We designed a generalizable transgenic tool that allows conditional, cell type-specific disruption of gene function. The Gene Disruption Project has produced a publically available collection of genomic insertions that can be exchanged for other DNA sequences using ϕC31 integrase (Figure 1a). These MiMIC cassettes target 2854 coding introns within 1862 distinct genes (Venken et al., 2011a; Nagarkar-Jaiswal et al., 2015b). We reasoned that a strategy that uses intronic insertions to conditionally disrupt gene function would be broadly useful. Therefore, we designed FlpStop, a small construct for conditional gene disruption capable of integrating into MiMIC insertions (Figure 1b). Our approach incorporated two parallel strategies to disrupt gene expression. First, the construct acts on transcription using the SV40 and Tubα1 transcriptional terminators (Stockinger et al., 2005) (Figure 1a and Figure 1—figure supplement 1a). Second, the construct acts on translation by incorporating the MHC intron 18 splice acceptor followed by stop codons in all three reading frames (Venken et al., 2011a; Hodges and Bernstein, 1992) (Figure 1a and Figure 1—figure supplement 1a). Similar constructs have been used previously in flies to produce strong loss-of-function alleles (Lukacsovich et al., 2001; Schuldiner et al., 2008). These disruptive elements, hereafter designated SA-STOP for brevity, are flanked by two pairs of Flp recombinase target (FRT) sites that form a FLEx-switch, making this DNA region invertible and thus conditional (Schnütgen et al., 2003). The FRT sites are arranged such that in the presence of Flp recombinase, the construct can be inverted and then stably locked in the opposite orientation (Schnütgen et al., 2003) (Figure 1c). Therefore, in one orientation, the splice acceptor and the transcriptional terminators of the SA-STOP cassette lie on the non-transcribed DNA strand and do not interfere with the expression (non-disrupting, ND); after inversion, the SA-STOP cassette is relocated to the transcribed DNA strand, enabling it to interfere with gene activity (disrupting locked orientation, D lock) (Figure 1c). A conceptually similar construct was sufficient to conditionally disrupt a mitochondrial RNA helicase in zebrafish (Ni et al., 2012). Using the FlpStop approach, homozygous mutant cells can be induced in otherwise heterozygous animals by placing the conditional FlpStop allele in trans to an existing null allele and expressing Flp recombinase within target cells of interest (Figure 1d and Figure 1—figure supplement 1b,c). Use of an independent null allele avoids the potential effects of off-target mutations in a genetic background, as is standard practice in the field. In Drosophila, precise control of Flp expression can be easily achieved by expressing Flp under either the direct control of a specific promoter or the indirect control of a driver (e.g. the Gal4 system).

Figure 1 with 2 supplements see all

Download asset Open asset

Because the MiMIC cassette contains two attP target sites, two independent FlpStop insertions can be isolated at each locus: one where the initial cassette is in the non-disrupting orientation (ND, Figure 1c) and another where the cassette is inserted in the disrupting orientation (D, not shown). As a result, FlpStop reagents for both conditional disruption (non-disrupting to disrupting locked) and rescue (disrupting to non-disrupting locked) can be produced in a single round of transgenesis. In addition, these disrupting alleles produced by transgenesis provide a matched control in an isogenic genetic background for testing cassette mutagenicity in each locus.

To provide a cell-autonomous report of cassette inversion, we incorporated the cytosolic red fluorescent protein tdTomato into the cassette (Shaner et al., 2004). To mark cells in which the cassette has been inverted, tdTomato was made part of the invertible FLEx switch region (Figure 1d and Figure 1—figure supplement 1a). Upon cassette inversion, the tdTomato coding region is brought into proximity of a UAS sequence that is located just outside of the FLEx switch, thus coming under the transcriptional control of Gal4 (Brand and Perrimon, 1993; Shaner et al., 2004). This fluorescent reporter provides a direct readout of the cells in which the cassette is inverted and allows assessment of inversion efficiency under different experimental conditions.

To test the ability of the FlpStop cassette to produce strong, conditional loss-of-function alleles, we targeted apterous, a gene encoding a transcription factor required for wing development (Cohen et al., 1992). The developmental role of apterous has been extensively characterized, and its disruption produces an easily quantifiable wing phenotype, making it a good candidate for proof-of-concept experiments. To target apterous, we used an intronic MiMIC insertion between exons 4 and 5, upstream of approximately half of the coding region (Figure 2a). Two FlpStop insertions in the apterous locus were isolated (non-disrupting and disrupting, Figure 2b and Table 1). We next performed complementation testing to characterize the apterous FlpStop alleles (designated ap^{FlpStop ND} and ap^{FlpStop D}) with an established recessive molecular null allele, ap^UG035 (Cohen et al., 1992). Wings were scored on an established scale from class 1 (wild-type wing) to class 5 (no wing) (Gohl et al., 2008). For the FlpStop approach to be conditional, the non-disrupting orientation must be inert, maintaining wild-type gene activity, while the disrupting orientation should be strongly mutagenic, abolishing gene function. When the ap^{FlpStop ND} allele was combined with ap^UG035, flies had almost exclusively wild-type wings (99% class 1, n = 462, Figure 2b and Figure 2—figure supplement 1). This result demonstrates that ap^{FlpStop ND} did not interfere with gene function. Conversely, when ap^{FlpStop D} was combined with the null allele, virtually all flies had no wings (97% class 5, n = 236, Figure 2b and Figure 2—figure supplement 1). This phenotype was as severe as homozygous flies bearing two copies of the null allele, demonstrating that ap^{FlpStop D} completely disrupted gene function. In addition, when combined with a wild-type chromosome, neither allele produced wing abnormalities, ruling out dominant negative effects (Figure 2—figure supplement 1). For comparison, we note that previous studies of apterous using the deGradFP approach produced only class 4 wing phenotypes and were unable to completely block wing development in any flies (Caussinus et al., 2012). Taken together, these data demonstrate that the FlpStop cassette can produce orientation-dependent, loss-of-function alleles.

Figure 2 with 2 supplements see all

Download asset Open asset

Next, we tested the ability of cassette inversion to alter gene function in a temporally controlled fashion. To invert the cassette, we expressed Flp recombinase under the control of the heat-shock promoter (hsFlp) (Golic and Lindquist, 1989). Flies that were ap^{FlpStop ND}/ap^UG035 or ap^{FlpStop D}/ap^UG035 and carried the hsFlp transgene were heat-shocked for 1 hr at 37°C to induce recombinase expression at different time points during development, and the phenotype of adult wings was scored (Figure 2c). We predicted that early manipulation of apterous function would have strong wing phenotypes because Apterous is essential for the development of the wing imaginal disc during larval stages (Cohen et al., 1992). We first tested the non-disrupting allele, whose inversion should disrupt apterous function. Control flies that were not heat-shocked had wild-type wings (Figure 2d). Experimental flies heat-shocked early in development (days 1–3) exhibited severe wing phenotypes, with many flies completely lacking one or both wings (Figure 2d). When cassette inversion was induced later in development, flies exhibited less severe wing phenotypes, consistent with the established role of apterous in wing development during late larval stages (Wilson, 1981). Next, we performed the converse experiment in which the disrupting allele was used to rescue apterous function at different developmental time points (Figure 2e). We observed a rescue of the apterous wing phenotype when the ap^{FlpStop D} cassette was inverted early; more than half of the wings from flies heat-shocked on day 1 were wild-type (Figure 2e). Restoration of apterous later in development (days 4–7) was unable to rescue the no-wings phenotype (Figure 2e). Interestingly, the time window during which apterous is necessary for wing development differs from the time window during which its rescue is sufficient to enable wing development: heat-shock on day 4 substantially altered the phenotype of ap^{FlpStop ND}/ap^UG035 flies (Figure 2d), yet had little effect on ap^{FlpStop D}/ap^UG035 flies (Figure 2e). This difference may reflect the early requirement of apterous in cell fate specification; rescue of apterous function following misspecification of cells within the wing disc cannot restore normal wing formation (Diaz-Benjumea and Cohen, 1993). Taken together, these results demonstrate that FlpStop enables temporally precise gene disruption as well as gene rescue, thereby facilitating the investigation of gene function during development.

