Novel functions for integrin-associated proteins revealed by analysis of myofibril attachment in Drosophila

  1. Hannah J Green
  2. Annabel GM Griffiths
  3. Jari Ylänne
  4. Nicholas H Brown  Is a corresponding author
  1. University of Cambridge, United Kingdom
  2. University of Jyväskylä, Finland


We use the myotendinous junction of Drosophila flight muscles to explore why many integrin associated proteins (IAPs) are needed and how their function is coordinated. These muscles revealed new functions for IAPs not required for viability: Focal Adhesion Kinase (FAK), RSU1, tensin and vinculin. Genetic interactions demonstrated a balance between positive and negative activities, with vinculin and tensin positively regulating adhesion, while FAK inhibits elevation of integrin activity by tensin, and RSU1 keeps PINCH activity in check. The molecular composition of myofibril termini resolves into 4 distinct layers, one of which is built by a mechanotransduction cascade: vinculin facilitates mechanical opening of filamin, which works with the Arp2/3 activator WASH to build an actin-rich layer positioned between integrins and the first sarcomere. Thus, integration of IAP activity is needed to build the complex architecture of the myotendinous junction, linking the membrane anchor to the sarcomere.

eLife digest

Our body consists of many different types of cells that build our tissues and organs. To do so, cells need to be able to stick together. One family of proteins called integrins helps to keep cells connected. They sit across cell membranes and anchor cells to the networks of protein fibres outside cells that link and strengthen our organs, and also connect muscles to tendons.

In fruit flies, the indirect flight muscle attach to the thorax of the insect, and create wing movements by ‘deforming’ the thorax. These flight muscles resemble the muscles of animals with a backbone, and consist of many different fibres. At the end of these fibres is a plaque of a protein important for muscle contraction, known as actin. Integrins attach to these actin plaques, allowing the ends of the muscle to anchor to the tendon.

Integrins form complexes with so-called 'integrin-associated proteins' inside the cell, which regulate integrin. Integrins and integrin-associated proteins are essential for proper muscle development, but until now it was not fully understood how they interact with each other. Here, Green et al. explored the role of some of these proteins in the indirect flight muscles of fruit flies.

This revealed that the connection between muscle and tendon is a balancing act. Some integrin associated proteins boost the attachment, whilst others block it. One protein, tensin, increased integrin attachment, whilst another, FAK, blocked tensin, decreasing attachment. Similarly, a protein called PINCH expands the attachment, whilst a protein called RSU1 reduced the activity of PINCH to the correct level. Moreover, the end point of the muscle fibres was discovered to be composed of four distinct layers, including a newly identified layer of actin, which is built by three other integrin-associated proteins.

The flight muscles of fruit flies are similar in structure to the skeletal muscles that move our own limbs. An important next step is to discover whether these integrin-associated proteins work similarly in our muscles. A better understanding of how they work together could help with research into diseases of the muscles.


Cell adhesion to the extracellular matrix (ECM) is essential for the development and homeostasis of multiple cell types and tissues (Winograd-Katz et al., 2014). Adhesion to the ECM is primarily mediated by integrins, α/β heterodimeric transmembrane receptors. The medical importance of integrin adhesion is exemplified by the range of human diseases resulting from its loss or misregulation (Winograd-Katz et al., 2014). The extracellular domains of both integrin subunits binds ECM ligands, whereas it is primarily the intracellular domain of the β subunit that recruits intracellular integrin-associated proteins (IAPs). As β subunit cytoplasmic tails lack enzymatic activity and almost all are short (~47 residues) it is the IAPs that mediate integrin signalling and interaction with the actin cytoskeleton (Campbell and Humphries, 2011). Over 150 different proteins have been implicated in integrin adhesion, and 60 are consistently found in adhesions (Horton et al., 2015). We aim to discover why so many proteins are required for the seemingly simple task of linking the ECM to the actin cytoskeleton. Two features of integrin adhesion sites may help explain the complexity of the machinery required: their complex architecture, and their ability to respond to mechanical forces.

Super-resolution microscopy of IAPs revealed that focal adhesions in fibroblasts have a complex nano-architecture with distinct layers in the Z-axis: a membrane proximal integrin signalling layer, a force transduction layer and an actin regulatory layer that connects to the actin stress fiber (Kanchanawong et al., 2010). Most IAPs localise to specific layers, but talin spans two layers with its N-terminus in the integrin signalling layer and C-terminus in the force transduction layer. It is not yet known whether a similar nano-architecture is present in stable integrin adhesions within tissues. In Drosophila embryonic muscles talin is orientated similarly to fibroblasts, whereas in the developing wing both ends are close to the membrane (Klapholz et al., 2015). This suggests diverse architectures of integrin adhesion sites, and an additional rationale for the large IAP number.

The maturation and stability of focal adhesions in vertebrate cells in culture requires force from actin polymerisation and/or acto-myosin contraction (Sun et al., 2016). Building integrin-mediated attachment sites in muscles during embryogenesis has two phases: the initial attachment phase that does not require myosin-mediated contractions, followed by an increase in IAP levels and stoichiometry changes, as muscles begin contracting (Bulgakova et al., 2017). Such a force-responsive mechanism may ensure adhesion strength is balanced with contractile force. The recruitment of vinculin by talin is a valuable paradigm for how adhesion can be strengthened in response to force, with force-induced stretching of talin unfolding protein domains to reveal binding sites for vinculin, and bound vinculin providing new links to actin (Klapholz and Brown, 2017).

A valuable way to assess the contribution of each IAP is to compare the defects that occur when they are genetically removed. The reduced number of paralogs has made this comparison easier in Drosophila. Focusing on integrin function at muscle attachment sites, analogous to myotendinous junctions, all IAPs are present but the consequence of removing IAPs ranges from complete loss of integrin adhesion to no apparent defect (Bulgakova et al., 2012). The loss of some IAPs could be tolerated either because they contribute a minor function not necessary in the laboratory, or due to redundancy between IAPs. To discover how these apparently minor IAPs contribute to integrin adhesion, and test their redundancy, we utilized an integrin adhesion that resists the strenuous activity of flight.

Indirect flight muscles (IFMs) are the major muscles in the adult thorax that power flight (Gunage et al., 2017). IFMs are more similar to vertebrate muscles than most Drosophila muscles, because IFMs are fibrillar as opposed to tubular muscles such as the adult leg muscle. Fibrillar muscles are made up of myofibers, which in turn contain hundreds of myofibrils. The myofibril sarcomeres are of standard structure, comprising a regular repeating structure of overlapping actin and myosin filaments. Actin filament barbed ends are anchored at Z-lines with their pointed ends towards the center of the sarcomere, while bipolar myosin filaments overlap with actin filaments in the center of the sarcomere and are anchored at M-lines. In the IFMs, sarcomeres form simultaneously along the length of each myofibril during pupal development (Weitkunat et al., 2014) and then elongate by growth from the actin pointed ends, and widen by circumferential addition (Mardahl-Dumesnil and Fowler, 2001; Shwartz et al., 2016). At the ends of each myofibril are modified terminal Z-lines (MTZ), which contain sites of integrin adhesion to the epidermal tendon cell. The myofibril and tendon cell membranes form finger-like protrusions that interdigitate with one another (hereafter referred to as interdigitations). The attachment sites in IFMs appear by electron microscopy more complex and larger than those in larval muscles, with ~1 µm separating plasma membrane from first sarcomere versus 0.1–0.5 µm (Reedy and Beall, 1993; Tepass and Hartenstein, 1994). Furthermore, IFMs contract 200 times per second (Fry et al., 2003), whereas larval muscles contract once every ~5 s during crawling (Crisp et al., 2008).

We use the IFMs to discover functions for four IAPs (tensin, RSU1, focal adhesion kinase (FAK) and vinculin) that surprisingly are not needed for viability of the fly, despite all colocalizing at integrin adhesion sites throughout development, and being conserved in all metazoa (Alatortsev et al., 1997; Grabbe et al., 2004; Kadrmas et al., 2004; Torgler et al., 2004; Maartens et al., 2016) (diagrammed in Figure 1—figure supplement 1A). We recently reported a new phenotype in flies lacking vinculin (Maartens et al., 2016), consisting of defective actin organisation in IFMs, suggesting that IFMs might reveal functions for other IAPs.

Here we show that indeed IFMs reveals a new phenotype for each IAP examined, and genetic interactions reveal how they work together by balancing positive and negative control. Tensin is able to bind integrins (Haynie, 2014), and contributes to focal adhesion maturation (Rainero et al., 2015) and integrin inside-out activation (Georgiadou et al., 2017). In IFMs we also find tensin elevates integrin activity, and discover this is negatively regulated by FAK, a cytoplasmic tyrosine kinase (Kleinschmidt and Schlaepfer, 2017), thus providing a new mechanism for its inhibition of integrin adhesions (Ilić et al., 1995). Like FAK, we discovered that RSU1 has a negative regulatory role in IFMs. RSU1 is a component of the IPP complex, containing integrin-linked-kinase, PINCH and parvin, via its binding to PINCH, and the function of this complex is not well understood (Xu et al., 2016). Here we show that instead of promoting IPP function, as previously thought (Kadrmas et al., 2004; Dougherty et al., 2005), RSU1 inhibits PINCH activity. By examining the localization of different IAPs and actin-binding proteins, we show that the MTZ is composed of 4 distinct layers. One of these layers, an actin rich region between the actin layer adjacent to the membrane and the start of the first sarcomere, requires vinculin, the mechanosensitive actin-binding protein filamin (Razinia et al., 2012) and the nucleation promoting factor WASH (Alekhina et al., 2017). Finally, we find that the mechanosensitive protein vinculin has dual functions at IFM adhesions. As mentioned, vinculin recruitment by stretched talin is a paradigm for mechanotransduction, yet we find that vinculin, once opened, can also function independently of talin, building an actin zone by promoting mechanical opening of filamin.


Indirect flight muscles (IFMs) reveal phenotypes for viable IAP mutants

To understand how IAPs contribute to integrin-mediated adhesion we sought to identify defects that occur in their absence. An unexpected finding is that some highly conserved IAPs can be genetically removed without impairing viability or fertility. Thus, we have been searching for biological processes that fail in the absence of this group of IAPs. We recently discovered that whereas the genetic removal of vinculin does not impair viability or fertility (Alatortsev et al., 1997), it does cause a fully penetrant phenotype in the highly active IFMs in the adult (Maartens et al., 2016). This prompted us to examine the IFMs in flies lacking three additional IAPs that are also present at integrin adhesion sites throughout development yet can be removed without impairing larval muscle function or viability: tensin, RSU1 and FAK (Grabbe et al., 2004; Kadrmas et al., 2004; Torgler et al., 2004) (although not required for viability, loss of RSU1 and tensin causes wing blisters).

We analysed the development of the myofibrils in each muscle by staining for filamentous actin at different stages of development and imaging by confocal microscopy (Figure 1A). No gross defects in muscle morphology were observed, but higher magnification revealed defects in myofibril morphology. To identify which phenotypes we should focus on, we first quantified aspects of myofibrils of flies that are 1 day old (after eclosion [AE]): myofibril width; sarcomere length; and the length of myofibril attachment sites, which in IFMs are called modified terminal Z-lines (MTZ) (Reedy and Beall, 1993) (Figure 1B–D). Myofibril width and sarcomere length were normal in IFMs lacking FAK or tensin, whereas IFMs lacking RSU1 had a reduced myofibril width and increased sarcomere length. Loss of each of these IAPs caused defects in MTZ length and unique alterations to MTZ structure (Figure 1A), so we focused our analysis on the MTZ. In wild type, the MTZ contains a brightly-staining block of actin, and the plasma membrane at the attachment site is interdigitated with the tendon cell, giving a wavy appearance (Reedy and Beall, 1993). The MTZ extends ~1 µm away from the plasma membrane to the Z-line at the start of the first sarcomere. In the absence of FAK the MTZ became modestly elongated, to 1.25 µm (Figure 1A and E). Myofibrils lacking RSU1 had an even more elongated MTZ, with a clear elongation of the interdigitations. Loss of tensin resulted in elongated and irregularly shaped MTZs, and approximately 20% of myofibrils were detached (Figure 1A and E). We confirmed that these defects were due to loss of these three IAPs, rather than any other mutation on the mutant chromosomes, as a transgenic copy of each gene rescued the defects (Figure 1—figure supplement 1B and D). In addition, these phenotypes result from loss of the IAP in the muscle since driving RNAi targeting these IAPs specifically in the muscles phenocopied the mutant phenotypes (Figure 1—figure supplement 1B and D).

