TRPV4 is the temperature-sensitive ion channel of human sperm

  1. Nadine Mundt
  2. Marc Spehr
  3. Polina V Lishko  Is a corresponding author
  1. University of California, Berkeley, United States
  2. RWTH Aachen University, Germany

Abstract

Ion channels control the ability of human sperm to fertilize the egg by triggering hyperactivated motility, which is regulated by membrane potential, intracellular pH, and cytosolic calcium. Previous studies unraveled three essential ion channels that regulate these parameters: (1) the Ca2+ channel CatSper, (2) the K+ channel KSper, and (3) the H+ channel Hv1. However, the molecular identity of the sperm Na+ conductance that mediates initial membrane depolarization and, thus, triggers downstream signaling events is yet to be defined. Here, we functionally characterize DSper, the Depolarizing Channel of Sperm, as the temperature-activated channel TRPV4. It is functionally expressed at both mRNA and protein levels, while other temperature-sensitive TRPV channels are not functional in human sperm. DSper currents are activated by warm temperatures and mediate cation conductance, that shares a pharmacological profile reminiscent of TRPV4. Together, these results suggest that TRPV4 activation triggers initial membrane depolarization, facilitating both CatSper and Hv1 gating and, consequently, sperm hyperactivation.

https://doi.org/10.7554/eLife.35853.001

Introduction

The ability of human spermatozoa to navigate the female reproductive tract and eventually locate and fertilize the egg is essential for reproduction (Okabe, 2013). To accomplish these goals, a spermatozoon must sense the environment and adapt its motility, which is controlled in part by ATP production and flagellar ion homeostasis (Lishko et al., 2012). Of vital importance is the transition from symmetrical basal tail bending into ‘hyperactivated motility’ – an asymmetrical, high-amplitude, whip-like beating pattern of the flagellum - that enables sperm to overcome the egg’s protective vestments (Ho et al., 2002; Ishijima et al., 2006; Quill et al., 2003; Suarez, 1996, 2008, 1993). The steroid hormone progesterone (P4) acts as a major trigger of human sperm hyperactivation (Suarez, 2008; Uhler et al., 1992). P4 is released by cumulus cells surrounding the egg (Schuetz and Dubin, 1981) and causes a robust elevation of human sperm cytoplasmic [Ca2+] via the principal Ca2+ channel of sperm, CatSper (EC50 = 7.7 ± 1.8 nM) (Lishko et al., 2011; Strünker et al., 2011; Smith et al., 2013). The steroid acts via its non-genomic receptor ABHD2, a serine hydrolase that, upon P4 binding, releases inhibition of human CatSper (Miller et al., 2016). The Ca2+ influx produced from the opening of CatSper channels is a necessary milestone in the process of fertilization and initiates hyperactivated motility (Suarez, 2008; Carlson et al., 2005, 2003; Chung et al., 2014; Jin et al., 2007; Navarro et al., 2008; Qi et al., 2007; Quill et al., 2003; Ren et al., 2001).

CatSper channels exhibit weak voltage-dependency with half-maximal activation at V1/2 human CatSper =+70 mV for capacitated sperm cells (Lishko et al., 2011). This parameter (V1/2) reflects a certain membrane voltage condition under which 50% of CatSper channels are in the open state. Given this unusually high V1/2, only a small fraction of human CatSper channels are open at physiological-relevant membrane potentials. P4 has been shown to potentiate CatSper activity by shifting V1/2 to more negative values (V1/2 human CatSper =+30 mV with 500 nM P4 for capacitated sperm cells [Lishko et al., 2011]). However, CatSper still requires both additional intracellular alkalization and significant membrane depolarization to function properly (Lishko et al., 2011; Kirichok et al., 2006). The proton channel Hv1 was revealed as one of the potential regulators of intracellular pH (pHi) in human spermatozoa (Lishko et al., 2010; Berger et al., 2017). By mediating unidirectional flow of protons to the extracellular environment, Hv1 represents an important component in the CatSper activation cascade, but it also induces membrane hyperpolarization by exporting positive charges out of the cell. Hv1 is a voltage-gated channel and depends on membrane depolarization to be activated (Ramsey et al., 2006; Sasaki et al., 2006). Therefore, both CatSper and Hv1 must rely on yet unidentified depolarizing ion channels. P4 was shown to inhibit the K+ channel of human sperm KSper (IC50 = 7.5 ± 1.3 μM [Mannowetz et al., 2013; Brenker et al., 2014]) making KSper inhibition one of the potential origins for membrane depolarization. However, efficient KSper inhibition requires P4 concentrations in the μM range, which are only present in close vicinity of the egg. Sperm hyperactivation, however, occurs in the fallopian tubes, where P4 concentrations are not sufficient to block KSper (Demott and Suarez, 1992). Hence, the current model is missing a fourth member – the ‘Depolarizing Channel of Sperm’ (DSper) (Miller et al., 2015). Activation of the hypothetical DSper ion channel would induce long-lasting membrane depolarization and provide the necessary positive net charge influx for CatSper/Hv1 activity. Despite its central role, the molecular identity of DSper yet remains elusive.

The goal of this work was to characterize DSper and resolve its molecular identity in human spermatozoa. Using whole-cell voltage-clamp measurements, we recorded a novel non-CatSper conductance in both capacitated and noncapacitated spermatozoa. This unidentified, nonselective cation conductance exhibited outward rectification and pronounced temperature sensitivity in a range that matches the temperature spectrum of TRPV4 activity. Moreover, the pharmacological profile of DSper bears resemblance to TRPV4. Based on our electrophysiological, biochemical and immunocytochemical data, we thus conclude that the molecular identity of DSper is TRPV4.

Results

A novel non-CatSper conductance of human sperm cells

As many calcium channels, CatSper conducts monovalent ions, such as Cs+ and Na+ in the absence of divalent cations from the extracellular solution (divalent free; DVF) (Lishko et al., 2011; Kirichok et al., 2006). CatSper is also permeable to Ca2+ and Ba2+, but it cannot conduct Mg2+ (Figure 1—figure supplement 1; Figure 1—source data 1B). In the presence of extracellular Mg2+ the CatSper pore is blocked, resulting in the inhibition of monovalent CatSper currents (ICatSper) (Figure 1—figure supplement 1; Figure 1—source data 1B).

