1. Developmental Biology
  2. Plant Biology
Download icon

Integration of light and metabolic signals for stem cell activation at the shoot apical meristem

  1. Anne Pfeiffer
  2. Denis Janocha
  3. Yihan Dong
  4. Anna Medzihradszky
  5. Stefanie Schöne
  6. Gabor Daum
  7. Takuya Suzaki
  8. Joachim Forner
  9. Tobias Langenecker
  10. Eugen Rempel
  11. Markus Schmid
  12. Markus Wirtz
  13. Rüdiger Hell
  14. Jan U Lohmann  Is a corresponding author
  1. Centre for Organismal Studies, Heidelberg University, Germany
  2. Max Planck Institute for Developmental Biology, Germany
Research Article
  • Cited 50
  • Views 4,829
  • Annotations
Cite this article as: eLife 2016;5:e17023 doi: 10.7554/eLife.17023


A major feature of embryogenesis is the specification of stem cell systems, but in contrast to the situation in most animals, plant stem cells remain quiescent until the postembryonic phase of development. Here, we dissect how light and metabolic signals are integrated to overcome stem cell dormancy at the shoot apical meristem. We show on the one hand that light is able to activate expression of the stem cell inducer WUSCHEL independently of photosynthesis and that this likely involves inter-regional cytokinin signaling. Metabolic signals, on the other hand, are transduced to the meristem through activation of the TARGET OF RAPAMYCIN (TOR) kinase. Surprisingly, TOR is also required for light signal dependent stem cell activation. Thus, the TOR kinase acts as a central integrator of light and metabolic signals and a key regulator of stem cell activation at the shoot apex.


eLife digest

Plants are able to grow and develop throughout their lives thanks to groups of stem cells at the tips of their shoots and roots, which can constantly divide to produce new cells. Energy captured from sunlight during a process called photosynthesis is the main source of energy for most plants. Therefore, the amount and quality of light in the environment has a big influence on how plants grow and develop. An enzyme called TOR kinase can sense energy levels in animal cells and regulate many processes including growth and cell division. Plants also have a TOR kinase, but it is less clear if it plays the same role in plants, and whether it can respond to light.

Plant stem cells only start to divide after the seed germinates. In shoots, a protein called WUSCHEL is required to maintain stem cells in an active state. Here, Pfeiffer et al. studied how shoot stem cells are activated in response to environmental signals in a plant known as Arabidopsis. The experiments show that light is able to activate the production of WUSCHEL independently of photosynthesis via a signal pathway that depends on TOR kinase. The stem cells do not directly sense light; instead other cells detect the light and relay the information to the stem cells with the help of a hormone called cytokinin.

Further experiments show that information about energy levels in cells is relayed via another signal pathway that also involves the TOR kinase. Therefore, Pfeiffer et al.’s findings suggest that the activation of TOR by light allows plant cells to anticipate how much energy will be available and efficiently tune their growth and development to cope with the environmental conditions. Future challenges are to understand how TOR kinase is regulated by light signals and how this enzyme is able to act on WUSCHEL to trigger stem cell division.



Light is the sole energy source of plants and therefore one of the most important environmental factors influencing their development and physiology. Consequently, several of the core developmental decisions during the lifecycle of a plant from germination to seedling development and flowering are strongly influenced by light conditions. After germination, higher plants undergo two distinct developmental programs depending on the availability of light, termed skotomorphogenesis and photomorphogenesis. Skotomorphogenesis, the dark adaptation program, is characterized by an etiolated phenotype, including an elongated hypocotyl, closed cotyledons, the formation of an apical hook and etioplast development. Importantly, stem cells at the shoot and root tip remain dormant and thus growth in etiolated seedlings is mainly dependent on cell elongation rather than cell division. In contrast, photomorphogenesis, the developmental program triggered in light, leads to seedlings with short hypocotyls, unfolded cotyledons and development of chloroplasts. In the light, shoot and root meristems are activated, leading to root growth and development of the first leaves by cell division and expansion (reviewed in Nemhauser and Chory 2002).

Based on evolutionary evidence, photomorphogenesis is the default pathway, since gymnosperms for example do not follow a strict skotomorphogenic development in darkness (Wei, 1994). With the advance of land plants and resulting new environmental challenges, such as growth in dense canopy and germination in soil, the evolution of the dark-adapted skotomorphogenesis program ensued an advantage: It allowed plants to allocate the limited energy sources supplied by the seed to maximally grow by elongation, in order to reach favorable light conditions that will provide energy for further growth and development. To faithfully execute these opposing developmental programs, plants have evolved complex mechanisms to perceive light quality and quantity through a whole range of photoreceptors that are mainly absorbing in the blue, red and far-red range of the spectrum. Activation of the blue absorbing CRYPTOCHROMES (crys) and/or the red and far-red absorbing PHYTOCHROMES (phys) overrides the skotomorphogenic program and plants undergo photomorphogenesis within minutes after perception of a light stimulus (reviewed in Chory, 2010). On the molecular level, activated light receptors inhibit the function of the core repressor of photomorphogenesis, CONSTITUTIVE PHOTOMORPHOGENESIS 1 (COP1), an E3 ubiquitin ligase that targets positive regulators of photomorphogenesis for degradation in darkness (Yi and Deng, 2005). At the same time, a group of potent transcription factors, the PHYTOCHROME INTERACTING FACTORS (PIFs), which promote skotomorphogenesis in darkness, are degraded upon light perception through the PHYTOCHROMES (Leivar and Quail, 2010). The activities of these pathways converge on the differential regulation of thousands of genes resulting in a massive reprogramming of the transcriptome in response to light (Ma et al., 2002; Tepperman et al., 2004; Peschke and Kretsch, 2011; Pfeiffer et al., 2014).

Light not only activates photoreceptors, it also fuels photosynthesis and therefore leads to the production of a number of energy rich metabolites including sugars. Plants are able to monitor their metabolic state with several signaling systems (Lastdrager et al., 2014) and recent studies have focused on the evolutionary conserved TARGET OF RAPAMYCIN (TOR) kinase complex (Dobrenel et al., 2016). In other eukaryotes, TOR functions as a central integrator of nutrient, energy, and stress signaling networks and consistently, TOR regulates cell growth and proliferation, ribosome biogenesis, protein synthesis, cell wall integrity and autophagy (Díaz-Troya et al., 2008; Henriques et al., 2014; Lastdragere et al., 2014; Xiong and Sheen, 2014). While other eukaryotes possess two TOR complexes, so far only a single complex has been identified in plants. It is comprised of TOR, FKBP12, LST8 and RAPTOR (Mahfouz et al., 2006; Moreau et al., 2012) and thus resembles the mammalian TOR complex 1 (mTORC1). AtTOR is expressed in the embryo and endosperm and in meristematic regions of the adult plant (Menand et al., 2002). While tor null mutants show premature arrest of embryo development (Menand et al., 2002), knock down of TOR leads to growth reduction and affects the carbohydrate and amino acid metabolism (Caldana et al., 2013). In contrast, the presence of sugars in general promotes TOR kinase activity (Ren et al., 2012; Dobrenel et al., 2013; Xiong et al., 2013). So far, the only known direct downstream targets of AtTOR kinase are S6 kinase 1 (S6K1) (Schepetilnikov et al., 2011, 2013; Xiong et al., 2013), TAP46 (Ahn et al., 2011, 2014) and E2 promoter binding factor a (E2Fa) (Xiong et al., 2013). S6K1 plays an important role in reinitiating translation (Schepetilnikov et al., 2011) as well as in the regulation of the cell cycle (Henriques et al., 2010; Shin et al., 2012). Similarly, E2Fa is associated with cell cycle control through the expression of S-phase genes (Polyn et al., 2015). Though little is known about how TOR is activated on a molecular level in plants, reports from the past decade suggest that TOR functions as a central regulator of protein synthesis, cell proliferation and metabolism in response to metabolic signals.

Several photomorphogenic responses, like the inhibition of hypocotyl elongation, unfolding of the hypocotyl hook and cotyledons, as well as chloroplast development can be triggered by a light signal alone, as displayed in dark-grown cop1 and pif1/pif3/pif4/pif5 quadruple mutants (pifq) (Deng and Quail, 1991; Leivar et al., 2009). However, root growth is not induced in cop1 mutants unless sucrose is supplied with the growth medium. Photosynthetic assimilates dominantly promote growth in the root where they can synergistically interact with photoreceptor-triggered light signaling (Kircher and Schopfer, 2012). Recently, Xiong et al. showed that this photosynthesis-driven growth and proliferation in the root is mediated by the TOR kinase (Xiong et al., 2013).

Here, we analyzed the role of light and nutrients for post-germination stem cell activation in the shoot apical meristem (SAM) of young seedlings. Stem cell control in the SAM of Arabidopsis thaliana is based on the activity of the homeodomain transcription factor WUSCHEL (WUS), which is expressed in the organizing centre and necessary and sufficient to non-cell- autonomously induce stem cell fate by protein movement. Stem cells in turn express CLAVATA3 (CLV3), a short secreted peptide, that acts via the CLV / CORYNE receptor system to limit the expression of WUS in the organizing center (Schoof et al., 2000; Daum et al., 2014). The use of a reporter system based on the regulatory regions of WUS and CLV3 allowed us to quantitatively trace behavior of stem cells (pCLV3:mCHERRY-NLS) as well as cells of the underlying organizing center (pWUS:3xVENUS-NLS). With the help of these tools, we were able to genetically dissect the individual contribution of light signaling and photosynthesis-driven nutrient sensing on the stem cell system of the SAM. We show that both pathways ultimately converge at the level of TOR kinase activation, revealing a role for TOR as a central regulator of stem cell activation in response to environmental cues.


Organogenic development is dependent on light and energy metabolites

The SAM of Arabidopsis seedlings remains dormant during skotomorphogenesis and therefore, plants are unable to advance to the organogenic stage in the absence of light. However, since light acts as signal and energy source alike, we first asked which of the two roles is dominant for SAM development. While supplementation of sugar to wild-type seedlings grown in the dark is known to be inefficient to trigger development (Figure 1A), activation of the light pathway alone, either physiologically by low level illumination, or genetically by introduction of the cop1 mutation, was shown to induce photomorphogenic development of the hypocotyl and cotyledons in darkness (Deng and Quail, 1991). Despite this stark developmental transition, SAMs of cop1 mutants were unable to produce organs when grown in the dark. However, the SAM was activated and organogenesis initiated in 100% of the dark-grown cop1 mutants when supplemented with sucrose as external energy source (Figure 1B, see also McNellis et al., 1994; Nakagawa and Komeda, 2004). Conversely, the SAM of light-grown wild-type seedlings remained dormant when photosynthesis was compromised by the carotenoid biosynthesis inhibitor norflurazon. In line with our observation of cop1 mutants, supplementing the growth medium of these plants with sucrose rescued the dormant phenotype in approximately every third seedling (Figure 1C). Thus, neither the availability of energy metabolites, nor light perception alone was sufficient for SAM activation. In contrast, light and energy, likely in the form of photosynthetic products, seemed to be sensed independently, and both factors need to act cooperatively to trigger SAM development.

Figure 1 with 1 supplement see all
SAM development depends on light and sugar.

