I (Figure 7C lanes 1, 3, 5, and 7 and 7D) (Keyamura et al., 2009). PriC moderately stimulated form I* formation specifically in the presence of both DnaA and DiaA (Figure 7C lanes 7 and 8, and 7D). These results further support the idea that PriC can bypass the specific requirement for the DnaA-DnaB interaction in DnaB loading at oriC. DiaA bound to oriC-DnaA complexes might be a physical obstacle reducing efficiency of DnaB loading by PriC.
In addition, we analyzed the DUE unwinding activities of DnaA mutants using the in vitro reconstituted system. As previously reported, DnaA V211A is largely inactive in DUE unwinding, but DnaA F46A H136A unwinds the DUE at a level comparable to that of WT DnaA (Figure 7—figure supplement 1A and B). PriC did not stimulate DUE unwinding irrespective of the presence of WT DnaA (Figure 7—figure supplement 1C and D). These results demonstrate the functional specificity of PriC in rescuing failed DnaB loading at oriC ssDNA and are consistent with the PriC mechanism mentioned above.
Role for PriC in cSDR
Finally, to analyze the role of PriC in other types of replication initiation, we examine whether PriC contributes to the initiation of cSDR, which does not require dnaA or oriC and is activated in cells lacking rnhA or recG. Although the PriA-PriB-DnaT primosome complex has previously been reported to be involved in the initiation of cSDR (Heller and Marians, 2006), it is unclear whether PriC has any role in this type of initiation.
Unlike dnaA46 cells, dnaA46 rnhA::cat double mutant cells grew even at 40 °C (Figure 8A), indicating that these cells were engaged in cSDR, as previously reported (Hinds and Sandler, 2004). The cell growth of ∆priC dnaA46 rnhA::cat triple mutant was severely inhibited at 40 °C (Figure 8A), suggesting that PriC contributes to the growth of dnaA46 rnhA::cat mutant cells.
PriC stimulation of constitutive stable DNA replication (cSDR)-dependent cell growth.
(A) Cell growth abilities. Cells of MIT125 (MG1655 dnaA46), MIT125c (MG1655 dnaA46 rnhA::cat), KRC004 (MG1655 dnaA46 ∆priC::frt-kan), and KRC004c (MG1655 dnaA46 ∆priC::frt-kan rnhA::cat) were grown at 30℃ overnight and 10-fold-serial dilutions of the overnight cultures (~109 cells/mL) were incubated for 16 h at 30℃ and for 36 hr at 40℃ on LB agar plates. Three independent experiments were performed. +, WT; -, deletion. (B) oriC and ter copy numbers. MIT125, MIT125c, KRC004, and KRC004c cells growing exponentially at 30℃ were further incubated for 90 min at 40℃ in LB medium. Samples were withdrawn before and after the 40℃ incubation. The genome DNA of each sample was extracted by boiling the cells for 5 min at 95℃. The relative copy numbers of oriC (84.6 min) and ter (32.4 min) to that of ypaB (50.5 min) were quantified using real-time qPCR. The data and averages of three independent experiments are shown with standard deviations.
To determine whether PriC contributes to the initiation of dnaA46-oriC replication or cSDR, we calculated the relative copy numbers of oriC (84.6 min) and ter (32.4 min: corresponding to insQ) using real-time quantitative PCR (qPCR). The ypaB (50.5 min) located at the middle position between oriC and ter was used as a reference. To calculate the copy number of the chromosomal ter region, the preferential initiation site of cSDR (Brochu et al., 2018; Maduike et al., 2014), dnaA46 rnhA::cat cells growing exponentially at 30 °C were shifted to 40 °C for 90 min and the copy number before and after incubation at 40 °C was calculated. Consistent with the cell growth data (Figure 8A), the ter copy number ratio of the dnaA46 rnhA::cat double mutant increased after 40 °C incubation, whereas the copy number ratio of the dnaA46 mutant expressing WT rnhA remained the same (Figure 8B). The ter copy number ratio of the dnaA46 rnhA::cat ∆priC triple mutant strain was also increased, indicating that cSDR could occur even in the absence of PriC.
To monitor initiation of DnaA-oriC replication, we determined the oriC copy number ratio (Figure 8B). At the permissive temperature, despite having similar growth rates, the oriC copy number ratio of the dnaA46 ∆priC double mutant cells was lower than that of the dnaA46 single mutant, confirming the importance of PriC for replication initiation in dnaA46 cells, as shown in Figure 2. In the priC+dnaA46 rnhA::cat mutant cells, the oriC copy number ratio was reduced, which is explained by activation of cSDR and increase in the relative copy number of the reference ypaB locus (50.5 min chromosomal map position). Together, these results suggest the idea that PriC stimulates replication fork progression during cSDR.