We next sought to test the efficacy of FlpStop for conditional gene disruption within a somatic mosaic clone (Figure 2—figure supplement 2a). Apterous protein expression during larval wing development is well characterized (Figure 2—figure supplement 2b) (Cohen et al., 1992; Bieli et al., 2015a, 2015b). To test whether the FlpStop approach could remove Apterous protein in somatic mosaic animals, we again expressed Flp recombinase under control of the heat-shock promoter (Golic and Lindquist, 1989) in ap^{FlpStop ND}/ap^UG035 larvae. To mark the tissue containing the inverted cassette, the ubiquitous driver Tubulin-Gal4 was also included. With this experimental design, apterous mutant cells were positively labeled with tdTomato, while the rest of the tissue was heterozygous and unmarked (Figure 2—figure supplement 2a). Importantly, wing discs from control larvae displayed normal Apterous expression (Figure 2—figure supplement 2c). TdTomato-positive regions lacked Apterous staining, while other regions of the same disc displayed high levels of protein expression (Figure 2—figure supplement 2d). Thus, tissue-specific inversion of the FlpStop cassette strongly impaired expression of Apterous, demonstrating the utility of the FlpStop approach for efficiently producing somatic mosaic tissue for developmental studies.

We next produced a set of FlpStop transgenic strains targeting seven genes that play central roles in either neuronal excitability or neurotransmission. All loci contained a MiMIC insertion within an intronic region common to all splice variants, upstream of a large portion of the coding sequence (Table 1). For neuronal excitability, we targeted paralytic (para), which encodes the alpha subunit of a voltage-gated sodium channel (Suzuki et al., 1971; Loughney et al., 1989); cacophony (cac), the alpha subunit of a voltage-gated calcium channel (Kawasaki et al., 2000); and Shaker cognate l (Shal), a voltage-gated potassium channel (Butler et al., 1990). For neurotransmission, we targeted Glutamic acid decarboxylase 1 (Gad1), which encodes an enzyme required for GABA synthesis (Jackson et al., 1990); Resistant to dieldrin (Rdl), the alpha subunit of the ionotropic GABA_A receptor (Ffrench-Constant et al., 1991); Vesicular glutamate transporter (VGlut), a transporter that packages glutamate into synaptic vesicles (Daniels et al., 2004); and Choline acetyltransferase (ChAT), an enzyme that is required for acetylcholine biosynthesis (Greenspan, 1980). For these loci, we produced FlpStop alleles with separate insertions in both the non-disrupting and disrupting orientations (Table 1). Each insertion was molecularly validated to confirm successful MiMIC replacement (see Materials and methods and data not shown). For cac, only the non-disrupting stock was isolated by transgenesis so we instead used germline expression of Flp to isolate an allele of cac in which the FlpStop cassette was locked in the disrupting orientation (D lock, Figure 3—figure supplement 2 and Materials and methods). We next extensively validated the FlpStop approach using a combination of phenotypic analysis, qRT-PCR, immunostaining, and in vivo imaging.

To validate disruption of the targeted genes, we performed complementation testing using the non-disrupting and disrupting alleles of each gene. The genes cac, ChAT, Gad1, para, Rdl, and VGlut are essential to nervous system function; hence null alleles are homozygous lethal. We combined the disrupting and non-disrupting orientation FlpStop alleles for ChAT, Gad1, Rdl, and VGlut with known null alleles and scored adult survival (Figure 3a,b and Figure 3—figure supplement 1). Importantly, all combinations of non-disrupting alleles with null alleles were viable and consistently produced adult flies at the expected rate (Figure 3a,b and Figure 3—figure supplement 1). This demonstrated that, as required for conditional manipulations, the FlpStop construct had no phenotypic effect when in the non-disrupting orientation. In addition, we saw no evidence of dominant negative activity as measured by heterozygous lethality from the FlpStop alleles (data not shown). Next, we tested mutagenicity of the disrupting orientation. For Gad1 and Rdl the combination of the disrupting allele with either of two independent null alleles was lethal, demonstrating complete disruption of gene function (Figure 3a,b). When placed in trans to a null allele, the VGlut^{FlpStop D} allele resulted in a significant reduction in viability relative to the non-disrupting allele (Figure 3—figure supplement 1a). However, the combination was not completely lethal, suggesting that insertion of the FlpStop cassette created a hypomorphic allele of VGlut (Figure 3—figure supplement 1a). The VGlut FlpStop insertion lies between exons 3 and 4, and consistent with our observation, a chromosomal deletion of exons 1–3 creates a viable allele that only partially reduces VGlut function (Daniels et al., 2006). The FlpStop insert into a single locus, ChAT, was viable in combination with established null alleles, showing no evidence of gene disruption (Figure 3—figure supplement 1b).

Figure 3 with 2 supplements see all

Download asset Open asset

Figure 3—source data 1

Table of statistical tests and exact p-values.

https://doi.org/10.7554/eLife.22279.010

Download elife-22279-fig3-data1-v2.docx

Para and cac are located on the X chromosome, with null alleles being hemizygous lethal in males and homozygous lethal in females (Ganetzky, 1984; Kawasaki et al., 2000). Thus, direct complementation tests using null alleles of these genes were not feasible. FlpStop cassette insertions in the disrupting orientation in these two genes were also hemizygous and homozygous lethal, consistent with them being null alleles, while insertions in the non-disrupting orientation were viable (data not shown). Temperature-sensitive alleles of para and cac exist that display prominent paralysis upon heating (Kawasaki et al., 2000; Suzuki et al., 1971). To further test the function of the FlpStop alleles of para and cac, we performed complementation tests with these temperature sensitive alleles and measured heat-induced paralysis (Figure 3c,d). Under our culture conditions, flies homozygous for para^ts1 were sometimes immobilized when exposed to 33°C for 2 min and almost always paralyzed at 35°C (Figure 3c). When the cassette in the non-disrupting orientation was combined with the para^ts1 mutation (para^{FlpStop ND}/para^ts1), flies did not become paralyzed at either temperature, results that were comparable to control flies that were heterozygous for para^ts1 (para^ts1/+). Thus, the para^{FlpStop ND} allele did not impair gene function. Conversely, flies in which the para^FlpStop D allele was combined with para^ts1 (para^{FlpStop D}/para^ts1) exhibited a fully penetrant paralysis phenotype at both temperatures (Figure 3c). As this phenotype was more severe than that observed for para^ts1 homozygous mutant flies, we infer that para^{FlpStop D} caused complete or nearly complete disruption of para function (Figure 3c). Analogous complementation tests were performed for the cac^FlpStop alleles using the temperature-sensitive mutation cac^TS2 (Kawasaki et al., 2000) (Figure 3d). When cac^FlpStop alleles were complemented against cac^TS2, the non-disrupting allele displayed little paralysis at either of two restrictive temperatures. Conversely, flies carrying the cassette in the disrupting orientation displayed a highly penetrant paralysis phenotype that was more severe than that observed in cac^TS2 homozygous animals. Thus, the cac^{FlpStop D lock} allele also severely impaired gene function.

