HNF1A is a novel oncogene that regulates human pancreatic cancer stem cell properties

Abstract
eLife digest
Introduction
Results
Discussion
Materials and methods
Data availability
References
Article and author information
Metrics

Abstract

The biological properties of pancreatic cancer stem cells (PCSCs) remain incompletely defined and the central regulators are unknown. By bioinformatic analysis of a human PCSC-enriched gene signature, we identified the transcription factor HNF1A as a putative central regulator of PCSC function. Levels of HNF1A and its target genes were found to be elevated in PCSCs and tumorspheres, and depletion of HNF1A resulted in growth inhibition, apoptosis, impaired tumorsphere formation, decreased PCSC marker expression, and downregulation of POU5F1/OCT4 expression. Conversely, HNF1A overexpression increased PCSC marker expression and tumorsphere formation in pancreatic cancer cells and drove pancreatic ductal adenocarcinoma (PDA) cell growth. Importantly, depletion of HNF1A in xenografts impaired tumor growth and depleted PCSC marker-positive cells in vivo. Finally, we established an HNF1A-dependent gene signature in PDA cells that significantly correlated with reduced survivability in patients. These findings identify HNF1A as a central transcriptional regulator of PCSC properties and novel oncogene in PDA.

https://doi.org/10.7554/eLife.33947.001

eLife digest

Pancreatic ductal adenocarcinoma is the most common form of pancreatic cancer. It is also one of the deadliest types of cancer: fewer than one in ten patients live for five years after being diagnosed with the disease. Several reasons can explain this poor outcome including that the cancer is often diagnosed late, when tumor cells have already spread, and that there are not many effective treatments for it.

Pancreatic tumors contain different types of cancer cells with different properties. Among these are the so-called pancreatic cancer stem cells. These aggressive cells produce copies of themselves, contributing to tumor growth and spread. They can also help tumors to resist chemotherapy and radiotherapy. New treatments that specifically target cancer stem cells could therefore prove important for treating pancreatic cancer.

It is still not clear what makes pancreatic cancer stem cells so aggressive, or how they differ from the rest of the cells in a tumor. Abel et al. therefore looked for proteins that were more abundant in human pancreatic cancer stem cells than in other, less aggressive cancer cells with the idea that these proteins are likely to be important for the behavior of the pancreatic cancer stem cells.

Abel et al. found that a protein called HNF1A is enriched in pancreatic cancer stem cells. Experimentally reducing the levels of HNF1A in cells taken from human pancreatic cancers caused the cells to grow less well and form smaller tumors when injected into the pancreases of mice. These tumors contained few cancer stem cells, suggesting that HNF1A is important for maintaining the stem cell state. Further experiments showed that HNF1A increases the amount of many other proteins inside cells, including one that controls the activity of normal stem cells.

Given the importance of HNF1A to pancreatic cancer stem cells, finding ways to prevent this protein from working could lead to new treatments for pancreatic cancer. At the moment there are no drugs that target HNF1A. Further research is therefore needed to develop new drugs that work against HNF1A or one of the other proteins that it affects.

https://doi.org/10.7554/eLife.33947.002

Introduction

Pancreatic ductal adenocarcinoma (PDA) is projected to be the second leading cause of cancer deaths in the U.S. by 2020 (Rahib et al., 2014). The exceeding lethality of PDA is attributed to a complex of qualities frequent to the disease including early and aggressive metastasis and limited responsiveness to current standards of care. While both aspects are in-and-of-themselves multifaceted and can be partially attributed to factors such as the tumor microenvironment (Olive et al., 2009; Provenzano et al., 2012; Waghray et al., 2016) and the mutational profile of the tumor cells (Yachida et al., 2012), cancer stem cells (CSCs) have also been identified to contribute to promoting early metastasis and resistance to therapeutics (Hermann et al., 2007; Li et al., 2011).

CSCs, which were originally identified in leukemias (Bonnet and Dick, 1997; Graham et al., 2002), have been identified in a number of solid tumors including glioblastoma (Singh et al., 2003), pancreas (Li et al., 2007; Hermann et al., 2007) and colon (O'Brien et al., 2007). In these cases, CSCs have been characterized by the ability to establish disease in immunocompromised mice, to resist chemotherapeutics, the capability of both self-renewal and differentiation into the full complement of heterogeneous neoplastic cells that comprise the tumor, and the propensity to metastasize. In each case, CSCs are distinguished from other tumor cell types by the expression of various, sometimes divergent cell surface markers. Our lab was the first to identify pancreatic cancer stem cells (PCSCs), which were found to express the markers EPCAM (ESA), CD44, and CD24 (Li et al., 2007). In addition to these markers, CD133 (Hermann et al., 2007), CXCR4 (Hermann et al., 2007), c-MET (Li et al., 2011), aldehyde dehydrogenase 1 (ALDH1) (Kim et al., 2011), and autofluorescence (Miranda-Lorenzo et al., 2014) have all been proposed markers of PCSCs. In all cases, the identified cells are characterized by being able to form spheres of cells (tumorspheres) under non-adherent, serum-free conditions, as well as an increased ability to form tumors in mice compared to bulk tumor cells. While a number of markers have been identified for PCSCs, relatively little is known about the transcriptional platforms that govern their function and set them apart from the majority of bulk PDA cells. Transcriptional regulators such as NOTCH (Wang et al., 2009; Abel et al., 2014), BMI1 (Proctor et al., 2013), and SOX2 (Herreros-Villanueva et al., 2013) have been demonstrated to play roles in PCSCs, although these proteins are also critical for normal stem cell function in many tissues.

In this study, we sought to better understand the biological heterogeneity of PCSCs and their bulk cell counterparts in an effort to identify novel regulators of PCSCs in the context of low-passage, primary patient-derived PDA cells. Using microarray analysis and comparing primary PDA cell subpopulations with different levels tumorigenic potential and stem-cell-like function, we identified hepatocyte nuclear factor 1-alpha (HNF1A), an endoderm-restricted transcription factor, as a key regulator of the PCSC state. Supporting this hypothesis, depletion of HNF1A resulted in a loss of PCSC marker expression and functionality both in vitro and in vivo. Additionally, ectopic expression of HNF1A augmented PCSC properties in PDA cells and enhanced growth and anchorage-independence in normal pancreatic cell lines. Mechanistically, we found that HNF1A directly regulates transcription of the stem cell transcription factor POU5F1/OCT4, which is necessary for stemness in PCSCs. Based on these data, we postulate a novel pro-oncogenic function for HNF1A through its maintenance of the pancreatic cancer stem cell properties.

Results

An HNF1A gene signature dominates a PCSC gene signature

A transcriptional profile of PCSCs has yet to be established, and we hypothesized that such a profile would contain key regulators of the PCSC state. To pursue this hypothesis, we utilized a series of low-passage, patient-derived PDA cell lines to isolate PCSC-enriching and non-enriching subpopulations for comparative analysis. Using two of our previously described PCSC surface markers, CD44 and EPCAM (Li et al., 2007), we found that low-passage PDA cells generally formed three subpopulations (abbreviated P herein) based on surface staining: CD44^High/EPCAM^Low (P1), CD44^High/EPCAM^High (P2), or CD44^Low/EPCAM^High (P3) (Figure 1A). Similar expression patterns were observed in 10 primary tumor samples (data not shown). Additionally, a CD44^Low/EPCAM^Low subpopulation was observed in five samples (data not shown), consistent with our previous data (Li et al., 2007). Using previously described measures of PCSC function (Li et al., 2007; Li et al., 2011), including co-expression of the PCSC marker CD24 (Figure 1—figure supplement 1A), the abilities for isolated subpopulations to reestablish heterogeneous CD44 and EPCAM surface expression (Figure 1B), to form tumorspheres under non-adherent/serum-free culture conditions (Figure 1C,D), and to initiate tumors in immune-deficient mice (Supplementary file 1), we found that P2 cells showed greater enrichment for cells with PCSC properties than their P1 and P3 counterparts.

Figure 1 with 2 supplements see all

Download asset Open asset

HNF1A-signature dominates pancreatic CSCs.