(AC) Five week old plants grown on media with (+) or without (-) sucrose. (A) Wild-type plants grown in darkness, (B) cop1 mutant plants grown in darkness and (C) wild-type seedlings grown in light in the presence of 0.5 µM photosynthesis inhibitor norflurazon . (DI) Maximum projections of SAMs of four day old seedlings; scale bar 20 µm. (DF) pCLV3:mCHERRY-NLS (red) and pWUS:3xVENUS-NLS (green). (GI) pCLV3:mCHERRY-NLS (red) and pWUS:WUS-linker-GFP (green). Quantification of pWUS:3xVENUS-NLS (J) and pCLV3:mCHERRY-NLS (K) expression by fluorescence intensity under different growth conditions (gray = darkness, red = red light (30 µmol*m−2*s−1), solid box = w/o sucrose, hatched box = 1% sucrose, dag = days after germination).


WUS expression is independently regulated by light and sucrose

Our phenotypic analysis suggested that light and metabolic signals synergize to activate SAM development, and thus we asked which of the known components underlying stem cell homeostasis might be the relevant cellular and molecular targets. By using transcriptional reporters for stem cells (pCLV3:mCherry-NLS) and niche cells (pWUS:3xVENUS-NLS) we found that stem cell identity was actively maintained independently of growth conditions and was even observed in the dormant state mediated by germination in the dark (Figure 1D). In contrast, expression of the reporter for the stem cell inducing WUS transcription factor was critically dependent on environmental signals and preceded meristem activity and the initiation of organogenic development (Figure 1E). To test if our WUS reporter faithfully recapitulated the behavior of the endogenous gene, we used in situ hybridization and were able to confirm strong light dependent induction of WUS mRNA (Figure 1—figure supplement 1C and D). Since WUS protein exhibits complex movement and a short lifetime (Daum et al., 2014), we furthermore analyzed the behavior of WUS-GFP protein in vivo by recording the GFP signal in our rescue line (pWUS:WUS-linker-GFP in wus mutant background [Daum et al., 2014]). Again, we observed a strong light- and sucrose-dependency of the WUS-GFP signal in line with the observed activation of the WUS promoter and accumulation of the endogenous WUS mRNA under these conditions (Figure 1G–I) confirming that the simple pWUS:3xVenus-NLS reporter represents a faithful and quantitative readout for WUS activity. Taken together, these findings on the one hand suggested that CLV3 expression is at least partially independent of WUS and on the other hand that the environmentally dependent transcriptional activation of WUS is the trigger to overcome stem cell dormancy.

Using seedlings carrying both reporters grown under wave-length specific LED illumination and image quantification we found that the WUS reporter (pWUS:3xVENUS-NLS) was below detection level in dark-grown seedlings. In contrast, GFP signals were readily detectable in light-grown plants from three days after germination onwards with the signal steadily increasing over time (Figure 1J). Interestingly, WUS expression was also induced in the absence of light, when plants were grown on sucrose-supplemented medium (Figure 1F,J) and when sucrose was supplied to light-grown seedlings, the effect of light and sucrose on WUS expression was additive (Figure 1J). Light and sucrose also had a similar effect on the regulation of CLV3 expression (Figure 1D–I, K), however, since the CLV3 reporter was already detectable in dark-grown seedlings, the induction of expression by light and sucrose was less pronounced and mainly due to an enlargement of the CLV3 domain rather than an increase of signal intensity in individual cells (Figure 1—figure supplement 1A and B). In sum, development of the SAM required both, light signal transduction and the availability of photosynthetic products, whereas WUS expression was induced also by each signal individually. Thus, tracing WUS expression in the SAM of young seedlings represented a sensitive model to decipher the contribution of upstream signals to stem cell activation in a developmentally and physiologically relevant setting.

Mechanisms of light dependent stem cell activation

Since the expression of the transcriptional WUS reporter showed an early and dynamic response to environmental stimuli that mimicked both endogenous WUS mRNA, as well as WUS-GFP protein, we used the intensity of the reporter signal in four day-old seedlings as an easily quantifiable proxy for stem cell activation. First, we wanted to elucidate the molecular players involved in stem cell activation by light. To this end, we irradiated seedlings with monochromatic light of low intensities (30 µmol*m−2*s−1) to analyze the effect of light signaling with minimal influence of photosynthesis-derived metabolites. Even at low intensities, blue, as well as red light were sufficient to robustly induce WUS expression (Figure 2A). In line with the well-documented biochemistry of the photoreceptors, red-light-induced WUS activation was specifically reduced in the phyB mutant background, while blue-light-induced reporter activity was impaired in the cry1/cry2 double mutant background (Figure 2A). We thus concluded that light perceived through phyB as well as the crys influences the developmental fate of the SAM.

Figure 2 with 1 supplement see all
Light induced WUS expression depends on photoreceptors and is repressed by COP1.

Quantification of pWUS:3xVENUS-NLS expression by fluorescence intensity was measured in four day old wild-type (WT) or mutant seedlings (WT) or mutant background under different growth conditions (gray = darkness, red = red light (30 µmol*m−2*s−1), blue = blue light (30 µmol*m−2*s−1), solid box = w/o sucrose, hatched box = 1% sucrose). (A) 0.5 mM lincomycin and 5 µM norflurazon, respectively were applied to the growth media of wild-type seedlings. (B) Impact of cop1−4 mutation on WUS expression.


We also tested WUS expression under far-red light, which is sensed by phyA and found that reporter activity was only weakly induced by far-red light. Interestingly, phyA mutants showed similar WUS promoter activity under far-red light and in darkness (Figure 2—figure supplement 1A). However, when we supplemented the growth media with 1% sucrose we observed a clear induction of WUS expression in response to far-red light, which was dependent on a functional copy of PHYA. Still, phyA mutants displayed a basal level of WUS promoter activity already in darkness even when grown on plates containing sucrose, suggesting a complex and so far unknown regulatory role for phyA under these conditions.

The fact that plants grown in far-red light are photosynthetically inactive and required an exogenous energy source for WUS activation, while plants under blue and red light did not, raised the question whether minimal levels of photosynthetically derived sugars might contribute to WUS expression in blue and red light, despite the low fluence. Therefore, we tested whether the availability of photosynthetic products is a prerequisite for light-induced WUS expression by chemical interference. However, the inhibition of photosynthesis by either norflurazon or lincomycin, did not affect WUS promoter activity in red or in blue light (Figure 2A). In the presence of lincomycin, WUS expression was even slightly increased under both light conditions. To avoid potential side effects of the pharmacological treatments we also tested the effect of CO2 withdrawal on seedling development and WUS expression. Preventing photosynthetic assimilation in a CO2-deficient atmosphere inhibited development of seedlings even when grown in light. This phenotype could be rescued in one third of the plants by adding 1% sucrose to the media, similar to what we observed using norflurazon treatment (compare Figure 1C and Figure 2—figure supplement 1C). Importantly, WUS induction by red light was unaffected by CO2 reduction in the atmosphere (Figure 2—figure supplement 1B). Thus, photosynthetically derived metabolites produced in a low light environment were not required for activation of stem cells, confirming that light signaling alone was sufficient for WUS expression.

We next asked how the light signal perceived by PHYTOCHROMES and CRYPTOCHROMES is relayed to the nucleus by testing the contribution of known downstream signaling components, such as COP1 and HY5. The E3-ubiquitin ligase COP1, which targets HY5 but also other factors for degradation in darkness, showed robust inhibitory effects on WUS expression. Cop1-4 mutants displayed photomorphogenic development in darkness, which was accompanied by WUS expression (Figure 2B). Furthermore, the repressive function of COP1 was prominent under all conditions tested and cop1-4 seedlings displayed strongly elevated WUS promoter activity compared to wild-type when grown in dark with or without sugar, and also under low light conditions (Figure 2B). To confirm that these effects were not caused by second site mutations present in the cop1-4 background or specific to the allele tested, we used qRT-PCR to assay WUS expression in seedlings carrying other cop1 loss-of-function alleles. However, since this approach lacked the spatial resolution provided by microscopic quantification of the WUS reporter, it proofed to be much less sensitive. Still, we were able to detect accumulation of endogenous WUS mRNA in response to light in 7d old wild-type seedlings, as well as in cop1-4 mutants in the dark (Figure 2—figure supplement 1D). Importantly, all three cop1 mutant alleles tested showed robust elevation of WUS mRNA levels when grown in the dark (Figure 2—figure supplement 1E), demonstrating that loss of COP1 function leads to activation of WUS.

One of the main functions of COP1 is to target the transcription factor HY5, a positive master regulator of photomorphogenesis, for degradation. Thus, we analyzed the role of HY5 working under the hypothesis that in contrast to cop1 mutants, which had shown elevated WUS reporter expression, hy5 mutants should suffer from a much reduced meristem activity due to the absence of an important photomorphogenesis stimulating activity. However, hy5 mutants were unaffected in activation of WUS expression (Figure 2—figure supplement 1F), suggesting that SAM stem cell activation is dependent on another COP1-targeted transcriptional transducer, such as HY5 HOMOLOG (HYH), or a so far unknown regulator.

Since the SAM is shielded from the environment especially in etiolated seedlings, where it is buried between the closed cotyledons and protected by the apical hook of the hypocotyl, it seemed questionable that the meristem itself is the site of light perception. We therefore tested the competence of different tissues to perceive light signals and translate them into a stem cell activating output. To this end, we expressed a constitutive active form of phyB (Su and Lagarias, 2007) under different tissue specific promoters (Figure 2—figure supplement 1C,D). Expression of phyB Y276H under an ubiquitous promoter (pUBI10) caused strong cop1-like phenotypes and a substantial activation of the WUS promoter in the SAM showing that transgenic activation of light signaling is sufficient to trigger stem cell activation in darkness (Figure 2—figure supplement 1G,H,J). In line with our hypothesis that light is likely perceived by cells outside the SAM, vascular specific expression of phyB Y276H by the pSUC2, or mesophyll specific expression by pCAB3 promoters (Ranjan et al., 2011) initiated constitutive photomorphogenic phenotypes and WUS expression in dark-grown seedlings. Similar results were also obtained for the epidermal pML1 promoter, in lines showing high expression levels of phyB Y276H (Figure 2—figure supplement 1G–J). These results suggested that the stimulus downstream of light perception can be transmitted between tissues by a mobile signal and raised the question whether the SAM itself even has the ability to respond to light. To explore this, we expressed phyB Y276H specifically in the SAM under the promoter of At3g59270 (Yadav et al., 2009), but in contrast to expression outside of the SAM, we observed fully etiolated seedlings without detectable WUS expression when these plants were grown in the dark. Even when we drove PHYB Y276H expression in cells surrounding the organizing center by the promoter of At1g26680 (Yadav et al., 2009), we only observed a minor reduction in hypocotyl elongation in darkness compared to wild-type and marginal WUS expression (Figure 2—figure supplement 1G,H,J). We therefore concluded that light is perceived by cells outside of the SAM, likely in the cotyledons or the hypocotyl and that this stimulus is transmitted to the SAM by a so far unidentified mobile signal. Amazingly, the SAM does not possess the competence to perceive and/or translate the light stimulus into stem cell activation, but rather is limited to responding to the signals that are transmitted from distant plant organs.