Next, to test whether FlpStop alleles affect mRNA transcript levels as designed, we extracted RNA from adult brains and used quantitative RT-PCR (qRT-PCR) to measure expression of each target gene. To capture the combined mutagenic effects of both the transcriptional terminators and the splice acceptor in the cassette, qRT-PCR primers were designed to amplify mRNA transcripts from the exons that flanked the FlpStop insertion (Figure 3e). Thus, either termination of transcription or hijacking of the splicing pattern would reduce the level of the qRT-PCR product. Complete loss of function of Shal is homozygous viable and has no easily scorable phenotype (Bergquist et al., 2010); thus, we performed qRT-PCR on flies homozygous for the FlpStop insertions to test their ability to disrupt gene function. Shal^{FlpStop D}/ Shal^{FlpStop D} flies displayed an approximately 50% reduction in Shal transcript relative to Shal^{FlpStop ND}/ Shal^FlpStop ND flies, consistent with the Shal^{FlpStop D} allele functioning as a hypomorph (Figure 3—figure supplement 1c). We also wanted to confirm that the alleles that were lethal by complementation testing (cac, Gad1, para, and Rdl) fully reduced mRNA transcript levels. As the disrupting alleles of these genes were homozygous lethal, we measured gene expression in heterozygous animals bearing one copy of either the non-disrupting or disrupting allele. Under these conditions, if the disrupting allele were behaving as a null, heterozygous D/+ flies should express half as much intact target gene mRNA as heterozygous ND/+ flies. Consistent with our complementation tests, transcripts in heterozygous flies bearing the disrupting allele were reduced approximately 50% relative to heterozygous flies bearing the non-disrupting allele (Figure 3f–i).

In summary, we created a set of FlpStop transgenic strains targeting seven genes that play central roles in neuronal communication. For all seven genes, as predicted, the non-disrupting alleles had no phenotypic effect (Table 1). For four of the seven genes, cac, Gad1, para, and Rdl, the disrupting orientations were genetically null (Table 1). For two of the seven genes, VGlut and Shal, the disrupting alleles were hypomorphic (Table 1). A single locus, ChAT, showed no evidence of gene disruption. Taken together, these genetic and molecular tests of the FlpStop alleles demonstrate that non-disrupting alleles have no negative effect on gene activity and that disrupting alleles often behave as genetic null or hypomorphic alleles (six of seven genes). Thus, the FlpStop approach can produce conditional loss-of-function mutations.

In the FlpStop approach, only cells that have both undergone cassette inversion and express Gal4 protein will be labeled by tdTomato (Figure 4a). As a result, this design can be used to positively label mutant cells. To directly test the efficiency of cassette inversion, we expressed Flp recombinase in different neuronal populations using different Gal4 driver lines in animals bearing cac^{FlpStop ND}. Flipping efficiency was quantified by counting the number of Gal4-expressing cells, as labeled by UAS-driven expression of GCaMP6f, that also expressed tdTomato. We tested cassette inversion using three different driver lines that label the neurons Mi1, Tm1, and T4 in the visual system, respectively (Jenett et al., 2012; Strother et al., 2014; Maisak et al., 2013). When Flp recombinase was expressed in flies carrying cac^{FlpStop ND}, creating cac^{FlpStop D lock} via cell type-specific inversion, tdTomato expression was observed throughout the cell bodies and neurites, labeling 90%, 93%, and 70% of GCaMP6f-expressing cells (Figure 4b–d). Cells in which tdTomato immunolabeling was discernable but GCaMP6f signal was absent were extremely rare in all genotypes tested (<0.01%, data not shown).

Figure 4

Download asset Open asset

We next tested the inversion efficiency of each of the eight FlpStop alleles by using the Mi1 Gal4 line to express Flp recombinase and the fluorescent marker mCD8::GFP. The FlpStop cassettes in ap, cac, ChAT, para, Rdl, and Shal all inverted efficiently: depending on the gene, 76% to 96% of GFP-positive cells were also tdTomato-positive (Figure 5). However, we observed that there was no tdTomato expressed in Mi1 from the Gad1 and VGlut FlpStop alleles (Figure 5—figure supplement 1a,b). As this result contrasted sharply with the efficient inversion of the other alleles, we used the pan-neuronal driver nSyb-Gal4 to express Flp recombinase to test whether the cassettes in Gad1 and VGlut were able to be inverted in other neurons. We observed tdTomato in many neurons in the visual system, indicating that these FlpStop alleles are capable of inverting and expressing the tdTomato reporter (Figure 5—figure supplement 1c,d). Notably, the expression patterns were distinct between the two genes even though they were consistent across brains of the same genotype (Figure 5—figure supplement 1c,d and data not shown). We speculate that silencing of the genetic locus when a gene is not expressed in a neuron (as the VGlut and Gad1 loci might be in a cholinergic neuron such as Mi1) also silences expression of tdTomato, despite the presence of Gal4. Indeed, UAS transgene expression is well known to depend on the site of integration into the genome (Markstein et al., 2008).

Figure 5 with 1 supplement see all

Download asset Open asset

Taken together, these results demonstrate that FlpStop cassette inversion is efficient across genes and can be achieved when the recombinase is expressed using a number of different Gal4 driver lines, demonstrating compatibility with existing tools for targeting and manipulating specific neuronal populations.

The ability to selectively manipulate gene activity in single identified neurons within intact circuits enables investigation of how specific genes contribute to neuronal function. To establish this proof-of-concept for FlpStop, we examined visually evoked responses in the third-order visual interneuron Tm3. This small monopolar neuron has branched arborizations in many brain layers, including M1, M5, M8, and M10 of the medulla and layers Lo1 and Lo4 of the lobula (Figure 6a) (Fischbach and Dittrich, 1989; Hasegawa et al., 2011). The layer M1 and M5 arbors are primarily dendritic, receiving the majority of their inputs from the neuron L1, which in turn receives direct input from the R1-6 photoreceptors (Takemura et al., 2013; Meinertzhagen et al., 1991). The arbors in layers M8, M10, Lo1, and Lo4 are primarily presynaptic, with prominent synapses onto T4 in layer M10 (Takemura et al., 2013; Hasegawa et al., 2011). Although each Tm3 arbor is primarily either dendritic or axonal, each arbor can contain both pre- and postsynaptic sites (Takemura et al., 2013). Tm3 responds with transient graded depolarizations to increases in light intensity (ON) and is required for flies to respond behaviorally to fast moving ON edges (Behnia et al., 2014; Yang et al., 2016; Ammer et al., 2015). This depolarization is accompanied by a corresponding increase in calcium concentration, but interestingly, unlike the voltage signals, these calcium signals vary non-uniformly across the neuron’s arbors, indicating that they are compartmentalized (Yang et al., 2016).

Figure 6

Download asset Open asset

We hypothesized that voltage-gated calcium channels contribute to Tm3’s light-evoked calcium signals and that differential distribution or regulation of specific types of calcium channels underlies compartmentalization. Given Tm3’s complex morphology and striking pattern of calcium signals, we tested the role of the voltage-gated calcium channel cac in producing its visually evoked calcium responses. To do this, we performed two-photon imaging of the genetically encoded calcium indicator GCaMP6f expressed in Tm3 and measured impulse responses to brief flashes of light.