Figure 1 with 1 supplement see all
Indirect flight muscle (IFM) attachment sites reveal phenotypes for viable IAP mutants.

(A–E) Examination of IFMs in the absence of FAK, RSU1 and tensin. Samples were fixed at the stage indicated, stained for F-actin (white, using phalloidin in this and all subsequent figures), and imaged by confocal microscopy (in all cases except Figure 5). (A) Defects in MASs arise at eclosion of the adult from the pupal case (0 hr after eclosion (AE)), but are not observed during pupal stages (30 or 48 hr after pupae formation (APF)). Yellow arrowheads indicate myofibrils with elongated MTZs and yellow arrows indicate detaching myofibrils. Quantification of MTZ length is shown in E. (B) TEM images of MTZs at the indicated stage and genotype, showing MTZ, tendon cell (TC) and sarcomeric actin (SA). An electron dense region is observed close the plasma membrane, which is absent at the base of interdigitations in wildtype MTZs (11/12) (orange arrow) but is continuous in MTZs lacking FAK (9/10). In attached myofibrils, two electron dense lines are seen at the plasma membrane, whereas in detached myofibrils only one line is seen (yellow arrow). Note the disappearance of fine interdigitation in RSU1- and tensin -. (C–E) Quantitation of muscle parameters in adults 1 day AE: in these and all subsequent figures, for each genotype 10–30 myofibrils were measured from each of 10 individuals; all data points are shown, overlain with a boxplot showing median, interquartile range, minimum and maximum; statistical test used was Mann-Whitney U. *p≤0.05; **p≤0.01; ***p≤0.001; ****p≤0.0001. (C) Myofibril width is smaller in the absence of RSU1 but not FAK or tensin. (D) Sarcomere length is longer in the absence of RSU1 but unchanged in the absence of FAK or tensin. (E) MTZ length is longer in all three mutants; full quantitation is in Figure 1—figure supplement 1. We used a log plot in this and subsequent graphs measuring MTZ length due to the great range in length.

We then used transmission electron microscopy (TEM) to examine the MTZ defects in more detail (Figure 1B). During the development of the muscles the attachment site becomes progressively more interdigitated with the tendon cell (Reedy and Beall, 1993), and this process appears defective in the absence of RSU1 and tensin. We see clear evidence of detachment of the muscle in the tensin mutant, but not in RSU1, showing that in the latter the more elongated MTZ does not reflect partial detachment. In the FAK mutant the electron dense layer adjacent to the plasma membrane, which we infer is the site of concentrated IAPs, was more continuous than in wild type (in wild type MTZs, this layer is reduced at the tips of interdigitations), thus revealing a role for FAK in keeping integrin adhesion structures as discrete contacts.

To discover when the defects first appeared, we next examined the MTZs at different stages of development. During pupal stages, the MTZs in all mutants appeared normal (Figure 1A and Figure 1—figure supplement 1D). However, immediately after eclosion, and prior to flight, all mutants showed an MTZ phenotype (Figure 1A and Figure 1—figure supplement 1D). This suggests that FAK, RSU1 and tensin are required either to build or strengthen the attachment so that it can withstand tension during pupal stages (Weitkunat et al., 2014). When we compared the phenotypes right after eclosion to 1 day later or 14 days later, we observed that the FAK mutant phenotype did not change, whereas the defects caused by absence of RSU1 or tensin became worse with age, presumably due to muscle activity. These defects were not strong enough to prevent flight (Figure 1—figure supplement 1C). Fewer flies lacking tensin and RSU1 flew than wildtype flies, but this defect was not reproduced by muscle-specific knockdown of tensin or RSU1, suggesting that reduced flight is more likely caused by the wing blisters in these mutants.

As loss of tensin and RSU1 caused strong phenotypes, we hypothesised that their effects may be due to mislocalisation of integrins or other IAPs. We examined the distribution of integrins and other IAPs, using endogenous genes tagged with fluorescent proteins, all of which are fully functional (see Key Resources Table), but did not find any dramatic loss of those examined: βPS integrin, talin, PINCH, paxillin, GIT or vinculin (Figure 2, Figure 2—figure supplement 1). However, paxillin was elevated to 250% in the RSU1 mutant and to 150% in the tensin mutant. The IPP components ILK and PINCH were affected differently by the absence of RSU1; ILK was reduced 50% whereas PINCH was unaffected (Figure 2L). In addition, vinculin distribution showed the extreme stretching of the MTZ in the absence of tensin (Figure 2F). Loss of tensin did not alter RSU1 levels or distribution (Figure 2H), nor did loss of RSU1 alter tensin (Figure 2K). To summarize, we have discovered that removing each IAP caused a unique and relatively mild defect in myofibril attachment, none of which resulted in the loss of recruitment of another IAP.

Figure 2 with 1 supplement see all
Other IAPs are still recruited in IFMs lacking RSU1 or tensin.

(A–K’) Confocal images showing the distribution of indicated GFP-tagged IAPs (white, green), each expressed from their own promoter, in the genotypes indicated at the top each panel. F-actin is magenta. The IFMs are from flies 1 day AE in this and all subsequent figures, unless indicated otherwise. (L) Quantification of IAP-GFP levels relative to levels in wild type IFMs at 1 day AE. For each genotype 10–30 myofibrils were measured from each of 10 individuals and an average from each individual was calculated; all data points are shown, overlain with a boxplot showing median, interquartile range, minimum and maximum; statistical test used was Mann-Whitney U. *p≤0.05; **p≤0.01; ***p≤0.001; ****p≤0.0001 .

Genetic interactions reveal inhibitory action and compensation between IAPs

To test for compensatory activities between these proteins we examined the consequences of removing two at a time. Flies lacking RSU1 and tensin died at pupal stages, however in these pupae the MTZs appeared normal (Figure 3—figure supplement 1A), suggesting the lethality is caused by defects in another tissue. Therefore, we employed RNAi to specifically knockdown tensin in muscles, using the muscle specific driver mef2-Gal4. Loss of RSU1 did not worsen the phenotype of tensin knockdown (Figure 3A and Figure 3—figure supplement 1C), demonstrating that these two proteins do not compensate for each other.

Figure 3 with 1 supplement see all
Epistasis reveals inhibitory action and compensation between IAPs.

(A) F-actin in myofibrils of the indicated genotype. βPS* is a missense mutant that makes βPS more active (mys[b27]). Yellow arrowheads indicate myofibrils with elongated MTZs and yellow arrows detaching myofibrils. Quantitation of MTZ length is in Figure 3—figure supplement 1. (B) Model of IAP function. Integrin heterodimers (green and blue) exist in an inactive bent conformation and an open upright conformation that binds ECM. Talin (purple) and tensin (green) both promote integrin activation, and FAK (red) inhibits activation by tensin. Active integrin performs adhesive functions through IAPs, including FAK and RSU1 (orange). RSU1 promotes adhesion by inhibiting excessive PINCH (pink) activity. Constitutively active integrin (βPS*) or loss of FAK, increases the amount of active integrins and stimulates the function of other IAPs that compensate for the loss of RSU1 or FAK.

Combining removal of FAK and RSU1 resulted in the unexpected rescue of the RSU1 phenotype (Figure 3A). This supports a role for FAK in downregulating integrin function (Ilić et al., 1995), and the expansion of integrin adhesions (Figure 1B). To confirm that increased integrin activity explains the rescue, we combined RSU1 loss with an integrin β subunit mutant with increased activity. We used the allele mys[b28], a mutation in the hybrid domain (V423E) that strongly elevates affinity for ligand (Kendall et al., 2011), and this also rescued the phenotype (Figure 3A and Figure 3—figure supplement 1C). Activated integrin alone did not cause any detectable changes (Figure 3A and Figure 3—figure supplement 1C), allowing us to infer that the MTZ elongation caused by FAK loss is not due to elevating integrin, but rather loss of a positive contribution by FAK to MTZ formation. Consistent with this, activated integrin rescued MTZ elongation caused by the absence of FAK (Figure 3A and Figure 3—figure supplement 1C). This mutant combination also shows that ‘double’ elevation of integrin activity did not cause detectable defects. Thus, in IFMs, FAK has both positive and negative activities. Activated integrin also partially rescued tensin loss, but for this IAP removing FAK did not rescue (Figure 3A and Figure 3—figure supplement 1C). This suggests that tensin normally elevates integrin activity, and this is inhibited by FAK. This predicts that elevating FAK would inhibit tensin further, producing a phenotype similar to loss of tensin. Using the act88F-Gal4 driver to overexpress Fak-GFP, we observed a similar phenotype to loss of tensin (Figure 3A and Figure 3—figure supplement 1C). Of note, this is different than embryonic muscles, where FAK overexpression also causes muscle detachment, but loss of tensin does not (Grabbe et al., 2004; Torgler et al., 2004), and therefore demonstrates that FAK achieves negative regulation of integrins by different mechanisms in larval muscles and IFMs. Furthermore, the finding that activating integrin only partially rescues loss of tensin suggests that tensin does more than activate integrin; consistent with this, neither activated integrin nor loss of FAK rescued the wing blister phenotype of tensin mutants (data not shown).

We also examined overlap in function between these IAPs and talin, which is the single IAP to date that is required for all integrin adhesion in Drosophila (Klapholz and Brown, 2017). Talin reduction (by removing one gene copy) substantially enhanced the defects caused by tensin loss, but had no effect on FAK or RSU1 (Figure 3A and Figure 3—figure supplement 1C). Thus, full levels of talin are especially important in the absence of tensin, and the overlap in function between talin and tensin is consistent with both increasing integrin activity (Georgiadou et al., 2017; Klapholz and Brown, 2017).

We next explored the importance of RSU1 binding to PINCH for its function. Because loss of PINCH is embryonic lethal (Clark et al., 2003) and because the RSU1 mutant phenotype cannot be explained by a loss of PINCH recruitment (Figure 2L), we instead overexpressed PINCH, anticipating that this may rescue IFM defects since elevating PINCH levels partially rescues hypercontraction mutants in larval and flight muscle (Pronovost et al., 2013). Unexpectedly, driving high levels of PINCH alone with the Gal4 system was sufficient to cause defects closely resembling the loss of RSU1, and combining overexpression of PINCH with loss of RSU1 enhanced this phenotype (Figure 3A and Figure 3—figure supplement 1C). Conversely, reduction of PINCH (by removing one gene copy) partially rescued the loss of RSU1 (Figure 3A and Figure 3—figure supplement 1C). This indicates that the function of RSU1 is to inhibit PINCH activity, rather than aid its function. This led to a model (Figure 3B) where free PINCH has an important activity that must be carefully regulated and is suppressed by RSU1 binding or integrin activity (since activated integrin or loss of FAK rescues loss of RSU1). The wing blisters caused by the absence of RSU1 are also rescued by activating integrin or removing FAK (data not shown), suggesting that this phenotype is also caused by loss of PINCH inhibition. To further understand this PINCH activity we performed structure-function analysis using constructs which lacked either the RSU1-binding LIM5 domain and adjacent LIM4 domain (PINCHΔ4–5) or the ILK-binding LIM1 domain (PINCHΔ1) (Figure 3—figure supplement 1). PINCHΔ4–5 localized indistinguishably to full length PINCH and caused a similar, though weaker, phenotype, ruling out a model where RSU1 inhibits PINCH activity by competing off another protein that binds to LIM5 and is necessary for PINCH activity. PINCHΔ1 no longer caused a phenotype, nor was it tightly localized, showing that ILK-binding is essential for PINCH recruitment and activity, consistent with results in the larval muscles (Zervas et al., 2011). Overexpression of ILK did not cause a phenotype (Figure 3—figure supplement 1), suggesting that it is PINCH that is limiting, and supporting the importance of tightly regulating PINCH activity.