Mechanisms of hormonal stem cell activation

Since we had shown that light is perceived at a distance from the SAM, which also for energy rich metabolites is not a source, but a sink tissue, we next asked how the information for both environmental inputs is relayed to the stem cell system. Obvious candidates for inter-regional signaling components are plant hormones and there are a number of studies demonstrating their importance in regulating the shoot stem cell niche, especially for cytokinin (CK) and auxin (reviewed in Murray et al., 2012). A previous study had analyzed the environmental influence on organ initiation at the SAM using transfer of light grown tomato plants to darkness as a model and found that light is required for CK signaling and polarized membrane localization of the auxin export carrier PIN1 (Yoshida et al.,2011). However, these studies could not distinguish whether light was perceived as informational cue or energy source. We therefore analyzed CK signaling activity using the pTCSn:GUS cytokinin output sensor (Zürcher et al., 2013) as well as auxin flux directionality using polarization of pPIN1:PIN1-GFP (Benková et al., 2003) as a proxy (Figure 3A–K). In line with the findings of Yoshida et al., CK signaling was strongly activated by light when compared to etiolated seedlings (compare Figure 3H,G). Furthermore, we also found that PIN1 polarly localized to the plasma membrane in a light dependent manner (Figure 3A and B). Interestingly, sucrose treatment of etiolated seedlings did not affect the localization of PIN1 (Figure 3C) but lead to a mild activation of the TCS reporter also in the absence of light (Figure 3I), suggesting that there is specificity in the hormonal response.

Figure 3 with 1 supplement see all
Hormonal control of the SAM.

(AF) Confocal images of four day old seedlings expressing pPIN1:PIN1-GFP in WT (AD) or cop1-4 (E,F) background under diverse growth conditions. The lower row shows a magnification of the meristem shown in the picture above. (GK) GUS staining of four day old plants expressing pTCSn:GUS (light = white light (150 µmol*m−2*s−1), + suc = 1% sucrose, nor = 5 µM norflurazon, scale bar = 20 µm). (L) Wild-type seedlings after 20 days on plates containing CK (75 µM benzyladenine) supplemented with (+) or without (-) sucrose.


To test the light signaling response independently from impeding effects of photosynthesis, we treated plants grown in light with the photosynthesis inhibitor norflurazon. While PIN1 localization was still light responsive, no activity of the TCS reporter was detectable under these conditions (Figure 3D,J). We also observed a reduction of TCS signal when plants were grown in a CO2-deficient environment (Figure 3—figure supplement 1C). Since in both cases TCS reporter activity could be restored by sucrose supplementation (Figure 3K and Figure 3—figure supplement 1D), we concluded that CK signaling output is dependent on the availability of energy metabolites. However, light signaling and photosynthesis together had a much stronger effect on CK output than nutrient availability alone, suggesting that both signals synergize to stimulate CK signaling at the SAM. In contrast, PIN1 localization to the plasma membrane was fully dependent on light perception and could not even be restored by the cop1 mutation (Figure 3E,F).

If CK signaling indeed integrates energy status and light perception, it may be sufficient to activate SAM development. In line with this idea, the importance of CK in light dependent SAM activation had already been demonstrated (Chory et al., 1994; Skylar et al., 2010) and Yoshida et al. had shown that the application of CK to tomato apices can induce organogenesis in the dark (Yoshida et al.,2011). Consistently, etiolated Arabidopsis seedlings treated with CK produced leaf like structures even in darkness (Figure 3L and Chory et al. 1994). However, this developmental transition was strictly dependent on the presence of an external energy source, similar to the behavior of cop1 mutants and in the absence of sucrose, CK treated seedlings failed to develop leaves in the dark (Figure 3L). Thus, our experiments were consistent with CK being an important component of, but not the sole signal for environmental stem cell activation.

Since we had found WUS expression to be a much more sensitive readout for SAM activation than organ development, we made use of our reporter system to dissect the role of CK for overcoming stem cell dormancy. Using hormone treatment assays we found that CK alone was sufficient to induce low levels of WUS expression even in darkness in line with its known role in SAM regulation (Gordon et al., 2009; Buechel et al., 2010). Interestingly, we observed the strongest stimulation of reporter activity in plants on sucrose medium, whereas the light response was largely unaffected by CK treatment (Figure 4A). These results suggested that application of CK can at least partially replace the perception of light and thus supported a role for CK as a mobile transducer for light signals upstream of WUS expression. However, as demonstrated by our results using the TCS reporter, in the absence of energy metabolites downstream CK signaling cannot be fully activated, resulting in a lack of organ development. Having established an environment specific role for CK in the initial steps leading up to stem cell activation, we wondered about the mechanism of regulating endogenous hormone levels. We therefore mined the literature for light responsive genes, expressed in the meristem and functionally related to CK metabolism, perception, or signaling. Only CYTOKININ OXIDASE 5 (CKX5), which codes for one of seven homologous cytokinin dehydrogenases involved in CK catabolism in Arabidopsis met all criteria (Frebort et al., 2011). CKX5 is a direct transcriptional target of several PHYTOCHROME INTERACTING FACTORs (PIFs) and is highly expressed in etiolated seedlings as well as under shade conditions (Hornitschek et al., 2012; Zhang et al., 2013; Pfeiffer et al., 2014). Similar to cop1 mutants, also pifq mutants form leaves in darkness when supplied with sugars externally, therefore the PIFs are likely to play an important role in suppressing SAM activation in darkness (Figure 4—figure supplement 1A). CKX6, a close homologue of CKX5, had already been described to limit primordia growth in response to shade treatment (Carabelli et al., 2007) and both CKX5 and CKX6 had been shown to be expressed around the shoot apex (Motyka et al., 2003; Bartrina et al., 2011). When we tested the contribution of CKX5 and CKX6 to SAM activation by crossing the single mutants to our reporter line, we found that loss of either did not promote WUS activity in the dark as CK treatment. In contrast, the responses to sucrose and light were robustly enhanced (Figure 4B), revealing that genetically removing etiolation specific antagonists of CK accumulation is sufficient to replace one of the essential environmental signals, but not both. Because CKX genes act partially redundantly (Bartrina et al., 2011), we decided to remove CKX6 in the ckx5 mutant reporter background by CRISPR/Cas9. Of 27 plants tested in T1, three were homozygous ckx6 mutants, with either insertions or deletions at the 5´end of the CKX6 locus leading to a shift in the reading frame (Figure 4—figure supplement 1E). Seedlings of all three independent ckx5/ckx6 mutant reporter lines were analyzed in the T2 generation and showed comparable effects on WUS expression (Figure 4B includes data from one representative ckx5/ckx6 line, AP101.9). In contrast to either single ckx mutant, ckx5/ckx6 double mutants showed basal WUS reporter activity in darkness, similar to its behavior under CK treatment. Furthermore, we observed a dramatic enhancement of the effect of sucrose on WUS activity and also light dependent reporter induction was increased two-fold over either single mutant, which was also detectable by qRT-PCR (Figure 4—figure supplement 1B). Based on these results we concluded that CKX5 and CKX6 repress activation of the SAM by degradation of the plant hormone CK in darkness. Interestingly, the level of WUS expression in the ckx5/ckx6 double mutant background was almost comparable to one found in cop1 mutant plants (Figure 2B). However, in striking contrast to cop1, the ckx5/ckx6 double mutant displayed a fully etiolated phenotype in darkness (Figure 4—figure supplement 1C and D), demonstrating that stem cell activation was fully uncoupled from photomorphogenesis in these plants. Thus, CK can act as an interregional transmitter of light signals specifically for WUS expression, but not for general regulators of photomorphogenic growth, suggesting that the developmental integration of light and metabolic signals might occur downstream of CK and locally at the SAM.

Figure 4 with 1 supplement see all
Role of cytokinin signaling in WUS activation.

Quantification of pWUS:3xVENUS-NLS expression in four day old seedlings. (A) Cytokinin was applied as 75 µM benzyladenine to wild-type (WT). (B) Ckx mutant lines display enhanced expression of the pWUS:3xVENUS-NLS reporter construct (growth conditions: gray = darkness, red = red light (30 µmol*m−2*s−1), solid box = w/o sucrose, hatched box = 1% sucrose).


Mechanisms of metabolic stem cell activation

In addition to light, seedling development and WUS expression both showed a strong dependency on sucrose. Since sugars can not only act as energy source, but also as signaling molecules, we first aimed to disentangle these functions for SAM activation. To this end, plants were grown on plates supplemented with equimolar amounts (15 mM) of different sugars with diverse energy content for four days in darkness (Figure 5A). While mannitol, a non-metabolizable sugar, did not affect WUS activity, WUS expression could be observed in etiolated seedlings in the presence of glucose and sucrose, with sucrose being approximately twice as effective as glucose. Conversely, palatinose, a non-metabolizable sugar structurally related to sucrose and able to induce the sugar-dependent bud burst of roses in vitro (Rabot et al., 2012), was not sufficient to induce WUS (Figure 5A). These findings strongly suggested that in the context of stem cell activation, sugars do not act as signaling molecules directly, but rather as energy source. In turn, the metabolic status of the plant seemed to be sensed and translated into appropriate cell behavior by the SAM.

Figure 5 with 1 supplement see all
The TOR pathway integrates metabolic and light signals upstream of WUS.

(A) Activation of pWUS:3xVENUS-NLS in four day old dark-grown seedlings grown with 15 mM of diverse sugars (+sug). (BD) Activation of pWUS:3xVENUS-NLS in seedlings grown in liquid culture. (B) Effect of AZD-8055 TOR inhibitor on glucose treatment. (C) Effect of AZD-8055 TOR inhibitor on light treatment. (D) Effect of AZD-8055 TOR inhibitor on cop1-4 mutant seedlings. (growth conditions: gray = darkness, red = red light (30 µmol*m−2*s−1), solid box = w/o sugars added, hatched box = with sugar) (E) Quantification of S6K phosphorylation relative to total S6K levels based on western blots shown in Figure 5—figure supplement 1B. (FH) Metabolite measurements from four day old seedlings. Gray bars represent untreated seedlings; hatched bars represent 24 hr treatment with 15 mM glucose; green bars represent 24 hr light treatment (60 µmol*m−2*s−1 of red and blue light each); yellow bars represent cop1-4 mutant seedlings. Error bars show standard error of the mean; asterixs indicate significance tested by unpaired two-tailed oneway ANOVA Student-Newman-Keuls test: *p<0.05, **p<0.01, ***p<0.001; Glyox = glyoxylate; KG = ketoglutarate. (I) PCA based on metabolite measurements shown in Figure 5F–H and Figure 5—figure supplement 1D,E.


A key sensor of nutrient availability in plants is the TOR (TARGET OF RAPAMYCIN) kinase and photosynthesis-mediated activation of the root meristem has recently been described to be under the regulation of TOR (Xiong et al., 2013). Characteristic expression changes that were described in response to glucose-TOR signaling (Xiong et al., 2013) and E2Fa overexpression (Vandepoele et al., 2005; López-Juez et al., 2008), namely affecting genes involved in ribosome biogenesis, protein translation and cell proliferation have also been identified in microarray analyses of shoot apex tissue derived from young seedlings (López-Juez et al., 2008). These genes were rapidly and synchronously induced by photosynthetically active light preceding organ growth, which lead us to hypothesize that stem cell activation in the SAM might also be under control of the TOR kinase.

Since mutations in TOR are lethal, we used chemical interference to functionally test its contribution to SAM activation. To efficiently inhibit TOR activity, we applied the ATP-competitive TOR kinase inhibitor AZD-8055 (Montané and Menand, 2013) on seedlings grown in liquid culture (Figure 5B–D). After an initial germination and growth phase of three days in darkness, sugar, light and inhibitor treatments were applied for another three days followed by microscopic analysis of the seedlings. In line with our hypothesis that TOR is required for energy sensing in the SAM, AZD-8055 inhibited glucose-induced WUS expression in a dose dependent manner (Figure 5B). Already 2–5 µM of AZD-8055 resulted in a considerable repression of WUS promoter activity when compared to mock controls, and almost completely suppressed the positive effect of glucose.

