1. Structural Biology and Molecular Biophysics
Download icon

Crystal structure of the full Swi2/Snf2 remodeler Mot1 in the resting state

  1. Agata Butryn
  2. Stephan Woike
  3. Savera J Shetty
  4. David T Auble
  5. Karl-Peter Hopfner  Is a corresponding author
  1. Ludwig-Maximilians-Universität München, Germany
  2. University of Virginia Health System, United States
  3. Center for Integrated Protein Sciences Munich, Germany
Research Advance
  • Cited 2
  • Views 1,424
  • Annotations
Cite this article as: eLife 2018;7:e37774 doi: 10.7554/eLife.37774


Swi2/Snf2 ATPases remodel protein:DNA complexes in all of the fundamental chromosome-associated processes. The single-subunit remodeler Mot1 dissociates TATA box-binding protein (TBP):DNA complexes and provides a simple model for obtaining structural insights into the action of Swi2/Snf2 ATPases. Previously we reported how the N-terminal domain of Mot1 binds TBP, NC2 and DNA, but the location of the C-terminal ATPase domain remained unclear (Butryn et al., 2015). Here, we report the crystal structure of the near full-length Mot1 from Chaetomium thermophilum. Our data show that Mot1 adopts a ring like structure with a catalytically inactive resting state of the ATPase. Biochemical analysis suggests that TBP binding switches Mot1 into an ATP hydrolysis-competent conformation. Combined with our previous results, these data significantly improve the structural model for the complete Mot1:TBP:DNA complex and suggest a general mechanism for Mot1 action.



Swi2/Snf2 ATPases are members of the NTP-dependent helicase/translocase superfamily 2 (SF2) and are well known as the principal ATP hydrolyzing ‘engines’ of chromatin remodelers that govern processes such as transcription, replication, and DNA repair (Flaus et al., 2006; Narlikar et al., 2013; Hopfner et al., 2012; Becker and Workman, 2013). It is generally assumed, that the Swi2/Snf2 ATPase motor translocates on the minor groove of double-stranded DNA and that this universal core activity generates the force for the large diversity of remodeling reactions catalyzed by Swi2/Snf2 proteins (Saha et al., 2002; Whitehouse et al., 2003; Zofall et al., 2006; Dürr et al., 2005). However, very little is known about how groove tracking activity is converted into the diverse chemo-mechanical remodeling reactions (Hauk and Bowman, 2011; Narlikar et al., 2013; Blossey and Schiessel, 2018). In the absence of substrates, remodelers have been observed in catalytically inactive resting states (Hauk et al., 2010; Xia et al., 2016; Yan et al., 2016), but it is unclear how universal auto-inhibited resting states are. Recent work provides some insight into how Swi2/Snf2 chromatin remodelers interact with and reconfigure nucleosomal substrates (Liu et al., 2017; Farnung et al., 2017; Ayala et al., 2018; Eustermann et al., 2018; Sundaramoorthy et al., 2018). However, the architecture and chemo-mechanical mechanisms of the diverse types of remodeling reactions are not well understood for the great majority of enzymes in this class.

The single subunit remodeler Mot1 (Modifier of transcription 1) is a Swi2/Snf2 enzyme that either activates or represses transcription in a context-dependent manner by dissociating TATA box-binding protein (TBP) and Negative Cofactor 2 (NC2) from promoter DNA (Dasgupta et al., 2002; Zentner and Henikoff, 2013). Mot1 is an essential Swi2/Snf2 enzyme in yeast and the Mot1-TBP-NC2 regulatory axis is highly conserved in eukaryotes. The 140 – 210 kDa Mot1 protein has two functional domains. The N-terminal domain (Mot1NTD) recognizes TBP while the C-terminal domain (Mot1CTD) contains the catalytic Swi2/Snf2 ATPase that binds the DNA upstream from the TATA box (Moyle-Heyrman et al., 2012). The structure of the Mot1NTD has been determined by X-ray crystallography in complex with TBP (Wollmann et al., 2011) and in complex with TBP:NC2:DNA (Butryn et al., 2015). Low-resolution negative stain electron microscopy and chemical crosslinking coupled to mass spectrometry indicated the approximate location of the Mot1CTD near the opening of the Mot1NTD horseshoe (Butryn et al., 2015). However, the orientation of the Swi2/Snf2 domain and consequently the path of DNA remained elusive. As a result, the mechanism of Mot1-mediated dissociation of TBP complexes is still not well understood.

Here, we report the crystal structure of the near full-length Mot1 protein from Chaetomium thermophilium. Our structure reveals the location and orientation of the Swi2/Snf2 domain and, supported by mutagenesis studies, suggests a new type of resting state. Our data allow us also to derive a model for the Mot1 remodeler in complex with TBP and DNA.

Results and discussion

Architecture of CtMot1

We crystallized the near full-length Mot1 protein from Chaetomium thermophilum. The construct covers the entire Mot1NTD and Mot1CTD domains but lacks 50 amino acids from the C-terminus (Figure 1A). We determined the structure of this construct (residues 1–1836, Mot1∆C) harboring a point mutation in the Walker B motif (E1434Q) by Se-SAD to 3.2 Å (Table 1).

Figure 1 with 1 supplement see all
Structure of the Chaetomium thermophilum Mot1.