(A) Flow cytometry analysis of CD44 and EPCAM surface expression of three primary PDA samples. (B) CD44^High/EPCAM^Low (P1), CD44^High/EPCAM^High (P2) and CD44^Low/EPCAM^High (P3) NY8 cells were isolated by FACS and grown in culture for 17 days, followed by flow cytometry for analysis for CD44 and EPCAM expression. (**C, D**) Isolated subpopulations were grown in tumorsphere media on non-adherent plates (500 cells/well) for 6 days. Representative images of resultant tumorspheres (100X magnification) are shown in (C), while quantitation of spheres (n = 3) is shown in (D). Statistical difference was determined by one-way ANOVA with Tukey’s multiple comparisons test. (E) Heat map representing relative fold differences in qRT-PCR expression of 50 cancer stem-cell-enriched genes in NY8 and NY15 cells. Per-gene values are relative to P1 or P3, whichever is higher. Gene names in red text indicate predicted HNF1A targets and asterisks (*) indicate known HNF1A targets. P1: CD44^High/EPCAM^Low, P2: CD44^High/EPCAM^High, P3: CD44^Low/EPCAM^High. For all genes, expression levels were normalized to an *ACTB* mRNA control, n = 3. Only genes with a significant (p<0.05) increase in P2 over both P1 and P3 subpopulations are shown, with statistical difference determined by one-way ANOVA with Tukey’s multiple comparisons test. (F) qRT-PCR analysis of *HNF1A* mRNA expression, normalized to an *ACTB* mRNA control, from different primary PDA subpopulations (n = 3). Statistical difference was determined by one-way ANOVA with Tukey’s multiple comparisons test. Related data can be found in Figure 1—figure supplements 1 and 2.

https://doi.org/10.7554/eLife.33947.003

Figure 1—source data 1 Quantitation of tumorspheres, P2 subpopulation-enriched transcripts, and HNF1A mRNA.: https://doi.org/10.7554/eLife.33947.006
Download elife-33947-fig1-data1-v2.xlsx
Figure 1—source data 2 Quantitation of GFP expression in adherent cells and tumorspheres.: https://doi.org/10.7554/eLife.33947.007
Download elife-33947-fig1-data2-v2.xlsx

Using two primary PDA lines (NY8 and NY15), P1, P2, and P3 PDA cells were sorted by flow cytometry, prepped immediately for mRNA, and analyzed by Affymetrix GeneChip microarray and validated by quantitative RT-PCR. We found that P2 cells from both lines exhibited a signature of 50 genes that was upregulated (>1.5 fold) relative to both P1 and P3 cell counterparts (Figure 1E). To further refine this gene cohort, we utilized oPOSSUM (Kwon et al., 2012), a web-based system to detect overrepresented transcription-factor-binding sites in gene sets. Interestingly, HNF1A, a P2 cohort gene itself (Figure 1E,F), had predicted binding sites in the ±5000 regions (from start of transcription) of 17/50 of the enriched genes, and due to its stringent consensus sequence (DGTTAATNATTAAC) was the most highly ranked common transcription factor by Z-score (17.895). Of these 50 genes, HNF1A is known to positively regulate cohort genes HNF4A (Boj et al., 2001), NR5A2 (Molero et al., 2012), CDH17 (Zhu et al., 2010), IGFBP1 (Babajko et al., 1993; Powell and Suwanichkul, 1993), and DPP4 (Gu et al., 2008). Interestingly, genome-wide association (GWA) studies have recently identified certain single nucleotide polymorphisms (SNPs) in the HNF1A locus as risk factors for developing PDA (Pierce and Ahsan, 2011; Li et al., 2012; Wei et al., 2012), although the mechanism by which these SNPs exert their influence is currently unknown. Similarly, SNPs in the HNF1A target NR5A2 are also associated with the development of PDA (Petersen et al., 2010; Rizzato et al., 2011), further implicating a role for the HNF1A-transcriptional network in PDA. To further support the enrichment of HNF1A in PCSCs, sorted cells were western blotted for HNF1A and HNF1A-target proteins, CDH17 and DPP4. These proteins were found to be elevated in P2 cell lysates compared to other subpopulations (Figure 1—figure supplement 1B), in agreement with their transcript levels. CSCs are enriched in cancer cell populations grown under low-attachment tumorsphere (S) conditions compared to cells grown in adherent (A) conditions. In keeping with this observation, we found protein levels of HNF1A and CDH17 elevated in multiple PDA lines cultured under tumorsphere conditions (Figure 1—figure supplement 2A and C). Using a GFP-based reporter driven by eight tandem copies of the HNF1A consensus sequence GGTTAATGATTAACC (Figure 1—figure supplement 2B), we found GFP expression was elevated in NY5, NY8, and NY15 cells grown under tumorsphere (S) compared to adherent conditions (A) (Figure 1—figure supplement 2C). This construct showed excellent dependence on HNF1A expression as targeting HNF1A with an HNF1A-specific siRNA ablated expression of both the ectopic GFP and endogenous CDH17 (Figure 1—figure supplement 2D). Lastly, we found the frequency of GFP-positive cells increased in cells grown in suspension (Figure 1—figure supplement 2E), with GFP expression being highest in the P2 subpopulation of NY15 cells (Figure 1—figure supplement 2F). Based on our gene expression and tumorsphere data, we hypothesized that HNF1A is a central regulator of CSC function.

HNF1A is a critical regulator of CSC properties in PDA cells

Consistent with our hypothesis that HNF1A may be an integral component of PDA biology we observed higher levels of HNF1A protein and transcripts in PDA cells compared to non-transformed immortalized pancreatic cell lines HPNE (N) and HPDE (D) (Figure 2A; Figure 2—figure supplement 1A). Immunostaining of a PDA tissue microarray showed HNF1A expression to be significantly elevated (p<0.0001) in PDA neoplastic ducts (n = 41) compared to normal pancreatic ducts (n = 18) (Figure 2—figure supplement 1B,C). To examine the role of HNF1A in PDA cells, we depleted the protein with two distinct siRNAs (Figure 2B). Knockdown of HNF1A resulted in reduced cell numbers in multiple primary PDA lines (Figure 2C). To determine whether the apparent loss in cell number was due to apoptotic cell death, we performed annexin V/DAPI staining on control and HNF1A-depleted NY5, NY8, and NY15 cells. In all cases, knockdown of HNF1A resulted in a significant (p<0.05) increase in apoptotic cells, while not affecting necrotic cell numbers (Figure 2D, data not shown). Furthermore, increased cleavage of caspases 3, 6, 7, and 9 was observed in cells depleted of HNF1A (Figure 2E), indicating apoptotic cell death. These data indicate that HNF1A is important for PDA cell growth and survival.

Figure 2 with 1 supplement see all

Download asset Open asset

Knockdown of HNF1A in primary PDA cells inhibits growth in vitro.

(A) Western blot analysis of HNF1A expression in a panel of primary PDA lines compared to immortalized pancreatic ductal cell line HPNE and HPDE. Quantitation of HNF1A protein is indicated below the respective blots. (B) Western blot of NY5, NY8, and NY15 cells transfected with non-targeting (Ctl) or HNF1A-targeting siRNA for 3 days, showing effective depletion of HNF1A protein by RNAi. Quantitation of HNF1A protein is indicated below the respective blots. (C) 1.5 × 10⁵ PDA cells were transfected with control (Ctl) or HNF1A-targeting siRNA (Day 1). Cells were collected and manually counted 3 and 6 days after transfection (n = 3). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. Red and green p values indicate Ctl vs. HNF1A#1 or #2, respectively. (D) Annexin V staining was performed on NY5, NY8, and NY15 cells transfected with control (Ctl) or HNF1A-targeting siRNA (**H1, H2**) for 3 days. The amount of apoptotic (annexin V+) cells are quantitated (n = 4). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test, with p values relative to the control siRNA group indicated. (E) Western blot analysis of cleaved caspases in NY8 and NY15 cells following HNF1A-knockdown (3 days). Actin serves as a loading control. Quantitation of proteins is indicated below the respective blots. Related data can be found in Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.33947.008

Figure 2—source data 1 Quantitation of PDA cell growth and apoptosis following HNF1A knockdown.: https://doi.org/10.7554/eLife.33947.010
Download elife-33947-fig2-data1-v2.xlsx
Figure 2—source data 2 Quantitative PCR analysis of HNF1A mRNA in PDA cells and histology score of HNF1A staining in normal and neoplastic ducts..: https://doi.org/10.7554/eLife.33947.011
Download elife-33947-fig2-data2-v2.xlsx

Next, we pursued whether depletion of HNF1A impacted PDA subpopulation distribution. Consistent with a central role in maintaining heterogeneous EPCAM and CD44 expression, we observed a change in P2 in all cell lines (Figure 3A, Figure 3—figure supplement 1A) with a concomitant increase in the P3 population (Figure 3—figure supplement 1A,C). NY8 cells showed a loss in the P1 population as well (Figure 3—figure supplement 1A,B). Collectively, these results support a role for HNF1A in maintaining cellular heterogeneity, with the most dramatic change being the consistent loss of the PCSC population. In addition to changes in CD44 and EPCAM surface expression, we also observed a marked decrease in CD24 surface expression (Figure 3B, Figure 3—figure supplement 1D) and mRNA levels (data not shown) in multiple PDA lines; suggesting that loss of HNF1A depletes the CSC compartment. To assess functional consequences of HNF1A-depletion on the PCSC compartment, cells (NY5, NY8, NY15) expressing HNF1A shRNAs were grown under tumorsphere-promoting conditions. These shRNAs effectively depleted HNF1A as well as CDH17 (Figure 3C), indicating downstream signaling inhibition. Consistent with a role in PCSC function, HNF1A knockdown showed a marked reduction in tumorsphere formation (p<0.05) (Figure 3D,E; Figure 3—figure supplement 1E).

