HNF1A is a novel oncogene that regulates human pancreatic cancer stem cell properties
- University of Michigan Health System, United States
- New York University Langone Health, United States
- New York University Langone Health, United states
Figures
Figure 1 with 2 supplements
HNF1A-signature dominates pancreatic CSCs.
(A) Flow cytometry analysis of CD44 and EPCAM surface expression of three primary PDA samples. (B) CD44High/EPCAMLow (P1), CD44High/EPCAMHigh (P2) and CD44Low/EPCAMHigh (P3) NY8 cells were isolated …
-
Figure 1—source data 1
Quantitation of tumorspheres, P2 subpopulation-enriched transcripts, and HNF1A mRNA.
- https://doi.org/10.7554/eLife.33947.006
-
Figure 1—source data 2
Quantitation of GFP expression in adherent cells and tumorspheres.
- https://doi.org/10.7554/eLife.33947.007
Figure 1—figure supplement 1
Cancer stem cell properties of PDA cell subpopulations.
(A) Co-localization of CD24High surface expression with EPCAM and CD44 expression is highlighted in red. (B) Western blot analysis of HNF1A and target genes CDH17 and DPP4, as well as CD44 and EPCAM …
Figure 1—figure supplement 2
HNF1A is elevated in tumorspheres.
(A) NY8 and NY15 cells were grown either in non-adherent conditions (labeled S) or under adherent conditions (labeled A) for 7 days. Lysates were collected and western blotted for HNF1A, CDH17, and …
Figure 2 with 1 supplement
Knockdown of HNF1A in primary PDA cells inhibits growth in vitro.
(A) Western blot analysis of HNF1A expression in a panel of primary PDA lines compared to immortalized pancreatic ductal cell line HPNE and HPDE. Quantitation of HNF1A protein is indicated below the …
-
Figure 2—source data 1
Quantitation of PDA cell growth and apoptosis following HNF1A knockdown.
- https://doi.org/10.7554/eLife.33947.010
-
Figure 2—source data 2
Quantitative PCR analysis of HNF1A mRNA in PDA cells and histology score of HNF1A staining in normal and neoplastic ducts..
- https://doi.org/10.7554/eLife.33947.011
Figure 2—figure supplement 1
HNF1A expression in PDA cells and patient samples.
(A) qRT-PCR analysis of HNF1A mRNA expression in a panel of conventional and primary PDA lines. HNF1A mRNA expression was normalized to an ACTB internal control and relative to HPNE. Relative HNF1A …
Figure 3 with 1 supplement
Knockdown of HNF1A depletes CSC numbers.
(A) Multiple PDA cells were transfected with HNF1A-targeting siRNA or non-targeting control siRNA for 6 days. Surface expression of CD44 and EPCAM was measured by flow cytometry, and the percentage …
-
Figure 3—source data 1
Quantitation of the P2 subpopulation, CD24 expression, and tumorsphere formation following HNF1A knockdown.
- https://doi.org/10.7554/eLife.33947.014
Figure 3—figure supplement 1
Knockdown of HNF1A depletes CSC numbers and properties in vitro.
(A) Surface expression of CD44 and EPCAM in multiple primary PDA cells following HNF1A knockdown. Percentages of P2 cells are indicated. (B, C) Surface expression of CD44 and EPCAM was measured by …
Figure 4 with 1 supplement
Overexpression of HNF1A promotes CSC properties in PDA cells and normal pancreatic cell lines.
(A) NY15 and NY53 cells Western blotted for HNF1A and control gene induction following 48 hr ± doxycycline (Dox). Quantitation of proteins is indicated below the respective blots. (B) NY8 cells were …
-
Figure 4—source data 1
Quantitation of CD24 expression and tumorsphere formation in PDA cells with HNF1A overexpression, and quantitation of colony formation in HPNE and HPDE cells expressing HNF1A and oncogenic KRAS.