(A) Domain organization of CtMot1. The HEAT repeats are in yellow. The latch is in pink, other insertions of CtMot1NTD and the linker are in brown. RecA-like subdomains of CtMot1CTD are in orange (1A) and green (2A). Swi2/Snf2-specific insertions 1B and 2B are in dark blue. Brace and bridge elements are in light blue and red, respectively. The boundary of the crystallization construct (residue 1836) is marked with the dotted line. (B) Cartoon representation of the structure. N- and C-termini are labelled N and C, respectively. HEAT repeats 1, 2, and 16 are labelled HR1, HR2, and HR16, respectively. Missing residues of the latch are represented by the dotted line. (C) Surface representation of CtMot1CTD lobe 1 (orange) and 2 (green). Regions where helicase motifs are located on each lobe are colored in red. (D) Side-by-side comparison of CtMot1CTD (top panel) and SsoRad54 (Dürr et al., 2005) (bottom panel). CtMot1NTD is represented as yellow surface. If not stated otherwise, all panels have color coding as in A.

Table 1
Data collection and refinement statistics for the CtMot1 structure.
Data collection
Space groupP21
Unit cell
a, b, c (Å)93.2, 96.9, 129.7
α, β, γ (°)90.0, 97.6, 90.0
Resolution (Å)48.7 (3.3–3.2)*
Total reflections239071 (10913)
Unique reflections36422 (1888)
Rmeas [%]14.4 (88.7)
I/σI11.8 (2.6)
CC1/20.99 (0.79)
Completeness (%)97.1 (68.8)
Redundancy6.6 (5.8)
Resolution (Å)48.7 (3.3–3.2)
No. reflections36410 (2930)
Rwork0.19 (0.42)
Rfree0.24 (0.42)
No. atoms12390
B factors (Å2)
R.M.S deviations
Bond lengths (Å)0.002
Bond angles (°)0.463
Ramachandran plot
Favored [%]97
Allowed [%]3
Outliers [%]0
  1. * Values in parentheses are for highest-resolution shell.

The CtMot1 enzyme is a ring-shaped protein (Figure 1B). The CtMot1NTD consists of 16 HEAT repeats (HR) with insertions at four sites and is similar to the much smaller Encephalitozoon cuniculi orthologue (EcMot1NTD) with some notable differences. The helices forming the HEAT repeats are not extended in number but in length and the insertion elements into the HEAT repeats are longer. Thus, genome compaction in E. cuniculi did not alter the overall architecture of Mot1, which appears to be highly conserved in evolution, consistent with its critical function.

The structure reported here is the first to visualize the position and orientation of the Swi2/Snf2 ATPase domain in Mot1. The ATPase domain contains two characteristic lobes connected by a short hinge helix. Each lobe consists of a RecA-like subdomain (1A or 2A) that harbors the SF2-specific sequence motifs responsible for ATP and DNA binding as well as Swi2/Snf2-specific helical subdomains 1B, 2B, and ‘brace’ that emanate from 1A, 2A and the C-terminus of 2A, respectively. Lobe 1 of the CtMot1CTD contacts the C-terminus of CtMot1NTD via HR16, a small insertion within HR12, and a ~ 45 amino acids linker. This highly hydrophobic surface has a total area of 2500 Å2. The tip of subdomain 1B interacts with HR1, thus lobe 1 effectively closes the ring structure of CtMot1. The architectural constraints imposed by a ring explain the conservation of the number of HEAT elements among Mot1 proteins. Lobe 2 binds the cleft between lobe 1 and HR1/2. The ~1900 Å2 interface between lobe 2 and the remainder of CtMot1 is dominated by hydrogen bonds and salt bridges.

In some remodelers, the brace is directly followed by a ‘bridge’ element (Hauk et al., 2010), also referred to as NegC (Clapier and Cairns, 2012) or SnAC (Sen et al., 2011; Xia et al., 2016). While EcMot1 does not possess this element, in CtMot1 it is 64 amino acids long (residues 1822 – 1886). The bridge can act as a positive or negative auto-regulatory element via mechanisms that are not understood (Wang et al., 2014; Xia et al., 2016; Yan et al., 2016; Clapier and Cairns, 2012; Carroll et al., 2014; Sen et al., 2011). The bridge was almost entirely omitted from our crystallization construct and the only included residues (1822 –1836) together with the C-terminal expression tag are not visible in the electron density maps.

In summary, the structure reveals the architecture of the CtMot1 protein. It forms a ring-like structure in which the substrate-interacting HEAT repeat ‘arch’ binds both lobes of the ATPase domain from opposing sites.