In whole-cell voltage-clamp recordings from human ejaculated spermatozoa, we consistently observed residual currents when ICatSper was blocked with 1 mM extracellular Mg2+ (Figure 1A,B). Cs+ inward and outward currents elicited under DVF condition (black traces and bars) were larger than currents recorded in the presence of Mg2+ (red traces and bars) (Figure 1A–C; Figure 1—source data 1A). This phenomenon was observed in both noncapacitated and capacitated spermatozoa, respectively. Notably, capacitated cells generally showed increased current densities under both conditions (Figure 1C). The data suggests that the remaining conductance is a novel non-CatSper conductance via the yet to be identified DSper ion channel. DSper currents were potentiated during capacitation (Figure 1C; Figure 1—source data 1A) and exhibited outward rectification, though, DSper currents recorded from capacitated cells were notably less rectifying (Figure 1A,B). This DSper component is unlikely a remnant of an increased leak current since the cells returned to their initial ‘baseline’ current after returning to the initial (HS) bath solution (Figure 1—figure supplement 2). Cation influx is the physiologically relevant entity to be analyzed as it represents channel activity under physiological relevant conditions and ensures membrane depolarization. Therefore, we preferentially analyzed DSper inward currents elicited by the change of membrane potential from 0 mV to −80 mV. To rule out ‘contamination’ of putative IDSper with remaining ICatSper, we next tested whether 1 mM Mg2+ is sufficient to completely block ICatSper and selectively isolate DSper currents. The CatSper inhibitor NNC 55–0396 (Lishko et al., 2011; Strünker et al., 2011) did not elicit any additional inhibitory effect on IDSper (Figure 1D–F; Figure 1—source data 1A), confirming efficient CatSper pore block by Mg2+. These findings corroborate our hypothesis that a novel CatSper-independent cation conductance could provide additional depolarization under physiological conditions. To isolate IDSper, we performed all following experiments in presence of both Mg2+ and NNC 55–0396.

Figure 1 with 2 supplements see all
Electrophysiological recordings reveal a novel non-CatSper conductance.

(A-B) Original current traces from representative whole-cell patch-clamp recordings from noncapacitated (A) and capacitated (B) human spermatozoa. Inward- and outward currents were elicited with voltage ramps as depicted in (A). Under divalent free conditions (black traces), typical CatSper monovalent caesium currents can be recorded. In the presence of 1 mM Mg2+ (red traces), an outward rectifying ‘DSper’ current component remains. Hence, the black traces represent a mixture of both CatSper and DSper monovalent Cs+ currents, while the red traces show pure Cs+ currents through DSper. (C) Quantification of current densities for all three conditions in (A-B). DSper currents are potentiated upon capacitation (noncapacitated cells: -4.50 ± 0.41 pA/pF, capacitated cells: -25.58 ± 5.88 pA/pF for inward currents recorded at -80 mV; noncapacitated cells: 28.80 ± 1.93 pA-pF, capacitated cells: 42.67 ± 9.27 pA/pF for outward currents recorded at +80 mV). Data are mean ± S.E.M., with (n) representing the number of individual sperm cells tested. Statistical significance (unpaired t-test) was indicated by: ***p ≤0.0005. Data was collected from 3 human donors, no variations between human donors were noticed. Quantification of normalized DSper inward currents (D) and original current traces (E-F) in presence and absence of the CatSper inhibitor NNC 55-0396 demonstrate the absence of the inhibition.

https://doi.org/10.7554/eLife.35853.002
Figure 1—source data 1

The source data for the inward and outward monovalent and divalent DSper current densities.

(A) Inward and Outward monovalent DSper current densities (pA/pF) recorded at -80mV and +80mV, respectively. (B) Divalent CatSper inward current densities (pA/pF).

https://doi.org/10.7554/eLife.35853.005

Human sperm DSper current exhibits temperature sensitivity

We next aimed to investigate mechanism(s) of DSper activation. Previous work had focused on various DSper candidates, one being ATP-activated P2X channels. Navarro et al. showed functional expression of P2X2 in mouse spermatozoa (Navarro et al., 2011). However, human spermatozoa appear to be insensitive to extracellular ATP (Brenker et al., 2012). De Toni et al. suggested that human spermatozoa perform thermotaxis mediated by a member of the thermosensitive transient receptor potential vanilloid channel family, TRPV1 (De Toni et al., 2016), supporting their claim by immunocytochemistry and Ca2+ imaging. By contrast, Kumar et al. detected TRPV4 expression in human spermatozoa using immunocytochemistry and calcium imaging (Kumar et al., 2016). To date, several temperature-sensitive ion channels and specific transporters have been reported in mammalian sperm (Kumar et al., 2016; Gervasi et al., 2011; Hamano et al., 2016). However, functional characterization of a temperature-activated cation conductance via direct methods, such as electrophysiology, has not been performed in human sperm yet. Since the functional expression of a thermosensitive TRP ion channel in human spermatozoa is currently under debate, and their cation permeability renders many of them DSper candidates, we investigated the impact of temperature on DSper activity. As shown in Figure 2A–C, elevating temperature profoundly increased IDSper. We observed a temperature-induced potentiation of both inward and outward currents in noncapacitated, as well as capacitated human spermatozoa (Figure 2A–B; Figure 2—source data 1). A temperature ramp from 23°C to 37°C potentiated IDSper inward currents by factors of 2.7 ± 0.5 for noncapacitated cells and 2.0 ± 0.2 for capacitated cells, respectively (Q10 noncapacitated=1.76, Q10 capacitated=1.65 for caesium inward currents). Half-maximal activation was achieved at T1/2 = 34°C (noncapacitated) and T1/2 = 31°C (capacitated) (Figure 2D). Moreover, the temperature-induced potentiation effect was reversible for both noncapacitated and capacitated cells (Figure 2E). We hence concluded that the observed phenomenon is not a temperature-induced loss of the seal and compromised membrane stability and that DSper is indeed temperature-activated.

DSper is activated by warm temperatures.