Taken together these findings have allowed us to propose a model for how these IAPs contribute to integrin function (Figure 3B). Both talin and tensin contribute to the activity of integrin, with tensin being inhibited by FAK to generate discrete integrin adhesive structures. RSU1 and integrin keep PINCH levels at the correct level; in the absence of RSU1 increased PINCH activity results in fewer, longer interdigitations. These findings highlight the tight balance in IAP activity required to make a wild type adhesive contact. With this improved understanding of the role of IAPs, we examined how vinculin fits into this picture.

Vinculin has two distinct functions in the MTZ

The defects caused by FAK, RSU1 and tensin are all in the MTZ adhesion structure, close to the membrane. In contrast, loss of vinculin results in disruption to the actin organization up to 25 µm from the muscle ends, with a lack of a clear distinction between the MTZ and the terminal sarcomeres, although overall muscle morphology appeared normal (Figure 4A). This defect was rescued by a transgenic copy of vinculin or muscle muscle-specific expression of vinculin, confirming that the defect was caused by loss of vinculin (Figure 4—figure supplement 1A and B). The vinculin defect arose earlier than those caused by loss of FAK, tensin or RSU1, as an elongation of the terminal actin block was detectable in pupal stages (Figure 4A 48 hr APF and Figure 4—figure supplement 1B). The extent of actin disruption progressively increased as adult flies aged from 0 to 14 days (Figure 4A and Figure 4—figure supplement 1B). This was quantified by measuring the distance between muscle terminus and the first M-line, rather than MTZ length, because of the loss of a distinct edge of the MTZ. Analysis of the vinculin mutant by TEM (Figure 4D) showed defects in addition to the expansion of the MTZ. The even layer of electron dense material at the membrane appears disrupted on the myofibril side of the attachment, but not the tendon cell side. In some areas it is thinner, whereas other regions contain round electron-dense structures, which are also seen throughout the MTZ. One day old flies lacking vinculin were able to fly normally but after 14 days, only 20% were able to fly (Figure 4B). However, muscle specific knockdown of vinculin did not reduce flying ability, yet caused comparable IFM actin defects, indicating that loss of flight in flies lacking vinculin is not due to the IFM defects.

Figure 4 with 1 supplement see all
Integrin regulates actin structures at a distance, through vinculin.

(A) F-actin distribution (white) in wild type and vinculin- IFMs at the stages indicated. Yellow asterisks and yellow arrow indicate regions of disorganized actin. (B) Muscle defects do not result in reduced flying ability in the vinculin mutant. 30 flies per genotype were tested and percentage that fly is shown. (C) F-actin distribution (white) in IFMs of the genotype indicated. Vinculin tail and VBS2 were expressed with mef2-Gal4. White arrows indicate zebra bodies (abnormally large Z-lines). Yellow indicate detaching myofibrils. (D) TEM images of MTZs at the indicated stage and genotype. Orange arrows indicate electron dense aggregates in the MTZ. Yellow arrowheads indicate loss of electron dense material from the muscle, but not tendon cell, membrane.

A role for vinculin in organizing actin distant from the membrane is consistent with the difference between the distribution of vinculin and other IAPs. Whereas the distribution of the other IAPs looked identical to integrin, vinculin extended up to 1 µm away from the muscle ends (Figure 2D), but not in the tendon cell, consistent with the greater importance of vinculin in maintaining an even layer electron dense material on the myofibril side of the attachment. We confirmed this with increased resolution microscopy, using structured illumination microscopy (SIM) (Figure 5). Whereas tensin and RSU1 colocalized with integrin, vinculin was separate from integrin (Figure 5C–G). GFP on the N-terminus of talin also colocalised with integrin, whereas a more C-terminal insertion of GFP into talin extended 0.5–1 µm from the membrane (Figure 5B). Thus, it is feasible for the distal accumulation of vinculin to occur by binding stretched talin. This fits with the stretching of talin in fibroblasts of ~500 nm (Margadant et al., 2011), and additional stretching of vinculin.

Figure 5 with 1 supplement see all
Super-resolution microscopy resolves distinct zones in the MTZ.

(A) Schematic of the four zones within the MTZ: (1) an integrin signalling layer (ISL, red) at the membrane; and then zones containing different actin structures-(2) a force transduction layer (FTL, orange); (3) a muscle actin regulatory layer (MARL, yellow); and (4) the first (half) Z-line (green) followed by the first sarcomere (blue). (B) SIM images of wild type myofibrils expressing IAPs tagged with GFP as indicated, or using antibody staining for arp3 (white and green), and stained for F-actin (white and magenta). Note the four zones: (1) the ISL containing tight membrane localization of RSU1, tensin, and GFP-talin tagged at the N-terminus and very little F-actin; (2) both ISL and FTL for vinculin and talin tagged toward the C-terminus; (3) the MARL containing filamin, vinculin, arp3 and WASH; (4) the first Z-line containing high levels of ZASP and α-actinin. Note that the web-like appearance of actin in the SIM images is an artefact of the SIM technique. See also Figure 5—figure supplement 1. (C–F) RSU1 and tensin overlap with integrin, in the ISL, whereas vinculin is separate, within the FTL. (C) SIM images of wild type myofibrils expressing pairs of proteins as indicated. (D–F) Representative line graphs, from images as in B, showing fluorescence intensity over distance. (G) Quantitation of the distance between the peaks of fluorescent intensity of βPS-mcherry versus RSU1-GFP, tensin-GFP or vinculin-GFP, combined from measurements of 10 myofibrils each. Boxplots show median, interquartile range, minimum and maximum.

With further experimental perturbation, we were able to divide the defects caused by loss of vinculin into two components, one perturbing adhesion, similar to the defects caused by FAK, RSU1 and tensin, and the second disrupting actin organization. The division was achieved by eliminating the binding of vinculin head to talin, either by deletion of the head domain, or by competitive inhibition through overexpression of a single vinculin-binding-site helix from talin (Maartens et al., 2016). Both caused aberrant attachment, but little disruption to actin in adjacent sarcomeres (Figure 4C and Figure 4—figure supplement 1B). In addition, TEM imaging revealed that vinculin tail did not rescue the disruption to electron dense material at the membrane, nor the appearance of aggregates away from the membrane (Figure 4D). Thus, vinculin binding to talin contributes to integrin-mediated adhesion, and surprisingly the tail domain could function on its own to keep actin organized. To our knowledge this is the first demonstration that the tail domain can function independently, and it is also significant that the tail alone gets recruited to the MTZ (Figure 4C).

Vinculin helps organize a novel actin structure at the muscle termini

It was difficult to discern how the extended actin defect arose in the absence of vinculin, as it was not clear which actin structure became disorganized, whether: (1) MTZ actin expands, pushing the first sarcomere away; (2) MTZ actin mixes with sarcomeric actin; or (3) overall actin organization near muscle ends deteriorates. To resolve between these possibilities, we examined actin-binding proteins and components of muscle sarcomeres, which revealed three major insights.

First, the distribution of the M-line component Unc-89/obscurin ruled out model 1 of MTZ pushing the first sarcomere away, as M-lines were visible within the region of disrupted actin (Figure 6H). Second, using super-resolution microscopy (Figure 5) and standard confocal microscopy (Figure 5—figure supplement 1) we were able to divide the MTZ into four distinct regions based on their composition, which appear analogous to the different regions discovered by super-resolution in the Z-axis of focal adhesions (Kanchanawong et al., 2010). The four regions are: (1) the adhesion structure at the membrane, analogous to the integrin signalling layer (ISL) in focal adhesions, which contains most IAPs (N-terminus of talin, paxillin, GIT, ILK, PINCH, RSU1, FAK and tensin); (2) the next layer, analogous to the force transduction layer (FTL), containing actin, the C-terminus of talin and vinculin; (3) an unexpected novel, actin-rich region, which appears analogous to the actin regulatory layer, but instead of containing Ena/VASP and zyxin, contains filamin, Arp3, and the Arp2/3 activator WASH, as well as the C-terminus of talin and vinculin. Because of these differences, we term this novel layer the muscle actin regulatory layer or MARL; and (4) the first Z-line with high levels of ZASP and α-actinin, analagous to the stress fiber attached to the focal adhesion (Figure 5A and B). The segregation of these proteins is not absolute, as ZASP and α-actinin were present in both the FTL and MARL, and in addition components from the MARL were detected at low levels in all Z-lines (Figure 5—figure supplement 1).

Figure 6 with 1 supplement see all
The absence of vinculin causes expansion of the MARL into the sarcomeres.

(A–H’) Distribution of F-actin (magenta) and the protein indicated (white, green) in wild type and vinculin- IFMs. MARL expansion is seen by expanded filamin-GFP and ZASP-GFP, and the underlying sarcomeres are visible with the M-line protein Obscurin/Unc-89 (antibody staining), whereas the ISL seems unaffected, as marked with paxillin-GFP. (J) Quantification of IAP-GFP levels relative to levels in wild type IFMs at 1 day AE. For each genotype 10–30 myofibrils were measured from each of 10 individuals and an average from each individual was calculated; all data points are shown, overlain with a boxplot showing median, interquartile range, minimum and maximum; statistical test used was Mann-Whitney U. *p≤0.05; **p≤0.01; ***p≤0.001; ****p≤0.0001.

The third key finding is that the MARL is expanded in the absence of vinculin (e.g. filamin, ZASP), whereas the ISL (e.g. paxillin) was not substantially altered (Figures 6B,D,F,J and Figure 6—figure supplement 1B). In addition, filamin levels were reduced to 40% in the absence of vinculin (Figure 6J). Thus, these findings favour explanation 2, where it is the MARL that expands into the sarcomeres, and therefore that vinculin has a role in the formation and/or stability of the MARL, consistent with the function of the tail domain in this region.

The MARL is distinguished by two actin-binding proteins associated with branched actin networks, Arp2/3 and filamin. Actin within the FTL is likely to link the MARL to the membrane, whereas the first Z-line assembles at the outer edge of the MARL, where it anchors the parallel actin filaments of the sarcomere. This highlights the ability of actin-binding proteins to associate with discrete actin structures in adjacent parts of the cell. Vertebrate muscles contain filamin-C at the myotendinous junction (van der Ven et al., 2000), suggesting they have a comparable structure. Our next goal was to discover how vinculin contributes to the formation and function of the MARL.

Filamin and WASH contribute to MARL formation

The concentration of Arp2/3, its nucleation promoting factor WASH, and filamin in the MARL suggested that the actin in this structure may form a cross-linked network, and we sought to determine whether these proteins contribute to MARL actin assembly. Flies lacking filamin are viable, albeit female sterile due to defects in the actin-based ring canals during oogenesis (Robinson et al., 1997). Loss of filamin (using a deletion of the C-terminal half [Huelsmann et al., 2016]) did not alter overall muscle shape, but caused reduced MARL size in pupal stages and just after eclosion (Figure 7A and Figure 7—figure supplement 1B and D), which converted to MARL expansion 1 day after eclosion and thereafter (Figure 7A and Figure 7—figure supplement 1B), resembling the vinculin mutant phenotype. The reduction in the MARL is even more dramatic when visualized by TEM (Figure 7B). A flight defect was observed in flies lacking filamin overall and when specifically knocked down in muscles (Figure 7C), consistent with previous observations (González-Morales et al., 2017).