- https://doi.org/10.7554/eLife.33947.017
-
Figure 4—source data 2
Quantitation of CD44+/CD24+ HPDE and HPNE cells overexpressing HNF1A.
- https://doi.org/10.7554/eLife.33947.018
Figure 4—figure supplement 1
Overexpression of HNF1A and mutant KRAS in HPDE and HPNE cell.
(A) HPDE and HPNE cells expressing LacZ (L), KRASG12D (K), HNF1A (H), or HNF1A with KRASG12D (HK) were analyzed by western blot to confirm transgene expression and activation of downstream signaling …
Figure 5 with 1 supplement
Knockdown of HNF1A impairs tumor growth and depletes CSCs in vivo.
(A, B) 10,000 firefly luciferase-labeled NY5 and NY15 cells expressing control or HNF1A shRNAs were implanted orthotopically into the pancreata of NOD/SCID mice and monitored by IVIS imaging for 6 …
-
Figure 5—source data 1
Quantitation of orthotopic and subcutaneous xenograft tumor volumes, and quantitation of PCSCs following HNF1A knockdown.
- https://doi.org/10.7554/eLife.33947.021
-
Figure 5—source data 2
Quantitation of subcutaneous xenograft tumor volumes following HNF1A knockdown.
- https://doi.org/10.7554/eLife.33947.022
Figure 5—figure supplement 1
Effects of HNF1A depletion on PDA xenograft biology.
(A) 103 control or HNF1A-depleted NY15 cells were implanted subcutaneously in NOD/SCID mice (10 mice per shRNA/bilateral injections) for 6 weeks. Tumors were measured by caliper to determine tumor …
Figure 6 with 2 supplements
HNF1A regulates stemness through POU5F1/OCT4 regulation.
(A) qRT-PCR analysis of POU5F1/OCT4 mRNA in NY5, NY8 and NY15 cells expressing control (LacZ2.1) or HNF1A shRNAs. ACTB was used as an internal control, n = 3. Statistical difference was determined …
-
Figure 6—source data 1
Quantitation of OCT4/POU5F1 mRNA following HNF1A knockdown and overexpression; relative HNF1A and OCT4/POU5F1 mRNA expressions in PDA cells; quantitation of tumorspheres following OCT4/POU5F1 knockdown; and quantitation of tumorsphere formation following OCT4A rescue.
- https://doi.org/10.7554/eLife.33947.026
-
Figure 6—source data 2
Quantitation of ChIP, CLuc activity, annexin V staining, PI staining, and tumorsphere formation.
- https://doi.org/10.7554/eLife.33947.027
Figure 6—figure supplement 1
HNF1A binds directly to and activates transcription from the POU5F1/OCT4 upstream LTR region.
(A) Schematic representation of the POU5F1/OCT4 locus, including the canonical exon 1 (E1), distal enhancer region (DE), and the cryptic exon E0 and upstream LTR regions reported in Malakootian et …
Figure 6—figure supplement 2
Rescue of POU5F1/OCT4 expression in PDA cells.
(A, B) NY8 cells were transiently transfected with control (Ctl) or POU5F1/OCT4-targeting (labeled OCT4) siRNA for 72 hr, followed by (A) annexin V/DAPI-staining or (B) propidium iodide (PI) …
Figure 7 with 1 supplement
HNF1A regulates a transcriptional program associated with poor survival in PDA.
(A) Venn diagrams illustrating overlapping genes with altered transcription (Bru-seq) following HNF1A knockdown in NY8 and NY15 cells. ‘HNF1A upregulated’ genes denote genes that were downregulated …
Figure 7—figure supplement 1
Association of HNF1A-responsive genes and survival in PDA.
(A, B) HNF1A-responsive genes were ranked according FDR-adjusted Wald p value and the direction of survival association using TCGA PDA patient data for (A) upregulated genes (including bound and …
Author response image 1
Comparison of TCGA and ICGC survival analyses.
https://doi.org/10.7554/eLife.33947.034
Author response image 2
Comparison of TCGA and ICGC background gene concordance.