(A–B) Representative current traces from whole-cell patch-clamp recordings from noncapacitated (A) and capacitated (B) human spermatozoa challenged with a rise in temperature from 23°C to 37°C. Both DSper inward- and outward currents are increased at warmer temperatures. (C) Quantification of DSper inward current densities as a function of bath temperature (in °C). Noncapacitated (grey squares) as well as capacitated cells (blue squares) show increased current densities when stimulated with increasing bath temperatures. (D) Data of (C) normalized to room temperature (22°C). Half maximal activation at T1/2 = 34°C (noncapacitated) and T1/2 = 31°C (capacitated) indicated by the dotted lines. The data were fitted with Boltzmann equation to estimate the temperature at which DSper currents have half-maximal activation. Right panel: statistical significance (unpaired t-test) was indicated by: *p≤0.05, **p≤0.005 for capacitated (blue bars) and noncapcitated (black bars) human sperm. (E) The bath temperatures as a function of time and corresponding DSper currents. Inset shows representative traces indicating that the temperature-induced potentiation effect was reversible. Data are mean ± S.E.M., with (n) representing the number of individual sperm cells tested obtained from three human donors.

https://doi.org/10.7554/eLife.35853.006
Figure 2—source data 1

DSper inward current densities as a function of the bath temperature.

https://doi.org/10.7554/eLife.35853.007

DSper conducts sodium ions

Since sodium (Na+) is the major extracellular ion in the female reproductive tract ([Na+]=140–150 mM [Borland et al., 1980]), Na+ is a likely source for membrane depolarization. We therefore investigated whether DSper has the capacity to conduct Na+. As indicated in Figure 3A, similar outward rectifying DSper currentswere recorded when extracellular Cs+ was replaced with equimolar concentrations of Na+. DSper inward Na+ currents were entirely CatSper-independent, since NNC 55–0396 had no significant inhibitory effect (Figure 3B,C; Figure 3—source data 1). In the presence of both 1 mM Mg2+ and 1 μM NNC 55–0396, IDSper was still reversibly activated by warm temperatures (Figure 3D,E; Figure 3—source data 1) with a 4.1 ± 0.5 fold increase for the inward sodium currents from 22°C to 37°C, which is notably larger than the fold-increase as observed for cesium currents (Figure 2D). Half -maximum activation was at T1/2 = 34°C, comparable to previously analyzed values for the temperature-activated Cs+ currents, however sodium conductance via DSper produced a larger Q10 noncapacitated=2.30. Together, these electrophysiological data indicate that DSper shares characteristic hallmarks with thermosensitive TRPV channels (Benham et al., 2003). We thus proceeded to define which TRPV channel(s) is involved.

DSper conducts sodium ions.

(A) Representative current traces from the whole-cell patch-clamp recordings of noncapacitated human spermatozoa. Inward and outward currents were elicited with the voltage ramps as depicted. To record DSper currents, extracellular Cs+ was substituted with the same concentration of Na+. Representative current traces (B) and quantification of the normalized DSper inward currents (C) before and after stimulation with 1 μM NNC suggest that CatSper channel does not contribute to the recorded sodium inward conductance. (D–E) Representative current traces in (D) and quantification of the inward currents normalized to 22°C (E) at increasing bath temperatures. A similar temperature-induced potentiation effect of DSper sodium inward currents was observed as for caesium currents. Recordings were performed in the presence of NNC to exclude any CatSper contribution. Half maximal activation was achieved at T1/2sodium = 34°C (dotted line). The data were fitted with the Boltzmann equation. Statistical significance (unpaired t-test) is indicated by: **p≤0.005. Data are mean ± S.E.M., with (n) representing the number of individual sperm cells tested obtained from two human donors.

https://doi.org/10.7554/eLife.35853.008
Figure 3—source data 1

The source data for the inward sodium currents via DSper.

https://doi.org/10.7554/eLife.35853.009

DSper is represented by the cation channel TRPV4

Based on the observed IDSper temperature spectrum (Figures 2D and 3E), candidate channels could be TRPV3, TRPM3 or TRPV4 (Benham et al., 2003; Güler et al., 2002; Watanabe et al., 2002; Cheng et al., 2012). We have ruled out TRPV2 involvement, since TRPV2 has an unusually steep activation threshold of above 53°C (Moore and Liedtke, 2017). In addition, TRPV1 was previously proposed as a mediator of human sperm thermotaxis (De Toni et al., 2016). To discriminate between these channels, we tested potential effects of corresponding selective agonists – carvacrol (Vogt-Eisele et al., 2009) for TRPV3, RN1747 (Vincent et al., 2009) for TRPV4, capsaicin (Caterina et al., 1997) for TRPV1, and pregnenolone sulfate (Harteneck, 2013) for TRPM3. Employing either electrophysiological, or Ca2+ imaging recordings, only TRPV4 agonist RN1747 elicited a significant effect. In detail, application of 10 μM RN1747 (EC50 = 0.77 μM [Vincent et al., 2009]) significantly potentiated DSper outward currents (Figure 4A,B; Figure 4—source data 1A) in noncapacitated human sperm. In contrast, no effects were observed by 1 μM or 10 μM capsaicin (EC50 = 711.9 nM [Caterina et al., 1997]) (Figure 4—figure supplement 1, Figure 4—source data 1B-D). In order to confirm TRPV1 functional absence, we repeated these capsaicin experiments with 30 µM PI4,5P2 inside, to account for a possible loss of capsaicin sensitivity due to potential depletion of endogenous PI4,5P2 during whole-cell recording (Bevan et al., 2014; Senning et al., 2014). However, no change in DSper inward- and outward currents was observed. Using Ca2+ imaging of fluo-4/AM-loaded sperm, we next recorded fluorescence changes in the flagellar principle piece while stimulating human sperm with either 10 μM capsaicin or 500 μM carvacrol (Figure 4—figure supplement 1; Figure 4—source data 1C,D). Neither TRPV1 nor TRPV3 agonist elicited any rise in cytosolic calcium levels. We thus concluded that human spermatozoa do not express functional TRPV1 or TRPV3 channels. TRPM3 channels also exhibit temperature sensitivity between ambient warm to hot, which resembles the range observed for DSper (Vriens and Voets, 2018). Therefore, we have tested the possibility of TRPM3 involvement in IDSper generation by applying the TRPM3 agonist pregnenolone sulfate (PS) (Figure 4—figure supplement 1E; Figure 4—source data 1E). Application of 10 µM PS did not result in any change of the basal DSper current, confirming the absence of functional TRPM3 in human spermatozoa. Taking together, our results indicate that the temperature-activated cation channel TRPV4 is likely to be functionally expressed and provides membrane depolarization in human sperm.

Figure 4 with 1 supplement see all
DSper is activated by the TRPV4 agonist RN1747.