To consolidate these findings, we performed the chromosome loci copy-number analysis using whole-genome sequencing. The dnaA46 cells and its derivative cells were grown exponentially at 30 °C, followed by incubation at 40 °C for 90 min prior to DNA extraction. In growing WT cells, the highest copy numbers are observed near the oriC-proximal region and the lowest are near the ter-proximal region, resulting in a coverage bias from oriC to ter (Brochu et al., 2018; Maduike et al., 2014). However, in dnaA46 cells incubated at 40 °C, the coverage bias was largely diminished due to the run-out replication (Figure 8—figure supplement 1A). Notably, dnaA46 rnhA::cat cells incubated at 40 °C exhibited discrete coverage peaks at the preferential initiation sites of cSDR near the ter (or insQ) region with a decreasing coverage bias to oriC. Similar profiles were observed in the ∆priC mutant background, supporting the idea that cSDR can occur even in the absence of PriC (Figure 8—figure supplement 1A). Moreover, in the dnaA46 rnhA::cat background, the absence of priC appeared to decrease the coverage level at genomic positions near the 1.3 MB and 4 MB map positions, which are slightly outside of ter and oriC, respectively (Figure 8—figure supplement 1B). This observation may reflect the role of priC in the replication fork progression.
Discussion
In growing cells, replication initiation can be blocked under challenging conditions. However, the mechanisms that rescue blocked initiations are largely unknown. To elucidate such mechanisms, we investigated PriC-promoted replication initiation under various challenging conditions. We showed that PriC was necessary for the optimal growth of dnaC2 cells at the semi-restrictive temperature and for replication initiation even at the permissive temperature (Figure 2), suggesting that PriC contributes to replication initiation rescue in dnaC2 cells by facilitating DnaB helicase loading at oriC. Furthermore, we observed that PriC was necessary for the optimal growth of cells in which the DnaA-DnaB interaction was inhibited by DiaA overexpression or DnaA F46A H136A double mutations (Figures 3 and 4). In addition, PriC was stimulatory for the cell growth and replication initiation bearing oriC mutations that impair efficient DnaB loading (Figures 5 and 6). These results, together with results of form I* formation assays (Figure 7), suggest that PriC bypasses the need for the DnaA-DnaB interaction by binding to unwound oriC DNA and recruiting DnaB to facilitate its loading onto ssDNA (Figure 9). This mechanism is similar to that proposed for the rescue of abandoned replication forks by PriC (Figure 1E).
Model for PriC-promoted replication initiation.
PriC-promoted rescue of blocked DnaA-oriC-dependent replication initiation. oriC, DnaA, IHF, DnaB, and DnaC are illustrated as depicted in Figure 1C. When tight DnaA binding of DiaA (dark gray circle) (or DnaA F46A H136A double mutations) inhibits DnaB recruitment, PriC (Brilliant red circle) binds to a stably unwound DUE strand, recruiting a DnaB-DnaC complex to lower strand of DUE instead of Left-DnaA subcomplex. When a sufficient ssDNA region is exposed, PriC then recruits the DnaB-DnaC complex to the opposite strand.
Also, PriC contributes to replication initiation rescue in dnaA46 cells at 37 °C. It is presumable that DnaA46 protein becomes partially denatured at the sub-permissive temperature of 37 °C (Hwang and Kaguni, 1988; Carr and Kaguni, 1996). This partial denaturation should impair both origin unwinding and helicase loading, though not to the extent that cell viability is lost. The priC deletion should further exacerbate helicase loading defects by inhibiting the bypass mechanism (Figure 9), resulting in the lethality of dnaA46 cells at this temperature.
There might remain an alternative possibility that PriC could stabilize the DnaA-DnaB interaction for rescuing the impaired DnaB loading process. However, we believe that this possibility is not very likely. Given that interactions between DnaA and DnaB during DnaB loading to oriC are highly dynamic and involve regulated multiple steps, the stabilization of the DnaA-DnaB interaction by PriC, even if it occurs, carries a considerable risk of inhibiting the DnaB loading by constructing abortive complexes. In addition, DnaA-DiaA binding is very tight and stable (Keyamura et al., 2007; Keyamura et al., 2009). Even if WT DnaA and WT DnaB are present, PriC can rescue the initiation defects of oriC mutants. Based on these facts and the known characteristics of PriC, it is more reasonable to infer that PriC provides a bypass of DnaB loading at oriC, similar to the mechanism at the stalled replication fork (Figures 1E and 9).
The finding that PriC failed to stimulate form I* formation in the presence of DnaA V211A, which lacks DUE unwinding activity (Figure 7), provides mechanistic insight into PriC-dependent replication initiation at oriC. We propose that PriC-dependent replication initiation possibly begins with the recognition of a stably unwound ssDNA region by PriC (Figure 9). Consistent with this perspective, PriC ssDNA-binding activity and ssDNA regions have been reported to be important for PriC-promoted replication fork rescue (Heller and Marians, 2006; McMillan and Keck, 2024). The failure of PriC to stimulate replication initiation in ∆diaA cells (Figure 4C) is also potentially explained by the reduced DUE unwinding caused by destabilization of the DnaA-oriC complex in ∆diaA cells. Based on this, we suggest that the stably unwound ssDNA region in oriC serves as a distinctive feature for PriC-promoting DnaB loading at oriC for replication initiation rescue, and distinguishes it from PriA-dependent replication restart, which requires the specific structure of the replication fork DNA consisting of sister dsDNA strands (Heller and Marians, 2005a; Windgassen et al., 2018). Unlike PriA, PriC can interact with the simple ssDNA to reload DnaB (Figure 1E).