Overlap of all genes is on the left, “UP” refers to increased survival genes, “DN” to reduced survival genes.
Author response image 3
Correlation of HNF1A and POU5F1 expression.
https://doi.org/10.7554/eLife.33947.036Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Human) | HNF1A | This paper | Cloned from NY5 cDNA | |
| Gene (Escherichia coli) | LacZ | Invitrogen | Originally from Catalog number: K499000 | Subcloned into pLentipuro3/TO/V5-DEST |
| Gene (Aequorea victoria) | PatGFP | This paper | Variant of EGFP containing the following mutations: S31R, Y40N, S73A, F100S, N106T, Y146F, N150K, M154T, V164A, I168T, I172V, A207V | |
| Gene (Human) | KRAS G12D | This paper | Cloned from NY5 cDNA | |
| Gene (Human) | POU5F1 (OCT4A) | Transomic Technologies | Catalog number: BC117435 | Subcloned into pLenti6.3 /UbC/V5-DEST |
| Gene (Escherichia coli) | LacZ2.1 shRNA | This paper | Sequence: CACCAAATCGCTGATTT GTGTAGTCGTTCAAGAGACGACT ACACAAATCAGCGA | |
| Gene (Human) | HNF1A shRNA#1 | This paper | Sequence: CACCGCTAGTGGAGGA GTGCAATTTCAAGAGAATTGCACTC CTCCACTAGC | |
| Gene (Human) | HNF1A shRNA#2 | This paper | Sequence: CACCGTCCCTTAGTGA CAGTGTCTATTCAAGAGATAGA CACTGTCACTAAGGGAC | |
| Gene (Escherichia coli) | IVS-TetR-P2A-Bsd | This paper | IVS-TetR and Bsd were subcloned from pLenti6/TR (Invitrogen) with a P2A peptide linker added by PCR and Gibson Assembly | |
| Gene (Aequorea victoria) | PatGFP-Luc2 | This paper | PatGFP and Luc2 (Promega) were amplified by PCR and fused by Gibson Assembly | |
| Strain, strain background (Mouse) | NOD.CB17-Prkdcscid/J | The Jackson Laboratory | Catalog number: 001303; RRID: IMSR_JAX:001303 | |
| Cell line (Human) | HPDE | Craig Logsdon, MD Anderson | ||
| Cell line (Human) | HPNE | ATCC | Catalog number: ATCC CRL-4023; RRID:CVCL_C466 | |
| Cell line (Human) | Capan-2 | ATCC | Catalog number: ATCC HTB-80; RRID:CVCL_0026 | |
| Cell line (Human) | HPAF-II | ATCC | Catalog number: ATCC CRL-1997; RRID:CVCL_0313 | |
| Cell line (Human) | BxPC-3 | ATCC | Catalog number: ATCC CRL-1687; RRID:CVCL_0186 | |
| Cell line (Human) | AsPC-1 | ATCC | Catalog number: ATCC CRL-1682; RRID:CVCL_0152 | |
| Cell line (Human) | MiaPaCa-2 | ATCC | Catalog number: ATCC CRL-1420; RRID:CVCL_0428 | |
| Cell line (Human) | Panc-1 | ATCC | Catalog number: ATCC CRL-1469; RRID:CVCL_0480 | |
| Cell line (Human) | NY1 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY2 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY3 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY5 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY6 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY8 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY9 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY12 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY15 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY16 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY17 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY19 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY28 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY32 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | NY53 | This paper | Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft | |
| Cell line (Human) | 293FT | Invitrogen | Catalog number: R70007 | |