Figure 7 with 1 supplement see all
Filamin and WASH contribute to MARL formation.

(A) Loss of filamin or WASH results in a smaller MARL at 48 hr APF and 0 days AE, followed by an expansion of the MARL at later stages. F-actin distribution (white) of the genotypes and stages as indicated. Yellow arrows indicate small MTZs, asterisks indicate expanded and disorganised MARL, and yellow arrowheads indicate split myofibrils observed in these mutants but not vinculin (Figure 4). (B) TEM images of MTZs at the indicated stage and genotype. (C) Muscle defects caused by loss of filamin, but not WASH, lead to reduced flying ability. 30 flies per genotype were tested and percentage that fly is shown. (D) Mechanical opening of filamin is required for MARL formation. F-actin and filamin-GFP distribution. Filamin that is easier to open makes a normal MTZ, and ectopic zebra bodies (white arrows). White arrowheadindicates split myofibrils.

Muscle-specific knockdown of Arp2/3 components is lethal and results in severe muscle defects (Schnorrer et al., 2010). However, flies lacking the Arp2/3 nucleation promotion factor WASH are viable (Nagel et al., 2017), and we found they had no gross changes to muscle morphology, had a smaller MARL during pupal stages, and a progressively elongated MARL during adult stages, similar to loss of filamin (Figure 7A and Figure 7—figure supplement 1B and D). The F-actin staining in the MARL was reduced (Figure 7A) in the absence of WASH, as were levels of filamin (Figure 7—figure supplement 1E and F). TEM confirmed that the MARL was less dense in MTZs lacking WASH and showed defects in the morphology of the interdigitations (Figure 7B). Muscle-specific RNAi of filamin and WASH confirmed that this phenotype is due to loss of these proteins in the muscles (Figure 7—figure supplement 1A and B). In contrast to filamin, flies lacking WASH flew normally (Figure 7C), suggesting it is the defects in sarcomere structure (González-Morales et al., 2017) rather than defects at the MTZ that impair flight in the absence of filamin.

We were intrigued by the observation that two proteins that aid MARL formation, vinculin and filamin, are mechanosensitive (Rognoni et al., 2012; Atherton et al., 2016; Huelsmann et al., 2016). We therefore wondered whether mechanical signaling might be required to build the MARL. To test the role of the mechanosensing region of filamin, we examined the IFM defects caused by mutations that either delete it (∆MSR), make it harder to open (closed), or make it easier to open (open) (Huelsmann et al., 2016). The ∆MSR and closed mutant had similar defects as deletion of the C-terminus (Figure 7D), although they were not as strong, indicating that mechanosensing contributes the majority, but not all, of filamin activity in forming the MARL. The open filamin did not cause any MTZ defects, but we observed a gain of function phenotype, consisting of the formation of bright, ectopic bands of actin, usually associated with a Z-line (Figure 7D). Similar ectopic actin bands, termed ‘zebra bodies’, occur with missense mutations in the troponin gene (Nongthomba et al., 2007) or knockdown of muscle components (Schnorrer et al., 2010). Overexpression of wild type vinculin or vinculin tail also produced zebra bodies, usually at the second-most terminal Z-line (Figure 7—figure supplement 1G and Figure 4B). Overexpression of WASH was sufficient to enlarge the MARL, with an apparent increase in actin levels (Figure 8A and Figure 7—figure supplement 1B).

Vinculin, filamin and WASH work together to build the MARL.

(A) F-actin distribution of the genotypes indicated. Yellow asterisks indicate disorganised actin. Combining mutants does not enhance the phenotypes, filamin open rescues absence of vinculin but not WASH, and overexpression of WASH expands the MTZ and enhances loss of filamin. White arrow indicates zebra bodies. (B) Filamin90open recruits actin more robustly than filamin90closed. Yellow arrows indicate mitochondrial aggregates that rcruit actin, orange arrows indicate aggregates that do not recruit actin and yellow arrowheads indicate the MTZ. (C) Filamin90open and closed-RFPmito recruit vinculinTail. (D) Filamin90closed recruits WASH-GFP, leading to large spheres of F-actin. (E) Vinculin is required for recruitment of filamin90-RFPmito constructs to the MTZ. (F) Model of MARL formation by vinculin (blue), filamin (yellow) and WASH (lilac). Mechanical stretching of talin (purple) reveals cryptic binding sites for vinculin. Vinculin binding to talin opens up vinculin, revealing it’s actin binding tail. The tail anchors filamin to actin filaments causing the MSR of filamin to be stretched. Open filamin then stimulates addition of branched actin filaments through WASH and Arp2/3 (green) activity.

We further manipulated MARL proteins to determine how they worked together. None of the double mutant combinations of vinculin, filamin and WASH showed enhancement or suppression of the expected additive phenotype (Figure 8A and Figure 7—figure supplement 1B and C). As these are all null alleles, this shows they are all required in the same pathway to make the MARL. It is also of interest that the reduced MARL in the absence of WASH does not result in a reduction in the expanded actin caused by loss of vinculin or filamin. Open filamin partially rescued the loss of vinculin (Figure 8A and Figure 7—figure supplement 1C), showing that a key function of vinculin is to open filamin. In contrast, open filamin did not rescue the absence of WASH, suggesting that WASH is downstream of filamin. Overexpression of WASH did not rescue the loss of vinculin or filamin and instead made the loss of filamin phenotype worse (Figure 8A and Figure 7—figure supplement B and C); reciprocally, filamin does not appear to be required for overexpressed WASH to expand the MARL, judging by the elevated actin staining at the termini of the disrupted actin. Thus, the aberrant MARL that forms in the absence of filamin appears expanded by additional WASH. Consistent with filamin being downstream of vinculin, vinculin tail-induced zebra bodies contained filamin, and did not form when only closed filamin was present (Figure 7—figure supplement 1G), whereas open filamin still made zebra bodies in the absence of vinculin (Figure 7—figure supplement 1G).

The genetic interactions suggested that vinculin tail and filamin may interact directly or indirectly. To test this, we targeted a portion of filamin to the surface of the mitochondria with an ActA peptide (Bubeck et al., 1997) to test whether it could recruit vinculin tail within IFMs. We tagged the short version of filamin (filamin90, containing the C-terminal 9 filamin repeats, including the 6 that form the MSR and dimerization repeat), both in open and closed form, with RFP and the ActA mitochondrial targeting sequence. When expressed in the IFMs, the majority of the fusion protein formed clusters on the mitochondrial surface, but some was still recruited to the MARL (Figure 8B). All of the clusters formed by open filamin90 recruited large amounts of actin, whereas only a fraction of the closed filamin90 clusters did so (Figure 8B). Both were able to recruit vinculin tail (Figure 8C). Furthermore, the recruitment of these fusion proteins to the MARL required vinculin (Figure 8E). Overexpression of WASH resulted enlarged the clusters formed by both closed and open filamin 90 (Figure 8D and not shown), with the filamin surrounding a sphere of actin and WASH-GFP. Thus, the C-terminus of filamin is able to recruit vinculin, actin and WASH to an ectopic location.

We can put these results together into a speculative model (Figure 8F) whereby formation of the MARL involves a series of mechanotransduction events: the first step is the mechanical stretching of talin, which will stabilize the open conformation of vinculin and expose the actin-binding tail; in the second step, the vinculin tail anchors the C-terminus of filamin to actin filaments, thus generating three actin contact points for the filamin dimer and permitting it to sense stretch in a more dense actin meshwork; in the third step, forces on the actin meshwork linked by filamin and vinculin leads to opening up of the filamin MSR, which then activates WASH, promoting Arp2/3-mediated formation of new actin branches, thus expanding the MARL.


The adult indirect flight muscles of Drosophila have proved to be an excellent system to identify functions for integrin-associated proteins (IAPs) that are not essential for viability. The mechanical linkage between the last Z-line of each myofibril and the plasma membrane is a well ordered and multi-layered structure, ideal for elucidating the mechanisms by which actin can be organized into different structures at subcellular resolution. In the layer closest to the membrane, the integrin signaling layer, we find important counterbalancing between IAPs, with FAK inhibiting the activation of integrin by tensin, and RSU1 inhibiting excess PINCH activity(summarised in Figure 9). We discovered that the muscle actin regulatory layer (MARL) has a different composition to the fibroblast ARL, containing a mechanotransduction cascade of vinculin and filamin, which, together with WASH and the Arp2/3 complex, builds an actin-rich zone linking the adhesion machinery at the membrane to the first Z-line (Figure 9).

Model of IAP function in the IFM MTZ.

The MTZ is composed of 4 zones: (1) an integrin signalling layer (ISL, red) at the membrane; and then zones containing different actin structures-(2) a force transduction layer (FTL, orange); (3) a muscle actin regulatory layer (MARL, yellow); and (4) the first (half) Z-line (green) followed by the first sarcomere (blue). Within the ISL, RSU1 (orange), PINCH (pink), tensin (green) and FAK (red) regulate integrin adhesion. Tensin promotes integrin activation, possibly through talin, and this activity is inhibited by FAK. Excessive PINCH activity, which leads to longer interdigitations than wildtype, is inhibited by RSU1. Within the FTL, stretched talin recruits and opens up vinculin, revealing its actin binding tail. In the MARL, vinculin tail anchors filamin to actin, leading to stretching of filamin and opening up of its mechanosensor region. Open filamin promotes addition of branched actin, possible through activation of WASH and the Arp2/3 complex.

FAK inhibits integrins via tensin

The MTZ revealed both positive and inhibitory actions of FAK, with the latter consistent with the role of FAK in adhesion disassembly (Ilić et al., 1995). Both loss of FAK and activated integrin supressed the phenotypes caused by loss of RSU1 or vinculin, but only activated integrin alleviated the defects caused by the absence of tensin, suggesting that FAK inhibition requires tensin activity, and in turn, tensin elevates integrin activity. This fits with the recent discovery that tensin contributes to the inside-out activation of integrins via talin (Georgiadou et al., 2017). FAK and tensin thus form a balanced cassette that we imagine responds to upstream signals to regulate integrin activity. Further work is needed to discover how tensin increases integrin activity, how this is inhibited by FAK, and what signals control this regulatory cassette. One model would have tensin activating integrin by direct binding to the β subunit cytoplasmic tail, and FAK inhibition by phosphorylation of tensin, but an alternative is that they have antagonistic roles in integrin recycling (e.g. Rainero et al., 2015).

RSU1 keeps PINCH activity in check

RSU1 is part of the complex containing ILK, PINCH and Parvin (IPP complex), and binds the 5th LIM domain of PINCH (Kadrmas et al., 2004). Loss of RSU1 causes milder phenotypes than loss of ILK, PINCH or parvin, and these phenotypes have previously been interpreted as a partial loss of IPP activity. Our findings indicate that the phenotypes observed in the absence of RSU1 are due to too much PINCH activity, and therefore the role of RSU1 is to keep PINCH activity in check. This suggests that PINCH is perhaps the key player of the IPP complex, and is recruited to adhesions by integrin via ILK, and kept in check by integrin and RSU1. The importance of regulating active PINCH levels is consistent with the dosage sensitivity of PINCH: reducing PINCH partially rescues the dorsal closure defect in embryos lacking the MAPK Misshapen (Kadrmas et al., 2004), and elevating PINCH rescues hypercontraction caused by loss of Myosin II phosphatase (Pronovost et al., 2013). Reducing the interaction of PINCH with ILK had unexpectedly no phenotype, but in combination with the loss of RSU1 becomes lethal (Elias et al., 2012); the lethality can now be interpreted as being caused by too much PINCH activity, rather than too little. Excess ‘free’ PINCH results in elongated membrane interdigitations and elevated paxillin levels. This suggests that PINCH has an important role at the cell cortex, consistent with cortical proteins in the PINCH interactome (Karaköse et al., 2015). Too much parvin activity also causes lethality, which is suppressed by elevating ILK levels (Chountala et al., 2012). Thus, it is increasingly clear that the functions of IPP components need to be tightly controlled. We gained some insight into how RSU1 inhibits PINCH activity by demonstrating that ∆LIM4, 5 PINCH still caused longer interdigitations. This rules out RSU1 blocking the binding of another protein from binding LIM5, and suggests instead that RSU1 bound to LIM5 must be inhibiting the activity of LIM1-3.