TOR acts as an integrator of light and metabolic signals for stem cell activation

Since TOR kinase has such a central function in the regulation of growth and development, we wondered whether besides the well documented nutrient availability pathway other stimuli, such as light signaling, might also depend on TOR activity. Using the same experimental setup as described above for glucose we indeed found that light-induced WUS expression was efficiently inhibited by AZD-8055 (Figure 5C). This suggested that TOR kinase might play a specific role in light signaling independent of energy production, since the plants were exposed to a rather low light intensity of 30 µmol*m−2*s−1. To further test this, we analyzed TOR dependency in the absence of photosynthesis and found that light dependent WUS expression was repressed by the TOR inhibitor even under norflurazon treatment (Figure 5—figure supplement 1A). Consistently, even genetic activation of the light signaling pathway through the cop1 mutation in the absence of a physiological stimulus was sensitive to TOR inhibition by AZD-8055 (Figure 5D).

Since we could not exclude that our observations were caused by unspecific side effects of the AZD-8055 inhibitor, we wanted to monitor TOR activity in response to sugars and light directly. Working under the hypothesis that TOR activity should correlate with energy and light signals if the inhibitor results were meaningful, we quantified the phosphorylation level of the direct TOR target S6K by a phospho-specific antibody (Figure 5E and Figure 5—figure supplement 1B). After transfer of three-day-old etiolated seedlings to either light (60 µmol*m−2*s−1 of blue and red light each) or 15 mM glucose for 24 hr, we detected a substantial increase in phosphorylation of S6K compared to seedlings that were kept in darkness (Figure 5E). Surprisingly, light treatment was even more efficient in activating TOR kinase than supplying plants with external glucose. Consistently, cop1-4 mutant seedlings displayed high S6K phosphorylation levels under all conditions, including the dark-grown control. Also in this case we were able to detect a similar activation of the TOR pathway in other cop1 alleles (Figure 5—figure supplement 1C), supporting our previous observation that the TOR pathway is repressed by the negative light signaling component COP1 in darkness. Taken together, TOR kinase seems to play a central and so far underestimated role not only for metabolic, but also for light dependent activation of WUS and ultimately stem cells in the SAM.

Environment dependent metabolic reprogramming

After having shown that light and energy status converge to activate stem cells, we wondered about the underlying metabolic changes in response to these environmental cues. We were most interested to analyze metabolic re-programming in response to light signaling because we hypothesized that TOR could be indirectly activated following at least two scenarios: First, since in the wild light signaling and photosynthesis usually go hand in hand, we were wondering whether signaling alone would trigger a metabolic shift in expectation of photosynthesis derived energy metabolites. And second, since COP1 regulates more than 20% of the Arabidopsis genome (Ma et al., 2002), we speculated that this could also extend to the activity of metabolic enzymes. In both cases the metabolic state of the seedlings, especially with respect to glucose levels, could be affected by light signaling and this in turn could indirectly trigger TOR. We therefore analyzed metabolites in seedlings that were subjected to the same experimental workflow as for studying TOR activity described above, namely wild-type and cop1-4 seedlings grown in darkness compared to seedlings treated with either 15 mM glucose or light for 24 hr before harvest (Figure 5F–H; Figure 5—figure supplement 1D–F; Supplementary file 1). A Principal Component Analysis (PCA) plot clearly identified light signaling triggered by the cop1 mutation (PC1) and energy availability caused by glucose supplementation (PC2) as the two major components in our sample set, with light treated samples being influenced by both components. Interestingly, glucose treatment only had a mild effect on seedling metabolism. We detected slight increases of glucose, fructose and sucrose as well as a clear increase of mannose levels in glucose treated seedlings, while raffinose levels were reduced (Figure 5F,H). The fact that under these conditions TOR activity is markedly increased and WUS expression is robustly detectable demonstrates that the energy sensing machinery must be exquisitely sensitive to small changes in metabolite content, most likely glucose. To our surprise, cop1 and light treated seedlings showed similar metabolic profiles that were clearly different from the glucose treated samples. Since cop1 seedlings were grown in darkness, the metabolic re-programming in cop1 and light treated seedlings is likely caused by light signaling dependent transcriptional regulation of metabolic enzymes, rather than simple photosynthesis dependent accumulation of sugars. We detected a clear reduction of fructose and sucrose levels and a decrease in the cell wall monosaccharides fucose, arabinose and galactose in both samples (Figure 5H). In addition, ADP and ATP levels were slightly increased by light and cop1 mutation (Figure 5G). Cop1 seedlings also displayed an accumulation of glyoxylate, an intermediate of the glyoxylate cycle that allows plants to use lipids as carbon source (Figure 5H). Another noteworthy exception from the similarity between cop1 and light treated seedlings was glucose. Importantly, only the light- and glucose-treated samples, but not cop1 seedlings showed an increase in glucose levels that might be responsible for the observed activation of TOR kinase. However, since it is not known how the TOR complex is activated in plants, we cannot exclude that the obvious metabolic re-programming indirectly triggered TOR kinase activity in cop1 seedlings. Nevertheless, since cop1 seedlings showed an overall reduction of energy rich metabolites, it seemed unlikely that the nutrient state was exclusively responsible for activation of the TOR pathway in the cop1 background.

Interestingly, we saw a significant increase in the levels of specific amino acids and their derivatives especially in cop1 (Glu, Gln, His, Arg, ornithin, spermidine and citrulline) that were all previously described to be reduced in amiR-tor seedlings (Figure 5—figure supplement 1F and Supplementary file 1). Conversely, time amino acids whose levels were reported to be increased upon TOR repression (Thr, Tyr, Val, Ile and Leu) were unchanged or reduced in cop1 (Caldana et al., 2013). The inverse correlation of amino acid levels in cop1 and amiR-tor lines was not apparent in the other samples, suggesting that the permanent de-regulation of the TOR pathway during either cop1 or amiR-tor seedling development strongly affected the metabolome while the short term nature of the glucose or light treatments was insufficient for such a profound change.


The life of a plant begins in many cases with skotomorphogenesis, which is characterized by the elongation of the hypocotyl, formation of an apical hook, unfolded cotyledons and the dormancy of the SAM. While most characteristics of skotomorphogenesis can be revoked by the perception of light through the photoreceptors alone, we showed that activation of the SAM in addition requires the presence of energy metabolites. Thus, for stem cell activation, light not only acts as a signal, but also needs to fuel the photosynthetic apparatus to produce sugars and despite the dual role of a single environmental factor, both inputs are sensed independently. Amazingly, it is not stem cell fate that is dependent on these signals, but rather the expression of WUS, which defines the niche and at the same time acts as a mobile stem cell activator. Thus, stem cell fate as defined by CLV3 promoter activity can exist without WUS in a physiologically and developmentally relevant setting, strongly suggesting that WUS is not the primary stimulating input for CLV3 expression.

For the sensing, transmission and integration of light and metabolic signals by the stem cell system, evolution seems to have co-opted well studied regulators into a novel and so far unsuspected regulatory network. On the one hand, the roles of the phyB and cry photoreceptors for stem cell activation are fully in line with text book photomorphogenesis, on the other hand phyA exhibits novel positive and negative functions in far-red light regulation of WUS expression, which point to a re-wiring of this core component of light signaling. Similarly, in light signal transduction, the etiolation regulator COP1 plays a prominent part and cop1 mutations can substitute for light in essentially all experiments, apart from PIN1 membrane localization. In contrast, HY5, another core component of the photomorphogenesis network, does not seem to have any apparent role in light dependent stem cell activation. This is even more striking when taking into account the recently discovered role in shoot-to-root signaling of HY5 (Chen et al., 2016), and our observation that the meristem region itself does not possess the competence to perceive and process light signals. However, we cannot exclude that the HY5 homolog HYH with partially overlapping function but higher expression level in the shoot might mask the effect of hy5 on WUS expression (Holm et al., 2002; Sibout et al., 2006). Since hy5/hyh mutants showed deficiencies in development of the first leaves future experiments analyzing such a double mutant in the context of our double reporter are required.

Interregional transmission of the light signal seems to depend on CK and with the cytokinin dehydrogenases CKX5 and CKX6, we identified two potent regulators of meristem activity that are highly responsive to environmental light conditions. Both are direct targets of PIFs and have already been shown to accumulate in etiolated seedlings (CKX5) and shade conditions (CKX6), respectively (Carabelli et al., 2007; Pfeiffer et al., 2014), which ultimately leads to an inactivation of cytokinin under unfavorable light conditions. Under open sun light PIFs are degraded, thus liberating cytokinin from CKX mediated degradation, which in turn results in the activation of stem cells. CKX5 is expressed in the rib zone below the stem cell niche and CKX6 additionally in the vasculature (Motyka et al., 2003; Bartrina et al., 2011), which might explain the surprisingly high efficiency of our pSUC2:PHYB Y276H line in activating WUS expression (Figure 2—figure supplement 1G). We did not specifically activate light signaling in the rib zone below the stem cell niche in our experiments and thus the possibility remains that light perception in the immediate vicinity to the meristem affects stem cell activity by short range CK signaling.

In parallel to light signals, WUS expression was strongly responsive to energy availability. The effect of sucrose on cop1 and ckx5/ckx6 double mutants was much stronger than the cumulative effect of light and sucrose treatments (Figures 2B and 4B). Also the activity of the CK output reporter pTCSn:GUS strictly depended on sucrose, but could be further stimulated by light, suggesting that CK signaling mainly acts to transmit light signals, but that elevation of CK levels genetically or by treatment are insufficient to elicit the full developmental response. Based on these results we suggest that light enhances CK levels by reducing the expression of CKX genes, however we cannot rule out other explanations, such as stimulation of CK biosynthesis.

Interestingly, the WUS paralog WOX9/STIMPY (STIP) also plays an important role in light, sugar and CK crosstalk at the shoot apex. Meristems of weaker stip mutants arrest at seedling stage but can be rescued by addition of sucrose to the medium (Wu et al., 2005). STIP was further shown to integrate CK signals at the meristem and STIP over-expression can partially overcome the deficits of CK perception mutants (Skylar et al., 2010). In contrast to WUS, however, sugar acts downstream of STIMPY, and it would be interesting to investigate whether the same is true for light signals.

Our experiments suggested that light and metabolic signals converge downstream of CK and locally at the SAM and consistently, we identified the TOR kinase to be an integrator of both signaling pathways. Earlier reports had shown that glucose-TOR signaling regulates photosynthesis-driven activation of the root meristem (Xiong et al., 2013) and we demonstrated here that also shoot stem cell activation by metabolizable sugars is dependent on TOR kinase. Intriguingly, TOR activity was not only required for the response to energy availability, but also for WUS stimulation by light. This activity was independent of photosynthesis, because the TOR pathway was also activated under norflurazon treatment, in the absence of CO2 or the suppression of COP1 function. The direct regulation of TOR kinase by light signaling elegantly explains the recently discovered impact of phytochromes on the metabolic state of the plant (Yang et al., 2016), but also represents another striking example of a so far undiscovered re-wiring of a core regulatory component within the stem cell network. Consistently, upstream regulators of TOR kinase described in other organisms are not well conserved in plants (Dobrenel et al., 2016) and thus evolution seems to have found alternative mechanisms to activate the TOR pathway in a highly context dependent manner. Coupling light and energy sensing via TOR could help plants to prepare for the dramatic developmental transition from skotomorphogenesis to photomorphogenesis, which involves transcriptional re-programming of almost a quarter of the genome (López-Juez et al., 2008). Light dependent activation of TOR kinase could allow etiolated seedlings to build up the photosynthetic apparatus, initiate ribosome biogenesis and prime stem cells via the expression of WUS to efficiently shift gear towards organogenic growth and development, once energy becomes available.