In this study, we found that cells with DnaA F46A H136A double mutations grew well, but only when the cells expressed PriC. As for the DnaA F46A single mutant, our previous studies show that DnaA F46A has a limited residual activity in vivo (unlike in vitro), and allows slow growth of cells (Abe et al., 2007). The growth of cells expressing the DnaA H136A single mutant was severely inhibited even when the cells expressed PriC (Sakiyama et al., 2018). The His136 residue is located within the weak, secondary DnaB interaction region in DnaA, and is crucial for DnaB loading onto oriC ssDNA. Although domain I in DnaA H136A can stably tether DnaB-DnaC complexes to DnaA complexes on oriC (Sakiyama et al., 2018), the complexes fail to load DnaB onto oriC ssDNA even in the presence of PriC. It is possible that the interaction between PriC and DnaB is inhibited by stable DnaB binding to DnaA domain I. This idea is consistent with the in vivo feature of DnaA F46A single mutant. Conversely, the PriC-DnaB interaction may inhibit the interaction between DnaA domain I and DnaB, as suggested by the inhibitory effect of PriC on DnaB loading in vitro in the presence of WT DnaA (Figure 7). However, this inhibitory effect of PriC was not observed in vivo, suggesting that PriC-DnaB binding could involve still unknown factors and regulatory mechanisms.
PriC supported cSDR-dependent growth in dnaA46 rnhA::cat double mutant cells without stimulating the initiation of cSDR (Figure 8). In this mutant, cSDR predominantly initiates from the ter region, resulting in head-on collisions between the replisome and transcription complexes in rrn operons (Maduike et al., 2014). This suggests that in cSDR cells, PriC specifically rescues abandoned forks, including those generated during head-on conflicts between the replisome and transcription complexes.
Bacillus subtilis (B. subtilis), which expresses a PriA homolog but not a PriC homolog, employs a PriA-independent fork rescue pathway (Bruand et al., 2001). In this pathway, B. subtilis DnaC (BsuDnaC) helicase is reloaded using the helicase loader DnaI together with B. subtilis DnaB (BsuDnaB) and DnaD coloaders. The ssDNA-binding activity of BsuDnaB has a crucial role in this PriA-independent pathway (Bruand et al., 2005). SsDNA-bound BsuDnaB remodels the SSB-ssDNA complex with DnaD and recruits BsuDnaC. These functions of BsuDnaB are similar to the proposed functions of PriC in replication fork rescue in E. coli. In addition, BsuDnaC helicase is recruited to oriC by concerted actions of B. subtilis DnaA and the DnaD-BsuDnaB complex, which has an essential role in chromosome replication initiation (Jameson and Wilkinson, 2017), suggesting a similar role of BsuDnaB to PriC in E. coli cells expressing DnaA F46A H136A. These similarities between PriC and BsuDnaB in these two evolutionarily distant bacterial species suggest that the mechanism of PriC-promoted helicase loading is conserved among bacterial species despite the absence of sequence conservation of PriC and BsuDnaB homologs.
Based on our results, we propose the abnormal competition between DnaB and DiaA for DnaA domain I could represent a form of intrinsic replication initiation stress in bacteria with conserved DiaA homologs. This type of stress could also occur in ε-proteobacterial species, such as Helicobacter pylori, because they express HobA, a DiaA-functional homolog (Natrajan et al., 2007; Zawilak-Pawlik et al., 2011). Similarly, YfdR, encoded by E. coli prophages, inhibits replication initiation by competing with DnaB for binding to DnaA domain I (Noguchi and Katayama, 2016), suggesting that such extraneously introduced inhibitors could trigger replication initiation stress.
Even in humans, ORC1, ORC2, and ORC5, the essential components of the eukaryotic replication initiation complex, are not essential in some cancer cell lines (Shibata and Dutta, 2020; Shibata et al., 2016), suggesting that mechanisms of replication initiation rescue may also operate beyond the bacterial kingdom. Therefore, further investigation of the initiation rescue processes and the factors involved in diverse organisms from bacteria to human will be important for a full understanding of the common principles and diverse mechanisms that ensure robust initiation of chromosomal DNA replication.
Materials and methods
Plasmids, proteins, and strains
Request a detailed protocolThe plasmids used in this study are listed in key resource table. pKA234, pKW44-1, pNA135, pBSoriC, pET22b(+)-priC, and pTKM601 were described previously (Aramaki et al., 2015; Ishida et al., 2004; Kawakami et al., 2005; Keyamura et al., 2009; Kubota et al., 1997; Ozaki et al., 2008). For the construction of pFH, an alanine substitution was introduced into pH136A with specific mutagenic primer sets using the QuikChange site-directed mutagenesis protocol (Stratagene [Agilent], Agilent, La Jolla, CA, United States) as described previously (Keyamura et al., 2007; Sakiyama et al., 2018).
WT DnaA and its derivative proteins were overproduced in E. coli strain KA450 from pKA234, pKW44-1, or pFH and purified as described previously (Noguchi et al., 2015; Ozaki et al., 2008; Sakiyama et al., 2017).