Vinculin, Filamin and WASH contribute to the formation of the MARL

Vinculin has a dual function in the MTZ: its head domain promotes FTL stability via binding talin, and its tail promotes MARL formation. Our analysis of the vinculin mutant by electron microscopy showed a phenotype within the electron dense layer close to the membrane that we presume corresponds to the integrin signalling layer. It suggests that vinculin may mediate interactions between IAPs that aid in keeping this as an even layer. The fact that the disruption to this layer is only evident on the muscle side of the interaction raises the question of how similar the integrin junctions are on the two sides of this cell-cell interaction via an intervening ECM. Many other sites of integrin-mediated adhesion in Drosophila involve integrins on both sides of the interaction (Bökel and Brown, 2002) and by electron microscopy the electron dense material looks similar on the two sides (Reedy and Beall, 1993), and we would expect that both sides need to resist the same forces. Even with structured illumination microscopy we cannot resolve the two sides of the membrane, but our results show that the C-terminus of talin and vinculin are not pulled away from the membrane in the adult tendon cells. This suggests either that vinculin has a different role in the tendon cell, with a different configuration, as we observed for talin in the pupal wing (Klapholz et al., 2015), or it is absent.

The vinculin tail function in MARL formation does not require that vinculin is bound to talin, but we suspect that in the wild type it is talin-binding that converts vinculin into an open conformation, permitting the tail to trigger MARL formation with filamin, as outlined in our working model in Figure 8F. A key function of vinculin tail in the MARL is to aid the mechanical opening of the filamin mechanosensitive region. We presented evidence suggesting this is achieved by the vinculin tail anchoring the C-terminus to actin, but further work is required to determine if there is direct binding between the two proteins. Similarly, our results indicate that the Arp2/3 nucleation promoting factor WASH is part of the same pathway as filamin and acts downstream of it, but the connection between the two has yet to be resolved. This new function for WASH is distinct from its best characterized role regulating actin on intracellular vesicles during endosomal sorting and recycling (Nagel et al., 2017), but WASH also has additional roles in the nucleus and the oocyte cortex (Verboon et al., 2018, 2015), showing that it is a versatile protein.

Implications for muscle function and disease

Given the myofibril defects seen with loss of RSU1, tensin, vinculin and filamin it might be expected that mutations in genes encoding these IAPs might be implicated in muscle disease. Indeed, mutations in integrin α7, talin and ILK are associated with muscular myopathies in humans and mice (Winograd-Katz et al., 2014). Mutations in the genes encoding RSU1, tensin and vinculin have not been linked to muscle myopathies, but mutations in filamin are linked to myofibrillar myopathies (Vorgerd et al., 2005). However, given the subtlety of these defects in Drosophila, one might predict that mutations in genes encoding these IAPs are associated with subtle defects in humans such as reduced sporting performance or susceptibility to muscle injury. We are not aware of any mutations in genes encoding these IAPs being related to athletic performance or injury susceptibility (Maffulli et al., 2013), but we expect that these IAPs would be good candidates for further study in this area.

One way that these IAPs may contribute to athletic performance is by building a muscle shock absorber, the MARL, which protects the myofibrils from contraction-induced damage. The concept of muscle shock absorbers is well established since tendons perform this function (Roberts and Azizi, 2010). The presence of filamin, Arp3, vinculin and α-actinin in the MARL suggests that the MARL contains branched and bundled actin filaments. Branched actin networks have been shown to be viscoelastic (Blanchoin et al., 2014) and actin crosslinkers such as filamin have been shown to reduce viscosity and increase elasticity of actin networks (Koenderink et al., 2009). Further study into the functional nature of the MARL should increase our understanding of athletic performance and injury susceptibility.

Materials and methods

Key resources table
Reagent type (species)
or Resource
DesignationSource or referenceIdentifiersAdditional information
Antibodyrabbit anti-obscurin(Burkart et al., 2007)N/A
Antibodyrabbit anti-arp3(Stevenson et al., 2002)N/A
Antibodyrat anti-filamin
C terminus
(Sokol and Cooley, 1999)N/A
Genetic reagent
FAK-: FakCG(Grabbe et al., 2004)N/A
Genetic reagent
RSU1-: ics2This paperN/ANull allele for ics (RSU1)
Genetic reagent
tensin-: by33c(Torgler et al., 2004)N/A
Genetic reagent
vinculin-: ΔVinc(Klapholz et al., 2015)N/A
Genetic reagent
(Huelsmann et al., 2016)N/A
Genetic reagent
filamin/cheerio open:
cheropen MSR
(Huelsmann et al., 2016)N/AViable line made by
homologous recombination
Genetic reagent
filamin/cheerio closed:
cherclosed MSR
(Huelsmann et al., 2016)N/AViable line made by
homologous recombination
Genetic reagent
filamin/cheerio ΔMSR:
(Huelsmann et al., 2016)N/AViable line made by
homologous recombination
Genetic reagent
βPS*: mysb27(Kendall et al., 2011)N/A
Genetic reagent
talin-: rhea62(Klapholz et al., 2015)N/A
Genetic reagent
WASH-: Wash185*(Nagel et al., 2017)N/A
Genetic reagent
βPS-GFP: mys-GFP(Klapholz et al., 2015)N/AViable line made by
homologous recombination
Genetic reagent
GFP-talin(Klapholz et al., 2015)N/AViable line made by
homologous recombination
Genetic reagent
talin-GFP(Klapholz et al., 2015)N/AFully functional gene trap
Genetic reagent
Paxillin-GFP:(Bataillé et al., 2010)N/AGenomic rescue construct
Genetic reagent
Git-GFP:(Bulgakova et al., 2017)N/AGenomic rescue construct
Genetic reagent
ILK-GFP:(Zervas et al., 2001)N/AGenomic rescue construct
Genetic reagent
PINCH-GFP:(Kadrmas et al., 2004)N/AGenomic rescue construct
Genetic reagent
RSU1-GFP:This paperN/AGenomic rescue construct
Genetic reagent
tensin-GFP:(Torgler et al., 2004)N/AGenomic rescue construct
Genetic reagent
vinculin-GFP:(Klapholz et al., 2015)N/AGenomic rescue construct
Genetic reagent
ZASP-GFP:(Jani and Schöck, 2007)N/AFully functional gene trap
Genetic reagent
α-actinin-GFP:(Buszczak et al., 2007)N/AFully functional gene trap
Genetic reagent
Huelsmann et al., 2016)N/AViable line made by
homologous recombination
Genetic reagent
UAS-WASH-GFP(Nagel et al., 2017)N/A
Genetic reagent
zyxin-GFP:This paperN/AGenomic rescue construct
Genetic reagent
ena-GFP:Kindly provided by
Yoshiko Inoue, Sven
Huelsmann and Jenny Gallop
N/AGenomic rescue construct
Genetic reagent
UAS-vinculin-RFP:(Maartens et al., 2016)N/A
Genetic reagent
UAS-vinculinTail-RFP:(Maartens et al., 2016)N/A
Genetic reagent
UAS-VBS2-GFP:(Maartens et al., 2016)N/A
Genetic reagent
mef2-Gal4: P{Gal4-Mef2.R}3Bloomington Drosophila
stock center
Genetic reagent
act88f-Gal4: P{Gal4-act88f}(Bryantsev et al., 2012)N/A
Genetic reagent
y1 P(nos-cas9, w+) M
(3xP3-RFP.attP)ZH-2A w*
Bloomington Drosophila
stock center
Genetic reagent
FAK-RNAi:Bloomington Drosophila
stock center
Genetic reagent
RSU1-RNAi:Vienna Drosophila
Resource centre
Genetic reagent
tensin-RNAi:Vienna Drosophila
Resource centre
Genetic reagent
filamin-RNAi:Vienna Drosophila
Resource centre
Genetic reagent
WASH-RNAi:Vienna Drosophila
Resource centre
Genetic reagent
UAS-ILK-GFP:(Zervas et al., 2011)N/A
Genetic reagent
UAS-PINCHΔ1-GFP:(Zervas et al., 2011)N/A
Genetic reagent
UAS-PINCHΔ4–5-GFPThis paperN/A
Genetic reagent
This paperN/A
Genetic reagent
This paperN/A
This paperN/AGuide RNA for mys-mcherry
This paperN/AGuide RNA for mys-mcherry
This paperN/APrimer to amplify 5’UTR
of zyxin
This paperN/APrimer to amplify 5’UTR
of zyxin
This paperN/APrimer to introduce Aat2
site to GFP
This paperN/APrimer to add Fsp1 site
to GFP
Recombinant DNA
pBluescript II KS(addgene)X52327.1
Recombinant DNA
pBluescript II KS_mys-
This paperN/APlasmid for generation of
mys-mcherry flies
Recombinant DNA
pCFD3(Port et al., 2014)N/A
Recombinant DNA
BACR13D24(Berkeley Drosophila
genome project)
Recombinant DNA
TOPO TA(Thermo Fisher Scientific)451641
Recombinant DNA
This paperN/APlasmid for generation of
zyxin-GFP flies
Recombinant DNA
This paperN/APlasmid for generation of
RSU1-GFP flies
Recombinant DNA
pUASP-attBDrosophila Genomics
Resource center
Recombinant DNA
MrRFPmito(Maartens et al., 2016)N/A
Recombinant DNA
This paperN/APlasmid for generation
of filamin90closed-RFPmito flies
Recombinant DNA
This paperN/APlasmid for generation
of filamin90open-RFPmito flies
SoftwareFIJI (ImageJ v1.5)NIHRRID:SCR_002285
SoftwaresoftWoRx 6.0Applied Precision
SoftwareAdobe PhotoshopAdobeRRID:SCR_014199
SoftwareMicrosoft ExcelMicrosoftRRID:SCR_016137

Fly husbandry

Request a detailed protocol

Flies were grown and maintained on food consisting of the following ingredients for 20 litres of food: 150 g agar, 1100 g glucose, 700 g wheat flour, 1000 g dry yeast, 500 ml nipagin 10%, 80 ml proprionic acid and 200 ml penicillin/streptomycin.

Animals of both sexes were used for this study with the exception of vinculin-; mef2 >vinculinTail RFP where only males were used. Expression of UAS::vinculin-RFP and UAS::vinculinTail-GFP (Maartens et al., 2016) were expressed in muscles with P{Gal4-Mef2.R}3 (Bloomington Drosophila stock centre, 54591). UAS::vinculinHead-RFP (Maartens et al., 2016) was expressed specifically in the IFMs using Gal4-act88f (Bryantsev et al., 2012), since expression with Gal4-mef2 is lethal.

Flight assays

Request a detailed protocol

Flight assays were performed as previously described (Weitkunat and Schnorrer, 2014). Briefly, flies were dropped into plastic tube (1 meter long and 15 cm wide) coated with a layer of oil, with water at the bottom. Flightless flies were counted as those that fall directly in the water and flying flies were counted as those that stick to the sides of the tube. 30 flies per condition were tested and percentage of flightless flies was calculated.