Apo CtMot1 adopts an auto-inhibited resting state

In all species tested (H. sapiens, S. cerevisiae, C. thermophilum, E. cuniculi), Mot1’s ATPase is robustly activated by TBP:DNA complexes, but very little if at all by DNA alone (Auble et al., 1997; Adamkewicz et al., 2000; Wollmann et al., 2011; Chicca et al., 1998). Interestingly, some Mot1 species are activated by TBP alone and do not require DNA, although a more robust activation is generally observed in the presence of both DNA and TBP. This suggests that the conformation of the Mot1CTD is structurally coupled to TBP binding to the Mot1NTD and that Mot1 alone is in an inactive state (Adamkewicz et al., 2000; Moyle-Heyrman et al., 2012). Indeed, comparison of CtMot1CTD to other SF2 enzymes shows that lobe 2 is flipped ~180° from an ‘active’ conformation in which the ATPase and DNA-binding motifs would be properly aligned, that is lobe 1’s motifs I-III are properly situated in the ATP-binding cleft, while lobe 2’s motifs IV-VI are situated on the outside and are fully solvent-exposed (Figure 1C). As more Swi2/Snf2 domain structures have become available, it has become evident that many show an auto-inhibited conformation with misaligned lobes 1 and 2 (Figure 1—figure supplement 1) (Dürr et al., 2005; Hauk et al., 2010; Xia et al., 2016; Yan et al., 2016). For example, the DNA binding site of the Saccharomyces cerevisiae Chd1 Swi2/Snf2 domain is directly occluded by the chromodomain, providing a means of specific activation of the enzyme by interaction with a nucleosomal substrate (Hauk et al., 2010; Farnung et al., 2017) (Figure 1—figure supplement 1A). Intriguingly, the ‘resting’ conformation of CtMot1CTD is very similar to the crystallographic conformation of the Sulpholobus solfataricus Rad54 Swi2/Snf2 domain (Dürr et al., 2005) (Figure 1D and Figure 1—figure supplement 1B). The functional relevance of the SsoRad54 Swi2/Snf2 domain conformation remained unclear because the crystallized and functionally analyzed fragment of SsoRad54 comprised only the isolated Swi2/Snf2 domain.

Although the precise orientation of lobe 2 might be additionally determined by the bridge element that is missing in the structure, our structural data suggest that the auto-inhibited resting state of CtMot1 is stabilized by the interactions between subdomain 2A and HR1/2. To test this, we mutated ion pairs (R4-D1720, R45-D1716) and a hydrophobic loop (L1658A/Y1659A) to destabilize the resting state (Figure 2A and B). Basal ATPase activity of the point mutants was greatly increased compared to wild-type CtMot1 (WT) and was not further stimulated by DNA and TBP (Figure 2C and Figure 2—figure supplement 1A). CtMot1∆C did not show increased basal ATPase rates and was not activated by TBP alone. However, its ATPase activity in the presence of DNA-containing complexes exceeded that of the WT enzyme. To find out whether this elevated ATPase activity of the mutants translates into productive disruption of the substrate complexes, we performed remodeling assays. Notably, despite an increase in the ATP hydrolysis rate, the ability of CtMot1∆C to dissociate TBP:DNA complexes was impaired (Figure 2D). Assays performed under less efficient dissociation conditions that allowed the TBP:DNA complexes to persist confirmed that all other tested mutants (L1658A/Y1659A, R4D and D1720R) indeed behaved as the WT (Figure 2—figure supplement 1B and C). This shows that the bridge element acts in response to TBP binding and, similarly to SnAC in Snf2 (Xia et al., 2016), ensures productive coupling of ATP hydrolysis to the remodeling reaction.

Figure 2 with 1 supplement see all
Analysis of CtMot1 mutants.

(A) View at the interface between RecA2A (green cartoon), HR1/2 (yellow surface), and lobe 1 (orange/blue surface). Residues analyzed in this study are shown as sticks and labelled accordingly. (B) Cartoon model showing the positions of mutations in the Mot1NTD (red spheres on yellow surface) and in lobe 2 (green spheres on green surface). Left: orientation as in the CtMot1 crystal structure. Right: CtMot1 with ATPase modeled as in the S. cerevisiae Chd1:nucleosome complex, that is the ATP hydrolysis-competent conformation (Farnung et al., 2017). (C) ATPase activity of the mutants. Error bars represent standard deviations from three technical replicates. CtMot1WT is labelled as WT, CtMot1ΔC as ΔC. (D) Electrophoretic mobility shift assay showing ATP-dependent dissociation of Mot1:TBP:DNA and TBP:DNA complexes. All CtMot1 constructs form ternary complexes with labelled DNA and TBP (M:T:D). In the presence of ATP and unlabeled competitor DNA (DNA*), wild-type CtMot1 (WT), L1658/Y1659, R4D, and D1720R mutants fully disrupt M:T:D and T:D complexes (lanes 5, 9, 11, and 13, respectively), whereas CtMot1ΔC (ΔC) is less efficient (lane 7).

Figure 2—source data 1

Raw data from the ATPase activity assay used for Figure 2C and Figure 2—figure supplement 1A.

Figure 2—source data 2

Raw data from quantification of electrophoretic mobility shift assay used for Figure 2—figure supplement 1B.


Taken together, our data show that Mot1 adopts a resting state with low catalytic activity by stabilizing lobe 2 of the Swi2/Snf2 domain in an inactive conformation relative to lobe 1. Mobilization of lobe 2 from its auto-inhibited state explains the activation of Mot1’s ATPase by TBP and TBP:DNA complexes.