We first examined whether the cac^{FlpStop ND} allele was inverted efficiently by the Tm3 driver line. As our Tm3 driver is expressed in other cells during larval stages (Jenett et al., 2012), removal of cac under these conditions was developmentally lethal. Thus, we incorporated a tub-Gal80^ts transgene, a ubiquitously expressed temperature-sensitive repressor of Gal4 (McGuire et al., 2003), to restrict Gal4 activity to late pupal and adult stages. We compared experimental males hemizygous for cac^{FlpStop ND} and carrying UAS-Flp, UAS-GCaMP6f, tub-Gal80^ts, and Tm3-Gal4 to two separate controls: males lacking UAS-Flp (no-Flp control) and heterozygous females carrying one copy of cac^{FlpStop ND} and one wild-type cac allele (heterozygous control). The no-Flp control should neither disrupt cac nor express tdTomato but otherwise contains all other transgenes, thereby controlling for their presence. The heterozygous control should invert cac^{FlpStop ND} and express tdTomato; however, as it carries one wild-type cac allele, cac function in Tm3 likely remains largely intact. This controls for any potential effects of Flp and tdTomato on Tm3. Experimental males and heterozygous controls expressed tdTomato in nearly all Tm3 cells while no-Flp controls expressed no detectable tdTomato (Figure 6b–e and data not shown). In one-day old adults, nearly all of Tm3 neurons expressed tdTomato and therefore carried the inverted FlpStop cassette (data not shown). To provide sufficient time for the FlpStop manipulation to overcome possible protein perdurance given estimated ion channel half-lives (Passafaro et al., 1992), we performed all subsequent experiments in 10–12 day old adult flies.

In larval motor neurons, loss of cac function substantially reduces axon branching and synaptic bouton number (Rieckhof et al., 2003). We therefore examined whether FlpStop-induced loss of Cac altered the morphology of Tm3. However, confocal imaging revealed no structural changes (Figure 6f–k). Thus, any observed changes in calcium signals following cac disruption are not the result of gross anatomical disruptions in Tm3 morphology. We also quantified cassette inversion efficiency in these flies: 91% of cells were both tdTomato- and GCaMP6f-positive (Figure 6l). We restricted all calcium imaging analysis to Tm3 arbors that were positively labeled by tdTomato, a signal that was easily visible during in vivo imaging (Figure 6b–e).

To measure visual stimulus-evoked Tm3 calcium signals, we presented 25 ms light flashes off of a gray background and used two-photon microscopy to image changes in GCaMP6f fluorescence in each of the Tm3 arbors as well as the cell body. Across the cell, Tm3 responded to this stimulus with a transient increase in calcium concentration (Figure 7) (Yang et al., 2016). Compared with both no-Flp and heterozygous controls, Tm3 cells lacking Cac displayed significantly reduced responses in the cell body as well as in the arbors in layers Lo1 and Lo4 (Figure 7a,f,g). This suggests that in these cellular compartments, Cac is required for a substantial portion, but not all, of the visually evoked calcium response. Strikingly, calcium signals in the layer M5 arbor became dramatically larger when Cac was removed (Figure 7c). We speculate that removal of Cac from this compartment leads to replacement of Cac channels with one or more other channel types, resulting in increased calcium influx. Interestingly, loss of cac function did not affect responses in the arbors of layers M1, M8, and M10 (Figure 7b,d,e), demonstrating that calcium signals in these compartments can be mediated by other channel types. Taken together, these results demonstrate that Cac is a critical regulator of Tm3’s calcium responses to visual stimuli and has differential effects across cellular compartments.

Figure 7

Download asset Open asset

Figure 7—source data 1

Table of exact p-values.

All statistical tests were two-sample Student’s t-tests, Bonferroni correction for multiple comparisons.

https://doi.org/10.7554/eLife.22279.018

Download elife-22279-fig7-data1-v2.docx

We generated FlpStop alleles of eight genes and extensively tested their ability to disrupt gene function. Of these eight, six were successful. The disrupting alleles of ap, cac, Gad1, para, and Rdl were molecular nulls, and the disrupting allele of VGlut was a hypomorph, as predicted from previous analysis of mutations in the VGlut locus (Daniels et al., 2006). Two genes targeted by FlpStop were not completely successful in creating the desired conditional null alleles: the insert into Shal produced a hypomorph, and the insert into ChAT showed no evidence of gene disruption. Interestingly, ChAT is a complex genetic locus where the coding region of VAChT is nested within the first intron of the ChAT gene, and it has been proposed that both transcripts arise from a common transcript by differential RNA processing (Kitamoto et al., 1998). Perhaps this complex, locus-specific regulation makes it insensitive to the mutagenic signals embedded within the FlpStop cassette.

Furthermore, we tested that FlpStop alleles in the non-disrupting orientation were indeed inert, a critical feature that enables conditional manipulation of the genes. For all eight genes, we found that the non-disrupting alleles did not interfere with gene function. Finally, we also demonstrated that these FlpStop alleles all inverted efficiently in the presence of Flp recombinase and expressed tdTomato. Taken together, our data suggest that incorporation of the FlpStop cassette will produce a successful conditional allele for many genes of interest.

FlpStop can be readily generalized to many genes of interest. At present, MiMIC insertions allow access to the coding introns of approximately 24% of neuronal genes (as annotated by flybase.org; see Materials and methods) (Nagarkar-Jaiswal et al., 2015b). For genes that lack a suitable MiMIC site, the FlpStop construct can be targeted to desired genomic loci using CRISPR/Cas9-mediated homology-directed repair (CRISPR-HDR). To facilitate this approach, we have created a plasmid for integration of the FlpStop construct through CRISPR-HDR (Cong et al., 2013; Gratz et al., 2014; Mali et al., 2013) (Materials and methods, Figure 1—figure supplement 2). This plasmid contains a multiple cloning site on either side of the FlpStop cassette to enable inclusion of the homology arms and a Cre recombinase-excisable 3xP3-dsRed reporter to enable scoring of successful incorporation of the cassette into the genome (Gratz et al., 2014) (Figure 1—figure supplement 2). Given the flexible access to almost all genetic loci provided by CRISPR-HDR, the FlpStop cassette can be targeted to essentially any gene of interest that contains a coding intron. While more time consuming because of the need to clone new homology arms for each genetic locus, CRISPR-HDR-mediated insertion of FlpStop is more flexible than MiMIC-based insertion and could be used to target specific introns for more efficient gene disruption. The CRISPR-HDR approach can be further adapted to target genomic regions containing a Gal4 transgene using Homology Assisted CRISPR Knock-in, opening up additional loci without the need for gene-specific homology arms (Gratz et al., 2014; Lin and Potter, 2016). As the FlpStop tool kit is expanded to more loci, more information about the failures and successes of insertions will be obtained. Incorporating this new information into the choice of intron for the targeting of new genes could further increase the already high success rate of the FlpStop approach.

Notably, the FlpStop cassette can initially be integrated into the gene in either the non-disrupting or the disrupting orientation such that Flp-mediated inversion then creates locked disrupting and non-disrupting alleles, respectively. Each of these inverted alleles would express tdTomato under Gal4 control. In this work, we demonstrate that the transformation from non-disrupting to disrupting provides a powerful approach for exploring the functions of essential genes. For non-essential genes, the transformation from disrupting to non-disrupting allows for cell type-specific genetic rescue by the endogenous locus, as demonstrated by the rescue of apterous function at specific time points during development (Figure 2). For this application, one should combine the disrupting allele with a null allele so that the entire animal lacks gene activity but the Flp-targeted cell population becomes heterozygous. This approach offers advantages over rescue experiments using the Gal4 system to express cDNAs as the genes are expressed in their native regulatory contexts. Therefore, it will be particularly useful for studies of gene function during development and circuit studies of genes involved in, for example, sensory transduction.