| Transfected construct (Gaussia) | pTK-GDLuc | This paper | The Gaussia coding region of pTK-Gluc (New England Biolabs) was replaced with the Gaussia Dura coding region (Millipore) | |
| Transfected construct (Cypridina) | pCLuc-Basic2 | New England Biolabs | Catalog number: N0317S | |
| Transfected construct (Cypridina) | pCLuc-Basic2/OCT4 LTR promoter | This paper | 1.7 kbp OCT4 LTR promoter region from NY5 was subcloned into pCLuc-Basic2 | |
| Transfected construct (Cypridina) | pCLuc-Basic2/OCT4 canonical promoter | This paper/Addgene | Originally from Catalog number: 38776 | OCT4 promoter from phOct4-EGFP (Addgene) was subcloned into pCLuc-Basic2 |
| Antibody | CD326 (EpCAM)-FITC | Miltenyi Biotec | Catalog number: 130-113-263; RRID:AB_2726064 | Application: flow cytometry |
| Antibody | BD Pharmingen APC Mouse Anti-Human CD44 | BD Biosciences | Catalog number: 559942; RRID:AB_398683 | Application: flow cytometry |
| Antibody | BD Pharmingen PE Mouse Anti-Human CD24 | BD Biosciences | Catalog number: 555428; RRID:AB_395822 | Application: flow cytometry |
| Antibody | H-2Kd/H-2Dd clone 34-1-2S | SouthernBiotech | Catalog number: 1911–08; RRID:AB_1085008 | Application: flow cytometry |
| Antibody | Anti-HNF1 antibody [GT4110] | Abcam | Catalog number: ab184194; RRID:AB_2538735 | Application: IHC, Western blot |
| Antibody | HNF-1 alpha Antibody (C-19) | Santa Cruz Biotechnology | Catalog number: sc-6547; RRID:AB_648295 | ChIP |
| Antibody | Normal Rabbit IgG | Cell Signaling Technology | Catalog number: 2729S; RRID:AB_1031062 | ChIP |
| Antibody | HNF1α (D7Z2Q) | Cell Signaling Technology | Catalog number: 89670S; RRID:AB_2728751 | Application: Western blot |
| Antibody | β-Actin (clone AC-74) | Sigma Aldrich | Catalog number: A2228-200UL; RRID:AB_476697 | Application: Western blot |
| Antibody | CDH17 antibody | Proteintech | Catalog number: 50-608-369; RRID:AB_2728752 | Application: Western blot |
| Antibody | DPP4/CD26 (D6D8K) | Cell Signaling Technology | Catalog number: 67138S; RRID:AB_2728750 | Application: Western blot |
| Antibody | CD44 (156–3 C11) | Cell Signaling Technology | Catalog number: 3570S; RRID:AB_10693293 | Application: Western blot |
| Antibody | EpCAM (D1B3) | Cell Signaling Technology | Catalog number: 2626S; RRID:AB_2728749 | Application: Western blot |
| Antibody | Cleaved Caspase-3 (Asp175) (5A1E) | Cell Signaling Technology | Catalog number: 9664S; RRID:AB_2070042 | Application: Western blot |
| Antibody | Cleaved Caspase-6 (Asp162) | Cell Signaling Technology | Catalog number: 9761S; RRID:AB_2290879 | Application: Western blot |
| Antibody | Cleaved Caspase-7 (Asp198) (D6H1) | Cell Signaling Technology | Catalog number: 8438S; R RID:AB_11178377 | Application: Western blot |
| Antibody | Cleaved Caspase-9 (Asp330) (D2D4) | Cell Signaling Technology | Catalog number: 7237S; RRID:AB_10895832 | Application: Western blot |
| Antibody | Cleaved Caspase-9 (Asp315) Antibody | Cell Signaling Technology | Catalog number: 9505S; RRID:AB_2290727 | Application: Western blot |
| Antibody | GFP (D5.1) XP | Cell Signaling Technology | Catalog number: 2956S; RRID:AB_1196615 | Application: Western blot |
| Antibody | Ras (G12D Mutant Specific) (D8H7) | Cell Signaling Technology | Catalog number: 14429S; RRID:AB_2728748 | Application: Western blot |
| Antibody | Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP | Cell Signaling Technology | Catalog number: 4370S; RRID:AB_2315112 | Application: Western blot |