PriC protein was prepared as previously reported with minor modifications (Aramaki et al., 2013). Briefly, PriC protein was overproduced in E. coli strain BL21-codonPlus-RIL by inducing its expression from pET22b(+)-priC using 0.2 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG). The resulting cells were suspended in chilled buffer A (50 mM HEPES-NaOH [pH7.0], 10% sucrose, 1 mM EDTA, 2 mM dithiothreitol (DTT), and 1 mM PMSF) and disrupted by sonication. Proteins in the soluble fraction were precipitated with 0.24 g/mL ammonium sulfate, resuspended in a separation buffer (50 mM imidazole [pH 7.0], 20% glycerol, 2 mM DTT, 1 mM EDTA, and 40 mM ammonium sulfate) and loaded onto a 1 mL HiTrap SP HP column (Cytiva, Uppsala, Sweden). Bound proteins were eluted with a linear gradient from 0 to 1 M sodium chloride.
All E. coli strains used in this study are listed in key resource table. KYA018, MIT125, MIT162, SA103, NY20, and NY21 were described previously (Kasho and Katayama, 2013; Noguchi et al., 2015; Noguchi and Katayama, 2016). Strains bearing mutant oriC (NY20L and NY20ATL) were constructed using the λRed site-directed recombination system as previously described (Noguchi et al., 2015; Sakiyama et al., 2017; Sakiyama et al., 2022). NY20-frt strain and oriC mutant strains (NY21-frt, NY20L-frt, and NY20ATL-frt) were constructed by eliminating kan from the NY20 strain and strains NY21, NY20L, and NY20ATL. To remove the kanamycin-resistant cassette (kan) from oriC, FLP recombinase encoded on pCP20 was used. Elimination of kan was verified by checking sensitivity to 50 µg/ml kanamycin in LB agar plates. ∆priC::frt-kan from JW0456-KC and ∆rep::frt-kan from JW5604-KC were introduced into MG1655 by P1 transduction, resulting in the construction of KRC002 and FF001, respectively. For construction of other ∆priC::frt-kan strains (KRC004, KRC005, NY20-priC, NY21-priC, NY20L-priC, NY20ATL-priC), P1 phage lysates prepared from KRC002 were used for transduction of strains MIT125, KYA018, NY20-frt, SYM21-frt, NY20L-frt, and NY20ATL-frt. Transductants were screened on LB agar plates containing 50 µg/mL kanamycin. ∆diaA::frt-kan or rnhA::cat derivatives (KRC006, MIT125c, and KRC004c) were constructed using a similar protocol except that P1 phage lysates from SA103 (∆diaA::frt-kan) or MIT162 (rnhA::cat) were used. KRC003 was generated by removal of kan from KRC002.
Buffers
Buffer P contained 60 mM HEPES–KOH (pH 7.6), 0.1 mM zinc acetate, 8 mM magnesium acetate, 30% [v/v] glycerol, and 0.32 mg/mL bovine serum albumin (BSA). Buffer N contained 50 mM HEPES–KOH (pH 7.6), 2.5 mM magnesium acetate, 0.3 mM EDTA, 7 mM DTT, 0.007% [v/v] Triton X-100, and 20% [v/v] glycerol. Form I* buffer contained 20 mM Tris-HCl (pH 7.5), 125 mM potassium glutamate, 10 mM magnesium acetate, 8 mM DTT, and 0.5 mg/mL BSA.
DUE unwinding assay
Request a detailed protocolDUE unwinding assays were performed essentially as described with minor modifications (Sakiyama et al., 2022; Yoshida et al., 2023). Briefly, DnaA was incubated with ATP in buffer N on ice for 3 min to generate ATP-DnaA. The indicated amount of PriC and ATP-DnaA or its mutant derivatives was incubated for 9 min at 30℃ in 10 µL buffer P containing 5 mM ATP, 125 mM potassium glutamate, 1.6 nM pBSoriC, and 42 nM IHF, followed by further incubation with 1.5 units of P1 nuclease (Wako) for 5 min. The reaction was stopped by the addition of 1% SDS and 25 mM EDTA, and DNA was purified by phenol-chloroform extraction and ethanol precipitation. One-third of each purified DNA was digested with AlwNI (NEB), which yielded 2.6 kb and 1.0 kb fragments after DUE unwinding of pBSoriC. The resultant DNA fragments were analyzed by 1% agarose gel electrophoresis with 1x Tris-acetate-EDTA buffer for 30 min at 100 V, followed by ethidium bromide staining. Gel images were taken using the GelDoc GO imaging system (Bio-Rad Laboratories, Hercules, CA), and products derived from unwound plasmids were quantified using ImageJ software.
Form I* assay
Request a detailed protocolThis assay was performed as previously described with minor modifications (Baker et al., 1986; Noguchi et al., 2015; Sakiyama et al., 2022). The indicated amount of ATP-DnaA was incubated for 15 min at 30℃ in 12.5 µL of Form I* buffer containing 3 mM ATP, 1.6 nM pBSoriC, 42 nM IHF, 400 nM His-DnaB, 400 nM DnaC, 76 nM GyrA, 100 nM His-GyrB, and 760 nM SSB. The reaction was stopped by the addition of 0.5% SDS, and DNA was purified by phenol-chloroform extraction. Samples were analyzed by 0.65% agarose gel electrophoresis with 0.5x Tris-borate-EDTA buffer for 15 hr at 23 V, followed by ethidium bromide staining.