Expression of Flp recombinase provides the FlpStop approach both spatial and temporal control. For example, as we demonstrate with ap^FlpStop, use of the heat-shock promoter to express Flp restricts inversion of the FlpStop construct to a brief time window, a manipulation that is well suited to developmental studies (Figure 2 and Figure 2—figure supplement 2). Flp recombinase can also be expressed under Gal4 control, and additional temporal specificity can be achieved by incorporating Gal80^ts, as we demonstrate with Tm3 (Figures 6 and 7). These approaches enable the inversion of the FlpStop construct to be restricted to a time period of hours to days. In addition, combining the FlpStop approach with temperature-sensitive alleles enables control of gene activity on the scale of seconds to minutes (Siddiqi and Benzer, 1976; Suzuki et al., 1971). As we demonstrated with para and cac (Figure 3), one can place a temperature-sensitive allele in trans to the FlpStop allele of the same gene and use a temperature shift to disrupt gene function. Extending this approach, when the disrupting orientation is induced within a cell type of interest, those cells will only produce proteins containing the temperature-sensitive mutation while all other cells will express both wild-type and mutant protein. Upon temperature shift, the cell type of interest will lack functional protein while the rest of the animal will have a 50% reduction in gene activity, becoming effectively heterozygous. This strategy could be applied to any gene where a temperature-sensitive mutation exists, thereby enabling highly precise spatial and temporal control of gene activity.

FlpStop complements and extends existing techniques for cell type-specific gene manipulation. First, our validated FlpStop disrupting alleles are nulls, and the non-disrupting alleles have wild-type function, reducing the experimental variability that can emerge when performing gene knock down using RNAi or deGradFP. That is, in these two approaches, differences in the strength of the Gal4 driver result in differences in the extent of gene knock down in each cell. In contrast, because of the binary nature of FlpStop, differences in the strength of the driver change the frequency of cassette inversion, producing different proportions of mutant cells; the extent of gene disruption across mutant cells is constant. However, RNAi requires fewer genetic elements than FlpStop, and collections targeting most genes are available (Dietzl et al., 2007). RNAi therefore may be more suitable for large-scale screens and experiments that contain genetic complexity in addition to gene knock down, while FlpStop would be more suitable for targeted interrogations where complete removal or rescue of gene function is required. Second, unlike recombinase-mediated deletion of exons, RNAi, deGradFP, and CRISPR/Cas9, FlpStop positively labels affected cells with a fluorescent reporter of gene manipulation and enables gene rescue in addition to gene disruption. Third, unlike MARCM, which also positively labels manipulated cells, FlpStop can be used to target all the cells of a single differentiated type in the adult brain. However, like MARCM, FlpStop requires a null allele of the gene of interest, though for FlpStop, this issue can be avoided for genes on the X chromosome by the use of hemizygous males (Figures 6 and 7). For autosomal genes, a rich history of Drosophila genetics has produced null alleles of many genes. When choosing a null for FlpStop analysis of an autosomal gene, we recommend avoiding alleles that contain an FRT site, as these could recombine with the FlpStop cassette and generate unwanted DNA rearrangements. This includes the disrupting FlpStop allele of the same gene and some deficiencies. If an established null does not already exist for a gene of interest, MiMIC insertions in the disrupting orientation can often provide a null allele, and CRISPR-Cas9 technology enables the straightforward production of null alleles by creating targeted mutations within an essential exon (Venken et al., 2011a; Bassett et al., 2013). Thus, FlpStop opens a number of new experimental avenues.

To demonstrate the utility of the FlpStop approach to studying neuronal function in vivo, we removed Cac specifically from the visual interneuron Tm3. We found that Cac is a critical regulator of light-evoked calcium responses in specific subcellular compartments (Figure 7). In motor neurons, Cac is the voltage-gated calcium channel required presynaptically for evoked neurotransmitter release (Kawasaki et al., 2000, 2002; Kawasaki and Zou, 2004). However, recent studies in olfactory projection neurons (PNs) demonstrate that Cac may have a more complex role in the central nervous system (Gu et al., 2009). We measured visually evoked calcium signals in all of the arbors of Tm3, comprising four predominately axonal regions and two predominately dendritic regions, as well as the cell body. As expected from its role in synaptic vesicle release in motor neurons, we show that in Tm3, cac is required for normal light-evoked calcium responses in the axon terminals in layers Lo1 and Lo4. However, unexpectedly, the effects of Cac removal were substantially different across the other compartments of Tm3. In particular, Cac is not required in the axon terminals in layers M8 and M10. Thus, unlike in motor neurons where Cac is required at all synaptic boutons, in Tm3, some, but not all, output regions require this channel. Given that these arbors synapse onto distinct downstream partners, these molecular differences may be computationally significant. Additionally, we observed that loss of Cac reduces calcium responses in the cell body, an observation that also diverges from its role in motor neurons (Worrell and Levine, 2008). As the cell body neither makes nor receives synapses, Cac perhaps contributes to other processes such as calcium-mediated regulation of transcription or enzyme activity (Catterall, 2011). Finally, we were surprised to find that removal of Cac increased calcium responses to light specifically in the layer M5 arbor. The removal of a voltage-gated calcium channel from a compartment would not be expected to directly increase calcium signals. One explanation for this observed increase is that Cac was locally replaced with another voltage-gated calcium channel that perhaps has a lower activation threshold or slower inactivation, allowing more calcium to enter the layer M5 arbor upon stimulation. Indeed, wild-type calcium responses in the layer M5 arbor are much smaller than would be expected from the corresponding voltage signals (Yang et al., 2016). Perhaps Cac normally mediates this small response, but the channel that replaces it in cac mutant cells has different properties. Alternatively, loss of Cac throughout Tm3 may cause global changes in calcium channel regulation or expression and thus the phenotypes we observe may also be influenced by compensation. If this were the case, the compartment-specific effects of cac disruption on calcium signaling would reflect differential effects of compensation across subcellular compartments. Taken together, the effects of disrupting cac in Tm3 illustrate the complexity of neuronal calcium signaling and the diverse roles Cac plays in a central nervous system neuron.

FlpStop is a powerful tool for addressing questions of how specific genes establish the rich complement of neuronal responses that support computation. Importantly, because this approach manipulates the endogenous mechanisms that confer a neuron’s response properties, it is fundamentally different from methods that activate or silence neurons through the expression of exogenous effectors. Thus, FlpStop will provide complementary and novel insights into nervous system function.

First, the backbone of the construct containing the MHC splice acceptor, the stop codons, the SV40 terminator (Stockinger et al., 2005), and the series of F3 and wild-type FRT sites was synthesized by GenScript (New Jersey, USA) and delivered in the pUC57 vector flanked by EcoRI and HindIII sites. This backbone was cloned in between the two attB sites of the MiMIC cloning vector pBS-KS-attB1-2 (obtained from the Drosophila Genome Resource Center, Bloomington, IN) using EcoRI and HindIII.

A sequence containing a 5xUAS, hsp70 promotor, and TATA box were PCR amplified from a pUAST>stop>mCD8::GFP vector (obtained from Liqun Luo, Stanford University). During the amplification with primers

UAShsp70_5p_EcoRI: GCTTGAATTCCCTGCAGGTCGGAGTACT and

UAShs70_3p_XhoI: GTTAGAGCTCCCCAATTCCCTATTCAGAGTTCT, EcoRI and XhoI restriction sites were added to the DNA fragment. This fragment was then cloned into the growing FlpStop construct using the EcoRI and XhoI restriction sites.

Next, the Tub α 1 terminator and the SV40 terminator associated with the tdTomato element were added. First, these two transcriptional terminators flanked by NotI and FseI restriction sites on one side and an AgeI restriction site on the other were synthesized as a DNA fragment (gBlocks Gene Fragments, Integrated DNA Technologies). This fragment was cloned into the main vector between the NotI and AgeI sites. Finally, the tdTomato element was added (Shaner et al., 2004). tdTomato flanked by NotI and FseI restriction sites was synthesized as a separate DNA fragment (gBlocks Gene Fragments, Integrated DNA Technologies). This fragment was cloned into the main vector between one of the FRT sites and tdTomato-associated SV40 terminator using NotI and FseI (Figure 1—figure supplement 1a).