Model of the Mot1:TBP:NC2:DNA complex

The new structure of the near full-length CtMot1 protein together with prior structures enables us to provide a model for the DNA path in the Mot1-bound protein:DNA complex (Figure 3). The EcMot1NTD:TBP:NC2:DNA complex can be readily superimposed with CtMot1 through the conserved structure of the HEAT repeats. Likewise, superimposing SsoRad54:DNA with CtMot1∆C via lobe 1 visualizes how the CtMot1 ATPase could initially contact duplex DNA since in all Snf2/Swi2 protein:substrate structures contacts between nucleic acid and the RecA1 subdomain are preserved. In the resulting model, localization and orientation of the Swi2/Snf2 domain is in full agreement with prior EM and CX-MS analyses (Butryn et al., 2015) and with biochemical studies showing that Mot1 covers two helical turns upstream from the TATA box (Darst et al., 2001; Sprouse et al., 2006; Moyle-Heyrman et al., 2012). Notably, the superimposed DNA segment bound by the ATPase is an almost direct continuation of the promoter DNA fragment from the EcMot1NTD:TBP:NC2:DNA crystal structure. Assuming the generally proposed directionality of ATP dependent translocation of Swi2/Snf2 motor domains on dsDNA (Zofall et al., 2006; Saha et al., 2002; Whitehouse et al., 2003), the structure of CtMot1 and the specific orientation of lobe 1 now suggests that the Swi2/Snf2 motor translocates ‘towards’ the TATA box and TBP along the nucleic acid scaffold.

Model of the Mot1:TBP:NC2:DNA complex.

CtMot1ΔC was superimposed onto EcMot1NTD:TBP:NC2:DNA via the HEAT repeats (yellow surface). The path of the upstream DNA was determined by superimposing SsoRad54:DNA onto CtMot1ΔC via lobe 1. The TATA box strand from EcMot1NTD:TBP:NC2:DNA as well as the corresponding strand from SsoRad54:DNA are marked in gray. The non-TATA box strands are in red. Substrate proteins TBP and NC2 are represented as dark and light gray surfaces, respectively. The black arrow represents the direction in which Swi2/Snf2 domain is proposed to translocate along the DNA scaffold. CtMot1CTD is color-coded as in Figure 1.


Our model of the Mot1:TBP:NC2:DNA complex suggests where the Swi2/Snf2 domain of Mot1 might engage with upstream DNA and provides new insight into how ATP hydrolysis-associated events are coupled to dissociation of protein:DNA substrates. Since processive ATP-dependent translocase activity has not been observed in biochemical studies, Mot1 could exploit short-range tracking toward TBP. Given the immediate vicinity of the Swi2/Snf2 domain to TBP, very few translocation steps could lead to the displacement of TBP by steric collision (Darst et al., 2001; Auble and Steggerda, 1999; Butryn et al., 2015). In addition, Mot1 could simply displace TBP from DNA by overwinding or introducing other small distortions into upstream DNA (Moyle-Heyrman et al., 2012; Butryn et al., 2015). Similar effects have been observed for other transcription factors, for which not only binding but also dissociation rates depend on the structure of their recognition sites affected by the presence of other factors bound nearby (Luo et al., 2014; Kim et al., 2013). This allosteric effect can be accounted for by local changes to the major and minor groove width (Kim et al., 2013). Such a scenario is plausible since changes two helical turns upstream from the TBP binding site could have an immediate allosteric effect on severely bent and widened TATA box (Tora and Timmers, 2010).

Interestingly, while Mot1’s ATPase orientation suggests that it ‘pulls’ DNA from TBP and overwinds DNA at the substrate, the reverse architecture is seen for the multisubunit INO80 remodeler: here the motor appears to pump DNA into the nucleosome and to underwind DNA at the substrate (Eustermann et al., 2018). Thus, our results suggest that Swi2/Snf2 proteins can use DNA translocation in different ways to disrupts protein:DNA interfaces.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
(Chaetomium thermophilum)
CtMot1this paperUniProtKB:
gene cloned from a cDNA library
Cell line
(Escherichia coli)
Rosetta(DE3)NovagenMerck: 70954
Cell line
(Escherichia coli)
B843(DE3)NovagenMerck: 69041
DNA reagent
pETDuet-1NovagenMerck: 71146used to express
full-length CtMot1 (1–1886) and its
point mutants
DNA reagent
pET21bNovagenMerck: 69741used to express
CtMot1 (1–1836)
and CtMot1(1–1836, E1434Q)
compound, drug
L(+)-SelenomethionineAcros OrganicsAcros Organics:
42 mg/mL final
compound, drug
Medium Base plus
Nutrient Mix
Molecular DimensionsMolecular Dimensions:
compound, drug
Adenosine 5′-
triphosphate disodium
salt hydrate (ATP)
Sigma-AldrichSigma: A2383-10G
compound, drug
β-Nicotinamide adenine
dinucleotide reduced
disodium salt hydrate
Sigma-AldrichSigma: 10107735001
compound, drug
acid monopotassium
salt (PEP)
PanReac AppliChemAppliChem: A2271
compound, drug
Pyruvate kinase/lactic
dehydrogenase enzymes
from rabbit muscle
Sigma-AldrichSigma: P0294
XDSKabsch, 2010,
doi: 10.1107/S0907444909047374
PHENIXAdams et al., 2010,
CootEmsley et al., 2010,
doi: 10.1107/S0907444910007493
UCSF ChimeraPettersen et al., 2004, doi: 10.1002/jcc.20084http://www.rbvi.ucsf.edu/chimera/
ImageJ 1.51 kSchneider et al., 2012,
doi: 10.1038/nmeth.2089
quantification of electrophoretic shift assay
OriginPro 2015OriginLab, Northampton, MA
based reagent
based reagent
based reagent