Material and methods


Double reporter

Request a detailed protocol

The pCLV3:mCHERRY (pMD149) construct was obtained by LR reactions of the pDONR221-mCHERRY-NLS plasmid (pFK143) with pFK317, a pGreen-IIS (Hellens et al., 2000; Mathieu et al., 2007) based binary vector with CLV3 1.4 kb promoter and 1.2 kb terminator sequences and kanamycin resistance cassette. The pWUS:3xVENUS-NLS construct (pTS81) was generated accordingly, using a pGREEN-IIS based binary vector with a 4.4 kb genomic WUS promoter upstream of the ATG and 2.8 kb WUS terminator downstream of the stop codon (pFK398) and a Basta resistance cassette. In both constructs the N7 NLS (Daum et al., 2014) was used.

To produce ckx6 mutants by CRISPR-Cas9 the two gRNAs GCATGGTTCTTTTCCTGAGG and GAAGCTGCAGGTCTACAGTG targeting the CKX6 locus were inserted in the plasmid pHEE401E as described by the authors (Wang et al., 2015) to generate pAP101.

All other constructs are based on the GreenGate cloning system (Lampropoulos et al., 2013). Details about the cloning of the modules and assembled plasmids for plant transformation can be found in Supplementary file 2.

Plant material

Request a detailed protocol

All used plant lines were in the Col-0 background. Arabidopsis Col-0 was transformed by floral dip (Clough and Bent, 1998) using the A. tumefaciens strain ASE (pSOUP+) carrying the pGREEN-IIS and GreenGate based plasmids. The Agrobacteria strain GV3101 was used for the transformation of plants with the plasmid pAP101.

To select for the presence of the corresponding resistance markers, plants were grown on plates supplemented with 5 mM D-Ala, 20 µg/ml Hygromycin B or 50 µg/ml Kanamycin or grown on soil and sprayed with the herbicides Inspire (Syngenta Agro AG, Dielsdorf, Switzerland) (7.6 µl/l) (Rausenberger et al., 2011) or Basta (0.02%) 1 week after germination.

The plasmids pMD149 and pTS81 were used to generate the reporter lines pCLV3:mCHERRY-NLS and pWUS:3xVENUS-NLS, respectively. The double reporter line is comprised of a cross of both lines. The WUS-GFP rescue line (pWUS:WUS-linker-GFP in wus mutant background [Daum et al., 2014]) was also crossed to the pCLV3:mCHERRY-NLS line. Both crossed lines were homozygous for all loci.

The mutant cop1-4 (McNellis et al., 1994) was crossed to pPIN1:PIN1-GFP (Benková et al., 2003) and the double reporter line was crossed to the mutants cop1-4 (McNellis et al., 1994), phyA-211 (Reed et al., 1994), phyB-9 (Reed et al., 1993), cry1-304/cry2-1 (Mockler et al., 2003), hy5 (SALK_096651C), ckx5-1 (SALK_064309) and ckx6-2 (SALK_070071) (Bartrina et al., 2011). All of these crossed lines used in the manuscript were homozygous mutants and screened to be also homozygous for carrying the pWUS:3xVENUS-NLS construct. Additional cop1 alleles, cop1-6 (McNellis et al., 1994) and cop1-19 (Favory et al., 2009), were used for qRT-PCR and the TOR activity assay.

A homozygous double reporter/ckx5 line was transformed with the CRISPR/CAS9 plasmid pAP101 to create a ckx5/ckx6 double mutant in the double reporter background. Genomic DNA of T1 plants was PCR-amplified using the oligos A05465 (ATCAAAAACCCTTTTCCATCCT) and A05466 (AGCCAACTTAAAGGCTATGCAG) and the PCR product was digested with Eco81I to screen for homozygous ckx6 mutants at the locus of the first gRNA. The genomic region of T1 plants that produced undigested PCR fragments was amplified with the oligos A05465 and A05468 (ACTTGAGGGTCTCATGCAAAAT), and sequenced after subcloning the PCR product into pGEM-T Easy (Promega, Madison, WI)) to confirm the mutation of the CKX6 locus. T2 plants of homozygous T1 mutants were used in this manuscript.

Growth conditions

Request a detailed protocol

Seeds were sterilized with 70% ethanol and 0.1% Triton for 10 min and afterwards washed twice with autoclaved water. All seeds were imbibed in water for three days at 4°C in darkness before plating 30–40 seeds on 0.5x MS (Duchefa, Haarlem, The Netherlands), 0.8% Phytoagar in vented petri dishes that were sealed with micropore tape (3 M, Two Harbors, MN). Germination was induced by 150 µmol*m−2*s−1 of white light for 6 hr. Afterwards plants were either kept in white light, transferred to darkness or to LED cabinets equipped with red (673 nm), far-red (745 nm) and blue (471 nm) LEDs (floralLEDs StarterKit 2, CLF Plant Climatics, Wertingen, Germany). Unless otherwise noted, constant red, far-red or blue light was applied with an intensity of 30 µmol*m−2*s−1. All white light treatments were carried out at 150 µmol*m−2*s−1 of fluorescent white light with a 16-h-light/8-h-dark cycle. Starting with the light induction of germination, plants were kept at 21–22°C. 0.5x MS plates were supplemented with 1% (30 mM) sucrose or 15 mM glucose only if mentioned explicitly. Growth in a CO2-deficient environment was accomplished by growing unsealed vented petri dishes in a sealed plastic bag with 5 g NaOH and 5 g CaO (Kircher and Schopfer, 2012).

Four day old seedlings that were harvested for protein extracts and metabolite measurements were grown vertically on top of 100 µm nylon meshes (nitex 03/100–44, Sefar, Heiden, Switzerland). For the glucose treatment in these experiments seedlings were transferred with the mesh to plates containing 15 mM glucose. Light treatments entailed irradiation with 60 µmol*m−2*s−1 of blue and red light each. Both treatments were started 24 hr before and continued until the harvest of the material. To exclude ungerminated seeds and empty seed shells form the metabolite measurements, only above root tissue was harvested. All seedlings were rinsed with distilled water prior to harvest.

Liquid culture

Request a detailed protocol

About 30–40 seeds, that were imbibed as described above, were sown in 3 ml 0.5x MS in petri dishes of 35 mm diameter. Plants were kept in darkness for three days after the induction of germination by 6 hr light treatment. The medium of three day old etiolated seedlings was supplemented with 15 mM glucose and/or 0.5–2 µM AZD-8055 (Santa Cruz Biotechnology, Dallas, TX). Stock solutions of 1000x concentrated AZD-8055 were diluted in DMSO, therefore control plants were mock treated with the same volume of DMSO.

In situ hybridization

Request a detailed protocol

A detailed protocol of the in situ hybridization procedure was provided previously (Medzihradszky et al., 2014).

RNA extraction and qRT-PCR

Request a detailed protocol

Total RNA was extracted from 100 mg seven day old Arabidopsis seedlings with the Plant RNA Purification Reagent (Invitrogen, Carlsbad, CA) according to the instructions of the manufacturer, digested with TURBO DNAse (Ambion/ Thermo Fisher, Waltham, MA) and purified with RNeasy Mini Kit (Quiagen, Hilden, Germany). Equal amounts of RNA were used for oligo dT primed cDNA synthesis with the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA). The qPCR reaction was set up using the SG qPCR Master Mix (EURx, Gdansk, Poland) and run on a Chromo4 Real-Time PCR System (Bio-Rad, Hercules, CA) with technical duplicates each. The relative expression levels were calculated using the ddCt method with PP2A expression as a reference. Results shown are the means of 2 independent biological replicates. The following oligos were used: PP2A: A01067: TAA CGT GGC CAA AAT GAT GC and A01068: GTT CTC CAC AAC CGC TTG GT; WUS: A00317: TTA TGA TGG CGG CTA ACG AT and A00318: TTC AGT ACC TGA GCT TGC ATG; PHYB total: A05986: AGC AAA TGG CTG ATG GAT TC and A05987: GCT TGT CCA CCT GCT GCT AT; PHYB 3'UTR: A05984: GCG ACC ATT GTC AAC TGC TA and A05985: CTC CGA CGT CGT TAG ACA CA.

Histochemical GUS staining

Request a detailed protocol

Four day old seedlings were harvested in 90% acetone and incubated at −20°C for at least 1 hr. Seedlings were washed with PBS and incubated in substrate buffer (1x PBS (pH 7.0), 1 mM K3Fe(III)(CN)6, 0.5 mM K4Fe(II)(CN)6, 1 mM EDTA, 1% Triton X-100, 1 mg/ml X-gluc) at 22°C over night. After staining, the seedlings were incubated with 60% and subsequently in 95% ethanol to remove chlorophyll.

Microscopy and fluorescence quantification

Request a detailed protocol

To image the fluorescent reporter activities in the SAM, seedlings were split in half by pulling one cotyledon away from the SAM with forceps. The exposed meristem was imaged with a Zeiss Imager M1, the Plan-APOCHROMAT 20x/0.8 objective (Zeiss, Oberkochen, Germany) and YFP- and mCHERRY-specific filter sets. For the quantification of VENUS and mCHERRY signal intensities the settings for the intensity of the fluorescent lamp and exposure times were unchanged for each channel. 16-bit B/W pictures of at least 20 SAMs per sample were analyzed by FIJI (Schindelin et al., 2012), using the background subtraction (100 pixel rolling ball radius) prior to measuring the mean gray value of a circular area surrounding the SAM with a diameter of 51 µm (100 pixels) for WUS and 41 µm (80 pixles) diameter for CLV3. Quantifications in each figure were normalized to the median of the fluorescence levels of wild-type plants grown in red light for four days. Only exception: in Figure 5A and B we used the glucose treated plants as a reference and in Figure 5D the cop1 mutant plants (second box in each box plot). For all these experiments plants of one experimental set were always grown and analyzed in parallel to the untreated (dark-grown) and the corresponding reference sample.

In situ sections were analyzed with the same microscope and a 40x/0.95 Plan-APOCHROMAT objective (Zeiss, Oberkochen, Germany). Equipment and settings used for confocal microscopy was described earlier (Daum et al., 2014).

TOR activity assay

Request a detailed protocol

Proteins were extracted from 50 mg materials in 250 µl 2x Laemmli buffer (0.25 mM Tris-HCL pH 6.8, 8% SDS, 5% ß-mercaptoethanol, 20% glycerol) supplemented with 1.5% phosphatase inhibitor cocktail 2 (Sigma-Aldrich, St. Louis, MO). After adding extraction buffer, samples were briefly mixed and heated at 95°C for 10 min. Cellular debris was removed by two centrifugation steps (10 min, 14,000 rpm, 4°C). 20 µg protein were separated on a 10% SDS gel and transferred to PVDF membrane. Phospho-p70 S6 kinase (Thr(P)-389) polyclonal antibody (No.9205, Cell Signaling Technology, Cambridge, UK) was used to detect S6K phosphorylation. S6K1/2 antibody (AS12-1855, Agrisera AB, Vännäs, Sweden) was used to detect total S6K1 and S6K2.

Metabolite measurements

Request a detailed protocol

Three biological replicates were harvested for and analyzed as described (Poschet et al., 2011) by the Metabolomics Core Technology Platform at the University of Heidelberg. PCA was performed with statistical language R (version 3.3.1). For the analysis all metabolite data except the amino acid measurements were used.