Figure 3 with 1 supplement see all

Download asset Open asset

Knockdown of HNF1A depletes CSC numbers.

(A) Multiple PDA cells were transfected with HNF1A-targeting siRNA or non-targeting control siRNA for 6 days. Surface expression of CD44 and EPCAM was measured by flow cytometry, and the percentage of CD44^High/EPCAM^High (P2) cells are represented (mean ± SEM, n = 3). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (B) Quantitation of CD24 +cells in multiple primary PDA cells following HNF1A knockdown for 6 days, n = 4. Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (C) NY5, NY8, and NY15 cells expressing LacZ2.1 (L) or two distinct HNF1A-targeting shRNAs (H1 and H2) were lysed and western blotted for HNF1A, CDH17, and Actin, showing effective knockdown of HNF1A and downstream signaling (CDH17). Quantitation of proteins is indicated below the respective blots. (**D, E**) NY5, NY8, and NY15 cells expressing LacZ2.1 or HNF1A-targeting shRNAs were grown in tumorsphere media on non-adherent plates (1500 cells/well). The number of tumorspheres formed after 6 days were counted (n = 3). Representative images of spheres (100X magnification) are shown in (F) and in Figure 3—figure supplement 1, with quantitation in (E). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. Related data can be found in Figure 3—figure supplement 1.

https://doi.org/10.7554/eLife.33947.012

Figure 3—source data 1 Quantitation of the P2 subpopulation, CD24 expression, and tumorsphere formation following HNF1A knockdown.: https://doi.org/10.7554/eLife.33947.014
Download elife-33947-fig3-data1-v2.xlsx

HNF1A exhibits oncogenic properties in pancreatic cells

We next sought to determine whether CSC properties could be augmented by ectopic expression of HNF1A in PDA cells. For these studies, we selected PDA lines with high (NY15), medium (NY8), and low (NY53) expression of HNF1A (Figure 2A) to determine if additional HNF1A expression could bolster PCSC properties under different cellular contexts. Using doxycycline-inducible expression of HNF1A (Figure 4A,B), we noted increased expression of CD24, CD44, and EPCAM in multiple primary PDA lines (Figure 4B–D, data not shown), indicating that ectopic HNF1A can increase PCSC marker expression in PDA cells. Additionally, we found that HNF1A-expressing cells formed ~2.5 fold more tumorspheres than their counterparts (Figure 4E) in all PDA cells tested. Taken together, these data indicate that ectopic HNF1A can promote PCSC properties, even in the presence of higher endogenous expression (i.e. NY15).

Figure 4 with 1 supplement see all

Download asset Open asset

Overexpression of HNF1A promotes CSC properties in PDA cells and normal pancreatic cell lines.

(A) NY15 and NY53 cells Western blotted for HNF1A and control gene induction following 48 hr ± doxycycline (Dox). Quantitation of proteins is indicated below the respective blots. (B) NY8 cells were treated 48 hr ± Dox to induce ectopic HNF1A. Lysates were western blotted for HNF1A, Actin, and PCSC markers EPCAM and CD44. Quantitation of proteins is indicated below the respective blots. (C) Representative surface expression of CD24 and EPCAM on NY15 cells expressing GFP or HNF1A. (D) Quantitation of CD24 +NY15 GFP and HNF1A cells and NY8 and NY53 LacZ and HNF1A cells by flow cytometry (n = 3). Statistical difference was determined by one-way ANOVA with Tukey’s multiple comparisons test. (E) NY15 GFP and HNF1A, NY8 and NY53 LacZ and HNF1A cells were grown under sphere-forming conditions ± Dox. The number of tumorspheres formed after 7 days were quantitated (n = 4). Statistical difference was determined by one-way ANOVA with Tukey’s multiple comparisons test. Representative images (100X magnification) of spheres are shown in the upper panels. (**F, G**) HPNE LacZ and HNF1A cells were plated at 200 cells/6 cm dish and treated ±Dox for 2 weeks, fixed, and stained with crystal violet (F). (G) Resultant colonies were quantitated (n = 3). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (**H, I**) HPDE cells expressing inducible LacZ, LacZ with KRAS^G12D, HNF1A, or HNF1A with KRAS^G12D were embedded in soft agar + Dox and monitored for signs of anchorage-independent growth for 21 days. (H) Representative images of resultant colonies (100X magnification) and (I) quantitation of colonies after 21 days (n = 3). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. Related data can be found in Figure 4—figure supplement 1.

https://doi.org/10.7554/eLife.33947.015

Figure 4—source data 1 Quantitation of CD24 expression and tumorsphere formation in PDA cells with HNF1A overexpression, and quantitation of colony formation in HPNE and HPDE cells expressing HNF1A and oncogenic KRAS.: https://doi.org/10.7554/eLife.33947.017
Download elife-33947-fig4-data1-v2.xlsx
Figure 4—source data 2 Quantitation of CD44+/CD24+ HPDE and HPNE cells overexpressing HNF1A.: https://doi.org/10.7554/eLife.33947.018
Download elife-33947-fig4-data2-v2.xlsx

We next examined the effects of ectopic HNF1A expression in the non-tumorigenic pancreatic ductal cell lines HPDE and HPNE, which were devoid of endogenous HNF1A expression (Figure 2A). Doxycycline-inducible ectopic expression of HNF1A alone or in concert with ectopic KRAS^G12D was readily achieved in HPDE cells (Figure 4—figure supplement 1A). Consistent with previous reports, KRAS^G12D-induced phosphorylation of both ERK1/2 and AKT in HPDE cells. Similar effects were seen in HPNE cells constitutively expressing HNF1A and KRAS^G12D alone or in combination (Figure 4—figure supplement 1A). We then tested the impact the of HNF1A and/or KRAS^G12D expression, either alone or in combination, on HPDE cell growth. Under normal growth conditions with serum, (LacZ) HPDE cells grew to confluency but did not form colonies, presumably due to contact-inhibition (Figure 4—figure supplement 1B). Expression of KRAS^G12D, however, resulted in colony formation, indicating a bypass of contact inhibition. HNF1A alone resulted in significantly increased colony formation, which was further enhanced by the additional expression of KRAS^G12D. Similar effects were seen in HPNE cells (data not shown). In clonogenicity assays, HNF1A-expressing HPNE cells formed similar numbers of colonies to control and KRAS^G12D-expressing cells (Figure 4F,G); however, HNF1A alone promoted enhanced colony size. HPDE cells failed to form colonies at clonal densities in the presence of serum. In addition to foci formation, anchorage-independent growth can indicate cellular transformation in vitro. When suspended in soft agar, control HPDE cells failed to grow over a 21-day period (Figure 4H,I). The addition of KRAS^G12D alone did not significantly promote colony formation, consistent with its relatively weak transforming ability in HPDE cells. Interestingly, HNF1A alone resulted in numerous small colonies which in turn synergized with the expression of KRAS^G12D in the form of numerous large colonies. Neither HNF1A nor KRAS^G12D alone resulted in anchorage-independent growth in HPNE cells (data not shown). Lastly, we examined the effects of both transgenes on PCSC marker expression. Expression of HNF1A increased expression of EPCAM, CD44, and CD24 in HPDE cells (Figure 4—figure supplement 1A,C). Control HPNE cells lacked expression of both EPCAM and CD24, but expressed high levels of CD44. Expression of HNF1A was able to increase CD44 surface expression, while not changing EPCAM status (Figure 4—figure supplement 1C, data not shown). Remarkably, CD24 was potently induced upon HNF1A expression, with nearly 83% of HPNE cells expressing CD24 compared to 0.5% of LacZ-expressing control cells. These data would suggest that HNF1A possesses properties of an oncogene capable of cooperation with oncogenic KRAS.

HNF1A is required for tumor growth and cancer stem cells properties in vivo

To determine whether HNF1A was necessary for tumorigenesis, we implanted two HNF1A-high primary lines (NY5 and NY15) expressing control or two HNF1A-targeting shRNAs orthotopically in the pancreas of NOD/SCID mice. HNF1A-depleted cells showed significantly reduced tumor growth compared to their control cohorts (p<0.05), (Figure 5A,B). Similar results were observed with HNF1A knockdown in subcutaneous xenografts of NY5 and NY15 cells (Figure 5C, Figure 5—figure supplement 1A). To determine whether inhibition of tumor growth was due to effects on the PCSC compartment, NY5 tumors were dissociated and analyzed by flow cytometry. Consistent with our in vitro findings, the EPCAM+/CD44+/CD24 +cell population was significantly reduced in HNF1A-depleted tumors (p<0.05) (Figure 5D,E). Importantly, western blot analysis of resultant tumor lysates confirmed that shRNAs remained effective at depleting HNF1A during the course of the experiment (Figure 5—figure supplement 1B).