| Antibody | Phospho-Akt (Ser473) (D9E) XP | Cell Signaling Technology | Catalog number: 4060S; RRID:AB_2315049 | Application: Western blot |
| Antibody | Oct-4A (C52G3) | Cell Signaling Technology | Catalog number: 2890S; RRID:AB_2167725 | Application: Western blot |
| Antibody | Anti-KRAS + HRAS + NRAS antibody | Abcam | Catalog number: ab55391; RRID:AB_941040 | Application: Western blot |
| Antibody | Anti-β-Galactosidase | Promega | Catalog number: Z3781; RRID:AB_430877 | Application: Western blot |
| Antibody | IRDye 800CW Goat anti-Mouse IgG | Licor | Catalog number: 926–32210; RRID:AB_621842 | Application: Western blot |
| Antibody | IRDye 800CW Goat anti-Rabbit | Licor | Catalog number: 926–32211; RRID:AB_621843 | Application: Western blot |
| Antibody | IRDye 680LT goat anti-mouse | Licor | Catalog number: 926–68020; RRID:AB_10706161 | Application: Western blot |
| Antibody | IRDye 680LT Goat anti-Rabbit IgG | Licor | Catalog number: 926–68021; RRID:AB_10706309 | Application: Western blot |
| Recombinant DNA reagent | pLentipuro3/TO/ V5-DEST | Andrew E. Aplin, Thomas Jefferson University | ||
| Recombinant DNA reagent | pLentineo3/TO/ V5-DEST | Andrew E. Aplin, Thomas Jefferson University | ||
| Recombinant DNA reagent | pLentihygro3/TO/ V5-DEST | Andrew E. Aplin, Thomas Jefferson University | ||
| Recombinant DNA reagent | pLenti0.3/EF/ V5-DEST | This paper | Human EF1-alpha promoter was substituted for the CMV promoter of pLenti6.3/UbC/V5-DEST and the SV40 promoter/Bsd cassette was removed | |
| Recombinant DNA reagent | pLenti6.3/UbC/ V5-DEST | Andrew E. Aplin, Thomas Jefferson University | ||
| Recombinant DNA reagent | pLenti6.3/UbC empty vector | This paper | EcoRV digest/re-ligation to remove Gateway element | |
| Recombinant DNA reagent | pLentipuro3/ Block-iT-DEST | Andrew E. Aplin, Thomas Jefferson University | ||
| Recombinant DNA reagent | pLenti0.3/EF/GW/IVS -Kozak-TetR-P2A-Bsd | This paper | LR recombination of IVS-TetR-P2A-Bsd cassette into pLenti0.3/EF/V5-DEST | |
| Recombinant DNA reagent | pLenti0.3/EF/GW/ PatGFP-Luc2 | This paper | LR recombination of PatGFP-Luc2 cassette into pLenti0.3/EF/V5-DEST | |
| Recombinant DNA reagent | pLP1 | Andrew E. Aplin, Thomas Jefferson University | Lentivirus packaging plasmid originally from Invitrogen | |
| Recombinant DNA reagent | pLP2 | Andrew E. Aplin, Thomas Jefferson University | Lentivirus packaging plasmid originally from Invitrogen | |
| Recombinant DNA reagent | pLP/VSVG | Andrew E. Aplin, Thomas Jefferson University | Lentivirus packaging plasmid originally from Invitrogen | |
| Sequence-based reagent | Non-targeting control siRNA | Dharmacon | Catalog number: D-001810-01-20 | |
| Sequence-based reagent | HNF1A siRNA #1 | Dharmacon | Catalog number: D-008215-01-0002 | Sequence: GGAGGAACCGTTTCAAGTG |
| Sequence-based reagent | HNF1A siRNA #2 | Dharmacon | Catalog number: D-008215-02-0002 | Sequence: GCAAAGAGGCACTGATCCA |
| Sequence-based reagent | POU5F1/OCT4 siRNA #5 | Dharmacon | Catalog number: D-019591-05-0002 | Sequence: CATCAAAGCTCTGCAGAAA |
| Sequence-based reagent | POU5F1/OCT4 siRNA #6 | Dharmacon | Catalog number: D-019591-06-0002 | Sequence: GATATACACAGGCCGATGT |
| Sequence-based reagent | POU5F1/OCT4 siRNA #9 | Dharmacon | Catalog number: D-019591-09-0002 | Sequence: GCGATCAAGCAGCGACTAT |