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
    A role for cytokinins in de-etiolation in arabidopsis (det mutants have an altered response to cytokinins)
    1. J Chory
    2. D Reinecke
    3. S Sim
    4. T Washburn
    5. M Brenner
    Plant Physiology 104:339–347.
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
    Tor signaling and nutrient sensing
    1. T Dobrenel
    2. C Caldana
    3. J Hanson
    4. C Robaglia
    5. M Vincentz
    6. B Veit
    7. C Meyer
    Annual Review of Plant Biology, 67, 10.1146/annurev-arplant-043014-114648.
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
    Regulation of photoperiodic flowering by Arabidopsis photoreceptors
    1. T Mockler
    2. H Yang
    3. X Yu
    4. D Parikh
    5. YC Cheng
    6. S Dolan
    7. C Lin
    Proceedings of the National Academy of Sciences of the United States of America 100:2140–2145.
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
    Phytochrome A and phytochrome B have overlapping but distinct functions in arabidopsis development
    1. JW Reed
    2. A Nagatani
    3. TD Elich
    4. M Fagan
    5. J Chory
    Plant Physiology 104:1139–1149.
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
    Gene expression map of the Arabidopsis shoot apical meristem stem cell niche
    1. RK Yadav
    2. T Girke
    3. S Pasala
    4. M Xie
    5. GV Reddy
    Proceedings of the National Academy of Sciences of the United States of America 106:4941–4946.
  70. 70
    Photoreceptor effects on plant biomass, resource allocation, and metabolic state
    1. D Yang
    2. DD Seaton
    3. J Krahmer
    4. KJ Halliday
    Proceedings of the National Academy of Sciences of the United States of America 113:7667–7672.
  71. 71
  72. 72
  73. 73
  74. 74

Decision letter

  1. Christian S Hardtke
    Reviewing Editor; University of Lausanne, Switzerland

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Integration of light and metabolic signals for stem cell activation at the shoot apical meristem" for consideration by eLife. Your article has been favorably evaluated by Ian Baldwin (Senior editor) and three reviewers, one of whom is a member of our Board of Reviewing Editors. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

All reviewers agree that your work is of general interest and in principle support publication. However, they also agree that a few issues have to be addressed before the work can be accepted. In your revision, please pay special attention to the following points:

1) The reviewers are worried about the validity of some of the pharmacological experiments because of possible indirect or side effects of the drugs (in particular of norfluorazon and lincomycin). Therefore, they believe that your paper would be substantially strengthened if you could repeat the basic introductory experiments (Figures 1 and 2) in a CO2-free atmosphere.

2) The reviewers also have some concerns regarding the plant material, especially with regard to the cop1 allele used. They ask that some of the basic experiments are verified with a cop1 null allele.

3) The reviewers acknowledge the use of reporters as an output for CLV3/WUS activity, but also wonder whether some of the basic observations could be confirmed by qPCR analysis of the endogenous genes?

Please find the reviewer comments attached below for more details, and please respond to them to the best of your capacity.

Reviewer #1:

This manuscript from the Lohmann lab and colleagues presents a complex set of data, which indicate that SAM activation is both light- and energy-status dependent in Arabidopsis. Overall, the data appear solid and are presented in a transparent manner, and the conclusions are largely justified from my point of view. However, the authors' conclusions strongly hinge on the quantification of two reporters under different conditions or in different genetic backgrounds, and I believe some improvements are required to make the manuscript acceptable for publication.

1) I have one major concern with respect to the genetic material. Several analyses are based on experiments with a mutant in COP1, a central negative regulator of photomorphogenesis. Understandably, the authors use one of the viable cop1 alleles in their work, the cop1-4 mutant. However, within the cop1 allelic series, this allele has always been the most mysterious. Unlike true null alleles, cop1-4 produces a truncated protein that comprises both the RING finger and coiled coil domains, yet alleles that retain these domains as well but are truncated further C-terminal or carry certain point mutations in the WD40 repeat domain also have a strong phenotype.

Therefore, I believe it is important to check whether the results obtained with cop1-4 are representative. I understand that it would be too much to ask to repeat reporter experiments in another cop1 background, but I think the authors could check the principal physiological responses in true cop1 null alleles, which should be easily available. In particular, the authors could repeat the experiment of Figure 1B and 5E. They could also try to detect the effect of cop1 on WUS expression by qPCR instead of a reporter, the difference appears strong enough although it is restricted to few cells (Figure 2B).

2) Another genetic concern: I believe the authors are formally right to conclude that HY5 has no role in light-dependent stem cell activation, however it is important to remember that unlike cop1, none of the COP1-target mutants has a phenotype that is as absolute skotomorphogenic as cop1 is photomorphogenic. If their conclusions with respect to cop1 are right, multiple mutants combining various COP1 targets should eventually show the pertinent defect. Among others, the hy5 hyh double mutant comes to mind. In the shoot, HYH is stronger expressed than HY5, and hy5 hyh double mutants have been reported to have meristematic defects, like "delayed" organ formation. I believe the authors should check light-dependent SAM activation at least in hyh single and hy5 hyh double mutants, and maybe also pertinent triple mutants with additional factors.

3) With respect to responses illustrated by images only, like cop1 shoot formation on +/- suc, are those responses fully penetrant? If so, this should be explicitly stated, if not, proportions clearly indicated.

4) One of the two ML1 transgenic lines deviates from the highlighted phenotype (Figure 2—figure supplement 1D). Why is that? Is it an expression problem? As I understand, the phyB mutant was not tagged? Maybe the authors can present evidence from additional lines and/or correlation with expression levels. As is, their statement regarding ML1 is misleading, because one out of two lines shows the other phenotype, so it's a 50:50 choice.

5) With regard to the cytokinin experiments, and the sometimes inconclusive contribution, I wonder whether the actual cytokinin used is of importance? Given the variety of cytokinins and their reported shoot- and root-specific activities, the authors might find a "better" cytokinin, which might have a more clear effect on WUS expression.

6) Because of the importance of the fluorescence measurements, I would like the authors to confirm that samples analyzed for one graph were grown in parallel and analyzed with identical settings.

Reviewer #2:

This is a very interesting manuscript exploring how light and metabolic signals activate the SAM. The SAM is dormant in etiolated seedlings and gets activated upon light perception. As shown previously the SAM of etiolated cop1 seedlings is activated by adding sugar thereby leading to the formation of leaves (even flowers) in darkness. This suggests that both light signals (constitutively on in cop1) and metabolic signals cooperate to enable SAM activation. The authors explore the molecular mechanisms underlying this activation. The authors show that the CLV3 expression domain is rather constant across conditions while WUS expression is induced by light. A number of experiments indicate that this light activation comprises both light and metabolic signals. TOR is implicated in the metabolic regulation of WUS expression while the phytohormone CK is involved in light regulation of WUS expression. This paper should be of broad interested for developmental biologists. Below I list a few issues that the authors should clarify.

1) Based on WUS expression in cop1 +/- sucrose and WT +/- light and the use of NF and Linc (Figure 2), the authors conclude that both light and metabolic signals contribute to WUS expression. How can we be sure that NF and Linc were really effective in the experiment shown in 2A? More generally, if at all possible it would more elegant/convincing to show the role of light on the production of sugars by performing at least one experiment in a CO2 free environment (see for example Kircher and Schopfer 2012). This would not lead to the rather drastic effects of these drugs on chloroplasts. In principle the effect of CO2-free air could be complemented by adding sucrose. Haydon et al., 2013 also complemented the NF effect by adding sucrose which to some extent rules out non-specific effects of NF.

2) The role of CK is potentially quite complex and I'm not sure that the current data allows drawing a clear conclusion. The authors propose that CK promote WUS expression by transmitting the light signal (e.g. subsection “Mechanisms of hormonal stem cell activation”, end of last paragraph). In Figure 2A one can observe that light-grown plants treated with NF still show strong WUS expression. However, on Figure 3J light grown seedlings treated with NF show absolutely no TCS:GUS signal, indicating no CK activity. How then could such seedlings express WUS (Figure 2A) given that the metabolic signal should be gone (in the presence of NF) and TCS:GUS is also gone? A second problem with the model is the role of light-regulated CKX5/6 expression. The authors propose that this is how light regulates the CK function in this process. However, light regulation of WUS expression is just as robust in the ckx5/ckx6 double mutant than in the WT (4B). It therefore rather appears that these genes are involved in basal regulation of WUS expression and not in light regulation. It would actually be interesting to test this by adding sucrose to the double mutant and look for signs of leaf development in darkness rather than hypocotyl elongation as shown in supplementary Figure 4.

3) A potential difficulty with the role of CK in this process and the use of drugs like NF is that CK biosynthesis requires plastids and chloroplast development is promoted by CK. Not sure how this can be untangled but it should be discussed.

4) All figure legends should be more explicit and provide detailed information about the exact light conditions (intensity, color), presence of sucrose and numbers of seedlings used per experiment. For example, I don't see which data correspond to + sucrose (hatched box) in 2A.

Reviewer #3:

This interesting manuscript investigates the regulation of the stem cell inducer WUSCHEL (WUS) and of it repressor CLAVATA3 (Clv3) by metabolic, hormonal and light signals using fluorescent markers driven by the promoters of these genes. This manuscript covers a lot of ground and makes a thorough analysis of the factors regulating the expression of these reporter genes. Specifically the role of cytokinins as well as sucrose and sugars in inducing WUS expression is shown and the obtained data suggest that the Target Of Rapamycin (TOR) kinase plays a central role in connecting metabolic signals to WUS induction. This manuscript is well written on the overall, although some Results parts could be shortened, and given the central and conserved roles of both TOR and WUS/Clv3 in promoting organ formation in plants, it is likely to be of interest for a large audience.

Nevertheless, I have a few points that, to my opinion, should be addressed by the authors:

1) It is not clear from the Methods if the WUS 5'UTR is included in the chimaeric construct used, which should be more clearly defined? This could be important given the translation regulations of WUS expression (see Cui et al., PCE 2015). Thus I am not sure that a transcriptional fusion with a reporter gene completely recapitulates WUS or Clv3 regulations.

2) Therefore I think that the data obtained with the fluorescent markers should be backed up, for the most important experiments, with another method like QPCR or even better immunolocalization. In situ hybridization was used but only for the first experiment.

3) The effect of TOR inhibition on WUS induction by sugars or light is quite clear and interesting. However, this effect could be indirect and linked to the pleiotropic effect of TOR inhibition on development and metabolism. This part of the paper is mainly descriptive and the authors could try to find more mechanistic evidence by mining the available data on the impact of TOR inhibition on transcriptome or metabolome. The western blot used to measure S6K phosphorylation, a classical readout for TOR activity, could be improved. The molecular mass of both phosphorylated and total S6K bands should be indicated together with a picture of the whole membrane. Much less proteins seem to have been loaded for dark-grown plants? Also a control experiment with AZD should be performed to check for lower S6K phosphorylation.

4) Some differences in metabolite abundance are quite small and should be confirmed by statistical analyses to avoid over-interpretation of the results.


Author response

All reviewers agree that your work is of general interest and in principle support publication. However, they also agree that a few issues have to be addressed before the work can be accepted. In your revision, please pay special attention to the following points:

1) The reviewers are worried about the validity of some of the pharmacological experiments because of possible indirect or side effects of the drugs (in particular of norfluorazon and lincomycin). Therefore, they believe that your paper would be substantially strengthened if you could repeat the basic introductory experiments (Figures 1 and 2) in a CO2-free atmosphere.