Figure 5 with 1 supplement see all

Download asset Open asset

Knockdown of HNF1A impairs tumor growth and depletes CSCs in vivo.

(**A, B**) 10,000 firefly luciferase-labeled NY5 and NY15 cells expressing control or HNF1A shRNAs were implanted orthotopically into the pancreata of NOD/SCID mice and monitored by IVIS imaging for 6 weeks (10 mice per group). Representative luminescence image of tumors prior to sacrifice is shown (A). Final tumor volumes determined during necropsy are quantitated in (B). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (C) 10³ control or HNF1A-depleted NY5 cells were implanted subcutaneously in NOD/SCID mice (10 mice per shRNA/bilateral injections) for 11 weeks. Tumors were measured by caliper to determine tumor growth (C, upper panel). Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. Red and orange p values indicate LacZ2.1 vs. HNF1A#1 or #2, respectively. ‘n.d.’ indicates that tumors were not detected. Representative tumors excised at sacrifice are shown (C, lower panel). (**D, E**) NY5 tumors from (A) were dissociated and stained for EPCAM, CD44, and CD24. Representative flow cytometry plots for recovered tumor cells are shown in (D), where the R22 gate denotes EPCAM^High/CD44^High cells, and CD24 +cells are donated in red. Quantitation of EPCAM+/CD44+/CD24 +cells is shown in (E), n = 6 tumors each for shRNA. Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. Related data can be found in Figure 5—figure supplement 1.

https://doi.org/10.7554/eLife.33947.019

Figure 5—source data 1 Quantitation of orthotopic and subcutaneous xenograft tumor volumes, and quantitation of PCSCs following HNF1A knockdown.: https://doi.org/10.7554/eLife.33947.021
Download elife-33947-fig5-data1-v2.xlsx
Figure 5—source data 2 Quantitation of subcutaneous xenograft tumor volumes following HNF1A knockdown.: https://doi.org/10.7554/eLife.33947.022
Download elife-33947-fig5-data2-v2.xlsx

HNF1A regulates stemness through POU5F1/OCT4 expression

As a direct relationship between HNF1A and stem cell function has not been reported, we examined mRNA expression of central stemness regulators MYC, SOX2, KLF4, NANOG, and POU5F1/OCT4 in HNF1A-depleted cells. Of these transcription factors, only POU5F1/OCT4 mRNA showed consistent downregulation in multiple PDA cell lines in response to HNF1A knockdown (Figure 6A, data not shown). Similarly, we found that POU5F1/OCT4 mRNA was upregulated in response to overexpression of HNF1A in both PDA cells and HPDE cells (Figure 6B), indicating regulation of POU5F1/OCT4 expression by HNF1A in pancreatic-lineage cells. To determine whether POU5F1/OCT4 mRNA was correlated with HNF1A expression, qRT-PCR was performed in 22 primary PDA lines as well as HPNE and HPDE cells. The Pearson correlation coefficient of POU5F1/OCT4 mRNA was found to be significantly correlated (p=0.0094) with HNF1A mRNA levels (Figure 6C). Additionally, POU5F1/OCT4 and HNF1A mRNA levels were correlated (Pearson’s r = 0.406, p=8.9×10⁻⁸) in patient tumors samples from The Cancer Genome Atlas (TCGA) dataset for PDA (PAAD cohort, data not shown), further supporting relationship between the two genes. Despite a strong association between POU5F1/OCT4 and HNF1A mRNA levels, we did not observe a significant association between POU5F1/OCT4 mRNA and any of the PDA subpopulations, indicating that factors other than HNF1A modulate the levels of POU5F1/OCT4 mRNA in different PDA subpopulations (data not shown).

Figure 6 with 2 supplements see all

Download asset Open asset

HNF1A regulates stemness through *POU5F1/OCT4* regulation.

(A) qRT-PCR analysis of *POU5F1/OCT4* mRNA in NY5, NY8 and NY15 cells expressing control (LacZ2.1) or HNF1A shRNAs. *ACTB* was used as an internal control, n = 3. Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (B) LacZ or HNF1A was induced in NY8, NY15 or HPDE cells with doxycycline for 6 days. Levels of *POU5F1/OCT4* mRNA were measured by qRT-PCR with *ACTB* as an internal control, n = 3. Statistical difference was determined by unpaired t test with Welch’s correction. (C) Pearson correlation coefficient of *POU5F1/OCT4* and *HNF1A* mRNA levels from NY PDA cells (n = 22, red) relative to HPNE and HPDE (blue) cells. (D) Western blot of OCT4A and HNF1A protein in NY5 and NY8 cells transfected with POU5F1/OCT4 (labeled OCT4) or HNF1A SMARTpool siRNA for 3 days. Quantitation of proteins is indicated below the respective blots. (E) NY5 and NY8 cells were transfected with HNF1A or POU5F1/OCT4 SMARTpool siRNA for 3 days and then grown in tumorsphere media on non-adherent plates (1500 cells/well). Spheres were quantitated 7 days later, n = 3. Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. (**F–H**) NY15 cells were transfected with POU5F1/OCT4 SMARTpool (SP) siRNA or individual sequences for 3 days and either harvested to assess OCT4A knockdown by Western blot (F) or grown in tumorsphere media on non-adherent plates (1500 cells/well) (G). Spheres were quantitated 7 days later, n = 3. Statistical difference was determined by one-way ANOVA with Dunnett’s multiple comparisons test. Representative spheres are shown in (H). (I) NY8 and NY15 cells transduced with OCT4A (labeled OCT4) or empty vector control (EV) were transiently transfected with control (Ctl) or HNF1A-targeting siRNA for 72 hr, and then grown in tumorsphere media on non-adherent plates (1500 cells/well). Spheres were quantitated 7 days later, n = 3. Statistical difference was determined by one-way ANOVA with Tukey’s multiple comparisons test. Related data can be found in Figure 6—figure supplements 1 and 2.

https://doi.org/10.7554/eLife.33947.023

Figure 6—source data 1 Quantitation of OCT4/POU5F1 mRNA following HNF1A knockdown and overexpression; relative HNF1A and OCT4/POU5F1 mRNA expressions in PDA cells; quantitation of tumorspheres following OCT4/POU5F1 knockdown; and quantitation of tumorsphere formation following OCT4A rescue.: https://doi.org/10.7554/eLife.33947.026
Download elife-33947-fig6-data1-v2.xlsx
Figure 6—source data 2 Quantitation of ChIP, CLuc activity, annexin V staining, PI staining, and tumorsphere formation.: https://doi.org/10.7554/eLife.33947.027
Download elife-33947-fig6-data2-v2.xlsx

Previously published HNF1A chromatin immunoprecipitation sequencing (ChIP-seq) data performed in HepG2 cells by The Encyclopedia of DNA Elements (ENCODE) project (Consortium and ENCODE Project Consortium, 2012) identified a region of enrichment of HNF1A upstream of the POU5F1/PSORS1C3 gene loci proximal to recently identified retrotransposon long terminal repeat (LTR)-rich region that can serve as a promoter for both genes (Malakootian et al., 2017). Additionally, enrichment of this LTR region by TATA-binding protein (TBP) and acetylated lysine 27 histone H3 supports the involvement of this region in the transcription of POU5F1/OCT4. Interestingly, this LTR promoter region contains three consensus half-sites for HNF1A (Figure 6—figure supplement 1A). To test whether HNF1A binds directly to these half-sites, ChIP-PCR was performed in NY5, NY8, and NY15 cells. Consistent with the ENCODE data we observed significant enrichment of two half-sites in NY5 and all three half-sites in NY8 and NY15 by HNF1A. By contrast, the canonical distal enhancer of POU5F1/OCT4 (Yeom et al., 1996), located 14-kbp downstream of the LTR promoter, and HNF1A non-target gene MYOD showed no significant enrichment by HNF1A (Figure 6—figure supplement 1B), demonstrating the specificity of enrichment observed. To validate the LTR promoter region as an HNF1A-responsive promoter region, a reporter construct was generated encompassing the three putative HNF1A half-sites (Figure 6—figure supplement 1C). Co-transfection of 293FT cells (which lack endogenous HNF1A) with the LTR reporter and an HNF1A-expression plasmid resulted in a 4.5-fold induction of Cypridina luciferase expression over LacZ-expression plasmid co-transfected cells (Figure 6—figure supplement 1D). Additionally, neither the cloning vector nor the canonical downstream promoter region of POU5F1/OCT4 showed responsiveness to HNF1A expression, supporting the POU5F1/OCT4 LTR promoter as the HNF1A-responsive promoter for the gene.