Flow cytometry analysis
Request a detailed protocolFlow cytometry analysis was performed essentially as described (Kasho et al., 2014). Briefly, cells were grown at 30℃ in LB medium until the absorbance of the culture (A600) reached 0.1. Portions of the cultures were diluted a thousand-fold into 5 ml LB medium and incubated at 30℃ until the absorbance of the culture (A600) reached 0.1. The remaining portions were further incubated to determine the doubling time (Td) by measuring A600 every 20 min. At A600 0.1, aliquots of the cultures were fixed in 70% ethanol to analyze cell mass using the Multisizer 3 Coulter counter (Beckman Coulter, Brea, CA). The remaining cultures were further incubated for 4 hr with 0.3 mg/mL rifampicin and 0.01 mg/mL cephalexin to allow run-out replication of chromosomal DNA. The resultant cells were fixed in 70% ethanol. After DNA staining with SYTOX Green (Thermo Fisher Scientific, Waltham, MA), cellular DNA contents were analyzed on a FACS Calibur flow cytometer (BD Bioscience, Franklin Lakes, NJ). The number of the origins/cell (ori/cell) was determined from the histograms of flow cytometry analysis. The number of ori/cell was divided by the mean cell mass determined by cell mass analysis, resulting in ori/mass ratios. The numbers of cells containing non-2n copy number of oriC were divided by the number of cells containing 2n copy number of oriC to calculate the asynchrony index (A.I.). For the analysis of cells bearing plasmids, LB medium was supplemented with 100 µg/mL ampicillin.
Replication initiation frequency test using synchronized cultures
Request a detailed protocolMIT125 (dnaA46 tnaA::Tn10) cells or its ∆priC derivative KRC004 were grown at 30℃, a permissive temperature, in LB medium until the absorbance of the culture (A600) reached 0.04, followed by further incubation for 90 min at 42℃, a restrictive temperature. Aliquots of the cultures were fixed in 70% ethanol as ‘Synchronization’ samples. The remaining cultures were further incubated for 5 min to initiate DNA replication, followed by further incubation for 4 hr at 42℃ with 0.3 mg/mL rifampicin and 0.01 mg/mL cephalexin to allow run-out replication of chromosomal DNA. The resultant cells were fixed in 70% ethanol as ‘5 min release’ samples. After DNA staining with SYTOX Green (Life Technologies), cellular DNA contents were analyzed on a FACS Calibur flow cytometer (BD Bioscience). Ratios of the origins/cell (ori/cell) were determined from the histograms of flow cytometry analysis.
For synchronization of dnaC2 mutant cells (KYA018 and KRC005), cells were grown in LB medium at 30℃ until the A600 reached 0.04, followed by further incubation for 80 min at 37℃, at the restrictive temperature. The resulting synchronized cultures were released for 5 min at 30℃ and incubated in the presence of 0.3 mg/mL rifampicin and 0.01 mg/mL cephalexin at 30℃ to allow run-out of chromosomal DNA replication.
qPCR for analysis of cSDR
Request a detailed protocolCells of MIT125 (dnaA46 tnaA::Tn10) cells and MIT125c (dnaA46 tnaA::Tn10 rnhA::cat) or its ∆priC derivative KRC004 (dnaA46 tnaA::Tn10 ∆priC::frt-kan) and KRC004c (dnaA46 tnaA::Tn10 rnhA::cat ∆priC::frt-kan) were grown at 30℃ in LB medium until the absorbance of the culture (A600) reached 0.04 and aliquots of the cultures were withdrawn. The remaining samples were further incubated for 90 min at 40℃ and aliquots of the cultures were withdrawn. These samples were boiled for 5 min at 95℃ and the genome DNA was extracted. The levels of oriC (84.6 min), ter (32.4 min), and ypaB (50.5 min) were quantified by real-time qPCR using TB Green Premix Ex TaqII (Tli RNaseH Plus) (TaKaRa, Shiga, Japan) and the following primers: ORI_1 and KWoriCRev for oriC, qoriK fw, and qoriK rev for ter, STM419, and STM420 for ypaB.
Chromosome loci copy-number analysis by whole-genome sequencing
Request a detailed protocolThe analysis was performed based on a previous paper with modifications (Brochu et al., 2018). Cells of the dnaA46 mutant derivatives MIT125 (dnaA46 tnaA::Tn10), MIT125c (dnaA46 tnaA::Tn10 rnhA::cat), KRC004 (dnaA46 tnaA::Tn10 ∆priC::frt-kan) and KRC004c (dnaA46 tnaA::Tn10 rnhA::cat ∆priC::frt-kan) were grown exponentially at 30℃ in LB medium (50 mL). When the absorbance of the culture (A600) reached 0.04, cells were incubated for 90 min at 40℃ and collected by centrifugation. Cell pellets were dissolved by incubation at 37℃ for 1 hr in TE buffer (0.6 mL) containing 0.5% SDS and 25 µg/ml proteinase K, and were mixed with 0.2 mL of buffer containing 4% cetyltrimethylammonium bromide, followed by further incubation for 10 min at 65℃, phenol-chloroform extraction and isopropanol precipitation. Precipitates were resuspended in Tris (pH7.5) buffer containing 0.1 mg/ml RNase A, followed by incubation for 1 hr at 37℃ and DNA purification by FastGene Gel/PCR Extraction Kit (Nippon Genetics, Tokyo, Japan). The quality control of genomic DNA, library preparation, and whole-genome sequencing were performed by Rhelixa, Inc using NEBNext Ultra II DNA Library Prep Kit and Illumina NovaSeq X Plus. The number of reads (150 bp × two pair-ended) was at least 6.7 M (3.3 M pairs) per sample. The sequence data were analyzed using Galaxy (https://usegalaxy.org) and the coverage plot was generated essentially as described (Ivanova et al., 2015). Briefly, paired-end reads were mapped using the MG1655 reference genome (NC_000913) and the BWA-MEM algorithm, followed by calculation of the number of reads per genome coverage. DNA-sequence data are deposited in the NCBI Sequence Read Archive (Accession number: PRJNA1222470).