We understand that the pharmacological experiments using the substances lincomyin and norflurazon bear the risk of triggering indirect side effects. We therefore now carried out additional experiments using CO2-deficient environment as proposed by reviewer #2 and described earlier in Kircher and Schopfer, 2012. The new experiments lead to the same conclusion as our previous experiments with norflurazon. The growth of plants in a CO2-deficient environment also inhibited development in light and could be rescued by the addition of sucrose to the medium (Figure 2—figure supplement 1C). In 4 day old seedlings the CO2-deficiency did not affect light induced WUS-expression (Figure 2—figure supplement 1B) but strongly suppressed the TCS reporter activity (Figure 3—figure supplement 1C).

2) The reviewers also have some concerns regarding the plant material, especially with regard to the cop1 allele used. They ask that some of the basic experiments are verified with a cop1 null allele.

We used cop1 mutants in several of our experiments. Since cop1 null mutants arrest at early seedling stage (McNellis et al., 1994), we used the weak allele cop1-4. The cop1-4 mutant expresses a truncated COP1 protein that lacks the WD repeats. A recent publication shows that the comparatively weak phenotype of the cop1-4 mutant relies on the SPA proteins that can partially substitute the lack of the WD repeats that are missing in cop1-41. In absence of the SPA proteins the COP1-4 protein has no activity.

Addressing the concerns of Reviewer #1, we want to point out that the development of cop1 mutants in darkness is not restricted to the cop1-4 allele. It has already been described in previous publications for the alleles cop1-1, cop1-6 and cop1-8 (Kircher & Schopfer, 2012; Nakagawa & Komeda, 2004).

Following the suggestions of the reviewers, we now repeated some key experiments with other cop1 mutant alleles (namely cop1-6 (McNellis et al., 1994) and cop1-19 (Favory et al., 2009) and all confirmed the results obtained with cop1-4. We show that in all alleles tested WUS expression is induced in darkness (Figure 2—figure supplement 1E) and that S6K phosphorylation levels are elevated (Figure 5—figure supplement 1C). We therefore conclude that the effects are not restricted to the cop1-4 allele, but characteristic for cop1 mutants in general.

3) The reviewers acknowledge the use of reporters as an output for CLV3/WUS activity, but also wonder whether some of the basic observations could be confirmed by qPCR analysis of the endogenous genes?

Many conclusions of our manuscript are based on the analysis of the WUS reporter line because it is by far the most sensitive and robust way to quantify WUS promoter activity. We have characterized these reporters in great detail and found them to faithfully recapitulate in many different settings, including other transgenes, suggesting that positional effects have minor influence on their output (see Author response image 1pWUS:mCHERRY-GUS reporter in 4 day old seedlings as an example).

As suggested by the reviewers, we have now quantified WUS expression by qRT-PCR to independently verify our results obtained with the reporter line. We were able to confirm our findings, however the lack of spatial resolution and the small number of expressing cells translated to low signal to noise ratio in the qRT assays. Therefore, we only detected mild expression changes of WUS with some variation in 4 day old seedlings grown in darkness, red light or in presence of sucrose (see Author response image 2). We therefore decided to test 7 day old seedlings, which showed very reliable results (Figure 2—figure supplement 1D and E and Figure 4—figure supplement 1B). The qRT-PCR analysis confirmed all key findings, including the induction of WUS expression by light and sucrose (Figure 2—figure supplement 1D) as well as the positive effect of the cop1 mutation (Figure 2—figure supplement 1D and E) and the ckx5/ckx6 double mutant (Figure 4—figure supplement 1B) on WUS expression.

We want to point out that quantitative analysis of WUS expression by qRT-PCR is problematic, since we need to compare plants of different morphology and thus an appropriate reference gene is not available (the issue was discussed in detail by Demidenko and Penin, 2012 2). We believe it to be essential to analyze WUS expression with cellular resolution and thus view the qRT-PCR results as a qualitative rather than a quantitative confirmation of our reporter gene analysis.

Please find the reviewer comments attached below for more details, and please respond to them to the best of your capacity.

Reviewer #1:

This manuscript from the Lohmann lab and colleagues presents a complex set of data, which indicate that SAM activation is both light- and energy-status dependent in Arabidopsis. Overall, the data appear solid and are presented in a transparent manner, and the conclusions are largely justified from my point of view. However, the authors' conclusions strongly hinge on the quantification of two reporters under different conditions or in different genetic backgrounds, and I believe some improvements are required to make the manuscript acceptable for publication.

1) I have one major concern with respect to the genetic material. Several analyses are based on experiments with a mutant in COP1, a central negative regulator of photomorphogenesis. Understandably, the authors use one of the viable cop1 alleles in their work, the cop1-4 mutant. However, within the cop1 allelic series, this allele has always been the most mysterious. Unlike true null alleles, cop1-4 produces a truncated protein that comprises both the RING finger and coiled coil domains, yet alleles that retain these domains as well but are truncated further C-terminal or carry certain point mutations in the WD40 repeat domain also have a strong phenotype.

Therefore, I believe it is important to check whether the results obtained with cop1-4 are representative. I understand that it would be too much to ask to repeat reporter experiments in another cop1 background, but I think the authors could check the principal physiological responses in true cop1 null alleles, which should be easily available. In particular, the authors could repeat the experiment of Figure 1B and 5E. They could also try to detect the effect of cop1 on WUS expression by qPCR instead of a reporter, the difference appears strong enough although it is restricted to few cells (Figure 2B).

Done – Please see response to Reviewing Editor point 2 above.

2) Another genetic concern: I believe the authors are formally right to conclude that HY5 has no role in light-dependent stem cell activation, however it is important to remember that unlike cop1, none of the COP1-target mutants has a phenotype that is as absolute skotomorphogenic as cop1 is photomorphogenic. If their conclusions with respect to cop1 are right, multiple mutants combining various COP1 targets should eventually show the pertinent defect. Among others, the hy5 hyh double mutant comes to mind. In the shoot, HYH is stronger expressed than HY5, and hy5 hyh double mutants have been reported to have meristematic defects, like "delayed" organ formation. I believe the authors should check light-dependent SAM activation at least in hyh single and hy5 hyh double mutants, and maybe also pertinent triple mutants with additional factors.

The hy5 mutation did not have any effect WUS expression in our reporter line. However, Reviewer #1 is right in pointing out that other COP1 targets might be also involved in downstream signaling and therefore the effects of the hy5 mutation might be masked by redundancy. Since we cannot exclude that HY5 is involved in regulation of meristem activity, we now state in the text:

"However, hy5 mutants showed no defect in activation of WUS expression (Figure 2—figure supplement 1B), suggesting that either SAM stem cell activation makes use of another COP1-targeted transcriptional transducer or the function of HY5 can in this case be substituted by the HY5 HOMOLOG (HYH)."

and in the Discussion:

"However, we cannot exclude that the HY5 homolog HYH with partially overlapping function but higher expression level in the shoot might mask any effect of hy5 on WUS expression (Holm et al., 2002; Sibout et al., 2006). Since hy5/hyh mutants showed deficiencies in development of the first leaved future experiments analyzing such a double mutant might give further insights."

We currently prepare CRISPR-CAS9 mutants of HYH in the hy5 double reporter background to test this hypothesis. However, these experiments will take six months to carefully execute and go well beyond the scope of this manuscript.

3) With respect to responses illustrated by images only, like cop1 shoot formation on +/- suc, are those responses fully penetrant? If so, this should be explicitly stated, if not, proportions clearly indicated.

We now clarify the percentage of plants with shoot formation in the text. We see that 100% of cop1-4 mutants developing leaves on sucrose. In contrast, only approximately one third of WT plants develop leaves on norflurazon CO2-deficient environment in light when supplemented with sucrose. In the absence of sucrose we never see development of the cop1 mutants in darkness or WT on norflurazon or CO2-deficient environment in light.

4) One of the two ML1 transgenic lines deviates from the highlighted phenotype (Figure 2—figure supplement 1D). Why is that? Is it an expression problem? As I understand, the phyB mutant was not tagged? Maybe the authors can present evidence from additional lines and/or correlation with expression levels. As is, their statement regarding ML1 is misleading, because one out of two lines shows the other phenotype, so it's a 50:50 choice.

When we grew pML1:PHYB Y276H expressing lines in darkness, some showed a cop-like phenotype, while others resembled WT seedlings. We now show that this correlates with the expression level of PHYB by analyzing the total and endogenous PHYB expression by qRT PCR. Line AP88.2.1 (cop phenotype in darkness) shows 15x higher level of PHYB than line AP88.1.3 (WT phenotype) (Figure 2—figure supplement 1I). Additionally we also analyzed the expression level of several lines expressing pML1:PHYB Y276H-YFP and also saw a clear negative correlation of hypocotyl length and PHYB Y276-YFP expression strength (see Author response image 3 pictures of 2 seedlings of each line grown for 4 days in darkness and above each line corresponding epifluorescence pictures of the YFP signal of hypocotyl cells with intensity coded in FIJI LUT "fire").

5) With regard to the cytokinin experiments, and the sometimes inconclusive contribution, I wonder whether the actual cytokinin used is of importance? Given the variety of cytokinins and their reported shoot- and root-specific activities, the authors might find a "better" cytokinin, which might have a more clear effect on WUS expression.

To elucidate the role of different cytokinin molecules we now assayed the effect of Kinetin and Zeatin on WUS expression. However, we did not see striking differences in the activation of WUS expression (see Author response image 4, plants were grown for 6 days in darkness and treated with 0.5 µM of cytokinin during the last 3 days).

6) Because of the importance of the fluorescence measurements, I would like the authors to confirm that samples analyzed for one graph were grown in parallel and analyzed with identical settings.

All datasets were grown and analyzed in parallel with the reference sample (which is either the red light treated sample or the glucose treated sample) as well as an untreated (dark grown) sample and we now state so explicitly in the Materials and methods section:

"For all these experiments plants of one experimental set were always grown and analyzed in parallel to the untreated (dark-grown) and the corresponding reference sample."

We already mentioned in the Methods that microscope settings were identical during all measurements. To illustrate that the measurements were highly reproducible we present an example of two experiments, which were not done at the same time. The plot shows WUS expression in dark-grown WT, red-light-grown WT and red-light-grown phyB mutants grown and analyzed days apart (box 1-3 and box 4-6).

Reviewer #2:

1) Based on WUS expression in cop1 +/- sucrose and WT +/- light and the use of NF and Linc (Figure 2), the authors conclude that both light and metabolic signals contribute to WUS expression. How can we be sure that NF and Linc were really effective in the experiment shown in 2A? More generally, if at all possible it would more elegant/convincing to show the role of light on the production of sugars by performing at least one experiment in a CO2 free environment (see for example Kircher and Schopfer 2012). This would not lead to the rather drastic effects of these drugs on chloroplasts. In principle the effect of CO2-free air could be complemented by adding sucrose. Haydon et al., 2013 also complemented the NF effect by adding sucrose which to some extent rules out non-specific effects of NF.

We want to thank Reviewer #2 for pointing out that growth a CO2-free environment would be a good alternative for the norflurazon and lincomycin treatments. We now have carried out the suggested experiments and found them to confirm our earlier results. For further details please see response to Reviewing Editor point 1 above.