POU5F1/OCT4 has previously been shown to be elevated in PCSCs (Miranda-Lorenzo et al., 2014; Luo et al., 2017), although a functional role for the protein has not been demonstrated in this context. To determine if POU5F1/OCT4 regulation was a key event in HNF1A-dependent stemness, we targeted POU5F1/OCT4 with multiple siRNAs, either in combination or as single sequences. Depletion of POU5F1/OCT4 resulted in a pronounced inhibition of tumorsphere formation, comparable to HNF1A knockdown (Figure 6D–H). To determine whether changes in apoptosis or cell cycle were responsible for the loss of tumorsphere formation in response to POU5F1/OCT4 knockdown, we performed annexin V/DAPI staining and propidium iodide staining in NY8 cells following transfection with POU5F1/OCT4 siRNA. Consistent with its role as a regulator of stemness in normal and cancer stem cells (Okita et al., 2007; Takahashi and Yamanaka, 2006; Lu et al., 2013; Kumar et al., 2012; Nishi et al., 2014), we did not observe changes in either apoptosis or cell cycle in response to POU5F1/OCT4 knockdown (Figure 6—figure supplement 2A,B). Importantly, knockdown of either HNF1A or POU5F1/OCT4 had comparable effects on the protein levels of OCT4A (Figure 6D), the isoform responsible for imparting stemness (Lee et al., 2006). To determine whether expression of OCT4A was sufficient to rescue stemness of PDA cells depleted of HNF1A, NY8, and NY15 cells were transduced with OCT4A-expressing lentiviruses or vector controls and transfected with HNF1A siRNA. Consistent with our previous results, loss of HNF1A impaired tumorsphere formation in both lines expressing the vector control, however, this effect was rescued by the expression of OCT4A (Figure 6I, Figure 6—figure supplement 2C,D). These data indicate that HNF1A mediates stemness of PCSCs through direct transcriptional regulation of POU5F1/OCT4.

HNF1A targets associated with poor survival in PDA patients

Lastly, we sought to gain insight into the transcriptional activity and genomic binding of HNF1A in PDA and determine whether its targets held prognostic information similar to other signatures in PDA (Bailey et al., 2016; Collisson et al., 2011). In order to identify transcriptional targets of HNF1A, we performed Bru-seq with control and HNF1A-depleted NY8 and NY15 cells (two replicates each of control shRNA and 2 HNF1A-targeting shRNAs per cell line). Bru-seq is a variation of RNA-seq which measures changes in nascent RNA levels (bona fide transcription rate) as opposed to steady-state mRNA changes measured by conventional RNA-seq and microarray (Paulsen et al., 2013). Differentially expressed genes were defined by adjusted p value<0.1 for at least one HNF1A-targeting shRNA and a mean expression level across samples (in RPKM) greater than 0.25. Of these differentially expressed genes, 243 HNF1A upregulated and 46 HNF1A downregulated were found to be in common between NY8 and NY15 (Figure 7A).

Figure 7 with 1 supplement see all

Download asset Open asset

HNF1A regulates a transcriptional program associated with poor survival in PDA.

(A) Venn diagrams illustrating overlapping genes with altered transcription (Bru-seq) following HNF1A knockdown in NY8 and NY15 cells. ‘HNF1A upregulated’ genes denote genes that were downregulated by HNF1A shRNAs, while ‘HNF1A downregulated’ genes were upregulated by HNF1A shRNAs. Cells expressed shRNAs constitutively for >14 days prior to Bru-seq analysis. (B) Proportion of HNF1A shRNA-downregulated genes identified in both NY8 and NY15 with HNF1A ChIP-seq peaks. Proximal peaks are ±5 kbp of the transcription start site (TSS) of a given gene and distal peaks are ±100 kbp of a TSS. Peaks are recognized only if they are closer to the TSS of a given gene than to other expressed genes. Peaks overlapping putative enhancer regions (ENCODE) are indicated in dark grey. (C) HNF1A ChIP-seq and HNF1A shRNA Bru-seq traces for the genes CDH17 and EPCAM in NY8 and NY15 cells. Traces represent normalized read coverage (in RPKM) across the indicated genomic ranges. MACS-identified ChIP peaks are represented by bars under the corresponding trace. (D) Transcription factor (TF) motif over-representation analysis of HNF1A upregulated and downregulated genes (±5 kbp of TSS). The top 10 over-represented TF motifs, ranked by z-score, are listed. (E) HNF1A upregulated and bound genes were ranked according to model significance and the direction of survival association using TCGA PDA patient data. Magnitude indicates significance (log₁₀-transformed FDR-adjusted Wald p values for Cox PH models) and sign represents survival direction (determined by hazard ratio). Red bars indicate FDR < 0.1, orange bars indicate FDR < 0.25, and gray bars are not significant. The FDR thresholds are also indicated by dotted horizontal lines. Insets: each histogram represents the null distribution of a permutation test (N = 10,000) for fraction of genes significantly associated with reduced survival (the tests use FDR thresholds of 0.1 or 0.25, as indicated). Vertical lines represent values for the set of HNF1A target genes; red: FDR < 0.1 test; orange: FDR < 0.25 test. * - indicates significant p value estimates for the permutation tests. Related data found in Figure 7—figure supplement 1.

https://doi.org/10.7554/eLife.33947.028

To assess genomic binding of HNF1A, we performed ChIP-seq using an HNF1A-specific antibody from NY8 and NY15 (two replicates each). ChIP-seq peaks were called using MACS (Feng et al., 2012) with the a priori assumption of narrow, transcription factor-like peaks. Input DNA was used to discern peaks from the background. Peaks were assigned to genes based on proximity and minimum mean expression level (0.25 RPKM) obtained from the Bru-seq data. Common peaks between NY8 and NY15 cells were defined as those peaks with overlap in at least one replicate of both cell lines. Genes were then classified as proximal, distal or neither, given the distance of the closest common peak to the transcription start site (proximal:±5 kb, distal:±100 kb, neither:>100 kb or no peak). The closest peak to a gene must also identify that gene as its closest gene, to discern among genes with nearby TSSs. 139/239 (57.2%) and 11/46 (23.9%) HNF1A upregulated/downregulated genes had HNF1A binding based on this criteria (Figure 7B), and supports the role of HNF1A as a transcriptional activator.

To further understand the regulatory role of HNF1A, we asked whether the HNF1A peaks overlapped with enhancer regions. The ENCODE combined segmentation model (a model for regulatory regions based on the ChromHMM and Segway models) was selected for this purpose (Hoffman et al., 2013; Ernst and Kellis, 2012; Hoffman et al., 2012). Of the six cell lines represented in this data set, it is not clear if any one best represents our PDA cell lines. We therefore extracted regions designated ‘strong enhancer’ (E) from all the cell lines and merged them into one set of enhancer regions. 72.7% of HNF1A-bound genes had peaks overlapping in at least one of these putative enhancer regions (Consortium and ENCODE Project Consortium, 2012) (Figure 7B), suggesting that HNF1A has significant interaction with regulatory regions.

A number of known HNF1A target genes exhibited HNF1A promoter-proximal binding and transcriptional responsiveness via Bru-seq/ChIP-seq, including CDH17 (Figure 7C). Additionally, the PCSC marker EPCAM also showed HNF1A distal binding and transcriptional responsiveness, implicating HNF1A as a direct regulator of this gene. CD24, which showed decreased transcription in response to HNF1A loss, did not show direct binding, indicating an indirect mechanism of regulation (data not shown). POU5F1/OCT4 transcription was found to decrease in both NY8 (34.3%) and NY15 (41.5%) cells, with weak enrichment of the LTR promoter region (data not shown), further supporting direct regulation of POU5F1/OCT4 transcription by HNF1A. To determine whether POU5F1/OCT4 contributes to the deregulation of genes by HNF1A knockdown, we tested for overrepresentation of TF-binding motifs in the proximal promoter regions (±5 kbp from TSS) of HNF1A upregulated and downregulated genes using oPOSSUM. The POU5F1/OCT4 motif was the most significantly over-represented transcription factor motif in HNF1A downregulated genes (z-score = 18.381; 13/45 genes). The POU5F1/OCT4 motif was enriched in the HNF1A upregulated genes, though less highly ranked (rank #60; z-score = 2.104; 47/231 genes; Supplementary file 2). Of the predicted POU5F1/OCT4 targets, four have previously been identified (CACNA2D1, GATA2, SNAI1, and ZEB2) (Marsboom et al., Li et al., 2010; Ben-Porath et al., 2008). Additionally, other reported POU5F1/OCT4 targets (Ben-Porath et al., 2008) were identified among non-predicted targets, including the HNF1A upregulated genes KLF5 and ZHX2 and the HNF1A downregulated gene GJA1. These data demonstrate an overlap between HNF1A and POU5F1/OCT4 transcriptional networks.