Generation of a null RSU1 (icarus) allele, ics2

Request a detailed protocol

To ensure we had a null allele, a new ics mutant allele was generated by excision of the P-element insertion P{GT1}icsBG02577, which is inserted 129 bp downstream of the translational start site. Two hundred single males of the genotype w; P{GT1}icsBG02577/CyO; mus309N1/mus309D2 Sb P{∆2,3}99B were crossed in individual vials to w; Sco/CyO; Dr/TM6 virgin females. From the progeny of each cross, three white-eyed excision males were individually crossed to w; Gla/CyO virgin females. Deletions were identified by PCR and characterized by sequencing. The allele ics2 is a 1775 bp deletion which deletes 781 bp upstream and 994 bp downstream of the P-element insertion site, deleting the first 165 of 283 RSU1 residues.

Generation of βPS-mcherry

Request a detailed protocol

βPS-mcherry was generated by CRISPR. A plasmid containing homology arms of mys (Drosophila gene encoding βPS) for the generation of βPS-GFP (Klapholz et al., 2015), was used as a template to generate a homology plasmid for the generation of βPS-mcherry. An 8502 bp fragment containing 4465 pb of the C-terminal coding region of mys, GFP and 3894 bp of downstream non-coding sequence was cloned into pBluescript II KS (addgene) using Not1 and Xba1. GFP was excised by digestion with Hind3 and Sac1 and replaced with mcherry. A guide RNA targeting the C-terminus of βPS was cloned into the pCFD3 plasmid as previously described (Port et al., 2014). The sequence of the oligonucleotide used to generate the guide RNA were 5’-GTCGCTTCAAGAACCCCATGTATG-3’ and 5’-AAACCATACATGGGGTTCTTGAAG-3’. The homology plasmid and the guide RNA plasmid were co-injected into y1 P{nos-cas9, w+} M{3xP3-RFP.attP}ZH-2A w* embryos. Injected adults were crossed to FM7 and the progeny were screened at larval stages by fluorescence microscopy for the presence of βPS-mcherry.

Generation of zyxin-GFP

Request a detailed protocol

BACR13D24 (Berkeley Drosophila genome project) containing the genomic region of Drosophila zyxin was used as a template. A 9865 bp fragment containing the zyxin genomic region was excised from the BAC using Spe1 and Not1 and cloned into pBluescript II KS (addgene). A 1601bp region 5’ to the Spe1 site was PCR amplified from Drosophila genomic DNA and cloned into TOPO TA (Thermo Fisher Scientific). The forward primer added an Mlu1 site and had the sequence 5’-ACGCGTGGGAATAGCAAACGCCACA-3’, while the reverse primer was 5’-TGTGTACTTGCGCATTCACA-3’. pBluescript II KS containing the GFP sequence was used a template for GFP. A 738 bp product containing GFP was PCR amplified and cloned into TOPO TA. An Aat2 site was added with the forward primer 5’-GACGTCAGAACATTCGAGCTCATCGATGAGTAAAGGA-3’ and an Fsp1 site was added with the reverse primer 5’ TGCGCAATAAATAAAATGAGCACTCAATTTATTTGTATAGTTCATCCATGC-3’. GFP was cloned into the 3’ of the zyxin genomic sequence at Fsp1 and Aat2 sites. The resulting 10,603 bp zyxin-GFP sequence was excised using Spe1 and Not1, and the 1601 bp 5’ region was excised from TOPO TA using Mlu1 and Spe1, and both were cloned into Mlu1 and Not1 sites of the vector pWhiteAttPRabbit (Brown, N and Klapholz, B unpublished). The vector contains attB sites and the white gene. The constructs were inserted into position 51 on chromosome II.

Generation of RSU1-GFP

Request a detailed protocol

A wild type ics genomic rescue construct tagged with GFP, RSU1-GFP, was prepared by subcloning a 12,888 bp AatII to NotI genomic DNA fragment containing 6853 bp upstream of the translational start site of the ics locus into the targeted P-element transformation vector pWhiteAttPRabbit. To fuse GFP to the COOH terminus of RSU1, XhoI and HindIII sites were inserted between the last codon and the stop codon of the ics gene, and at the NH2 and COOH termini of GFP. A short linker amino acid sequence was introduced at the NH2 terminus of GFP so that the fusion protein junction corresponds to RAYSSSSMSK, with the linker underlined. The constructs were inserted into position 51 on chromosome II and recombined with ics2.

Generation of UAS-PINCHΔ4–5

Request a detailed protocol

Using the UAS-PINCH-GFP construct described in Zervas et al., 2011 we deleted LIM domains 4 and 5 (residues 198–317 of isoform Stck-PA) and generated transgenic lines by P-element mediated tranformation.

Generation of filamin-RFPmito constructs

Request a detailed protocol

Gibson cloning was used to clone a 2756 bp genomic fragment containing filamin90 and RFPmito into pUASP-attB (Drosophila Genomics Resource center). RFPmito was amplified from MrRFPmito plasmid (Maartens et al., 2016) using primers 5’-ccagatcgatgtcTCGAGCTCCAGCATGGTG-3’ and 5’- ttaacgttaacgttcgaggtcgactctagaACTAGTTGTTCTTGCGCAGTTG-3’ and filamin90 was amplified from pGE-attB-filaminopen-GFP or pGE-attB-filaminclosed-GFP (Huelsmann et al., 2016) using 5’- gtacccgcccggggatcagatccgcggccgcGGCCGCAAAATGACTACG-3’ and 5’- tgctggagctcgaGACATCGATCTGGAATGG-3’. Fragments were incubated with pUASP-attB linearize with Xba1 and Not1.


Request a detailed protocol

IFMs were dissected from pupae and adult flies as previously described (Weitkunat and Schnorrer, 2014). Briefly pupal thoraces were dissected in PBS and fixed in 4% formaldehyde in PBS + 0.3% Triton X-100 (PBST) for 15 min. Adult thoraces were dissected in PBS and fixed in 4% formaldehyde in PBS for 1 hr. Thoraces were washed in PBST and dissected further as required. Thoraces were blocked in PBST +0.5% BSA and incubated in primary antibody overnight at 4°C. Primary antibodies used were rabbit anti-obscurin (Burkart et al., 2007) diluted 1:100, rat anti-filamin C-terminus (Sokol and Cooley, 1999) diluted 1:250 and rabbit anti-arp3 diluted 1:500 (Stevenson et al., 2002). Thoraces were incubated with anti-rabbit-Alex Fluor 488 (Abcam) if needed and phalloidin conjugated with rhodamine (Thermo Fisher Scientific), Dylight650 (Cell Signaling Technology) or Alex Fluor 488 (Thermo Fisher Scientific). IFMs were further dissected and mounted in Vectashield (VectorLabs).


Request a detailed protocol

Confocal images were taken with an Olympus FV1000 confocal microscope using a 60×/1.35 NA objective and 3x zoom. A single stack of 5 z-sections spaced by 0.5 µm was imaged per individual. SIM images were taken with a DeltaVision OMX BLAZE V3 (Applied Precision) using an Olympus 10 × 0.4 NA air objective or 60 × 1.4 NA oil objective, 488 nm and 593 nm laser illumination and standard excitation and emission filter sets. Raw data was reconstructed using softWoRx 6.0 (Applied Precision) software. Images were processed using ImageJ (NIH) and Adobe Photoshop.

Transmission electron microscopy

Request a detailed protocol

Half thoraces were dissected from 1 day old flies in PBS and fixed in glutaraldehyde/2% formaldehyde in 0.05 M sodium cacodylate buffer pH 7.4 for 4 hr at 4°C. Thoraces were osmicated in 1% OsO4/1.5% potassium ferricyanide/0.05 M NaCAC pH 7.4 overnight at 4°C and then treated with 0.1% thiocarbohydrazide/DIW for 20 min. Thoraces were osmicated again in 2% OsO4 for 1 hr and finally embedded in Quetol resin. 70 nm sections were imaged on a Tecnai G2 80-200kv transmission electron microscope at 6500x magnification.

Quantification and statistical analysis

Request a detailed protocol

Phenotypes were analysed manually using ImageJ. The line tool was used to measure MTZ length, myofibril width, sarcomere length and the distance from the myofibril end to the first M-line. 10–30 myofibrils per individual were measured from 10 individuals per genotype. Average MTZ length of distance to first M-line was calculated per individual. Statistical significance was determined by Mann Whitney U test (p<0.05) using Prism software (GraphPad). Fluorescence intensity plots for SIM images were using the plot profile function in ImageJ (NIH). Profiles were processed and distance between peaks was calculated in Microsoft Excel.

Fluorescence intensity of GFP tagged proteins at the MTZ were quantified using a Matlab script adapted from Bulgakova et al. (2017). Briefly, all objects in each frame were detected by a series of dilation, hole filling and eroding. The resulting objects were filtered by their area, eccentricity and orientation (more than 45° to long image axis) to exclude all objects that did not represent MTZs. MTZ minor axis length and mean intensities of the resulting objects were collected from original non-modified confocal frames and averaged. Mean intensity was then multiplied by the mean axis length to correct for differences in the MTZ length in different mutants. Statistical significance was determined by Mann Whitney U test (p<0.05) using Prism software (GraphPad).

Contact for reagent and resource sharing

Request a detailed protocol

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Nick Brown (

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files


    1. Bubeck P
    2. Pistor S
    3. Wehland J
    4. Jockusch BM
    Ligand recruitment by vinculin domains in transfected cells
    Journal of cell science 110 ( Pt 12:1361–1371.
    1. Robinson DN
    2. Smith-Leiker TA
    3. Sokol NS
    4. Hudson AM
    5. Cooley L
    Formation of the Drosophila ovarian ring canal inner rim depends on cheerio
    Genetics 145:1063–1072.

Decision letter

  1. Frank Schnorrer
    Reviewing Editor; Max Planck Institute of Biochemistry, Germany
  2. Didier YR Stainier
    Senior Editor; Max Planck Institute for Heart and Lung Research, Germany

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Novel functions for integrin-associated proteins revealed by myofibril attachment in Drosophila" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Frank Schnorrer as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Didier Stainier as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


Green et al., provide a comprehensive study of the distribution, and functional contribution of Integrin Associated Proteins (IAPs, i.e. FAK, RSU1, tensin and vinculin) at the myotendinous junction (MTJ) of the indirect flight muscles (IFMs). Previous experiments revealed surprisingly mild phenotypes in flies upon deletion of those proteins. The authors show that individual deletions of FAK, RSU1, tensin and vinculin lead to distinct morphological defects in IFMs, and genetic interaction studies suggest various degrees of interdependency, with positive and negative roles for integrin activity.

The experiments focus on a particular substructure of IFMs, called the modified terminal Z-disc (MTZ), which connects the myofibril to the neighboring tendon cell. The MTZ is affected to different extents by the loss of FAK, RSU1, tensin and vinculin. Unexpectedly, simultaneous deletion of FAK and RSU1 leads to the rescue of MTZ morphology, which is attributed to enhanced integrin activation (as a result of FAK depletion) since an active integrin mutant rescues the RSU1 phenotype as well. Activating integrins also partially rescued the phenotype of tensin-deficient flies, whereas FAK-overexpression leads to a tensin-mutant like MTZ morphology. The authors conclude from these experiments that FAK regulates integrin activity through tensin. The RSU1 phenotype can be (partially) rescued by reducing levels of its binding partner PINCH, whereas PINCH overexpression causes a RSU1-like MTZ phenotype; it is concluded that RSU1 inhibits PINCH activity. Next, the role of vinculin is analyzed and the authors find that depletion of this protein has two distinguishable consequences. First, loss of vinculin affects talin-dependent adhesion in the MTZ; second, it impairs actin organization in a newly defined structure called MARL (muscle actin regulatory layer). Additional genetic studies imply that vinculin regulates MARL organization through filamin, and MARL assembly requires the presence of the Arp2/3 regulator WASH.