First, the backbone of the construct containing the 3XP3 promoter, the DsRed coding sequence, and the SV40 3’ terminator flanked by loxP sites, ΦC31 attP sites, and homology arm multiple cloning sites (sequence identical to those in pHD-DsRed-attP from Gratz et al., 2014) was synthesized by GenScript (New Jersey, USA) and delivered in the pUC57-mini vector with unique MluI and KpnI sites separating the upstream attP and loxP sites. Next, the FlpStop cassette internal to and excluding the attB sites was PCR amplified from the construct pFlpStop-attB-UAS-2.1-tdTom with the following primers: 5’_Fwd_FlpStop_KpnI: GCGTAGTCGATCGCGGTACCGCAGGAATTCCCTGCAGGTC and 3’_Rev_FlpStop_KpnI:

TTATACGAAGTTATGGTACCGTCGACAAGCTTGGATCCG.

This fragment was cloned into the KpnI site of the pFlpStop-HDR-UAS-2.1-tdTom

construct using Infusion cloning (Clontech Laboratories, Inc.). All inserts in the pUC57-mini vector were sequenced end to end (Sequetech DNA Sequencing Service) to ensure sequence identity (Figure 1—figure supplement 2a).

The full sequence of the pFlpStop-attB-UAS-2.1-tdTom and pFlpStop-HDR-UAS-2.1-tdTom plasmids are found in Supplementary file 1 and Supplementary file 2, respectively, and the plasmids are available from Addgene (pFlpStop-attB-UAS-2.1-tdTom: https://www.addgene.org/88910/; pFlpStop-HDR-UAS-2.1-tdTom: https://www.addgene.org/89148/).

Initial MiMIC lines (Venken et al., 2011a; Nagarkar-Jaiswal et al., 2015a):

y, w; ap^MI01996/CyO

y, w, cac^MI02836

y, w; ; Gad1^MI09277/ TM3, Sb

y, w, para^MI08578

y, w; ;Rdl^MI02620/ TM3, Sb

y, w; ; ChAT^MI04508/ TM3, Sb

y, w; Shal^MI00446

y, w; VGlut^MI04979/ CyO

Apterous disruption and rescue time course:

y, w, hsFlp¹²² (Golic and Lindquist, 1989)

ap^UG035/CyO (Cohen et al., 1992)

+; ap^{FlpStop ND}/ CyO (this study)

y, w; ap^{FlpStop D}/ CyO (this study)

Apterous wing disc immunolabeling:

S/CyO, Kr-GFP (obtained from T Mosca)

ap^{FlpStop ND}/CyO, Kr-GFP (this study)

ap^{FlpStop D}/CyO, Kr-GFP (this study)

y, w, hsFlp¹²² (Golic and Lindquist, 1989)

tubP-Gal4/TM6B, Tb (Lee and Luo, 1999)

Complementation tests:

ap^UG035/CyO (Cohen et al., 1992)

cac^TS2/cac^TS2 (obtained from R. Ordway) (Kawasaki et al., 2000)

ChAT^l9/TM3, Ser (obtained from BDSC)

Df(3R)ED2/TM3, Sb, Ser (obtained from BDSC)

Df(3L)ED4341/TM3, Sb, Ser (obtained from BDSC)

Gad1^L352F, e/TM3, Sb, Ser (obtained from BDSC)

para^ts1/para^ts1 (obtained from B. Ganetzky) (Suzuki et al., 1971)

Rdl¹/TM3, Sb, Ser (obtained from BDSC) (Ffrench-Constant et al., 1991)

Df(3L)Rdl-2/TM3, Sb, Ser (obtained from BDSC) (Ffrench-Constant et al., 1991)

Df(2L)VGlut²/CyO (obtained from A DeAntonio) (Daniels et al., 2006)

y, w; ap^{FlpStop ND}/ CyO (this study)

y, w; ap^{FlpStop D}/ CyO (this study)

y, w; ; ChAT^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; ; ChAT^{FlpStop D}/TM3, Sb, Ser (this study)

y, w; VGlut^{FlpStop ND}/SM6a (this study)

y, w; VGlut^{FlpStop D}/SM6a (this study)

y, w, cac^{FlpStop ND}/FM7c (this study)

y, w, cac^{FlpStop D lock}/FM7c (this study)

y, w; ; Gad1^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; ; Gad1^{FlpStop D}/TM3, Sb, Ser (this study)

y, w, para^{FlpStop ND}/FM7 (this study)

y, w, para^{FlpStop D}/FM7 (this study)

y, w; ; Rdl^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; ; Rdl^{FlpStop D}/TM3, Sb, Ser (this study)

qRT-PCR:

y, w, cac^{FlpStop ND}/FM7c; ; TM3, Sb/+ (this study)

y, w, cac^{FlpStop D lock}/FM7c; ; TM3, Sb/+ (this study)

y, w; ; Gad1^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; ; Gad1^{FlpStop D}/TM3, Sb, Ser (this study)

y, w, para^{FlpStop ND}/FM7 (this study)

y, w, para^{FlpStop D}/FM7 (this study)

y, w; ; Rdl^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; ; Rdl^{FlpStop D}/TM3, Sb, Ser (this study)

y, w; ; Shal^{FlpStop ND}/Shal^{FlpStop ND} (this study)

y, w; ; Shal^{FlpStop D}/Shal^{FlpStop D} (this study)

Germline inversion of cac^{FlpStop ND}:

w; ovo-Flp/CyO (obtained from BDSC)

Fluorescence reporter testing:

Mi1^R19F01-Gal4 (obtained from BDSC) (Jenett et al., 2012)

Tm1^R74G01-Gal4 (obtained from BDSC) (Jenett et al., 2012)

T4^R54A03-Gal4 (obtained from BDSC) (Jenett et al., 2012)

nSyb^R57C10-Gal4 (obtained from BDSC) (Jenett et al., 2012)

UAS-Flp/CyO (obtained from BDSC)

UAS-mCD8::GFP/CyO (obtained from L Luo) (Lee and Luo, 1999)

cac^{FlpStop ND} (this study)

UAS-GCaMP6f/CyO (obtained from BDSC) (Chen et al., 2013)

+; ap^{FlpStop ND}/ CyO (this study)

y, w, cac^{FlpStop ND}/FM7c (this study)

y, w; ; ChAT^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w, para^{FlpStop ND}/FM7 (this study)

y, w; ; Rdl^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; ; Shal^{FlpStop ND}/ TM3, Sb, Ser (this study)

y, w; ; Gad1^{FlpStop ND}/TM3, Sb, Ser (this study)

y, w; VGlut^{FlpStop ND}/SM6a (this study)

Tm3 cac FlpStop:

Tm3^R13E12-Gal4 (obtained from BDSC) (Jenett et al., 2012)

tubP-Gal80^ts (obtained from BDSC) (McGuire et al., 2003)

UAS-Flp/CyO (obtained from BDSC)

UAS-GCaMP6f/CyO (obtained from BDSC) (Chen et al., 2013)

cac^{FlpStop ND} (this study)

Unless otherwise stated, all flies were raised on standard molasses food at 25°C on a 12/12 hr light-dark cycle. Parental crosses were flipped into new vials approximately every two days. For Tm3 cac FlpStop experiments, flies were raised at 18°C until they were wandering third instar larvae. They were then raised at 29°C. As our Tm3 driver is expressed in other cells during larval stages (Jenett et al., 2012), removal of cacophony within the pattern defined by this driver line was developmentally lethal. To circumvent this lethality, we incorporated the a tub-Gal80^tstransgene (ubiquitously expressed temperature-sensitive repressor of Gal4 (McGuire et al., 2003]) and used the temperature shifts stated above to restrict Gal4 activity to late pupal and adult stages.