| Sequence-based reagent | POU5F1/OCT4 siRNA #10 | Dharmacon | Catalog number: D-019591-10-0002 | Sequence: TCCCATGCATTCAAACTGA |
| Peptide, recombinant protein | Recombinant human EGF | Invitrogen | Catalog number: PHG0311L | |
| Peptide, recombinant protein | FGF-basic Recombinant Human | Invitrogen | Catalog number: PHG0264 | |
| Peptide, recombinant protein | Leukemia Inhibitory Factor human | Sigma Aldrich | Catalog number: L5283 | |
| Peptide, recombinant protein | Bone Morphogenetic Protein four human | Peprotech | Catalog number: 120–05 | |
| Commercial assay or kit | SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads) | Cell Signaling Technology | Catalog number: 9003 | |
| Commercial assay or kit | BioLux Gaussia Luciferase Assay Kit | New England Biolabs | Catalog number: E3300S | |
| Commercial assay or kit | BioLux Cypridina Luciferase Assay Kit | New England Biolabs | Catalog number: E3309S | |
| Commercial assay or kit | RNeasy Plus Mini Kit coupled with RNase-free DNase set | Qiagen | Catalog number: 74136 and 79254 | |
| Commercial assay or kit | High Capacity RNA-to-cDNA Master Mix | Applied Biosystem | Catalog number: 4387406 | |
| Commercial assay or kit | Power SYBR Green PCR Master Mix | Applied Biosystem | Catalog number: 4367659 | |
| Chemical compound, drug | APC-Cy7 Streptavidin | BD Biosciences | Catalog number: 554063 | |
| Chemical compound, drug | DAPI (4',6-Diamidino-2-Phenylindole, Dilactate) | Invitrogen | Catalog number: 3571 | |
| Chemical compound, drug | APC Annexin V | BD Biosciences | Catalog number: 550474 | |
| Chemical compound, drug | Annexin V Binding Buffer, 10x concentrate | BD Biosciences | Catalog number: 556454 | |
| Chemical compound, drug | RNase A | Invitrogen | Catalog number: 12091021 | |
| Chemical compound, drug | Lipofectamine 2000 Reagent | Invitrogen | Catalog number: 11668019 | |
| Chemical compound, drug | Lipofectamine RNAiMAX Reagent | Invitrogen | Catalog number: 13778150 | |
| Chemical compound, drug | Propidium iodide | Invitrogen | Catalog number: P1304MP | |
| Chemical compound, drug | Gentamicin | Invitrogen | Catalog number: 15710072 | |
| Chemical compound, drug | Antibiotic-Antimycotic (100X) | Invitrogen | Catalog number: 15240062 | |
| Chemical compound, drug | N-2 Supplement (100X) | Invitrogen | Catalog number: 17502–048 | |
| Chemical compound, drug | B-27 Serum-Free Supplement (50X) | Invitrogen | Catalog number: 17504–044 | |
| Chemical compound, drug | Doxycycline | Sigma Aldrich | D9891-100G | |
| Software, algorithm | GraphPad Prism 6 | GraphPad Software; http://www.graphpad.com | RRID:SCR_002798 | |
| Software, algorithm | oPOSSUM 3.0 | http://opossum.cisreg.ca/oPOSSUM3/; PMID: 22973536 | RRID:SCR_010884 | |
| Software, algorithm | Bowtie v1.1.1 | PMID: 19261174 | RRID:SCR_005476 | |
| Software, algorithm | Bowtie v0.12.8 | PMID: 19261174 | RRID:SCR_005476 | |
| Software, algorithm | MACS v1.4.2 | PMID: 18798982 | RRID:SCR_013291 | |
| Software, algorithm | TopHat v1.4.1 | PMID: 19289445 | RRID:SCR_013035 | |
| Software, algorithm | DESeq v1.24.0 | PMID: 20979621 | RRID:SCR_000154 | |
| Software, algorithm | bedtools v.2.26.0 | PMID: 20110278 | RRID:SCR_006646 | |
| Software, algorithm | survival v2.40–1 | DOI: 10.1007/978-1-4757-3294-8 |
Additional files
-
Supplementary file 1
Cancer stem cell frequencies in PDA subpopulations.