Overall, the manuscript is interesting, the data are of high quality, and the amount of data is impressive. It adds important new structural information regarding the muscle-tendon junction structure (dividing it into 4 zones using super resolution and EM microscopy) and partially explains why so many IAPs are required to stably anchor myofibrils to tendons during the high force producing muscle contractions.

Some important points should be addressed during the revisions to clarify the introduction and to ideally further support the conclusions or tone-down/modify some of the molecular conclusions drawn in the paper. It will also be interesting to show the consequences of IAPs deletions for flight muscle function.

Essential revisions:

1) Specificity of the phenotypes. The authors convincingly show a defect of the terminal Z-disc structure in the IAP mutants. However, many IAPs are likely also expressed in tendon cells. Is the observed defect indeed solely due to a role of the IAPs in muscle? This is already convincingly shown for tensin using the muscle specific RNAi, but should be shown for the other IAPs as well. This will rule out an indirect effect of the function of the IAPs in tendons on the muscle attachment morphology. The authors have also tools ready to perform a muscle-specific rescue for the IAP mutants.

2) Functionality of GFP fusions. The authors gained important conclusions from their GFP-tagged IAP proteins. These are expressed from endogenous enhancers, thus over-expression artefacts are likely not an issue. However, the functionality of these GFP fusions should be tested wherever possible. Mutant rescue experiments with the IAP-GFP fusions used for the localisation studies appear straight forward. If not functional, it should be mentioned.

3) Molecular mechanisms. The paper several times states potentially interesting mechanisms of the IAPs that are not much supported by molecular data. Can the authors provide more convincing data to support how FAK inhibits integrin activity via tensin? How is integrin activity defined? Ligand binding affinity, or integrin dynamics, or mechanical interconnection with IAPs, etc.?

The authors state in the methods section that the βPS*: mysB72 mutant was used as previously described, but this line is not mentioned in the cited study (Kendall et al., 2011).

Alternatively, is there a way to support the hypothesis that RSU1 controls PINCH activity by molecular data? Pinch expression levels? IPP levels? IPP independent?

Or, can the intriguing hypothesis that vinculin promotes MARL formation through inducing a conformational change in filamin be supported by molecular data? Can the authors show a direct association between vinculin and filamin (e.g. through immunoprecipitation, FRET studies, or biochemical assays)?

4) Introduction/context. Some points in the intro should be made clearer. The development of the adult muscles in covered only very briefly in Dobi et al., 2015. A more appropriate recent review would be Gunage et al., 2017.

It is important for the remaining parts of the paper to clearly state that IFMs are "fibrillar" muscles, with individual myofibrils attaching to tendons, in contrast to the normal "tubular" cross-striated adult muscles. See Josephson et al., or Schonbauer et al.,. This might explain the exclusive phenotype in the IFMs for the IAP mutants.

Indirect flight muscles are built by multiple myofibers (not myofibrils as currently stated in the intro) and thus more similar to vertebrate muscles. Each myofiber contains many hundred myofibrils.

The sarcomere not only consists of "interdigitated" actin and myosin filaments, which can be present in many cell types, not only in muscles. Please describe the sarcomere structure more accurately. "Interdigitations" are also used throughout the text to describe defects in sarcomere length ("longer interdigitations", longer sarcomeres would be more appropriate.)

5) Force sensing structure. The description of the MARL domain is very interesting and novel. The authors suggest that this domain is induced by mechanotransduction. Can the authors reinforce this hypothesis by manipulating the force transmitted by the MTJ? One option might be to reduce myosin force by expressing a motor deficient version of myosin heavy chain under act88F control (Weitkunat et al., 2014).

Alternatively, they could try to reduce integrin function selectively in the tendon cells, which might make attachments less rigid.

6) Flight muscle function. Please show the results from the flight tests at day 1 and day 14 of the IAP mutants instead of quoting "unpublished results". It is surprising that these mutants can fly normally despite the defective attachments, in particular at day 14 of age.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Novel functions for integrin-associated proteins revealed by analysis of myofibril attachment in Drosophila" for further consideration at eLife. Your revised article has been favorably evaluated by Didier Stainier (Senior Editor), and Frank Schnorrer (Reviewing Editor) after consultation with two additional reviewers.

The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:

1) The authors state that vinculin mutants can fly (see figure legend, old point 6). However, the day 14 vinculin mutant shows severe myofibril defects (Figure 4A) and only about 20% of the flies appear to fly (Figure 4B). This should be a very robust difference that should be mentioned (p-value?).

2) Interdigitations (old point 4). Sarcomeres are now explained correctly and not described as "interdigitated" actin and myosin filaments. However, "interdigitations" are used to describe the folded electron dense structure/membrane at the myofibril tips (zone 1 of the MTZ). This is used first in subsection “Indirect flight muscles (IFMs) reveal phenotypes for viable IAP mutants” without a clear description of what these interdigitations mean. Please explain it better, including its appearance in the model (Figure 8). What do "longer interdigidations" in the model mean? Longer than what?

3) 'Web-like' structure of actin in SIM imaging (old point S4). If this is an artifact of the technique, it should be mentioned, at least in the figure legend.

4) In many of the sarcomere stains with phalloidin (not only the former rescued vinculin mutant image initially mentioned) for example the recused FAK or tensin mutant (Figure 1—figure supplement 1) or many of the GFP-fusion genotype images in Figure 2 and Figure 2—figure supplement 2 the characteristic high concentration of phalloidin at the Z-disc is not visible. This likely due to an artifact when cutting the myofibrils during histology (these are under high tension). As sarcomere length was not determined in these samples the issue appears not too large. However, we recommend fixing these artifacts wherever possible. The use of relaxing solution during the preparation should also help. A clean, parallel cut is important to preserve myofibrils. Cut myofibrils should wherever possible not be imaged.

5) Arrows in Figure 1A are yellow not white (legend). Same for Figure 7A. Figure 6: Obscurin/Unc-89 not Unc-86 (legend).

6) Weitkunat et al., 2014 do not show any spontaneous muscle contractions during pupal stages of the developing flight muscles (currently stated in the Introduction). Spletter et al., 2018 found these contractions, so this could be cited.

7) Subsection “Genetic interactions reveal inhibitory action and compensation between IAPs”: "RSU1 and integrin keep PINCH levels at the correct level; in its absence the […]"; in which absence? PINCH?

Author response

Essential revisions:

1) Specificity of the phenotypes. The authors convincingly show a defect of the terminal Z-disc structure in the IAP mutants. However, many IAPs are likely also expressed in tendon cells. Is the observed defect indeed solely due to a role of the IAPs in muscle? This is already convincingly shown for tensin using the muscle specific RNAi, but should be shown for the other IAPs as well. This will rule out an indirect effect of the function of the IAPs in tendons on the muscle attachment morphology. The authors have also tools ready to perform a muscle-specific rescue for the IAP mutants.

We have performed muscle specific RNAi of all the IAPs and all of these phenocopy the mutant phenotype. This data can be found in Figure 1—figure supplement 1 and Figure 7—figure supplement 1. We do not show RNAi of vinculin as we had already shown muscle specific rescue in Figure 4—figure supplement 4.

2) Functionality of GFP fusions. The authors gained important conclusions from their GFP-tagged IAP proteins. These are expressed from endogenous enhancers, thus over-expression artefacts are likely not an issue. However, the functionality of these GFP fusions should be tested wherever possible. Mutant rescue experiments with the IAP-GFP fusions used for the localisation studies appear straight forward. If not functional, it should be mentioned.

The GFP-tagged proteins are expressed from 'genomic rescue constructs' or insertions into the endogenous locus (by gene trapping or homologous recombination), and all have previously been shown to rescue mutant alleles fully, or if at the endogenous locus, not cause a phenotype when homozygous viable. We have added a line stating this in the Results section.

3) Molecular mechanisms. The paper several times states potentially interesting mechanisms of the IAPs that are not much supported by molecular data. Can the authors provide more convincing data to support how FAK inhibits integrin activity via tensin?

We have not been able to advance our understanding of the details of this mechanism within the revision time.

How is integrin activity defined? Ligand binding affinity, or integrin dynamics, or mechanical interconnection with IAPs, etc.?

The authors state in the methods section that the βPS*: mysB72 mutant was used as previously described, but this line is not mentioned in the cited study (Kendall et al., 2011).

It is b27, not b72. The mysb27 allele is discussed at length in Kendall et al., 2011 (e.g. Table1, hybrid domain mutants, and the section on Hybrid Domain Activation Mutants). In this paper the authors show that this allele has "extremely elevated affinity" for ligand, testing by putting this mutant form of integrin into cells in culture and measuring binding to the ligand mimetic antibody TWOW. The similarity in loss of FAK and the mysb27 allele rescue of RSU1 and vinculin is what supports the idea that FAK is negatively regulating integrin activity. We lack antibodies that report on Drosophila integrin activity within tissues (TWOW does not work for this), so unfortunately, we do not have a way of directly assessing the amount of active integrin in Drosophila tissues.

Alternatively, is there a way to support the hypothesis that RSU1 controls PINCH activity by molecular data? Pinch expression levels? IPP levels? IPP independent?

We have added additional data to address this mechanism, but have not got as far as fully solving it. We have quantified IAP levels in Figure 2 and included this in the revised Figure. This showed that in the RSU1 mutant Paxillin is elevated 2.5 fold (as mentioned in the text previously), ILK levels are reduced 2 fold, but PINCH levels did not change. We followed up to test whether elevating Paxillin would mimic elevation of PINCH, but it did not and instead produced a new phenotype that we felt was outside the scope of the paper. We then tested two truncation mutants of PINCH, for their ability to mimic the RSU1 mutant phenotype when overexpressed, as full-length PINCH does. Deletion of LIM4,5 reduced its function, but we still got a phenotype. This rules out a model where RSU1 acts by competing with another protein that binds to LIM5. We also found that overexpression of PINCH ∆LIM1 did not cause a phenotype, suggesting that PINCH still needs to interact with ILK to produce its gain of function phenotype. We have included this data in the Results section, and in a revised Figure 3—figure supplement 1 and modified the model in Figure 3.

Or, can the intriguing hypothesis that vinculin promotes MARL formation through inducing a conformational change in filamin be supported by molecular data? Can the authors show a direct association between vinculin and filamin (e.g. through immunoprecipitation, FRET studies, or biochemical assays)?

Yes, we have been able to show an association between the vinculin tail and the filamin C-terminus that is independent of whether filamin is open or closed (described in subsection “Filamin and WASH contribute to MARL formation” and included in Figure 8). For this we have used an assay where we target the filamin C-terminal 9 Filamin repeats (the isoform filamin90) to the mitochondria and show that it recruits vinculin tail, as well as actin and WASH. We prefer this to the IP as it shows they can interact within the intact cell, but like IP it does not distinguish direct from indirect. We tested whether purified filamin MSR region binds to the vinculin tail in vitro and it does not but have were not able to make and test other parts of filamin90. FRET would be a good approach, but not possible within the timeframe of revisions as we would need to map the interactions precisely enough to bring the FRET pairs in proximity and generate appropriate transgenic animals. The ability of filamin90 to recruit WASH made us reconsider whether they are in the same or different pathways and we realized that the majority of the data is consistent with WASH being downstream of mechanically opened filamin.

We have also been able to strengthen our analysis with TEM pictures for vinculin, filamin and WASH, which give a clearer view of the impact of the loss of these proteins on the structure of the MARL.

We thought it would be helpful to assemble all the data into a model that while speculative is consistent with all our data, which is described in subsection “Filamin and WASH contribute to MARL formation” and shown in Figure 8.

4) Introduction/context. Some points in the intro should be made clearer. The development of the adult muscles in covered only very briefly in Dobi et al., 2015. A more appropriate recent review would be Gunage et al., 2017.