2) The role of CK is potentially quite complex and I'm not sure that the current data allows drawing a clear conclusion. The authors propose that CK promote WUS expression by transmitting the light signal (e.g. subsection “Mechanisms of hormonal stem cell activation”, end of last paragraph). In Figure 2A one can observe that light-grown plants treated with NF still show strong WUS expression. However, on Figure 3J light grown seedlings treated with NF show absolutely no TCS:GUS signal, indicating no CK activity. How then could such seedlings express WUS (Figure 2A) given that the metabolic signal should be gone (in the presence of NF) and TCS:GUS is also gone? A second problem with the model is the role of light-regulated CKX5/6 expression. The authors propose that this is how light regulates the CK function in this process. However, light regulation of WUS expression is just as robust in the ckx5/ckx6 double mutant than in the WT (4B). It therefore rather appears that these genes are involved in basal regulation of WUS expression and not in light regulation. It would actually be interesting to test this by adding sucrose to the double mutant and look for signs of leaf development in darkness rather than hypocotyl elongation as shown in supplementary Figure 4.

We appreciate the reviewers' thought on this complex matter and agree that the proposed role of CK in transmitting light signals likely is only one of many.

We have carried out the experiment suggested to test a potential role of CK as a regulator of basal WUS expression. However, ckx5/ckx6 mutants grown in darkness for a prolonged time do not develop leaves, even in the presence of sucrose (see Figure 4—figure supplement 1D). Therefore, additional development promoting components are still missing in line with the CKX genes being only one element in the system. The reviewer is also right to point out the discrepancy between WUS activation and TCS activity, but since TCS is merely a read out B-type ARR activity and not of CK levels, and we have no knowledge on the relative sensitivities of the two promoters, or the directness of WUS regulation, we are unable to provide any further mechanistic insight into that matter at the moment.

We pointed out these complications in the following paragraph of the Discussion: "Also the activity of the CK output reporter pTCSn:GUS strictly depended on sucrose, but could be further stimulated by light, suggesting that CK signaling mainly acts to transmit light signals, but that elevation of CK levels genetically or by treatment are insufficient to elicit the full developmental response. Based on these results we suggest that light enhances CK levels by reducing the expression of CKX genes, however we cannot rule out other explanations, such as stimulation of CK biosynthesis."

3) A potential difficulty with the role of CK in this process and the use of drugs like NF is that CK biosynthesis requires plastids and chloroplast development is promoted by CK. Not sure how this can be untangled but it should be discussed.

To disentangle the dependency of CK biosynthesis on chloroplast development we now grew plant in a CO2-free atmosphere in addition to the pharmacological treatment to show the dependency of CK signaling on energy and this new experiment confirmed our original findings (Figure 3—figure supplement 1C).

4) All figure legends should be more explicit and provide detailed information about the exact light conditions (intensity, color), presence of sucrose and numbers of seedlings used per experiment. For example, I don't see which data correspond to + sucrose (hatched box) in 2A.

We tried to improve the readability of the figures and now add more information about the growth conditions in the figure legends. We also refer to the Materials and methods section, where we explained in detail the quantification of the fluorescence intensities.

Reviewer #3:

This interesting manuscript investigates the regulation of the stem cell inducer WUSCHEL (WUS) and of it repressor CLAVATA3 (Clv3) by metabolic, hormonal and light signals using fluorescent markers driven by the promoters of these genes. This manuscript covers a lot of ground and makes a thorough analysis of the factors regulating the expression of these reporter genes. Specifically the role of cytokinins as well as sucrose and sugars in inducing WUS expression is shown and the obtained data suggest that the Target Of Rapamycin (TOR) kinase plays a central role in connecting metabolic signals to WUS induction. This manuscript is well written on the overall, although some Results parts could be shortened, and given the central and conserved roles of both TOR and WUS/Clv3 in promoting organ formation in plants, it is likely to be of interest for a large audience.

Nevertheless, I have a few points that, to my opinion, should be addressed by the authors:

1) It is not clear from the Methods if the WUS 5'UTR is included in the chimaeric construct used, which should be more clearly defined? This could be important given the translation regulations of WUS expression (see Cui et al., PCE 2015). Thus I am not sure that a transcriptional fusion with a reporter gene completely recapitulates WUS or Clv3 regulations.

Reviewer #3 pointed out the importance of the 5'UTR in the regulation of WUS expression. The 5' and 3´ UTRs are part of our WUS reporter and the regulatory regions used in the reporter have been shown to fully rescue the meristem defect of wus mutants in the context of a WUS-GFP fusion, which has been published and is also used in our study (pWUS:WUS- linker-GFP in wus mutant background (Daum et al., 2014). To clarify the reporter design, we now state in the text:

"The pWUS:3xVENUS-NLS construct (pTS81) was generated accordingly, using a pGREEN- IIS based binary vector with a 4.4 kb genomic WUS promoter upstream of the ATG and 2.8 kb WUS terminator downstream of the stop codon (pFK398) and a Basta resistance cassette."

2) Therefore I think that the data obtained with the fluorescent markers should be backed up, for the most important experiments, with another method like QPCR or even better immunolocalization. In situ hybridization was used but only for the first experiment.

We have now repeated key experiments using qRT-PCR and confirmed our results obtained with the WUS reporter. For a detailed answer, please see response to Reviewing Editor point 3 above.

3) The effect of TOR inhibition on WUS induction by sugars or light is quite clear and interesting. However, this effect could be indirect and linked to the pleiotropic effect of TOR inhibition on development and metabolism. This part of the paper is mainly descriptive and the authors could try to find more mechanistic evidence by mining the available data on the impact of TOR inhibition on transcriptome or metabolome. The western blot used to measure S6K phosphorylation, a classical readout for TOR activity, could be improved. The molecular mass of both phosphorylated and total S6K bands should be indicated together with a picture of the whole membrane. Much less proteins seem to have been loaded for dark-grown plants? Also a control experiment with AZD should be performed to check for lower S6K phosphorylation.

Normalization of TOR activation assays is challenging in situations of diverging protein synthesis, such as light vs. dark, since TOR kinase has been described as a central regulator of protein synthesis. Therefore, we decided to load equal amounts of fresh weight to the gel instead of equal total protein amounts and to use unphosphorylated S6K1/2 for normalization. In our experience loading equal fresh weight results in rather similar amounts of unphosphorylated S6K1/2 signal, while protein levels correlated strongly with TOR activity, as expected. We now repeated the Western Blot analysis on AZD-8055 treated samples as control to confirm the specificity of the phosphorylation specific antibody (Figure 5—figure supplement 1C). As requested, we now show a larger section of the membrane and added indicators of molecular mass.

As suggested, we have again screened the literature and databases for candidates that might explain the effect of TOR on SAM development. Obviously, several regulators could be identified, but since we cannot provide any evidence of the contribution of these candidates in meristem regulation we would like to constrain ourselves from speculation at this point.

We hope that the manuscript text makes this point rather clear:

"Characteristic expression changes that were described in response to glucose-TOR signaling (Xiong et al., 2013) and E2Fa overexpression (Vandepoele et al., 2005; López- Juez et al., 2008), namely affecting genes involved in ribosome biogenesis, protein translation and cell proliferation have also been identified in microarray analyses of shoot apex tissue derived from young seedlings (López-Juez et al., 2008). These genes were rapidly and synchronously induced by photosynthetically active light preceding organ growth, which lead us to hypothesize that stem cell activation in the SAM might also be under control of the TOR kinase."

4) Some differences in metabolite abundance are quite small and should be confirmed by statistical analyses to avoid over-interpretation of the results.

We now added statistical information to all metabolite measurements and also added a PCA that analyses the overall variability of our data sets and replicates.


1) Ordoñez-Herrera, N. et al. A cop1 spa Mutant Deficient in COP1 and SPA Proteins Reveals Partial Co-Action of COP1 and SPA during Arabidopsis Post-Embryonic Development and Photomorphogenesis. Mol. Plant 8, 479–481 (2015).

2) Demidenko, N. V. & Penin, A. A. Comparative analysis of gene expression level by quantitative real-time PCR has limited application in objects with different morphology. PLoS One 7, 5–10 (2012).


Article and author information

Author details

  1. Anne Pfeiffer

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    AP, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  2. Denis Janocha

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    DJ, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  3. Yihan Dong

    Department of Molecular Plant Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    YD, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  4. Anna Medzihradszky

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    AM, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  5. Stefanie Schöne

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    SS, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  6. Gabor Daum

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    GD, Acquisition of data, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  7. Takuya Suzaki

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    Present address
    Graduate School of Life and Enviromental sciences, University of Tsukuba, Tsukuba, Japan
    TS, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  8. Joachim Forner

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    JF, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  9. Tobias Langenecker

    Department of Molecular Biology, Max Planck Institute for Developmental Biology, Tübingen, Germany
    TL, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  10. Eugen Rempel

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    ER, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  11. Markus Schmid

    Department of Molecular Biology, Max Planck Institute for Developmental Biology, Tübingen, Germany
    Present address
    Umeå Plant Science Centre, Umeå University, Umeå, Sweden
    MS, Drafting or revising the article, Contributed unpublished essential data or reagents
    Competing interests
    The authors declare that no competing interests exist.
  12. Markus Wirtz

    Department of Molecular Plant Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    MW, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  13. Rüdiger Hell

    Department of Molecular Plant Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    RH, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6238-4818
  14. Jan U Lohmann

    Department of Stem Cell Biology, Centre for Organismal Studies, Heidelberg University, Heidelberg, Germany
    JUL, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3667-187X


Baden-Württemberg Stiftung (Eliteprogramme for Postdocs)

  • Anne Pfeiffer

Deutsche Forschungsgemeinschaft (CellNetworks Cluster of Excellence)

  • Anne Pfeiffer

Deutsche Forschungsgemeinschaft (HE 1848/15-1)

  • Markus Wirtz
  • Rüdiger Hell

Deutsche Forschungsgemeinschaft (WI 3560/1-1)

  • Markus Wirtz
  • Rüdiger Hell

Deutsche Forschungsgemeinschaft (SFB 1036)

  • Markus Wirtz
  • Rüdiger Hell

European Research Council (Starting Grant 282139, StemCellAdapt)

  • Jan U Lohmann

Deutsche Forschungsgemeinschaft (SFB 873)

  • Jan U Lohmann

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Cornelia Klose and Roman Ulm for sharing photoreceptor and light signaling mutants, Andreas Hiltbrunner for the plasmid for mPPO and Inspire, Qi-Jun Chen for providing the CRISPR-Cas9 plasmids and the Metabolomics Core Technology Platform at the University of Heidelberg. This work was supported by the ERC grant (#282139) 'StemCellAdapt' to JL and the German research foundation (DFG) grants SFB873 to JL and grants HE 1848/15-1, WI 3560/1-1 and SFB 1036 to RH and MW. AP is indebted to the Baden-Württemberg Stiftung for the financial support of this research project by the Eliteprogramme for Postdocs.

Reviewing Editor

  1. Christian S Hardtke, University of Lausanne, Switzerland

Publication history

  1. Received: April 17, 2016
  2. Accepted: July 9, 2016
  3. Accepted Manuscript published: July 11, 2016 (version 1)
  4. Accepted Manuscript updated: July 27, 2016 (version 2)
  5. Version of Record published: August 1, 2016 (version 3)


© 2016, Pfeiffer et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 4,829
    Page views
  • 1,433
  • 50

Article citation count generated by polling the highest count across the following sources: Scopus, Crossref, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    2. Developmental Biology
    Zhiwei Lu et al.
    Research Article Updated
    1. Developmental Biology
    2. Neuroscience
    Jennifer A Honeycutt et al.
    Research Article