(A) Representative whole-cell patch-clamp recordings of noncapacitated human spermatozoa. Inward- and outward currents were elicited with voltage ramps as depicted. DSper monovalent caesium currents (black trace) are increased after stimulation with 10 μM RN1747 (red trace). Both recordings were performed in the presence of 1 μM NNC. (B) Quantification of normalized DSper outward currents under control conditions and after stimulation with RN1747. A significant gain upon stimulation with the TRPV4 agonist (factor 2.22 ± 0.23, **p=0.0007, unpaired t-test, n = 6) is observable. No variation between human donors were noticed.

https://doi.org/10.7554/eLife.35853.010
Figure 4—source data 1

The source data for DSper regulation of TRP channel agonists and inhibitors.

(A) DSper inward currents potentiated by RN1747. (B) DSper currents after stimulation with Capsaicin. (C) Calcium imaging (stimulation with 10 μM capsaicin after 20 s). (D) Calcium imaging (stimulation with 500 μM carvacrol after 20 s). (E) Pregnonolone sulfate effect on IDSper.

https://doi.org/10.7554/eLife.35853.012

Interestingly, additional pharmacological investigation of DSper revealed that both TRPV4-specific antagonists, HC067047 and RN1734 (Vincent et al., 2009; Everaerts et al., 2010), prevented temperature activation of DSper, confirming that DSper pharmacology matches that of TRPV4 (Figure 5A–C; Figure 5—source data 1A). Since both inhibitors are dissolved in ethanol, we performed a vehicle control to exclude any inhibitory effect of ethanol on temperature activation. Indeed, the same vehicle concentration (0.1% ethanol) failed to inhibit DSper temperature activation and yielded results comparable to the control conditions (Figure 5—figure supplement 1; Figure 5—source data 1B).

Figure 5 with 2 supplements see all
TRPV4 inhibitors RN1734 and HC067047 antagonize human DSper activity.

(A–B) Quantification of normalized DSper outward currents as a function of bath temperature (in °C) in the absence (grey squares) and the presence (turquoise/blue squares) of TRPV4 inhibitors RN1734 (A) and HC067047 (B), respectively. Both inhibitors greatly reduce DSper’s temperature-sensitivity. Representative current traces of whole-cell voltage clamp recordings from noncapacitated spermatozoa for all three conditions are depicted in (C). Representative current traces indicate that a rise in temperature from 22°C to 42°C considerably potentiated DSper inward and outward currents under control conditions but not in presence of the TRPV4 antagonists HC067047 and RN1734. No variations between human donors were noticed.

https://doi.org/10.7554/eLife.35853.013
Figure 5—source data 1

The source data for the experiments shown on Figure 5 and its Figure 5—figure supplement 1.

(A) DSper’s temperature-sensitivity in presence of TRPV4 specific inhibitors RN1734 and HC067047. (B) EtOH vehicle control.

https://doi.org/10.7554/eLife.35853.016

Supporting our functional data, TRPV4 was detected in human sperm on both mRNA and protein levels. Reverse transcriptase PCR performed with mRNA isolated from "swim-up" purified spermatozoa, followed by an amplification of the full-length TRPV4 (Figure 5—figure supplement 2A), produced a band of the expected size. The band was absent in negative controls, to which no reverse transcriptase and no templates were added. The sequence of the isolated PCR product of that specific band (dotted square), yielded the full-length sequence of TRPV4 isoform A (2620 bp, 98 kDa, Q9ERZ8). Moreover, the presence of TRPV4 protein was confirmed by western blotting (Figure 5—figure supplement 2B). Immunoreactive bands were detected at ~115 kDa in extracts from human testicular tissue (1), capacitated (2) and noncapacitated (3) spermatozoa (Figure 5—figure supplement 2B). Immunostaining with anti-hTRPV4 specific antibodies (Figure 5—figure supplement 2C) yielded an immunopositive signal in the acrosome and flagellum. Finally, when TRPV4 was cloned from human sperm mRNA extracts and recombinantly expressed in HEK293 cells (Figure 6A), a band of similar molecular weight could be detected by western blotting (Figure 6B). Moreover, TRPV4 cloned from human sperm mRNA recapitulates DSper temperature sensitivity (Figure 6D–E; Figure 6—source data 1), as well as activation by the selective TRPV4 agonist RN1747 (Figure 6F–G; Figure 6—source data 1), indicating that TRPV4 cloned from human sperm cells indeed assembles into a functional channel.

Sperm TRPV4 assembles into a functional channel when recombinantly expressed in HEK293 cells.

(A) Schematic representation of experimental approach: Full-length TRPV4 (isoform A) was cloned from human sperm mRNA extracts and recombinantly expressed in HEK293 cells, utilizing a pTracer CMV vector (Invitrogen). The GFP containing bicistronic vector allowed identification of green fluorescent transfected cells. (B) Western blotting results are shown for (1) nontransfected HEK293 cells, (2) cells transfected with the empty vector and (3) HEK293 cells transfected with the TRPV4-containing vector. An intense immunopositive band can be detected in line 3) at approx. 115 kDa corresponding to the expected size for TRPV4. Weak bands in 1) and 2) suggest endogenous expression of TRPV4 in HEK293 cells. (C) Electrophysiological characterization reveals a significant increase in the basic activity of TRPV4 transfected cells (at room temperature, 22°C). Inward and outward current densities were recorded as described before (ramp recordings −80 to +80 mV). Statistical significance (unpaired t-test) is indicated by: **p≤0.005, ***p≤0.0005. (D) Quantification of the inward current densities for nontransfected vs. TRPV4 transfected cells as a function of bath temperature (in °C) and representative current traces of whole-cell voltage clamp recordings for both cell populations in (E). Temperature-induced potentiation of inward and outward currents in TRPV4 transfected cells suggests that TRPV4 cloned from human sperm assembles into a functional protein in the heterologous expression system. (F) Whole-cell voltage clamp recordings reveal a strong potentiation of the inward and outward currents upon stimulation with the TRPV4 agonist RN1747 in TRPV4- transfected but not in nontransfected cells. Inward and outward currents were elicited via voltage ramps as depicted above. (G) Quantification of both inward and outward currents normalized to control conditions indicates statistical significance (**p≤0.005, ***p≤0.0005) for TRPV4 transfected cells.

https://doi.org/10.7554/eLife.35853.017
Figure 6—source data 1

Recombinantly expressed TRPV4, initially isolated from human sperm mRNA pool, exhibits typical TRPV4-like behavior when expressed in HEK293 cells.

https://doi.org/10.7554/eLife.35853.018

Discussion

Sperm transition to hyperactivated motility is essential for fertilization. Hyperactivation provides the propulsion force required to penetrate through viscous luminal fluids of the female reproductive tract and protective vestments of the egg. The CatSper channel is a key player in the transition to hyperactivated motility (Ren et al., 2001). However, proper CatSper function requires three concurrent activation mechanisms: (1) membrane depolarization (Lishko et al., 2011; Kirichok et al., 2006), (2) intracellular alkalization (Lishko et al., 2011; Kirichok et al., 2006), and for primate CatSper specifically (3) abundance of progesterone (Lishko et al., 2011; Strünker et al., 2011; Smith et al., 2013; Sumigama et al., 2015). While the two latter mechanisms have been described in detail, the source of membrane depolarization remained puzzling.