Protein purification

Request a detailed protocol

The sequence of the full-length Mot1 (1 – 1886) was isolated from the Chaetomium thermophilum cDNA library and cloned into pETDuet-1 vector (Novagen, Germany) harboring N-terminal His6 tag followed by TEV cleavage site. CtMot1ΔC(1 – 1836) was cloned into pET21 vector containing PreScission protease cleavage site and C-terminal His6 tag. Both constructs were expressed in Escherichia coli Rosetta(DE3) cells (Novagen) and purified using Ni2+-NTA agarose (QIAGEN, Germany). After proteolytic cleavage of the expression tags, the proteins were further purified using ion-exchange chromatography (HiTrap Q HP, GE Healthcare, Germany) and size exclusion chromatography (HiLoad 16/60 200 pg, GE Healthcare). Proteins were concentrated to ~15 mg/ml in 20 mM Tris pH 7.5, 50 mM NaCl and 15% glycerol and stored at −80°C. Selenomethionine labelling of CtMot1∆C was performed in E. coli B843 (Novagen) using SelenoMethionine Medium Base and Nutrient Mix (Molecular Dimensions, UK) supplemented with L(+)-Selenomethionine (Acros Organics, Germany) at 42 mg/L. Purification of selenium-derivatized protein was performed according to the same protocol as for the native protein.

Crystallization and structure determination

Request a detailed protocol

Crystals of selenomethionine-derivatized CtMot1∆C were grown at 20°C by streak seeding in 0.1 M Tris pH 8.9, 0.2 M ammonium acetate and 13% (w/v) PEG 3350. Plate-like crystals with average dimensions of 700 × 150 × 30 µm appeared after three days and were cryocooled in liquid nitrogen using mother liquor supplemented with butanediol at 25% final concentration.

The data were collected at the European Synchrotron Radiation Facility in Grenoble, France at the peak of Se K-edge at 100K. Images were indexed, integrated, scaled, and merged in space group P21 to 3.2 Å using XDS package (Kabsch, 2010). The initial model was built manually to the experimental electron-density derived from SAD phasing using PHENIX AutoSol wizard (Adams et al., 2010). Alternating cycles of manual building using Coot (Emsley et al., 2010) and refinement with PHENIX yielded the final model (Rwork/Rfree of 19.0/23.8%) covering 87% of all residues.

ATPase assay

Request a detailed protocol

The assays were performed using an NADH-coupled assay as described (Kiianitsa et al., 2003). Reactions were performed using 2 mM phosphoenolpuryvate, 25 U/mL of pyruvate kinase/lactic dehydrogenase mix, 1 mM ATP, and 1 mM NADH at final concentrations. Test samples contained 100 nM dsDNA (5′–CAGTACGGCCGGGCGCCCGGCATGGCGGCCTATAAAAGGGGGTGGAAT–3′ top strand), 100 nM TBP, 100 nM NC2 and 250 nM CtMot1.

Electrophoretic mobility shift assays

Request a detailed protocol

Electrophoretic mobility shifts were essentially performed as described (Darst et al., 2001) with some modifications. In the assay shown in Figure 2D, fluorescently labelled dsDNA (40 nM, 5′–CAGTACGGCCGGGCGCCCGGCATGGCGGCCTATAAAAGGGGGTGGAAT–3′ top strand with 6-FAM label on the 5’ end of the reverse strand) was incubated with TBP (10 nM) and Mot1 (25 nM) for 10 min. Unlabeled dsDNA competitor (800 nM, 5′–CGGCCGGGCGCCCGGCATGGCGGCCTATAAAAGGGC–3’ top strand) was then added directly followed by ATP addition (50 µM) for 10 min. Samples were loaded onto 6% polyacrylamide gels and run at 160 V and 4° for 60 min and imaged using Typhoon FLA 9000 imager. The assays shown in Figure 2—figure supplement 1B and quantified in Figure 2—figure supplement 1C were prepared analogously, but TBP was added at a concentration of 15 nM and ATP was added for 6 min before loading the reactions on the gel.

Accession numbers

Request a detailed protocol

The coordinates and structure factors were deposited in the Protein Data Bank under accession code 6G7E.

Data availability

The coordinates and structure factors are deposited in the Protein Data Bank under accession code 6G7E. All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 2 and Figure 2-figure supplement 1.