Because CSC and oncogene gene signatures have been linked to prognosis in a variety of cancer types (Bartholdy et al., 2014; Eppert et al., 2011; Glinsky et al., 2005; Merlos-Suárez et al., 2011; Rosenwald et al., 2003), we asked if expression of HNF1-regulated genes was related to survival as a clinical outcome. The TCGA dataset for PDA (PAAD) consists of 178 tumor samples from different patients where both gene expression (RNA-seq) and clinical survival data was collected. Of these, we selected those tumors (n = 169) not identified as histologically neuroendocrine. For each gene, we generated a Cox proportional hazards survival model. We asked what fraction of genes in the HNF1A-responsive genes exhibited significance via Cox regression and whether they were associated with increased or reduced survival (hazard ratio <1 or>1, respectively). p Values were FDR-adjusted for multiple testing and two thresholds were explored. 13/237 (5.5%) of HNF1A upregulated genes were associated with reduced survival at FDR < 0.1 and 57/237 (24.1%) at FDR < 0.25, with only one gene associated with increased survival passing the FDR < 0.25 threshold (Figure 7—figure supplement 1A). For HNF1A upregulated and bound, we found a similar pattern; 11/137 (8.0%) genes associated with reduced survival and 37/137 (27.0%) genes at FDR < 0.25 and 0 genes passing the FDR < 0.25 threshold (Figure 7E). For HNF1A downregulated genes, 1/45 (2.2%) genes were significant at FDR < 0.25 only (Figure 7—figure supplement 1B). A background set of genes, defined as those genes expressed above a minimal threshold in the Bru-seq data and mappable to gene identifiers in the TCGA data (see Materials and methods, was selected for permutations testing). The permutation tests showed that HNF1A upregulated genes were significantly associated with poorer outcomes versus randomly selected genes (insets, Figure 7E and Figure 7—figure supplement 1A; see Materials and methods for details). These findings further support the oncogenic role for HNF1A in PDA as a direct regulator of a set of genes associated with poor patient survival.

Discussion

In this study, we identified the transcription factor HNF1A as putative regulator of a PCSC gene signature. Functional studies revealed that HNF1A was not only central to the regulation of this gene signature, but also PCSC function. Depletion of HNF1A effectively inhibited PDA cell growth, tumorsphere formation, and tumor growth, with a loss of PCSC marker expression observed both in vitro and in vivo. Mechanistically, HNF1A appears to promote stemness through positive regulation of pluripotency factor POU5F1/OCT4. Finally, we found that expression of HNF1A upregulated genes significantly predicted poor survival outcomes in patients with PDA. These data point to a novel oncogenic role for HNF1A in pancreatic cancer, particularly in promoting PCSC properties.

A clear role for HNF1A in PDA has not previously been established. An early study of the putative oncogene FGFR4, frequently expressed in PDA (Ohta et al., 1995), is directly regulated by HNF1A through intronic binding sites (Shah et al., 2002). More recently, 73% of PDA samples were found to stain positive for HNF1A (Kong et al., 2015). A more direct role for HNF1A in PDA has been suggested by multiple GWA studies implicating certain SNPs in HNF1A as risk factors for the development of PDA (Pierce and Ahsan, 2011; Wei et al., 2012; Li et al., 2012). Nearly all the identified HNF1A SNPs are non-coding and relatively common (minor allele frequencies between 30 and 40%), suggesting these SNPs may serve as potential contributing rather than driving factors in pancreatic tumorigenesis. Interestingly, PDA-associated HNF1A SNPs rs7310409, rs1169300, and rs2464196 are also associated with both an elevated risk (1.5–2 fold) of developing lung cancer and elevated circulating C-reactive protein (CRP). A well-established direct target of HNF1A (Toniatti et al., 1990), CRP is downregulated in patients with inactivating mutations in HNF1A (Thanabalasingham et al., 2011). As several PDA-associated SNPs are associated with elevated CRP, it is therefore possible that these SNPs augment the activity/expression of HNF1A rather than diminish it, as in the case of maturity-onset diabetes of the young 3 (MODY3) variants which reduce or abolish HNF1A expression or function. Still, a tumor suppressive role for HNF1A in PDA has also been proposed (Hoskins et al., 2014; Luo et al., 2015). In these studies, HNF1A was found to possess pro-apoptotic/anti-proliferative properties contrary to the data in this study. Differences in these results may be technical in nature (control cells in Luo et al. exhibited unusually high baseline apoptosis approaching 50%); however, it is also possible that the role of HNF1A may differ between different molecular subtypes of PDA (Bailey et al., 2016) or in a dynamic manner like fellow transcription factor PDX1 (Roy et al., 2016). Supporting the former, HNF1A expression has been proposed as a biomarker to distinguish between the exocrine/ADEX subtype (HNF1A high/KRT81 low) and the quasi-mesenchymal/squamous/basal-like subtype (HNF1A low/KRT81 high) (Muckenhuber et al., 2018; Noll et al., 2016), and supports previous observations that the quasi-mesenchymal/squamous/basal-like subtype is associated with poorer prognosis and drug resistance (Bailey et al., 2016; Collisson et al., 2011; Moffitt et al., 2015). Although these studies suggest that HNF1A expression may be highest in the exocrine/ADEX subtype of PDA, HNF1A function was not specifically examined. It is possible that like other pancreas-lineage transcription factors, such as PDX1 (Roy et al., 2016) and FOXA1 (Roe et al., 2017), HNF1A is associated with subtypes of PDA that retain elements of pancreatic identity (classical and exocrine/ADEX), but are nonetheless important maintenance of the disease. Interestingly, Noll et al. demonstrated that high expression of CYP3A5 in the exocrine/ADEX subtype mediates resistance to tyrosine kinase inhibitors and paclitaxel. Our work identifies CYP3A5 as a direct target of HNF1A, suggesting that HNF1A may play a direct role in drug resistance in PDA, and future studies should explore this possibility.

While we found an association between HNF1A upregulated genes and poor patient survival, we did not observe a significant association between HNF1A mRNA expression and survival (p=0.7017). As the promoters of HNF1A upregulated genes were enriched for transcription factor known to play roles in PDA including GATA (likely GATA5 or GATA6) (Roe et al., 2017; Martinelli et al., 2017; Zhong et al., 2011), PDX1 (Roy et al., 2016), and SOX9 (Camaj et al., 2014; Kopp et al., 2012; Tsuda et al., 2018), it is possible that HNF1A may work in concert with other transcription factors to elicit its full oncogenic function in PDA. A similar interaction between the transcription factors Foxa1 and Gata5 was recently described in driving metastasis in murine models of PDA (Roe et al., 2017).

Our data on HPDE and HPNE cells support a partially transforming capacity for HNF1A, wherein it overcomes contact-inhibition and anchorage-dependent growth. As cooperation with oncogenic KRAS was observed in these cells, it is feasible that HNF1A provides additional oncogenic input, possibly by altering the differentiation state of KRAS-mutant, precancerous pancreatic cells or by expanding the resident stem cell/cancer stem cell population. Indeed, expression of HNF1A alone was sufficient to increase CD24 expression/positivity in both HPDE and HPNE cells.

Typically a marker of endodermal differentiation, HNF1A has not previously been reported as necessary for normal or cancer stem cells. HNF1A plays a critical role in the normal functionality of the endocrine pancreas, with hereditary inactivating mutations in the gene and promoter region resulting in MODY3, an autosomal dominant form of diabetes resulting from β cell insufficiency. Additionally, murine knockout models recapitulate the diabetic phenotype seen in humans (Lee et al., 1998), with elegant transcriptomic work demonstrating a requirement for murine Hnf1a in β cell proliferation (Servitja et al., 2009). The role for HNF1A in the exocrine pancreas is less clear, and compared to islet and liver cells in the latter study, we only identified 11 overlapping HNF1A upregulated genes (ANXA4, CEACAM1, CHKA, DPP4, HNF4A, HSD17B2, LGALS3, MTMR11, NR0B2, SLC16A5, TM4SF4), suggesting distinct activity for HNF1A in PDA compared to either β cells or the liver. Regulation of POU5F1/OCT4 transcription by HNF1A is an especially exciting finding, connecting HNF1A with a previously unidentified role in regulating stemness. Our study identifies a recently described LTR promoter region (Malakootian et al., 2017), upstream from the canonical POU5F1/OCT4 promoter, as a likely region of direct transcriptional regulation of POU5F1/OCT4 by HNF1A, supported by both ChIP and reporter assays (Figure 6—figure supplement 1B,D). As this promoter region, is not conserved between humans and rodents, it is possible the interaction between HNF1A and POU5F1/OCT4 is an acquisition of human evolution and may explain why POU5F1/OCT4 has not previously been identified as an HNF1A target. Interestingly, a recent study SPINK1-positive castrate resistant prostate cancer identified POU5F1/OCT4 as part of a gastrointestinal gene signature present in SPINK1-positive prostate cancer and regulated by HNF1A and its target gene HNF4G (Shukla et al., 2017). Consistent with our findings, this study showed downregulation/upregulation of POU5F1/OCT4 mRNA in response to HNF1A knockdown/overexpression, respectively. While direct regulation of POU5F1/OCT4 and HNF1A was not explored in this study, it does support an association between these two transcription factors, not only in gastrointestinal cells, but other cancers as well. This could indicate a more general role for HNF1A in regulating stem cell properties in human cells in which it is normally expressed.