Immunoblot analysis
Request a detailed protocolThe assay was performed as described previously with minor modifications (Kawakami et al., 2005; Sakiyama et al., 2017; Yoshida et al., 2023). Briefly, MIT125 (dnaA46 tnaA::Tn10) and KRC004 (dnaA46 tnaA::Tn10 ∆priC::frt-kan) cells bearing pING1, pKA234, or pFH were grown at 30 °C in LB medium including 100 µg/ml ampicillin until the absorbance of the culture (A600) reached 0.05, followed by incubation at 42 °C for 90 min. Cells were harvested by centrifugation and dissolved in SDS sample buffer to adjust the calculated A600 of 0.5. Proteins were separated using SDS-12% polyacrylamide gel electrophoresis and were transferred to polyvinylidene difluoride membranes (Millipore) using a semi-dry blotting method (Bio-Rad). After blocking at 30 °C for 30 min in 3% gelatin-TBS (3% gelatin, 20 mM Tris–HCl, 500 mM NaCl, pH 7.5), the membrane was incubated overnight at 4 °C in 1% gelatin-TTBS (20 mM Tris–HCl, 500 mM NaCl, 0.05% Tween-20, pH 7.5) containing anti-DnaA rabbit antiserum (1:3000). After washing, the membrane was incubated at 30 °C for 1 hr in 1% gelatin-TTBS containing goat anti-rabbit IgG antibody conjugated to alkaline phosphatase (Bio-Rad), followed by development using AP Conjugate substrate Kit (Bio-Rad).
Appendix 1
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | BW25113 ∆priC::frt-kan | Keio collection | JW0456-KC | |
| Strain, strain background (Escherichia coli) | BW25113 ∆rep::frt-kan | Keio collection | JW5604-KC | |
| Strain, strain background (Escherichia coli) | MG1655 dnaC2 zjj18::cat | Kasho and Katayama, 2013 | KYA018 | |
| Strain, strain background (Escherichia coli) | MG1655 dnaA46 tnaA::Tn10 | Noguchi and Katayama, 2016 | MIT125 | |
| Strain, strain background (Escherichia coli) | MG1655 rnhA::cat | Noguchi and Katayama, 2016 | MIT162 | |
| Strain, strain background (Escherichia coli) | MG1655 ∆diaA::frt-kan | Noguchi and Katayama, 2016 | SA103 | |
| Strain, strain background (Escherichia coli) | MG1655 ∆priC::frt-kan | This work | KRC002 | MG1655 x P1 JW0456-KC |
| Strain, strain background (Escherichia coli) | MG1655 ∆priC::frt | This work | KRC003 | KRC002 x pCP20 |
| Strain, strain background (Escherichia coli) | MIT125 ∆priC::frt-kan | This work | KRC004 | MIT125 x P1 JW0456-KC |
| Strain, strain background (Escherichia coli) | KYA018 ∆priC::frt-kan | This work | KRC005 | KYA018 x P1 JW0456-KC |
| Strain, strain background (Escherichia coli) | KRC003 ∆diaA::frt-kan | This work | KRC006 | KRC003 x P1 SA103 |
| Strain, strain background (Escherichia coli) | MG1655 ∆rep::frt-kan | This work | FF001 | MG1655 x P1 JW5604-KC |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt-kan | Noguchi et al., 2015 | NY20 | |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt-kan oriC∆R4 box::TmaDnaA box | Noguchi et al., 2015 | NY21 | |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt-kan oriC∆Middle-Right DOR | This work | NY20L | |
| strain, strain background (Escherichia coli) | MG1655 asnA::frt-kan oriC∆AT-L region | This work | NY20ATL | |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt | Yoshida et al., 2023 | NY20-frt | |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt oriC∆R4 box::TmaDnaA box | This work | NY21-frt | NY21 x pCP20 |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt oriC∆Middle-Right DOR | This work | NY20L-frt | NY20L x pCP20 |
| Strain, strain background (Escherichia coli) | MG1655 asnA::frt oriC∆AT-L region | This work | NY20ATL-frt | NY20ATL x pCP20 |
| Strain, strain background (Escherichia coli) | NY20-frt ∆priC::frt-kan | This work | NY20-priC | NY20-frt x P1 KRC002 |
| Strain, strain background (Escherichia coli) | NY21-frt ∆priC::frt-kan | This work | NY21-priC | NY21-frt x P1 KRC002 |
| Strain, strain background (Escherichia coli) | NY20L-frt ∆priC::frt-kan | This work | NY20L-priC | NY20L-frt x P1 KRC002 |
| Strain, strain background (Escherichia coli) | NY20ATL-frt ∆priC::frt-kan | This work | NY20ATL-priC | NY20ATL-frt x P1 KRC002 |
| Strain, strain background (Escherichia coli) | MIT125 ∆rnhA::cat | This work | MIT125c | MIT125 x P1 MIT162 |