The FlpStop attB donor plasmid, pFlpStop-attB-UAS-2.1-tdTom, was injected into flies containing the MiMIC insertion and a ΦC31 integrase-expressing transgene. Flies were screened for insertion of the FlpStop cassette by the loss of yellow rescue from the MiMIC construct. The orientation of the cassette was then confirmed by PCR using one primer within the Minos backbone of the MiMIC construct

Orientation-MiL-F: GCGTAAGCTACCTTAATCTCAAGAAGAG (Venken et al., 2011a)

and two other primers with homology to the two ends of the FlpStop cassette:

FRTspacer_5p_rev: AAATGGTGCAAAGAGAAGTTCC

FRTspacer_3p_for: ACAATCCAGCTACCATTCTGC

BestGene Inc. (Chino, CA) performed the embryo injections for, established, and PCR-verified the majority of the FlpStop stocks.

For cac, only the non-disrupting allele was isolated from the first round of injections. To enable assessment of the mutagenicity of cac^FlpStop, an allele in the disrupting orientation was made by expressing Flp recombinase in the germline using ovo-Flp (Figure 3—figure supplement 2). Cassette inversion was then confirmed using four different PCR reactions that together could distinguish the full cassette inversion from a partial inversion (only one FRT reaction) or the original, uninverted cassette. The distinguishing PCR primer pairs were: Orientation-MiL-R and tdTomato_5p_Rev, Orientation-MiL-R and FRTspacer_5p_rev, Orientation-MiL-F and SV40_for, and Orientation-MiL-F and FRTspacer_3p_for.

y, w, hsFlp¹²²/+ or Y; ap^UG035/ap^{FlpStop ND} and y, w, hsFlp¹²²/w or Y; ap^UG035/ap^{FlpStop D} flies were heat-shocked once at 37°C for 1 hr at the indicated age (1 to 7 days where 1 day is 24 hr after the parents were first placed into a new vial to begin laying eggs). As a control, flies of the same genotypes were not heat-shocked. Flies that eclosed within 24 hr after the first fly eclosed from a given vial were scored for their wing phenotypes. Both male and female flies were scored. Each wing was scored independently for the severity of the wing phenotype on an established scale from 1 to 5 (Gohl et al., 2008). For Figure 2d, female flies lightly anesthesized with CO₂ were photographed using a CCD camera mounted on a dissection microscope.

y, w, hsFlp¹²²/w or Y; ap^UG035/ap^{FlpStop ND}; tubP-Gal4/ + flies were heat-shocked at 37°C for 15 to 20 min during early development (first or second instar). As a control, flies of the same genotype were not heat-shocked. Wing discs from wandering third instar larvae were examined (see Immunolabeling).

For each biological replicate, RNA was extracted from the brains of approximately 10 adult flies. Brains were microdissected out of the flies’ heads in PBS. Brains were then homogenized in a solution containing beta-mercaptoethanol, and RNA was extracting using an RNeasy Mini Kit (Qiagen). All of the RNA samples were checked for quality by bioanalysis to confirm the presence of both 18S and 28S ribosomal peaks and the lack of evidence of RNA degradation (RNA integrity number > 5). QC Bioanalysis was performed by the Stanford PAM facility using an Agilent 2100 Bioanalyzer. cDNA was made from the RNA samples using the SuperScript VILO Master Mix (Thermo Fisher Scientific), and this cDNA solution was used directly in subsequent qRT-PCR reactions. Four technical replicates were run for each of the biological replicates of each genotype, and the mean of those four readings was used to estimate transcript levels for each individual biological replicate. For all of the qRT-PCR experiments, Gapdh2 was used as a reference for normalization. Cycle threshold (Ct) values were obtained from the Eppendorf software. The Delta-Delta Ct method was used to calculate relative transcript levels: % Transcript difference = 2^∧((Ct ND target gene – Ct ND reference gene) - (Ct D target gene – Ct D reference gene)). An unpaired, two-tailed, two-sample Student’s t-test was applied to the delta Ct values obtained for the biological replicates to assess significance. For presentation purposes, all observations were normalized to the mean transcript level of the non-disrupting genotype.

All primers were tested for primer efficiency using serial dilution of control Canton-S cDNA. Primers were designed to amplify a product that spanned the two exons flanking the intron containing the FlpStop cassette. For each locus, three primer pairs were initially designed and tested with a 5-fold serial dilution of Canton-S cDNA. The primer pair with the efficiency closer to 2 (idealized PCR doubling efficiency) was used for the quantification experiments on the FlpStop genotypes. Measured efficiency values are noted next to each primer pair below.

To image the adult brain, flies approximately 1 day (T4^R54A03-Gal4), 5–7 days (Mi1^R19F01-Gal4, Tm1^R74G01-Gal4, nSyb^R57C10-Gal4) (Figures 4 and 5), or 10–12 days (Tm3^R13E12-Gal4) (Figure 6) post-eclosion were dissected, fixed, and stained using standard methods. To observe wing discs, wandering third instar larvae were dissected, fixed, and stained using standard methods (Morante and Desplan, 2011). The primary antibodies used in this study were anti-GFP (chicken, Abcam, 1:2000, RRID:AB_300798), anti-Bruchpilot (nc82, mouse, Developmental Studies Hybridoma Bank, 1:30, RRID:AB_2314867), anti-DsRed (rabbit, Clontech, 1:500, RRID:AB_10013483), anti-Apterous (rabbit, gift from D Bieli, University of Basal, Switzerland, 1:1000), and anti-RFP (chicken, 1:1000 Millipore, RRID:AB_91496). The anti-GFP antibody recognized both GFP and GCaMP6f. The anti-DsRed and anti-RFP antibodies both recognized tdTomato. Adult brains and larval wing discs were imaged using a Leica TCS SP8 confocal microscope (Bensheim, Germany) using either a Leica HC PL APO 20x/0.70-NA or a Leica HCX PL APO 40x/1.25–0.75-NA oil immersion objective. Confocal images were rendered in three dimensions using Imaris (Bitplane), adjusted using cropping and thresholding tools in Photoshop (Adobe), and assembled into figures using Illustrator (Adobe).

To quantify the FlpStop cassette inversion efficiency, we performed cell body counting using Imaris (Bitplane) to count the number of GFP-positive neurons that were also tdTomato-positive. In the 3D ‘Surpass’ visualization mode, we manually placed ‘spots’ on the middle of each GFP-positive cell body (GCaMP6f in Figure 4 and 6, mCD8::GFP in Figure 5). Spots labeling GFP-positive cells were placed while blinded to the tdTomato channel. Next, ‘spots’ marking the center of tdTomato positive cell bodies were placed while blinded to the GFP channel. Colocalization between GFP and tdTomato spots was then obtained using the ‘Colocalize Spots’ function. For experiments labeling Mi1, Tm1, and Tm3, a threshold distance of less than 3.5 µm between the two spots was used as the cutoff for colocalization. For the T4 analysis this threshold was lowered to 2.5 µm since the T4 cell bodies were more closely clustered together. After running the colocalization function, the analysis was checked by eye and any obvious false positive or false negative errors were corrected by changing either the location of a spot, removing a spot, or adding a spot. The main analysis work flow followed the instructions laid out in this guide: Imaris Guide, Cell Counting, Queensland Brain Institute’s Advance Microimaging and Analysis Facility: http://web.qbi.uq.edu.au/microscopy/imaris-counting-cells-on-slide-scanner-images/