Given that HNF1A upregulated genes were found to be significantly associated with poor survival in patients with PDA, it is likely that multiple target genes contribute to HNF1A’s oncogenic influence, and future studies should be done to assess the functions of these genes in PDA to ascertain their value as either potential biomarkers or therapeutic targets. Further studies are also needed in regards to HNF1A’s role in the exocrine pancreas and whether its function is redirected during the development of PDA, particularly under the influence of oncogenic KRAS. Overall, this study further validates the importance of HNF1A to PDA while providing a novel and critical role for HNF1A in driving pancreatic cancer stem cell properties.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Human)	HNF1A	This paper		Cloned from NY5 cDNA
Gene (Escherichia coli)	LacZ	Invitrogen	Originally from Catalog number: K499000	Subcloned into pLentipuro3/TO/V5-DEST
Gene (Aequorea victoria)	PatGFP	This paper		Variant of EGFP containing the following mutations: S31R, Y40N, S73A, F100S, N106T, Y146F, N150K, M154T, V164A, I168T, I172V, A207V
Gene (Human)	KRAS G12D	This paper		Cloned from NY5 cDNA
Gene (Human)	POU5F1 (OCT4A)	Transomic Technologies	Catalog number: BC117435	Subcloned into pLenti6.3 /UbC/V5-DEST
Gene (Escherichia coli)	LacZ2.1 shRNA	This paper		Sequence: CACCAAATCGCTGATTT GTGTAGTCGTTCAAGAGACGACT ACACAAATCAGCGA
Gene (Human)	HNF1A shRNA#1	This paper		Sequence: CACCGCTAGTGGAGGA GTGCAATTTCAAGAGAATTGCACTC CTCCACTAGC
Gene (Human)	HNF1A shRNA#2	This paper		Sequence: CACCGTCCCTTAGTGA CAGTGTCTATTCAAGAGATAGA CACTGTCACTAAGGGAC
Gene (Escherichia coli)	IVS-TetR-P2A-Bsd	This paper		IVS-TetR and Bsd were subcloned from pLenti6/TR (Invitrogen) with a P2A peptide linker added by PCR and Gibson Assembly
Gene (Aequorea victoria)	PatGFP-Luc2	This paper		PatGFP and Luc2 (Promega) were amplified by PCR and fused by Gibson Assembly
Strain, strain background (Mouse)	NOD.CB17-Prkdc^scid/J	The Jackson Laboratory	Catalog number: 001303; RRID: IMSR_JAX:001303
Cell line (Human)	HPDE	Craig Logsdon, MD Anderson
Cell line (Human)	HPNE	ATCC	Catalog number: ATCC CRL-4023; RRID:CVCL_C466
Cell line (Human)	Capan-2	ATCC	Catalog number: ATCC HTB-80; RRID:CVCL_0026
Cell line (Human)	HPAF-II	ATCC	Catalog number: ATCC CRL-1997; RRID:CVCL_0313
Cell line (Human)	BxPC-3	ATCC	Catalog number: ATCC CRL-1687; RRID:CVCL_0186
Cell line (Human)	AsPC-1	ATCC	Catalog number: ATCC CRL-1682; RRID:CVCL_0152
Cell line (Human)	MiaPaCa-2	ATCC	Catalog number: ATCC CRL-1420; RRID:CVCL_0428
Cell line (Human)	Panc-1	ATCC	Catalog number: ATCC CRL-1469; RRID:CVCL_0480
Cell line (Human)	NY1	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY2	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY3	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY5	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY6	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY8	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY9	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY12	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY15	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY16	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY17	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY19	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY28	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY32	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	NY53	This paper		Low passage pancreatic adenocarcinoma patient primary cell line established from xenograft
Cell line (Human)	293FT	Invitrogen	Catalog number: R70007
Transfected construct (Gaussia)	pTK-GDLuc	This paper		The Gaussia coding region of pTK-Gluc (New England Biolabs) was replaced with the Gaussia Dura coding region (Millipore)
Transfected construct (Cypridina)	pCLuc-Basic2	New England Biolabs	Catalog number: N0317S
Transfected construct (Cypridina)	pCLuc-Basic2/OCT4 LTR promoter	This paper		1.7 kbp OCT4 LTR promoter region from NY5 was subcloned into pCLuc-Basic2
Transfected construct (Cypridina)	pCLuc-Basic2/OCT4 canonical promoter	This paper/Addgene	Originally from Catalog number: 38776	OCT4 promoter from phOct4-EGFP (Addgene) was subcloned into pCLuc-Basic2
Antibody	CD326 (EpCAM)-FITC	Miltenyi Biotec	Catalog number: 130-113-263; RRID:AB_2726064	Application: flow cytometry
Antibody	BD Pharmingen APC Mouse Anti-Human CD44	BD Biosciences	Catalog number: 559942; RRID:AB_398683	Application: flow cytometry
Antibody	BD Pharmingen PE Mouse Anti-Human CD24	BD Biosciences	Catalog number: 555428; RRID:AB_395822	Application: flow cytometry
Antibody	H-2Kd/H-2Dd clone 34-1-2S	SouthernBiotech	Catalog number: 1911–08; RRID:AB_1085008	Application: flow cytometry
Antibody	Anti-HNF1 antibody [GT4110]	Abcam	Catalog number: ab184194; RRID:AB_2538735	Application: IHC, Western blot
Antibody	HNF-1 alpha Antibody (C-19)	Santa Cruz Biotechnology	Catalog number: sc-6547; RRID:AB_648295	ChIP
Antibody	Normal Rabbit IgG	Cell Signaling Technology	Catalog number: 2729S; RRID:AB_1031062	ChIP
Antibody	HNF1α (D7Z2Q)	Cell Signaling Technology	Catalog number: 89670S; RRID:AB_2728751	Application: Western blot
Antibody	β-Actin (clone AC-74)	Sigma Aldrich	Catalog number: A2228-200UL; RRID:AB_476697	Application: Western blot
Antibody	CDH17 antibody	Proteintech	Catalog number: 50-608-369; RRID:AB_2728752	Application: Western blot
Antibody	DPP4/CD26 (D6D8K)	Cell Signaling Technology	Catalog number: 67138S; RRID:AB_2728750	Application: Western blot
Antibody	CD44 (156–3 C11)	Cell Signaling Technology	Catalog number: 3570S; RRID:AB_10693293	Application: Western blot
Antibody	EpCAM (D1B3)	Cell Signaling Technology	Catalog number: 2626S; RRID:AB_2728749	Application: Western blot
Antibody	Cleaved Caspase-3 (Asp175) (5A1E)	Cell Signaling Technology	Catalog number: 9664S; RRID:AB_2070042	Application: Western blot
Antibody	Cleaved Caspase-6 (Asp162)	Cell Signaling Technology	Catalog number: 9761S; RRID:AB_2290879	Application: Western blot
Antibody	Cleaved Caspase-7 (Asp198) (D6H1)	Cell Signaling Technology	Catalog number: 8438S; R RID:AB_11178377	Application: Western blot
Antibody	Cleaved Caspase-9 (Asp330) (D2D4)	Cell Signaling Technology	Catalog number: 7237S; RRID:AB_10895832	Application: Western blot
Antibody	Cleaved Caspase-9 (Asp315) Antibody	Cell Signaling Technology	Catalog number: 9505S; RRID:AB_2290727	Application: Western blot
Antibody	GFP (D5.1) XP	Cell Signaling Technology	Catalog number: 2956S; RRID:AB_1196615	Application: Western blot
Antibody	Ras (G12D Mutant Specific) (D8H7)	Cell Signaling Technology	Catalog number: 14429S; RRID:AB_2728748	Application: Western blot
Antibody	Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP	Cell Signaling Technology	Catalog number: 4370S; RRID:AB_2315112	Application: Western blot
Antibody	Phospho-Akt (Ser473) (D9E) XP	Cell Signaling Technology	Catalog number: 4060S; RRID:AB_2315049	Application: Western blot
Antibody	Oct-4A (C52G3)	Cell Signaling Technology	Catalog number: 2890S; RRID:AB_2167725	Application: Western blot
Antibody	Anti-KRAS + HRAS + NRAS antibody	Abcam	Catalog number: ab55391; RRID:AB_941040	Application: Western blot
Antibody	Anti-β-Galactosidase	Promega	Catalog number: Z3781; RRID:AB_430877	Application: Western blot
Antibody	IRDye 800CW Goat anti-Mouse IgG	Licor	Catalog number: 926–32210; RRID:AB_621842	Application: Western blot
Antibody	IRDye 800CW Goat anti-Rabbit	Licor	Catalog number: 926–32211; RRID:AB_621843	Application: Western blot
Antibody	IRDye 680LT goat anti-mouse	Licor	Catalog number: 926–68020; RRID:AB_10706161	Application: Western blot
Antibody	IRDye 680LT Goat anti-Rabbit IgG	Licor	Catalog number: 926–68021; RRID:AB_10706309	Application: Western blot
Recombinant DNA reagent	pLentipuro3/TO/ V5-DEST	Andrew E. Aplin, Thomas Jefferson University
Recombinant DNA reagent	pLentineo3/TO/ V5-DEST	Andrew E. Aplin, Thomas Jefferson University
Recombinant DNA reagent	pLentihygro3/TO/ V5-DEST	Andrew E. Aplin, Thomas Jefferson University
Recombinant DNA reagent	pLenti0.3/EF/ V5-DEST	This paper		Human EF1-alpha promoter was substituted for the CMV promoter of pLenti6.3/UbC/V5-DEST and the SV40 promoter/Bsd cassette was removed
Recombinant DNA reagent	pLenti6.3/UbC/ V5-DEST	Andrew E. Aplin, Thomas Jefferson University
Recombinant DNA reagent	pLenti6.3/UbC empty vector	This paper		EcoRV digest/re-ligation to remove Gateway element
Recombinant DNA reagent	pLentipuro3/ Block-iT-DEST	Andrew E. Aplin, Thomas Jefferson University
Recombinant DNA reagent	pLenti0.3/EF/GW/IVS -Kozak-TetR-P2A-Bsd	This paper		LR recombination of IVS-TetR-P2A-Bsd cassette into pLenti0.3/EF/V5-DEST
Recombinant DNA reagent	pLenti0.3/EF/GW/ PatGFP-Luc2	This paper		LR recombination of PatGFP-Luc2 cassette into pLenti0.3/EF/V5-DEST
Recombinant DNA reagent	pLP1	Andrew E. Aplin, Thomas Jefferson University		Lentivirus packaging plasmid originally from Invitrogen
Recombinant DNA reagent	pLP2	Andrew E. Aplin, Thomas Jefferson University		Lentivirus packaging plasmid originally from Invitrogen
Recombinant DNA reagent	pLP/VSVG	Andrew E. Aplin, Thomas Jefferson University		Lentivirus packaging plasmid originally from Invitrogen
Sequence-based reagent	Non-targeting control siRNA	Dharmacon	Catalog number: D-001810-01-20
Sequence-based reagent	HNF1A siRNA #1	Dharmacon	Catalog number: D-008215-01-0002	Sequence: GGAGGAACCGTTTCAAGTG
Sequence-based reagent	HNF1A siRNA #2	Dharmacon	Catalog number: D-008215-02-0002	Sequence: GCAAAGAGGCACTGATCCA
Sequence-based reagent	POU5F1/OCT4 siRNA #5	Dharmacon	Catalog number: D-019591-05-0002	Sequence: CATCAAAGCTCTGCAGAAA
Sequence-based reagent	POU5F1/OCT4 siRNA #6	Dharmacon	Catalog number: D-019591-06-0002	Sequence: GATATACACAGGCCGATGT
Sequence-based reagent	POU5F1/OCT4 siRNA #9	Dharmacon	Catalog number: D-019591-09-0002	Sequence: GCGATCAAGCAGCGACTAT
Sequence-based reagent	POU5F1/OCT4 siRNA #10	Dharmacon	Catalog number: D-019591-10-0002	Sequence: TCCCATGCATTCAAACTGA
Peptide, recombinant protein	Recombinant human EGF	Invitrogen	Catalog number: PHG0311L
Peptide, recombinant protein	FGF-basic Recombinant Human	Invitrogen	Catalog number: PHG0264
Peptide, recombinant protein	Leukemia Inhibitory Factor human	Sigma Aldrich	Catalog number: L5283
Peptide, recombinant protein	Bone Morphogenetic Protein four human	Peprotech	Catalog number: 120–05
Commercial assay or kit	SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads)	Cell Signaling Technology	Catalog number: 9003
Commercial assay or kit	BioLux Gaussia Luciferase Assay Kit	New England Biolabs	Catalog number: E3300S
Commercial assay or kit	BioLux Cypridina Luciferase Assay Kit	New England Biolabs	Catalog number: E3309S
Commercial assay or kit	RNeasy Plus Mini Kit coupled with RNase-free DNase set	Qiagen	Catalog number: 74136 and 79254
Commercial assay or kit	High Capacity RNA-to-cDNA Master Mix	Applied Biosystem	Catalog number: 4387406
Commercial assay or kit	Power SYBR Green PCR Master Mix	Applied Biosystem	Catalog number: 4367659
Chemical compound, drug	APC-Cy7 Streptavidin	BD Biosciences	Catalog number: 554063
Chemical compound, drug	DAPI (4',6-Diamidino-2-Phenylindole, Dilactate)	Invitrogen	Catalog number: 3571
Chemical compound, drug	APC Annexin V	BD Biosciences	Catalog number: 550474
Chemical compound, drug	Annexin V Binding Buffer, 10x concentrate	BD Biosciences	Catalog number: 556454
Chemical compound, drug	RNase A	Invitrogen	Catalog number: 12091021
Chemical compound, drug	Lipofectamine 2000 Reagent	Invitrogen	Catalog number: 11668019
Chemical compound, drug	Lipofectamine RNAiMAX Reagent	Invitrogen	Catalog number: 13778150
Chemical compound, drug	Propidium iodide	Invitrogen	Catalog number: P1304MP
Chemical compound, drug	Gentamicin	Invitrogen	Catalog number: 15710072
Chemical compound, drug	Antibiotic-Antimycotic (100X)	Invitrogen	Catalog number: 15240062
Chemical compound, drug	N-2 Supplement (100X)	Invitrogen	Catalog number: 17502–048
Chemical compound, drug	B-27 Serum-Free Supplement (50X)	Invitrogen	Catalog number: 17504–044
Chemical compound, drug	Doxycycline	Sigma Aldrich	D9891-100G
Software, algorithm	GraphPad Prism 6	GraphPad Software; http://www.graphpad.com	RRID:SCR_002798
Software, algorithm	oPOSSUM 3.0	http://opossum.cisreg.ca/oPOSSUM3/; PMID: 22973536	RRID:SCR_010884
Software, algorithm	Bowtie v1.1.1	PMID: 19261174	RRID:SCR_005476
Software, algorithm	Bowtie v0.12.8	PMID: 19261174	RRID:SCR_005476
Software, algorithm	MACS v1.4.2	PMID: 18798982	RRID:SCR_013291
Software, algorithm	TopHat v1.4.1	PMID: 19289445	RRID:SCR_013035
Software, algorithm	DESeq v1.24.0	PMID: 20979621	RRID:SCR_000154
Software, algorithm	bedtools v.2.26.0	PMID: 20110278	RRID:SCR_006646
Software, algorithm	survival v2.40–1	DOI: 10.1007/978-1-4757-3294-8