In human spermatozoa, K+, Ca2+, Cl, and H+ conductances have been described (Lishko et al., 2011; Strünker et al., 2011; Smith et al., 2013; Lishko et al., 2010; Berger et al., 2017; Mannowetz et al., 2013Brenker et al., 2014; Brown et al., 2016; Geng et al., 2017; Williams et al., 2015; Orta et al., 2012). However, the molecular nature of Na+ conductance of sperm remained unknown. Upon ejaculation, mammalian spermatozoa are exposed to increased [Na+] (~30 mM in cauda epididymis versus 100–150 mM in seminal plasma). In the female reproductive tract, Na+ levels are similar to those in serum (140–150 mM) (Borland et al., 1980). Hence, Na+ is ideally suited to provide a depolarizing charge upon sperm deposit into the female reproductive tract.

Here, we recorded a novel CatSper-independent cation conductance that exhibits outward rectification as well as potentiation upon capacitation. We propose that this novel conductance is carried by the hypothetical ‘Depolarizing Channel of Sperm’ DSper and provides the necessary cation influx that ensures membrane depolarization. IDSper is activated by warm temperatures between 22 and 37°C (Figures 2 and 3D–E) which makes the protein thermoresponsive within the physiologically relevant temperatures (34.4°C in the epididymis (Valeri et al., 1993), 37°C body core temperature at the site of fertilization). Previous studies showed that capacitated rabbit and human sperm cells have an inherent temperature sensing ability (Bahat et al., 2003), which could be an additional driving force to guide male gametes from the reservoir in the Fallopian tubes towards the warmer fertilization site. It is thus very likely, that human spermatozoa express a temperature-activated ion channel, which operates in the described temperature range and enables thermotaxis. Another potential role for this channel is to serve as a sensor for the initiation of human sperm capacitation. During maturation in the female reproductive tract, human sperm are exposed to elevated temperature, especially before and during ovulation, which is correlated with an increase in basal body temperature by 1°C. As spermatozoa are able to survive in the female reproductive tract for several days by binding to the ciliated epithelia of the fallopian tubes, they must eventually undergo hyperactivation to detach (Ardon et al., 2016). Accordingly, CatSper-deficient spermatozoa that cannot hyperactivate are not able to ascend the fallopian tubes (Ho et al., 2009).

In order for hyperactivation to occur, spermatozoa must be fully capacitated – a process that takes approximately 5 hr in humans, and requires sperm exposure to bicarbonate, albumin, and elevated temperature. While sperm capacitation can be achieved in vitro, exposure to 37°C is an absolute requirement. Therefore, the presence of a temperature-sensitive sperm ion channel could serve as the potential sensor for the onset of capacitation and might ensure sperm final maturation in the female reproductive tract.

The temperature response profile of DSper conforms with previously reported temperature sensitivity of TRPV4 (Benham et al., 2003; Güler et al., 2002; Watanabe et al., 2002). Moreover, we observed IDSper potentiation by the selective TRPV4 agonist RN1747 (Figure 4), as well as decreased temperature-sensitivity upon stimulation with TRPV4 selective inhibitors HC067047 and RN1734 (Figure 5). It should be noted that the absence of a significant inward current via TRPV4 in presence of both extracellular Mg2+ and Ca2+, such as in HS solution (Figure 1A–B), results from competition for the channel pore between the divalent and monovalent ions. It has been reported that extracellular Ca2+ inhibits TRPV4 monovalent conductance (Watanabe et al., 2003).

The temperature coefficient Q10 reflects the temperature dependence of the membrane current and has been reported to be between 9 and 19 for recombinantly expressed TRPV4 (Güler et al., 2002; Watanabe et al., 2002). However, endogenously expressed TRPV4 channels recorded from aorta endothelial cells (Watanabe et al., 2002) exhibit less steep temperature dependence, which resembles the Q10 of sperm TRPV4 (Q10 sodium = 2.30, noncapacitated sperm). It is possible that different lipid environments or additional channel modifications are responsible for such differences.

It is also possible that sperm cells possess more than one type of temperature-regulated ion channel. The biphasic inhibition of DSper with TRPV4-selective antagonists (Figure 5) does not result in complete current inhibition, particularly in the temperate range between 24 and 32°C. This may suggest an additional, non-TRPV4 conductance. The molecular nature of such additional conductance(s) could be either temperature-dependent release of NNC inhibition on CatSper or perhaps the presence of other yet undiscovered temperature-sensitive ion channel(s). Interestingly, according to one published report (Hamano et al., 2016), murine TRPV4 regulates sperm thermotaxis. However, TRPV4-deficient male mice are fertile which may indicate either presence of an additional temperature sensor or a compensatory mechanism.

According to our model (Figure 7), human spermatozoa are exposed to an increase in both temperature and [Na+] upon deposit to the female reproductive tract. TRPV4-mediated Na+ influx induces membrane depolarization, which in turn activates both Hv1 and CatSper. H+ efflux through Hv1 promotes intracellular alkalization and thus enhanced CatSper activation. Approaching the egg, sperm is exposed to P4 and the endocannabinoid anandamide (AEA), both secreted by cumulus cells (El-Talatini et al., 2009; Hunter and Rodriguez-Martinez, 2004). P4 binding to ABHD2 releases CatSper inhibition (Miller et al., 2016) while AEA was shown to activate Hv1 (Lishko et al., 2010). The resulting opening of CatSper generates a Ca2+ influx along the flagellum and serves as the trigger for hyperactivation. P4 not only potentiates CatSper, it also inhibits KSper-mediated hyperpolarization, which gives the CatSper activation cascade an additional impulse (Mannowetz et al., 2013).

Interdependency of ion channel complexes in the human sperm flagellum.