Limiting dilution assay was performed with sorted NY15 cells injected subcutaneously in NOD/SCID mice. The resultant numbers of tumors/injection is tabulated with estimated cancer stem cell frequencies calculated by extreme limiting dilution analysis (ELDA).
- https://doi.org/10.7554/eLife.33947.030
-
Supplementary file 2
Data for generating PDA subpopulation heatmap and HNF1A target gene data (Excel spreadsheet).
Contents of each worksheet are as follows: worksheet 1) notes for summary tables; worksheet 2) Primers for qPCR validation of CSC50 genes; worksheet 3) table includes values represented in the Figure 1E where values are fold changes relative to HL or LH, as indicated; worksheet 4) NY8 and NY15 Bru-seq data related to Figure 7A; worksheet 5) NY8 and NY15 ChIP-seq data related to Figure 7B with information regarding enhancer binding; worksheet 6) summary of selected genes in expression vs survival in TCGA PAAD tumors - related to Figure 7E, S9A, and S9B, worksheet 7) HNF1A-upregulated and -bound genes: association between gene expression and survival in TCGA PAAD tumors - related to Figure 7E; worksheet 8) HNF1A-upregulated genes: association between gene expression and survival in TCGA PAAD tumors - related to Figure 7—figure supplement 1A; worksheet 9) HNF1A-downregulated genes: association between gene expression and survival in TCGA PAAD tumors - related to Figure 7—figure supplement 1B; worksheet 10) TCGA donors used in survival analysis - related to Figure 7E, Figure 7—figure supplement 1A and B; worksheet 11) Overrepresented TF-binding motifs in cancer stem cell gene set (CSC50), oPOSSUM3 results - related to Figure 1; worksheet 12) predicted HNF1A targets - related to Figure 1; worksheet 13) overrepresented TF-binding motifs in HNF1A upregulated genes, oPOSSUM3 results - related to Figure 7D; worksheet 14) overrepresented TF-binding motifs in HNF1A downregulated genes, oPOSSUM3 results - related to Figure 7D; worksheet 15) predicted POU5F1 targets - related to Figure 7D; worksheet 16) HNF1A ChIP-seq peak enhancer overlap, NY15 replicate 1 (rep1) - related to Figure 7B; worksheet 17) A ChIP-seq peak enhancer overlap, NY15 replicate 2 (rep2) - related to Figure 7B; worksheet 18) HNF1A ChIP-seq peak enhancer overlap, NY8 replicate 1 (rep1) - related to Figure 7B; worksheet 19) HNF1A ChIP-seq peak enhancer overlap, NY8 replicate 2 (rep2) - related to Figure 7B.
- https://doi.org/10.7554/eLife.33947.031
-
Transparent reporting form
- https://doi.org/10.7554/eLife.33947.032