The following data sets were generated


Decision letter

  1. Geeta J Narlikar
    Reviewing Editor; University of California, San Francisco, United States
  2. John Kuriyan
    Senior Editor; University of California, Berkeley, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Crystal structure of the full Swi2/Snf2 remodeler Mot1 in the resting state" for consideration by eLife. Your article has been reviewed by two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by John Kuriyan as the Senior Editor. The following individual involved in review of your submission has agreed to reveal his identity: Gregory D Bowman (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


Mot1 is an important factor involved in TBP turnover and recycling, containing an Swi2/Snf2-type ATPase that is believed to disrupt TBP:DNA complexes. Previous high-resolution structural information showed how the HEAT repeat portion of Mot1 engaged TBP:DNA, yet how the ATPase motor was organized was not well defined. Here the authors present a crystal structure of the Mot1 regulator that includes the ATPase domains. The ATPase motor is in an inactive organization, with the two halves rotated significantly away from the expected active configuration for Swi2/Snf2 ATPases. Interestingly, this inactive state very much resembles that of Rad54, suggesting it may represent a common resting state. The authors support the idea that the structure shows an inhibited state using mutants at the observed interface, which activate ATPase activity. By combining this new structural data with the previous Mot1:TBP:DNA:NC2 complex, the authors propose an organization of the holocomplex, where the ATPase motor is positioned to engage and translocate on DNA toward TBP. This is an important advance to previous structural knowledge about this enzyme, and helps deepen our understanding of how Mot1 accomplishes its task.

Essential revisions:

1) Clear interpretation of the in vivo data is confounded by the result that the mutants that do not support viability also show substantially lower expression levels than WT. The mutant that supports viability (D1720R) appears to be the only mutant with expression levels comparable to WT. At the same time, to demonstrate a mechanistic advance the in vivo data is not really needed. So the authors should either remove the in vivo data from the revised manuscript or repeat the experiments under conditions where the expression levels of the mutants can be better controlled.

2) The authors suggest that Mot1 might displace TBP by "counteracting TBP-induced bending and underwinding", which makes sense given their structure. Others have demonstrated how adjacent DNA-binding factors can stimulate dissociation of their neighbors, likely by changing groove widths (Kim et al., 2013; Luo et al., 2014). A brief discussion of these systems would be beneficial in relation to the Mot1:TBP system, as the change in DNA geometry that the authors propose would likely be sufficient for rapid TBP eviction.

3) As mentioned by the authors, auto-inhibited states are being observed in a variety of different chromatin remodeling ATPases and Mot1 is distinct in terms of its substrate. It will therefore be useful to expand a bit the discussion in the first paragraph of the subsection “Apo CtMot1 adopts an auto-inhibited resting state”, by making a supplementary figure, which compares the misalignment of lobes 1 and 2 in the resting state structures of Chd1, SWI2 and ISWI to Mot1 in addition to the comparison with Rad54.

4) The data in Figure 2C should be quantified and error bars shown.

5) The reviewers don't think the authors can state "Our model of the Mot1:TBP:NC2:DNA complex illustrates how the Swi2/Snf2 domain of Mot1 engages with upstream DNA," since there is no DNA in the structure. It would be more appropriate to say "…suggests where…" instead of "illustrates how".

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Crystal structure of the full Swi2/Snf2 remodeler Mot1 in the resting state" for further consideration at eLife. Your revised article has been favorably evaluated by John Kuriyan as the Senior Editor, and the Reviewing Editor.

The majority of the reviewer comments have been satisfactorily addressed. Before making a final decision we require one clarification regarding the gel in the new Figure 2D. It appears that in this gel, the ATP-dependent effects seen in lanes 5, 9, 11 and 13 mainly disrupt the ternary complex (M:T:D) and not the TBP-DNA complex (T:D). This seems to be different than in Wollman et al., 2011 and in the previous submission of this work where the T:D complex is disrupted in the presence of ATP and WT Mot1. Please send us a brief paragraph clarifying the reasons for these apparent differences.


Author response

Essential revisions:

1) Clear interpretation of the in vivo data is confounded by the result that the mutants that do not support viability also show substantially lower expression levels than WT. The mutant that supports viability (D1720R) appears to be the only mutant with expression levels comparable to WT. At the same time, to demonstrate a mechanistic advance the in vivo data is not really needed. So the authors should either remove the in vivo data from the revised manuscript or repeat the experiments under conditions where the expression levels of the mutants can be better controlled.

We understand this concern. There is a SUMO- and ubiquitin-mediated protein quality control system in yeast whose function was uncovered through genetic analysis of Mot1 point mutants (Wang et al., Genetics 172:1499-1509, 2006; Wang and Prelich, MCB 29:1694-1706, 2009). This system is responsible for reduced levels of many mutant Mot1 proteins in vivo, even in some cases in which the amino acid changes are relatively subtle. We have also explored Mot1 function in vivo using multi-copy plasmids and strong regulated promoters such as GAL1, which do boost protein levels and can compensate for reduced protein levels. However, these over-expression systems often cause dominant-negative effects on growth, even when the over-expressed protein is wild-type Mot1 (Darst et al., 2003; Auble et al., 1997). Based on this prior work, while it would be possible to investigate the in vivo function of the point mutants included in the first submission by increasing their expression, we feel that such studies are unlikely to provide much additional insight into Mot1 function. For these reasons we have opted to remove the in vivo data at the reviewer’s suggestion.

2) The authors suggest that Mot1 might displace TBP by "counteracting TBP-induced bending and underwinding", which makes sense given their structure. Others have demonstrated how adjacent DNA-binding factors can stimulate dissociation of their neighbors, likely by changing groove widths (Kim et al., 2013; Luo et al., 2014). A brief discussion of these systems would be beneficial in relation to the Mot1:TBP system, as the change in DNA geometry that the authors propose would likely be sufficient for rapid TBP eviction.