It is important for the remaining parts of the paper to clearly state that IFMs are "fibrillar" muscles, with individual myofibrils attaching to tendons, in contrast to the normal "tubular" cross-striated adult muscles. See Josephson et al., or Schonbauer et al.,. This might explain the exclusive phenotype in the IFMs for the IAP mutants.

Indirect flight muscles are built by multiple myofibers (not myofibrils as currently stated in the intro) and thus more similar to vertebrate muscles. Each myofiber contains many hundred myofibrils.

The sarcomere not only consists of "interdigitated" actin and myosin filaments, which can be present in many cell types, not only in muscles. Please describe the sarcomere structure more accurately. "Interdigitations" are also used throughout the text to describe defects in sarcomere length ("longer interdigitations", longer sarcomeres would be more appropriate.

Thank you for these suggestions, we have modified the text accordingly.

5) Force sensing structure. The description of the MARL domain is very interesting and novel. The authors suggest that this domain is induced by mechanotransduction. Can the authors reinforce this hypothesis by manipulating the force transmitted by the MTJ? One option might be to reduce myosin force by expressing a motor deficient version of myosin heavy chain under Act88F control (Weitkunat et al., 2014).

We did this experiment but found that the sarcomeres are so disrupted that it was difficult to make any firm conclusions (see Author response image 1). The MTZ does appear smaller, but whether this is due to loss of force alone would be difficult to conclude. We did not think this result substantially supported the idea that mechanical force is needed to build the MARL, so we have not added it to the revised version but let us know if you think it would be important to include it.

Alternatively, they could try to reduce integrin function selectively in the tendon cells, which might make attachments less rigid.

We appreciate the suggestion but think it would require extensive work to demonstrate that it was an alteration of forces that was having any effect observed.

6) Flight muscle function. Please show the results from the flight tests at day 1 and day 14 of the IAP mutants instead of quoting "unpublished results". It is surprising that these mutants can fly normally despite the defective attachments, in particular at day 14 of age.

Surprising but true, now quantified in Figure 1—figure supplement 1, Figure 2 and Figure 7—figure supplement 1. Only loss of filamin caused a substantial reduction in the number of flies that will fly in the test, and this is likely to be due to the defects in sarcomere structure as recently reported by Frieder Schöck and colleagues.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

1) The authors state that vinculin mutants can fly (see figure legend, old point 6). However, the day 14 vinculin mutant shows severe myofibril defects (Figure 4 A) and only about 20% of the flies appear to fly (Figure 4B). This should be a very robust difference that should be mentioned (p-value?).

We have revised subsection “Vinculin has two distinct functions in the MTZ” as follows:

“One day old flies lacking vinculin were able to fly normally but after 14 days, only 20% were able to fly (Figure 4B). However, muscle specific knockdown of vinculin did not reduce flying ability, yet caused comparable IFM actin defects, indicating that loss of flight in flies lacking vinculin is not due to the IFM defects.”

Unfortunately, we were not able to perform sufficient numbers of independent repeats to merit a p-value.

2). Interdigitations (old point 4). Sarcomeres are now explained correctly and not described as "interdigitated" actin and myosin filaments. However, "interdigitations" are used to describe the folded electron dense structure/membrane at the myofibril tips (zone 1 of the MTZ). This is used first in subsection “Indirect flight muscles (IFMs) reveal phenotypes for viable IAP mutants” without a clear description of what these interdigitations mean. Please explain it better, including its appearance in the model (Figure 8). What do "longer interdigidations" in the model mean? Longer than what?

We have added a sentence defining the interdigitations in the Introduction. We have also added ‘interdigitations’ to the model in Figure 5 and Figure 9. Finally, we have added “longer than wildtype” to the legend for Figure 9.

3) 'Web-like' structure of actin in SIM imaging (old point S4). If this is an artifact of the technique, it should be mentioned, at least in the figure legend.

We have added a sentence to the Figure 5 legend.

4) In many of the sarcomere stains with phalloidin (not only the former rescued vinculin mutant image initially mentioned) for example the recused FAK or tensin mutant (Figure 1—figure supplement 1) or many of the GFP-fusion genotype images in Figure 2 and Figure 2—figure supplement 2 the characteristic high concentration of phalloidin at the Z-disc is not visible. This likely due to an artifact when cutting the myofibrils during histology (these are under high tension). As sarcomere length was not determined in these samples the issue appears not too large. However, we recommend fixing these artifacts wherever possible. The use of relaxing solution during the preparation should also help. A clean, parallel cut is important to preserve myofibrils. Cut myofibrils should wherever possible not be imaged.

As pointed out, the morphology of the sarcomeres is not the focus of the paper, and we have not noted any effects on the attachment structure, nor IAP distribution, of the contractile state of the sarcomeres. For example, we did not notice any changes when dissecting in relaxing solution. Nonetheless, to provide images that are as similar as possible we have replaced those images with a dark Z-line with available alternative images and did new stainings to replace the rescued FAK mutant (Figure 1—figure supplement1, Figure 2 and Figure 2—figure supplement 1).

5) Arrows in Figure 1A are yellow not white (legend). Same for Figure 7A. Figure 6: Obscurin/Unc-89 not Unc-86 (legend).

Thanks. These have now been fixed in the figure legends.

6) Weitkunat et al., 2014 do not show any spontaneous muscle contractions during pupal stages of the developing flight muscles (currently stated in the Introduction). Spletter et al., 2018 found these contractions, so this could be cited.

Sorry, our mistake, we were meaning to say the increased tension as measured in Weitkunat et al., 2014.

7) Subsection “Genetic interactions reveal inhibitory action and compensation between IAPs”: "RSU1 and integrin keep PINCH levels at the correct level; in its absence the […]"; in which absence? PINCH?

We have removed “its” and replaced with “in the absence of RSU1”.

Article and author information

Author details

  1. Hannah J Green

    1. Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, United Kingdom
    2. Department of Biological and Environmental Sciences, University of Jyväskylä, Jyväskylä, Finland
    3. Nanoscience Center, University of Jyväskylä, Jyväskylä, Finland
    Conceptualization, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3039-3015
  2. Annabel GM Griffiths

    Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, United Kingdom
    Resources, Investigation
    Competing interests
    No competing interests declared
  3. Jari Ylänne

    1. Department of Biological and Environmental Sciences, University of Jyväskylä, Jyväskylä, Finland
    2. Nanoscience Center, University of Jyväskylä, Jyväskylä, Finland
    Conceptualization, Supervision, Funding acquisition, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4627-021X
  4. Nicholas H Brown

    Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, United Kingdom
    Conceptualization, Supervision, Funding acquisition, Validation, Visualization, Writing—original draft, Writing—review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8958-7017


Wellcome (099739/Z/12/Z)

  • Hannah J Green

Suomen Akatemia (278668)

  • Hannah J Green
  • Jari Ylänne

Medical Research Council

  • Annabel G M Griffiths

Jenny ja Antti Wihurin Rahasto (Foundation research sabbatical grant)

  • Jari Ylänne

Biotechnology and Biological Sciences Research Council (BB/L006669/1)

  • Nicholas H Brown

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We would like to thank Golnar Kolahgar and Benjamin Richier for critical reading of the paper; John Overton for performing microinjections; Nicola Lawrence for assistance with SIM imaging; Yoshiko Inoue, Sven Huelsmann, Jenny Gallop, Sven Bogdan, Frank Schnorrer, Richards Cripps and the Bloomington Stock Center for providing fly stocks; Lynn Cooley for antibodies; and Lyn Carter and Karin Muller from the Cambridge Advanced Imaging Centre for assistance with electron microscopy and sample preparation. This work was funded by a Wellcome Trust studentship (099739/Z/12/Z) to HG, a Medical Research Council Studentship to AGMG, a BBSRC grant BB/L006669/1 to NB, a Acadamy of Finland grant (278668), and a Jenny and Antti Wihuri foundation research sabbatical grant to JY.

Senior Editor

  1. Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany

Reviewing Editor

  1. Frank Schnorrer, Max Planck Institute of Biochemistry, Germany

Publication history

  1. Received: February 9, 2018
  2. Accepted: July 19, 2018
  3. Accepted Manuscript published: July 20, 2018 (version 1)
  4. Version of Record published: August 14, 2018 (version 2)


© 2018, Green et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 2,260
    Page views
  • 378
  • 12

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Hannah J Green
  2. Annabel GM Griffiths
  3. Jari Ylänne
  4. Nicholas H Brown
Novel functions for integrin-associated proteins revealed by analysis of myofibril attachment in Drosophila
eLife 7:e35783.

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Haikel Dridi et al.
    Research Article Updated

    Age-dependent loss of body wall muscle function and impaired locomotion occur within 2 weeks in Caenorhabditis elegans (C. elegans); however, the underlying mechanism has not been fully elucidated. In humans, age-dependent loss of muscle function occurs at about 80 years of age and has been linked to dysfunction of ryanodine receptor (RyR)/intracellular calcium (Ca2+) release channels on the sarcoplasmic reticulum (SR). Mammalian skeletal muscle RyR1 channels undergo age-related remodeling due to oxidative overload, leading to loss of the stabilizing subunit calstabin1 (FKBP12) from the channel macromolecular complex. This destabilizes the closed state of the channel resulting in intracellular Ca2+ leak, reduced muscle function, and impaired exercise capacity. We now show that the C. elegans RyR homolog, UNC-68, exhibits a remarkable degree of evolutionary conservation with mammalian RyR channels and similar age-dependent dysfunction. Like RyR1 in mammals, UNC-68 encodes a protein that comprises a macromolecular complex which includes the calstabin1 homolog FKB-2 and is immunoreactive with antibodies raised against the RyR1 complex. Furthermore, as in aged mammals, UNC-68 is oxidized and depleted of FKB-2 in an age-dependent manner, resulting in ‘leaky’ channels, depleted SR Ca2+ stores, reduced body wall muscle Ca2+ transients, and age-dependent muscle weakness. FKB-2 (ok3007)-deficient worms exhibit reduced exercise capacity. Pharmacologically induced oxidization of UNC-68 and depletion of FKB-2 from the channel independently caused reduced body wall muscle Ca2+ transients. Preventing FKB-2 depletion from the UNC-68 macromolecular complex using the Rycal drug S107 improved muscle Ca2+ transients and function. Taken together, these data suggest that UNC-68 oxidation plays a role in age-dependent loss of muscle function. Remarkably, this age-dependent loss of muscle function induced by oxidative overload, which takes ~2 years in mice and ~80 years in humans, occurs in less than 2–3 weeks in C. elegans, suggesting that reduced antioxidant capacity may contribute to the differences in lifespan among species.

    1. Cell Biology
    Desiree Schatton et al.
    Research Article

    Proliferating cells undergo metabolic changes in synchrony with cell cycle progression and cell division. Mitochondria provide fuel, metabolites, and ATP during different phases of the cell cycle, however it is not completely understood how mitochondrial function and the cell cycle are coordinated. CLUH is a post-transcriptional regulator of mRNAs encoding mitochondrial proteins involved in oxidative phosphorylation and several metabolic pathways. Here, we show a role of CLUH in regulating the expression of astrin, which is involved in metaphase to anaphase progression, centrosome integrity, and mTORC1 inhibition. We find that CLUH binds both the SPAG5 mRNA and its product astrin, and controls the synthesis and the stability of the full-length astrin-1 isoform. We show that CLUH interacts with astrin-1 specifically during interphase. Astrin-depleted cells show mTORC1 hyperactivation and enhanced anabolism. On the other hand, cells lacking CLUH show decreased astrin levels and increased mTORC1 signaling, but cannot sustain anaplerotic and anabolic pathways. In absence of CLUH, cells fail to grow during G1, and progress faster through the cell cycle, indicating dysregulated matching of growth, metabolism and cell cycling. Our data reveal a role of CLUH in coupling growth signaling pathways and mitochondrial metabolism with cell cycle progression.