| Strain, strain background (Escherichia coli) | KRC004 ∆rnhA::cat | This work | KRC004c | KRC004 x P1 MIT162 |
| Antibody | anti-DnaA (Rabbit polyclonal) | Kawakami et al., 2005 | Immunoblot (1:3000) | |
| Antibody | Goat Anti-Rabbit IgG (H+L)-AP Conjugate | Bio-Rad | Cat. #1706518 | Immunoblot (1:3000) |
| Recombinant DNA reagent | pBRpriC (Plasmid) | This work | pBR322 encoding priC | |
| Recombinant DNA reagent | pING1 (Plasmid) | Johnston et al., 1985 | Vector bearing arabinose-inducible promoter | |
| Recombinant DNA reagent | pKA234 (Plasmid) | Kubota et al., 1997 | pING1 encoding dnaA | |
| Recombinant DNA reagent | pH136A (Plasmid) | Sakiyama et al., 2018 | pKA234 dnaA H136A | |
| Recombinant DNA reagent | pFH (Plasmid) | This study | pH136A mutated by Quick Change site-directed mutagenesis by primers F46A 1/2 | |
| Recombinant DNA reagent | pKW44-1 (Plasmid) | Ozaki et al., 2008 | pKA234 dnaA V211A | |
| Recombinant DNA reagent | pNA135 (Plasmid) | Ishida et al., 2004 | pBR322 bearing diaA gene | |
| Recombinant DNA reagent | pBSoriC (Plasmid) | Kawakami et al., 2005 | pBluescript bearing a 678 bp chromosome-derived region including oriC | |
| Recombinant DNA reagent | pET22b(+)-priC (Plasmid) | Aramaki et al., 2015 | pET22b(+) bearing priC under the T7 promoter | |
| Recombinant DNA reagent | pTKM601 (Plasmid) | Keyamura et al., 2007 | pBAD/HisB bearing diaA | |
| Sequence-based reagent | F46A 1 | Keyamura et al., 2009 | PCR primer | GTACGCGCCAAACCGCGCGGTCCTTCGATTG GGTACG |
| Sequence-based reagent | F46A 2 | Keyamura et al., 2009 | PCR primer | CGTACCCAATCGAAGGACCGCGCGGTTTGGCGCGTAC |
| Sequence-based reagent | ORI_1 | Kasho et al., 2014 | qPCR primer | CTGTGAATGATCGGTGATC |
| Sequence-based reagent | KWoriCRev | Kasho et al., 2014 | qPCR primer | GTGGATAACTCTGTCAGGAAGCTTG |
| Sequence-based reagent | qoriK fw | Brochu et al., 2018 | qPCR primer | CGAGACTTCAGCGACAGTTAAG |
| Sequence-based reagent | qoriK rev | Brochu et al., 2018 | qPCR primer | CCTGCGGATATTTGCGATACA |
| Sequence-based reagent | STM419 | This work | qPCR primer | CGGACACCTTGTCTGACCTAAG |
| Sequence-based reagent | STM420 | This work | qPCR primer | AGTGTGAAAATGACCCTCTTGC |
| Commercial assay or kit | AP Conjugate Substrate Kit | Bio-Rad | Cat #1706432 |
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files; source data files have been provided for Figure 7, Figure 3-figure supplement 1A, and Figure 7-figure supplement 1A and C.
References
-
Structure and function of DnaA N-terminal domains: specific sites and mechanisms in inter-DnaA interaction and in DnaB helicase loading on oriCThe Journal of Biological Chemistry 282:17816–17827.https://doi.org/10.1074/jbc.M701841200
-
Basic and aromatic residues in the C-terminal domain of PriC are involved in ssDNA and SSB bindingJournal of Biochemistry 157:529–537.https://doi.org/10.1093/jb/mvv014
-
The initiation of eukaryotic DNA replicationAnnual Review of Biochemistry 91:107–131.https://doi.org/10.1146/annurev-biochem-072321-110228
-
Structural basis for ATP-dependent DnaA assembly and replication-origin remodelingNature Structural & Molecular Biology 13:676–683.https://doi.org/10.1038/nsmb1115
-
The box VII motif of Escherichia coli DnaA protein is required for DnaA oligomerization at the E. coli replication originThe Journal of Biological Chemistry 279:51156–51162.https://doi.org/10.1074/jbc.M409695200
-
Structural basis of replication origin recognition by the DnaA proteinNucleic Acids Research 31:2077–2086.https://doi.org/10.1093/nar/gkg309
-
DnaB helicase is recruited to the replication initiation complex via binding of DnaA domain I to the lateral surface of the DnaB N-terminal domainThe Journal of Biological Chemistry 295:11131–11143.https://doi.org/10.1074/jbc.RA120.014235
-
Unwinding of the nascent lagging strand by Rep and PriA enables the direct restart of stalled replication forksThe Journal of Biological Chemistry 280:34143–34151.https://doi.org/10.1074/jbc.M507224200
-
Purification and characterization of the dnaA46 gene productThe Journal of Biological Chemistry 263:10625–10632.