Transition into hyperactivated motility is triggered by a CatSper-mediated rise in the cytosolic calcium levels. Proper CatSper function requires three concurrent activation mechanisms: (1) membrane depolarization, (2) intracellular alkalization via Hv1-mediated proton extrusion, and (3) abundance of progesterone. In our proposed model the sperm’s sodium channel TRPV4 is activated by warm temperatures (37°C at the site of fertilization). TRPV4-mediated sodium influx induces: (1) membrane depolarization, which in turn activates both Hv1 and CatSper. Hv1 then extrudes protons out of the sperm, thereby leading to (2) intracellular alkalization and further activation of CatSper. Cumulus cells surrounding the egg secrete (3) P4 and AEA. P4 releases CatSper inhibition and high P4 concentrations block KSper-mediated hyperpolarization. AEA was shown to potentiate Hv1. The resulting opening of CatSper generates a Ca2+ influx that serves as the trigger for hyperactivation.

https://doi.org/10.7554/eLife.35853.019

Using a CatSper2-deficient infertile patient, no remaining cation current was recordable, when both Hv1 and KSper were blocked (Smith et al., 2013). However, these recordings were performed in a condition where ATP was absent from the pipette solution. According to Phelps et al. intracellular ATP binding to the N-terminal ankyrin repeat domain of TRPV4 has a profound sensitizing effect (Phelps et al., 2010; Lishko et al., 2007), which is a feature of the TRPV ankyrin repeats and is shared between TRPV1 and TRPV4 (Lishko et al., 2007). Indeed, addition of 4 mM ATP to the pipette solution, allowed us to consistently record TRPV4 activity from fertile human sperm.

Our data suggests that TRPV4 activity is increased upon capacitation. Since capacitation encompasses changes in the phosphorylation state of many proteins (Visconti et al., 2011), and TRPV4 requires tyrosine phosphorylation to function properly (Wegierski et al., 2009), it is likely that TRPV4 phosphorylation is required. It would also explain, why only capacitated human spermatozoa appear to be thermotactically responsive (Bahat et al., 2003). Interestingly, we also observed different IDSper kinetics (i.e. less outward rectification) after capacitation. This finding could also be the result of phosphorylation, modified lipid composition or even formation of TRPV4/X heteromers upon capacitation. These aspects will be addressed in future studies.

Selective anti-hTRPV4 antibodies located TRPV4 in the flagellum and acrosome of human sperm (Figure 5—figure supplement 2C). The localization of TRPV4 in the acrosome region should be evaluated critically since this compartment is highly antigenic and attracts antibodies in general (Cheng et al., 1996). However, TRPV4 appears to be distributed in the sperm flagellum. The principal piece of the sperm tail is also the compartment where CatSper and Hv1 reside (Lishko et al., 2010; Ren et al., 2001), bringing those three interdependent ion channels in close proximity to each other.

TRPV4 – more precisely its hyperfunction - might underlie the aversive effect of increased scrotal temperatures on sperm production and epididymal preservation. As proposed by Bedford et al., increased scrotal temperatures when clothed contribute substantially to the inferior quality of human ejaculate (Bedford, 1991). By contrast, TRPV4 might represent an attractive target for male fertility control, since TRPV4 is likely to lie upstream in the signaling cascades leading to sperm hyperactivation and can be heterologously expressed for high-throughput functional studies.

Materials and methods

Key resources table
Reagent typeDesignationSourceIdentifierAdditional information
Cell lineHEK293ATCCATCC cat# CRL-1573
RRID:CVRL_0045
CompoundRN1747Tocris3745TRPV4 agonist
CompoundcapsaicinCayman404-86-4TRPV1 agonist
CompoundcarvacrolSigma499-75-2TRPV3 agonist
CompoundPregnenolone sulfateSigmaP162TRPM3 agonist
CompoundHC067047Tocris4100TRPV4 antagonist
CompoundRN1734Tocris3746TRPV4 antagonist
CompoundNNC 55–0396R and D systems2268CatSper antagonist
CompoundFluo-4/AMInvitrogenF14201Ca2+ indicator
CompoundLipofectamineInvitrogen11668019Transfection reagent
Antibodyα-TRPV4AlomoneAlomone cat# ACC-034
RRID:AB_2040264
polyclonal; host:
rabbit; unconjugated

Human sperm cells

Request a detailed protocol

A total of 5 healthy male volunteers were recruited to this study, which was conducted with approval of the Committee on Human Research at the University of California, Berkeley (protocol 10–01747, IRB reliance #151). Informed consent was obtained from all participants. Ejaculates were obtained by masturbation and spermatozoa were purified following the swim-up protocol as previously described (Lishko et al., 2011). In-vitro capacitation was accomplished by 4 hr incubation in 20% Fetal bovine serum, 25 mM NaHCO3 in HTF buffer (Lishko et al., 2013) at 37˚C and 5% CO2.

Reagents

RN1747, HC067047 and RN1734 were purchased from Tocris Bioscience (Bristol, UK), NNC 55–0396 was purchased from R&D systems (Minneapolis, USA), capsaicin from Cayman Chemical (Ann Arbor, USA), fluo-4/AM is from Invitrogen (Thermo Fisher Scientific, Carlsbad, USA) and all other compounds were obtained from Sigma (St. Louis, USA). NNC 55–0396 stock solution was dissolved in water, HC067047 and RN1734 were dissolved in EtOH, while RN1747 and PS were dissolved in DMSO.