We thank the reviewers for this interesting point of discussion. We expanded this part of the Discussion (subsection “Model of the Mot1:TBP:NC2:DNA complex”, second paragraph). We indicate that the proposed “counteracting” effect of the Snf2/Swi2 motor domain can be accounted for by an allosteric effect transmitted via DNA, a phenomenon that has been described for other transcription factors (Kim at al., 2013; Luo et al., 2014). Local changes to the DNA could be easily transmitted from the upstream DNA, where ATPase is located, to the highly constrained TATA box just two helical turn downstream.

3) As mentioned by the authors, auto-inhibited states are being observed in a variety of different chromatin remodeling ATPases and Mot1 is distinct in terms of its substrate. It will therefore be useful to expand a bit the discussion in the first paragraph of the subsection “Apo CtMot1 adopts an auto-inhibited resting state”, by making a supplementary figure, which compares the misalignment of lobes 1 and 2 in the resting state structures of Chd1, SWI2 and ISWI to Mot1 in addition to the comparison with Rad54.

As the reviewer suggested, we include a supplementary figure (Figure 1—figure supplement 1) and also expanded the Discussion (subsection “Apo CtMot1 adopts an auto-inhibited resting state”, first paragraph). The new figure (panel A) shows the comparison between the auto-inhibited and activated (nucleosome-bound) conformation of a Swi2/Snf2 domain illustrated by the example of Chd1. Panel B shows other Swi2/Snf2 domain structures representing different auto-inhibited conformations (Snf2, ISWI, Rad54 and Mot1). We additionally updated the colors in Figure 1A to match the updated scheme used in Figure 1—figure supplement 1.

4) The data in Figure 2C should be quantified and error bars shown.

We repeated electrophoretic mobility shift assays that were presented in Figure 2C and Figure 2—figure supplement 1B in the original submission file. We improved our procedure for performing these assays and we used polyacrylamide gels rather than agarose, which enhanced band sharpness and the overall signal to noise ratio. New results are shown in reorganised Figure 2 (an exemplary gel, panel D) and Figure 2—figure supplement 1 (quantification from six technical replicates, panel B). We did not repeat the assays on TBP:DNA:NC2 complexes that were shown in Figure 2—figure supplement 1B of the original submission, as there was no difference between the activity of Mot1 mutants on this substrate in the first place. New data comprise the results of the assays performed on TBP:DNA complexes and, as in the previous version of the assay, show reduced activity of the Mot1ΔC mutant.

5) The reviewers don't think the authors can state "Our model of the Mot1:TBP:NC2:DNA complex illustrates how the Swi2/Snf2 domain of Mot1 engages with upstream DNA," since there is no DNA in the structure. It would be more appropriate to say "…suggests where…" instead of "illustrates how".

We concur with the comment and toned down this statement to “Our model of the Mot1:TBP:NC2:DNA complex suggests where the Swi2/Snf2 domain of Mot1 might engage with upstream DNA”.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

The majority of the reviewer comments have been satisfactorily addressed. Before making a final decision we require one clarification regarding the gel in the new Figure 2D. It appears that in this gel, the ATP-dependent effects seen in lanes 5, 9, 11 and 13 mainly disrupt the ternary complex (M:T:D) and not the TBP-DNA complex (T:D). This seems to be different than in Wollman et al., 2011 and in the previous submission of this work where the T:D complex is disrupted in the presence of ATP and WT Mot1. Please send us a brief paragraph clarifying the reasons for these apparent differences.

Thank you very much for you very positive feedback on our revised manuscript and your invitation to clarify a remaining point regarding the ATP dependent dissociation of TBP:DNA complexes by Mot1. We are very happy to provide a brief explanation for the observed differences. As noted, in the gel shown in Figure 2D (revision 1), the addition of ATP (lanes 5, 9, 11, and 13) mainly resulted in dissociation of the ternary complex (M:T:D) and not the TBP:DNA complex (T:D). In the earlier submission as well as in our previous work (Wollmann et al., 2011), T:D complexes were disrupted in the presence of ATP. We are confident that the differences observed in these different experiments are due to small but significant alterations in the specific experimental conditions. In the experiment shown in Figure 2D (revision 1), conditions were chosen that allowed the T:D complex to still persists so that we could better quantify differences in activity between WT CtMot1 and the mutants, rather than driving the system to an endpoint. Of note, TBP was added at a concentration of 15 nM and ATP was added for 6 minutes before loading the reactions on the gel. A relatively modest decrease in TBP concentration from 15 nM to 10 nM in combination with an extension of the incubation time with ATP to 10 minutes resulted in disruption of T:D as shown in the gel image below and is consistent with our previously published results. The other components were present at the same concentrations in both experiments: DNA (40 nM), CtMot1 (25 nM) and competitor DNA (800 nM). We did not use the more efficient dissociation conditions in the experimental results shown in the paper because under the conditions in which all of the labelled DNA is in a free state, it is not possible to see the differences in dissociation catalyzed by WT versus L1658A/Y1659A, R4D, or D1720R. The Mot1, TBP, DNA system is very sensitive to experimental conditions, since multiple equilibria and complexes are in competition (M:T:D, M:T*, T:D, T:T*, * have blocked TBP DNA binding site). To address the remaining concern, we added the new data as new Figure 2D (revision 2), and moved Figure 2D (revision 1) to Figure 2—figure supplement 1B (along with its quantification).