Share this article

Cite this article

HNF1A-signature dominates pancreatic CSCs.

Figure 1—source data 1

Figure 1—source data 2

Knockdown of HNF1A in primary PDA cells inhibits growth in vitro.

Figure 2—source data 1

Figure 2—source data 2

Knockdown of HNF1A depletes CSC numbers.

Figure 3—source data 1

Overexpression of HNF1A promotes CSC properties in PDA cells and normal pancreatic cell lines.

Figure 4—source data 1

Figure 4—source data 2

Knockdown of HNF1A impairs tumor growth and depletes CSCs in vivo.

Figure 5—source data 1

Figure 5—source data 2

HNF1A regulates stemness through POU5F1/OCT4 regulation.

Figure 6—source data 1

Figure 6—source data 2

HNF1A regulates a transcriptional program associated with poor survival in PDA.

Author details

Ethan V Abel

Contribution

Competing interests

Masashi Goto

Contribution

Competing interests

Brian Magnuson

Contribution

Competing interests

Saji Abraham

Contribution

Competing interests

Nikita Ramanathan

Contribution

Competing interests

Emily Hotaling

Contribution

Competing interests

Anthony A Alaniz

Contribution

Competing interests

Chandan Kumar-Sinha

Contribution

Competing interests

Michele L Dziubinski

Contribution

Competing interests

Sumithra Urs

Contribution

Competing interests

Lidong Wang

Contribution

Competing interests

Jiaqi Shi

Contribution

Competing interests

Meghna Waghray

Contribution

Competing interests

Mats Ljungman

Contribution

Competing interests

Howard C Crawford

Contribution

Competing interests

Diane M Simeone

Contribution

For correspondence

Competing interests

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Categories and tags

Research organism

Further reading