Electrophysiology

Request a detailed protocol

For electrophysiological recordings, only the ultra-pure upper 1 ml of the swim-up fraction was used. Single cells were visualized with an inverse microscope (Olympus IX71) equipped with a differential interference contrast, a 60 x Objective (Olympus UPlanSApo, water immersion, 1.2 NA, ∞/0.13–0.21/FN26.5) and a 1.6 magnification changer. An AXOPATCH 200B amplifier and an AxonTM Digidata 1550A digitizer (both Molecular Devices, Sunnyvale, CA, USA) with integrated Humbug noise eliminator was used for data acquisition. Hardware was controlled with the Clampex 10.5 software (Molecular Devices). We monitored and compensated offset voltages and pipette capacitance (Cfast). Gigaohm seals were established at the cytoplasmic droplet of highly motile cells in standard high saline buffer (‘HS’ in mM: 135 NaCl, 20 HEPES, 10 lactic acid, five glucose, 5 KCl, 2 CaCl2, 1 MgSO4, one sodium pyruvate, pH 7.4 adjusted with NaOH, 320 mOsm/l) (Kirichok et al., 2006; Lishko et al., 2011). The patch pipette was filled with 140 mM CsMeSO3, 20 mM HEPES, 10 mM BAPTA, 4 mM NaATP, 1 mM CsCl (pH 7.4 adjusted with CsOH, 330 mOsm/l). For recordings from capacitated spermatozoa, BAPTA was substituted for 5 mM EGTA and 1 mM EDTA. We confirmed that changing of the chelator composition had no effect on DSper current amplitudes in noncapacitated cells. Transition into whole-cell mode was achieved by applying voltage pulses (499–700 mV, 1–5 ms, Vhold = 0 mV) and simultaneous suction. After establishment of the whole-cell configuration, inward and outward currents were elicited via 0.2 Hz stimulation with voltage ramps (−80 mV to +80 mV in 850 ms, Vhold = 0 mV, total 1000 ms/ramp). Data was not corrected for liquid junction potential changes. To ensure stable recording conditions, only cells with baseline currents (in HS solution) ≤10 pA at −80 mV were used for experiments. Under ‘HS’ condition, CatSper and DSper currents were considered to be minimal, thus any remaining baseline current represented the cells leak current. During whole-cell voltage-clamp experiments, the cells were continuously perfused with varying bath solutions utilizing a gravity-driven perfusion system. If not stated otherwise, electrophysiological experiments were performed at 22°C. Temperature of the bath solution was controlled and monitored with an automatic temperature control (TC-324B, Warner Instrument Corporation, Hamden, CT, USA). Both, CatSper and DSper currents were recorded under symmetric conditions for the major permeant ion. Under these conditions, the bath solution was divalent free (‘DVF’) containing (in mM) 140 CsMeSO3, 20 HEPES, 1 EDTA, and pH 7.4 was adjusted with CsOH, 320 mOsm/l. To isolate DSper conductances, monovalent currents through CatSper channels were inhibited by supplementing the DVF solution with 1 mM Mg2+ and in the absence of EDTA (Qi et al., 2007). Experiments with different bath solutions were performed on the same cell. Signals were sampled at 10 kHz and low-pass filtered at 1 kHz (Bessel filter; 80 dB/decade). Pipette resistance ranged from 9 to 15 MΩ, access resistance was 21–100 MΩ, membrane resistance ≥1.5 GΩ. Membrane capacitance was 0.8–1.3 pF and served as a proxy for the cell surface area and thus for normalization of current amplitudes (i.e. current density). Capacitance artifacts were graphically removed. Statistical analysis was done with Clampfit 10.3 (Molecular Devices, Sunnyvale, CA, USA), OriginPro 8.6 (OriginLab Corp., Northampton, MA, USA) and Microsoft Excel 2016 (Redmond, WA, USA). Statistical data are presented as mean ± standard error of the mean (SEM), and (n) indicates the number of recorded cells. Statistical significance was determined with unpaired t-tests.

Temperature dependency for cesium and sodium inward currents was fitted using the Boltzmann equation y=A2+(A1A2)/(1+exp((xx0)/dx)) with parameters as indicated in Table 1.

Table 1
Fitting parameters.
https://doi.org/10.7554/eLife.35853.020
Permeant cationCell typeA1A2x0Dx
Cesiumnoncapacitated0.873143.4545133.86.4
Cesiumcapacitated0.908922.1909631.23.7
Sodiumnoncapacitated0.846865.1991834.13.6

The temperature coefficient Q10 reflects the temperature dependence of the membrane current and was obtained using the van’t Hoff equation: Q10= (I2/I1)10/(T2-T1) where In are the corresponding current amplitudes at the lower (T1) and higher temperatures (T2) in °C. Here, we analyzed current amplitudes at 22 and 37°C.

Calcium imaging

Request a detailed protocol

All calcium imaging experiments were performed in HS solution. Prior to fluorescence recording, swim-up purified human spermatozoa were bulk loaded with 9 µM fluo-4/AM (dissolved in DMSO) and 0.05% Pluronic (dissolved in DMSO) in HS solution for 30 min at room temperature. Cells were then washed with dye-free HS solution and allowed to adhere to glass imaging chambers (World Precision Instruments, Sarasota, USA) for 1 min. Via continuous bath perfusion, the attached spermatozoa were presented with alternating extracellular conditions (HS ± agonist/antagonist; continuous presence of 1 μM NNC55-0396 as CatSper inhibitor). Fluorescence was recorded at 1 Hz, 100 ms exposure time over a total time frame as indicated. Imaging was performed using a Spectra X light engine (Lumencore, Beaverton, USA) and a Hamamatsu ORCA-ER CCD camera. Fluorescence change over time was determined as ΔF/F0 where ΔF is the change in fluorescence intensity (F - F0) and F0 is the baseline intensity as calculated by averaging the fluorescence signal of the first 20 s in HS solution. Regions of interest (ROI) were restricted to the flagellar principal piece of each cell by manual selection in ImageJ (Java, Redwood Shores, CA, USA). Statistical data are presented as mean ± standard error of the mean (SEM), and (n) indicates the number of recorded cells.

Immunocytochemistry

Request a detailed protocol

Purified spermatozoa were plated onto 20 mm coverslips in HS and allowed to attach for 20 min. The cells were fixed with 4% paraformaldehyde (PFA) in PBS for 20 min and washed twice with PBS. Additional fixation was performed with 100% ice-cold methanol for 1 min with two washing steps in PBS. Cells were blocked and permeabilized by 1 hr incubation in PBS supplemented with 5% immunoglobulin-γ (IgG)–free BSA and 0.1% Triton X-100. Immunostaining was performed in the same blocking solution. Cells were incubated with primary antibodies (rabbit polyclonal αTRPV4, 1:100, abcam ab39260) overnight at 4°C. After extensive washing in PBS, secondary antibodies (mouse monoclonal αRabbit-DyLight488, 1:1000, Jackson 211-482-171) were added for 45 min at room temperature. After vigorous washing, cells were mounted with ProLong Gold Antifade with DAPI reagent (Life Technologies, Carlsbad, CA) and imaged with a confocal microscrope.

RT-PCR and cloning

Request a detailed protocol

Total donor-specific RNA was extracted from purified spermatozoa with a QIAGEN RNAeasy mini kit followed by complementary DNA synthesis with a Phusion RT-PCR kit (Finnzymes, MA, USA). The donor-specific translated region of TRPV4 (cDNA) was amplified with the primers forward 5- ACAGATATCACCATGGCGGATTCCAGCG −3’ and reverse 5’-AACACAGCGGCCGCCTAGAGCGGGGCGTCATC-3’ and was subcloned into a pTracer-CMV2 vector (Invitrogen) using the restriction sites: EcoRV and NotI. TRPV4 identity was sequence verified. HEK293 (ATCC CRL-1573) cells were transfected during passages 2 to 15 using a standard lipofectamine protocol (Invitrogen). Transfected cells were identified as green fluorescent and successful transfection was verified via both western blotting and electrophysiology. The cell lines was not tested for mycoplasma and is not on the list of commonly misidentified cell lines maintained by the International Cell Line Authentication Committee: http://iclac.org/wp-content/uploads/Cross-Contaminations-v8_0.pdf.