Article and author information

Author details

  1. Agata Butryn

    1. Department of Biochemistry, Ludwig-Maximilians-Universität München, Munich, Germany
    2. Gene Center, Ludwig-Maximilians-Universität München, Munich, Germany
    Present address
    Diamond Light Source Limited, Harwell Science and Innovation Campus, Didcot, United Kingdom
    Formal analysis, Investigation, Writing—original draft
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5227-4770
  2. Stephan Woike

    1. Department of Biochemistry, Ludwig-Maximilians-Universität München, Munich, Germany
    2. Gene Center, Ludwig-Maximilians-Universität München, Munich, Germany
    Competing interests
    No competing interests declared
  3. Savera J Shetty

    Department of Biochemistry and Molecular Genetics, University of Virginia Health System, Charlottesville, United States
    Competing interests
    No competing interests declared
  4. David T Auble

    Department of Biochemistry and Molecular Genetics, University of Virginia Health System, Charlottesville, United States
    Formal analysis, Writing—review and editing
    Competing interests
    No competing interests declared
  5. Karl-Peter Hopfner

    1. Department of Biochemistry, Ludwig-Maximilians-Universität München, Munich, Germany
    2. Gene Center, Ludwig-Maximilians-Universität München, Munich, Germany
    3. Center for Integrated Protein Sciences Munich, Munich, Germany
    Conceptualization, Formal analysis, Supervision, Writing—original draft
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4528-8357


National Institutes of Health (GM055763)

  • David T. Auble

European Commission (ERC Advanced Grant ATMMACHINE)

  • Karl-Peter Hopfner

Deutsche Forschungsgemeinschaft (Gottfried Wilhelm Leibniz-Prize)

  • Karl-Peter Hopfner

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank the Max-Planck Crystallization Facility (Martinsried) for crystallization trials and the European Synchrotron Radiation Facility (Grenoble) and the Deutsches Elektronen-Synchrotron (PETRA III, Hamburg) for beamtime and excellent support. AB acknowledges support from the Integrated Analysis of Macromolecular Complexes and Hybrid Methods in Genome Biology (DFG GRK1721) training program.

Senior Editor

  1. John Kuriyan, University of California, Berkeley, United States

Reviewing Editor

  1. Geeta J Narlikar, University of California, San Francisco, United States

Publication history

  1. Received: May 1, 2018
  2. Accepted: October 4, 2018
  3. Accepted Manuscript published: October 5, 2018 (version 1)
  4. Version of Record published: October 15, 2018 (version 2)
  5. Version of Record updated: October 24, 2018 (version 3)


© 2018, Butryn et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,424
    Page views
  • 240
  • 2

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Structural Biology and Molecular Biophysics
    Lukas M Langer et al.
    Research Advance

    The PI3K-related kinase (PIKK) SMG1 monitors progression of metazoan nonsense-mediated mRNA decay (NMD) by phosphorylating the RNA helicase UPF1. Previous work has shown that the activity of SMG1 is impaired by small molecule inhibitors, is reduced by the SMG1 interactors SMG8 and SMG9, and is downregulated by the so-called SMG1 insertion domain. However, the molecular basis for this complex regulatory network has remained elusive. Here, we present cryo-electron microscopy reconstructions of human SMG1-9 and SMG1-8-9 complexes bound to either a SMG1 inhibitor or a non-hydrolyzable ATP analogue at overall resolutions ranging from 2.8 to 3.6 Å. These structures reveal the basis with which a small molecule inhibitor preferentially targets SMG1 over other PIKKs. By comparison with our previously reported substrate-bound structure (Langer et al. 2020), we show that the SMG1 insertion domain can exert an autoinhibitory function by directly blocking the substrate binding path as well as overall access to the SMG1 kinase active site. Together with biochemical analysis, our data indicate that SMG1 autoinhibition is stabilized by the presence of SMG8. Our results explain the specific inhibition of SMG1 by an ATP-competitive small molecule, provide insights into regulation of its kinase activity within the NMD pathway, and expand the understanding of PIKK regulatory mechanisms in general.

    1. Physics of Living Systems
    2. Structural Biology and Molecular Biophysics
    Valentin Dunsing et al.
    Tools and Resources Updated

    Signaling pathways in biological systems rely on specific interactions between multiple biomolecules. Fluorescence fluctuation spectroscopy provides a powerful toolbox to quantify such interactions directly in living cells. Cross-correlation analysis of spectrally separated fluctuations provides information about intermolecular interactions but is usually limited to two fluorophore species. Here, we present scanning fluorescence spectral correlation spectroscopy (SFSCS), a versatile approach that can be implemented on commercial confocal microscopes, allowing the investigation of interactions between multiple protein species at the plasma membrane. We demonstrate that SFSCS enables cross-talk-free cross-correlation, diffusion, and oligomerization analysis of up to four protein species labeled with strongly overlapping fluorophores. As an example, we investigate the interactions of influenza A virus (IAV) matrix protein 2 with two cellular host factors simultaneously. We furthermore apply raster spectral image correlation spectroscopy for the simultaneous analysis of up to four species and determine the stoichiometry of ternary IAV polymerase complexes in the cell nucleus.