Flies were cold anaesthetized, positioned in a fly-shaped hole cut in steel foil such that their heads were tilted forward approximately 90° to expose the back of the head capsule above the foil while leaving most of the retina below the foil, and then affixed in place with UV-cured glue (NOA 68T from Norland Products Inc.). The brain was exposed by removing the overlying cuticle and fat bodies with fine forceps, and an oxygenated saline-sugar solution (Wilson et al., 2004) was perfused over the fly. The saline composition was as follows: 103 mM NaCl, 3 mM KCl, 5 mM TES, 1 mM NaH₂PO₄, 4 mM MgCl₂, 1.5 mM CaCl₂, 10 mM trehalose, 10 mM glucose, 7 mM sucrose, and 26 mM NaHCO₃. The pH of the saline equilibrated near 7.3 when bubbled with 95% O₂/5% CO₂. Neurons were imaged with a Leica TCS SP5 II microscope with a Leica HCX APO 20X/1.0-NA water immersion objective (Leica). For two-photon imaging, a pre-compensated Chameleon Vision II femtosecond laser (Coherent, Inc.) tuned to a wavelength of 920 nm was used to excite the sample (5–15 mW of power at the stage). Emitted photons from GCaMP6f were collected with a 525/50 nm filter. Visually evoked calcium responses were acquired at a constant frame rate of 38.9 Hz using a frame size of 200 × 20 pixels, 15X digital zoom, a line scan rate of 1400 Hz, and bidirectional scanning. Imaging time per fly never exceeded 1.5 hr. Tm3 calcium signals were imaged in adult flies 10 to 12 days after eclosion. For one-photon imaging, a 488 nm diode laser was used to excite GCaMP6f, and emitted photons with wavelengths between 496 nm and 537 nm were collected. A 543 nm diode laser was used to excite tdTomato, and emitted photons with wavelengths between 557 nm and 661 nm were collected.

Visual stimuli were generated with custom-written software using C++ and OpenGL (available on GitHub at https://github.com/ClandininLab/2pstim) and presented using a digital light projector as described previously (Clark et al., 2011). The visual stimulus was projected onto a coherent fiber optic bundle that then re-projected onto a rear-projection screen positioned approximately 4 cm anterior to the fly that spanned 80° of the fly’s visual field horizontally and 50° vertically. Immediately prior to being projected onto the screen, the stimulus was filtered with a 482/18 nm bandpass filter as well as an ND 0.5 neutral density filter so that it could not be detected by the microscope PMTs. The stimulus was refreshed at 240 Hz and had a radiance of approximately 30 mW·sr⁻¹·m⁻². The imaging and the visual stimulus presentation were synchronized as described in Freifeld et al. (2013). Following this procedure, the time of stimulus onset relative to the start of imaging varied within one stimulus frame (8.33 ms). To compensate for this, the average delay was measured (6.25 ms), and all imaging data was shifted in time by this delay.

The visual stimuli used were:

2 s flash search stimulus: alternating full contrast light and dark flashes, each 2 s in duration, were presented within the central region of the screen while the remainder of the screen was kept dark. The distance between the edges of the flashing stimulus and the edges of the screen spanned approximately 15° of the fly’s visual field. This stimulus was presented for 2400 imaging frames (62 s) per field of view.

25 ms light and dark flashes: 25 ms light and dark flashes, with 1500 ms of gray between the flashes, were presented over the entire screen. The light and dark flashes alternated with each presentation. The Michelson contrast of the flashes relative to the gray was 0.5. This stimulus was presented for 6600 imaging frames (170 s) per field of view. Tm3’s initial calcium response to dark flashes was minimal (Yang et al., 2016) and was not altered by Cac removal (data not shown). Therefore, only responses to light flashes were further analyzed.

Both stimuli were presented to all cells.

Raw images in each time series were aligned in x and y coordinates in ImageJ (NIH) using a macro based on the plugin Turboreg (http://bigwww.epfl.ch/thevenaz/turboreg/) and then further processed in MATLAB (Mathworks, MA). Regions of interest (ROIs) around individual arbors or cell bodies were manually selected in the time series-averaged image. For each imaging frame within the time series, intensity values for the pixels within each ROI were averaged and the mean background value (the average intensity in a region of the image without cells) was subtracted. To correct for bleaching, the time series for each ROI was fit with the sum of two exponentials, and in the calculation of ΔF/F = (F(t) – F₀)/F₀, the fitted value at each time t was used as F₀. For the 2 s flash search stimulus, all imaging frames were used to compute the fit, thereby placing ΔF/F = 0 at the mean response after correction for bleaching. For the 25 ms light and dark flashes off of gray stimulus, only imaging frames that fell in the last 25% of the gray period were used to fit the bleaching curve; this places ΔF/F = 0 at the mean baseline the cell returns to after responding to the flash instead of at the mean of the entire trace. The stimulus-locked average was computed for each ROI by reassigning the timing of each imaging frame to be relative to the stimulus transitions (dark to light or light to dark for the 2 s flash search stimulus, gray to light or gray to dark for the flashes off of gray) and then computing a simple moving average with a 25 ms averaging window and a shift of 8.33 ms. This effectively resampled our data from 38.9 Hz to 120 Hz with 3-point boxcar smoothing but did not otherwise distort the fluorescence signal. As the screen on which the stimulus was presented did not span the fly’s entire visual field, only a subset of imaged ROIs actually observed the stimulus. Both the 2 s flash search stimulus and the 25 ms light and dark flashes stimulus were presented to each ROI. Responding ROIs were identified as those responding to the 2 s flash search stimulus. All of the responses also were examined manually. All traces are presented as the mean ±1 SEM across all of the responding ROIs of the moving average response to all trials of each ROI.

Peak ΔF/F for each ROI was computed as follows:

For the responses to the 25 ms light and dark flashes off of gray stimulus, the peak response to the light flash (peak ΔF/F) was the ΔF/F value farthest from zero in the expected direction of the initial response (calcium increase). Each ROI’s peak ΔF/F was then normalized to the mean peak ΔF/F of the no-Flp control and presented as mean ±1 SEM. One-way ANOVAs comparing the experimental and two control genotypes were performed. Post-hoc Student’s two-sample t-tests between the experimental and each of the two control genotypes were performed and Bonferroni-corrected for multiple comparisons.

A list of D. melanogaster neuronal genes was obtained by using FlyBase's QueryBuilder tool to search for genes expressed in the nervous system. The DataClass field was set to ‘Expression Patterns’, the Body Part/Tissue field was set to ‘nervous system’, and the species filter was set to ‘Dmel’. This yielded ~2000 neuronal genes. Based on this list of neuronal genes and the list of MiMIC insertions (http://flypush.imgen.bcm.tmc.edu/pscreen/files/MI-list-2016-06-30.xlsx), we identified the subset of neuronal genes that had at least one MIMIC site in a coding intron.

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

We thank T Mosca and members of the Clandinin Laboratory for helpful discussion and comments on this manuscript. We thank D Bieli (University of Basel), M Müller (University of Basel), L Luo (Stanford University), T Mosca (Stanford University), A DeAntonio (Washington University in St. Louis), B Ganetzky (University of Wisconsin), R Ordway (Pennsylvania State University), the Drosophila Genome Resource Center (DGRC), and the Bloomington Drosophila Stock Center (BDSC) for reagents. We thank R Volkan for an unpublished qRT-PCR primer sequence; M Bennett, C Bennett, T Li, M Fu, and S Liddelow (Stanford University) for advice about qRT-PCR experiments; and B Barres (Stanford University) for use of a qRT-PCR machine. We thank the Harvard Image and Data Analysis Core (IDAC) for access to Imaris software for analysis of immunostaining. YEF was supported by a National Science Foundation Fellowship. HHY was supported by a Stanford Graduate Fellowship and a Stanford Interdisciplinary Graduate Fellowship. DMG was supported by a Ruth L Kirschstein NRSA Postdoctoral Fellowship (F32 EY020040) from the National Eye Institute. This work was funded by R01 EY022638 and U01 MH109119 (to TRC).

© 2017, Fisher et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.