Immunoblotting

Request a detailed protocol

The highly motile sperm fraction was separated from other somatic cells (mainly white blood cells, immature germ cells, and epithelial cells) by density gradient consisting of 90% and 50% isotonic Isolate (Irvine Scientific, CA) solution diluted in HS solution with the addition of protease inhibitors (Roche). Protease inhibitors were used throughout the whole procedure. After centrifugation at 300 g for 30 min at 24°C, the sperm pellet at the bottom of the 90% layer was collected, diluted ten times, and washed in HS by centrifugation at 2000 g for 20 min. Cells were examined by phase-contrast microscopy for motility and counted before centrifugation. Contamination of the pure sperm fraction by other cell types was minimal, with less than 0.2% of somatic cells, which was below the protein detection threshold for immunoblotting applications. The pellet was subjected to osmotic shock by a 5 min incubation in 0.5x HS solution, the addition of 10 mM EDTA and 10 mM dithiothreitol (DTT) for 10 min, and sonication in a water bath at 25°C for 5 min. Osmolarity was adjusted by addition of 10x phosphate-buffered saline (PBS). Laemmli sample buffer (5x) was added to a final 1x concentration, and the DTT concentration was adjusted to 20 mM. An additional 5 min sonication and boiling at 100°C for 5 min were performed. The total crude cell lysate was loaded onto a 4–20% gradient Tris-HCl Criterion SDS-PAGE (BioRad) with 500,000 sperm cells/well. TRPV4- and empty vector-transfected HEK293 cells were lysed in 2x Laemmli sample buffer and subjected to SDS-PAGE. Ten thousand cells per well were loaded onto SDS-PAGE. After transfer to polyvinylidene fluoride membranes, blots were blocked in 0.1% PBS-Tween20 with 3% IgG-free BSA for 15 min and incubated with primary antibodies overnight at 4°C. Blots were probed with rabbit anti-b-tubulin antibodies (Abcam), mouse monoclonal anti-actin C4 antibodies (Abcam), or anti-TRPV4 antibodies (Abcam). After subsequent washing and incubation with secondary horseradish peroxidase-conjugated antibodies (Abcam), membranes were developed with an ECL SuperSignal West Pico kit (Pierce).

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files. Source data files have been provided for all figures.

References

    1. Bevan S
    2. Quallo T
    3. Andersson DA
    (2014)
    Handbook of Experimental Pharmacology
    207–245, TRPV1, Handbook of Experimental Pharmacology, 222.
    1. Cheng FP
    2. Fazeli A
    3. Voorhout WF
    4. Marks A
    5. Bevers MM
    6. Colenbrander B
    (1996)
    Use of peanut agglutinin to assess the acrosomal status and the zona pellucida-induced acrosome reaction in stallion spermatozoa
    Journal of Andrology 17:674–682.
    1. Moore C
    2. Liedtke WB
    (2017)
    Neurobiology of TRP Channels
    Osmomechanical-Sensitive TRPV Channels in Mammals, Neurobiology of TRP Channels,  Boca Raton, FL, CRC Press.
    1. Suarez SS
    (1996)
    Hyperactivated motility in sperm
    Journal of Andrology 17:331–335.
    1. Valeri A
    2. Mianné D
    3. Merouze F
    4. Bujan L
    5. Altobelli A
    6. Masson J
    (1993)
    [Scrotal temperature in 258 healthy men, randomly selected from a population of men aged 18 to 23 years old. statistical analysis, epidemiologic observations, and measurement of the testicular diameters]
    Progres en Urologie : Journal De l'Association Francaise d'urologie Et De La Societe Francaise d'urologie 3:444–452.
    1. Vriens J
    2. Voets T
    (2018) Sensing the heat with TRPM3
    Pflügers Archiv - European Journal of Physiology 470:799–807.
    https://doi.org/10.1007/s00424-017-2100-1

Article and author information

Author details

  1. Nadine Mundt

    1. Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    2. Department of Chemosensation, Institute for Biology II, RWTH Aachen University, Aachen, Germany
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3370-2933
  2. Marc Spehr

    Department of Chemosensation, Institute for Biology II, RWTH Aachen University, Aachen, Germany
    Contribution
    Supervision, Funding acquisition, Writing—review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6616-4196
  3. Polina V Lishko

    Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Validation, Investigation, Project administration, Writing—review and editing
    For correspondence
    lishko@berkeley.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3140-2769

Funding

National Institute of General Medical Sciences (R01GM111802)

  • Polina V Lishko

Pew Charitable Trusts (00028642)

  • Polina V Lishko

Alfred P. Sloan Foundation (FR‐2015‐65398)

  • Polina V Lishko

Deutscher Akademischer Austauschdienst

  • Nadine Mundt

Packer Wentz Endowment Will

  • Polina V Lishko

Rose Hill Innovator Fund

  • Polina V Lishko

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Dr. Junji Suzuki (UCSF, CA) for the help with calcium imaging. We also thank Dr. Julio F Cordero-Morales (University of Tennessee Health Science Center, Memphis, TN) for the initial input and suggestions. MS is a Lichtenberg Professor of the Volkswagen Foundation and acknowledges support from the FENS-Kavli Network of Excellence. This work was supported by a DAAD fellowship to NM, and by NIH R01GM111802, Pew Biomedical Scholars Award, Alfred P Sloan Award, and Packer Wentz Endowment Will to PVL.

Ethics

Human subjects: The participation of healthy human sperm donor volunteers was approved by the Committee on Human Research at the University of California, Berkeley (protocol number 2013-06-5395). All donors provided informed consent.

Copyright

© 2018, Mundt et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 3,780
    views
  • 583
    downloads
  • 66
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Nadine Mundt
  2. Marc Spehr
  3. Polina V Lishko
(2018)
TRPV4 is the temperature-sensitive ion channel of human sperm
eLife 7:e35853.
https://doi.org/10.7554/eLife.35853

Share this article

https://doi.org/10.7554/eLife.35853