-
DiaA, a novel DnaA-binding protein, ensures the timely initiation of Escherichia coli chromosome replicationThe Journal of Biological Chemistry 279:45546–45555.https://doi.org/10.1074/jbc.M402762200
-
Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiationNucleic Acids Research 42:13134–13149.https://doi.org/10.1093/nar/gku1051
-
IHF and Fis as Escherichia coli cell cycle regulators: activation of the replication origin oriC and the regulatory cycle of the DnaA initiatorInternational Journal of Molecular Sciences 24:11572.https://doi.org/10.3390/ijms241411572
-
Formation of an ATP-DnaA-specific initiation complex requires DnaA Arginine 285, a conserved motif in the AAA+ protein familyThe Journal of Biological Chemistry 280:27420–27430.https://doi.org/10.1074/jbc.M502764200
-
DiaA dynamics are coupled with changes in initial origin complexes leading to helicase loadingThe Journal of Biological Chemistry 284:25038–25050.https://doi.org/10.1074/jbc.M109.002717
-
Stable DNA replication: interplay between DNA replication, homologous recombination, and transcriptionMicrobiology and Molecular Biology Reviews 61:212–238.https://doi.org/10.1128/mmbr.61.2.212-238.1997
-
Conformational transition of DnaA protein by ATP: structural analysis of DnaA protein, the initiator of Escherichia coli chromosome replicationBiochemical and Biophysical Research Communications 232:130–135.https://doi.org/10.1006/bbrc.1997.6244
-
Biochemical characterization of Escherichia coli DnaC variants that alter DnaB helicase loading onto DNAThe Journal of Biological Chemistry 300:107275.https://doi.org/10.1016/j.jbc.2024.107275
-
Replication Restart in BacteriaJournal of Bacteriology 199:e00102-17.https://doi.org/10.1128/JB.00102-17
-
Regulation of E. coli Rep helicase activity by PriCJournal of Molecular Biology 433:167072.https://doi.org/10.1016/j.jmb.2021.167072
-
The arg fingers of key DnaA protomers are oriented inward within the replication origin oriC and stimulate DnaA subcomplexes in the initiation complexThe Journal of Biological Chemistry 290:20295–20312.https://doi.org/10.1074/jbc.M115.662601
-
Principles and concepts of DNA replication in bacteria, archaea, and eukaryaCold Spring Harbor Perspectives in Biology 5:a010108.https://doi.org/10.1101/cshperspect.a010108
-
A common mechanism for the ATP-DnaA-dependent formation of open complexes at the replication originThe Journal of Biological Chemistry 283:8351–8362.https://doi.org/10.1074/jbc.M708684200
-
Highly organized DnaA-oriC complexes recruit the single-stranded DNA for replication initiationNucleic Acids Research 40:1648–1665.https://doi.org/10.1093/nar/gkr832
-
Differentiation of the DnaA-oriC subcomplex for DNA unwinding in a replication initiation complexThe Journal of Biological Chemistry 287:37458–37471.https://doi.org/10.1074/jbc.M112.372052
-
Regulatory dynamics in the ternary DnaA complex for initiation of chromosomal replication in Escherichia coliNucleic Acids Research 45:12354–12373.https://doi.org/10.1093/nar/gkx914
-
Concerted actions of DnaA complexes with DNA-unwinding sequences within and flanking replication origin oriC promote DnaB helicase loadingThe Journal of Biological Chemistry 298:102051.https://doi.org/10.1016/j.jbc.2022.102051
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsThe Journal of Biological Chemistry 295:16949–16959.https://doi.org/10.1074/jbc.RA120.015450
-
Toward an understanding of the DNA replication initiation in bacteriaFrontiers in Microbiology 14:1328842.https://doi.org/10.3389/fmicb.2023.1328842
-
PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding proteinThe Journal of Biological Chemistry 288:17569–17578.https://doi.org/10.1074/jbc.M113.478156
-
Structure and function of the PriC DNA replication restart proteinThe Journal of Biological Chemistry 291:18384–18396.https://doi.org/10.1074/jbc.M116.738781
-
An aromatic-rich loop couples DNA binding and ATP hydrolysis in the PriA DNA helicaseNucleic Acids Research 44:9745–9757.https://doi.org/10.1093/nar/gkw690
-
Characterization of dnaC2 and dnaC28 mutants by flow cytometryJournal of Bacteriology 180:1624–1631.https://doi.org/10.1128/JB.180.7.1624-1631.1998
-
DiaA/HobA and DnaA: a pair of proteins co-evolved to cooperate during bacterial orisome assemblyJournal of Molecular Biology 408:238–251.https://doi.org/10.1016/j.jmb.2011.02.045
Article and author information
Author details
Funding
Japan Society for the Promotion of Science (JP17H03656)
- Tsutomu Katayama
Japan Society for the Promotion of Science (JP20H03212)
- Tsutomu Katayama
Japan Society for the Promotion of Science (JP23K27131)
- Tsutomu Katayama
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We are grateful to Drs. Yusuke Akama and Yukari Sakiyama for initial exploratory study related to this work. Japan Society for the Promotion of Science (JSPS KAKENHI) [JP17H03656, JP20H03212, and JP23K27131].
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.103340. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Yoshida et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 1,107
- views
-
- 84
- downloads
-
- 2
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Citations by DOI
-
- 2
- citations for umbrella DOI https://doi.org/10.7554/eLife.103340