The glycosphingolipid MacCer promotes synaptic bouton formation in Drosophila by interacting with Wnt
Abstract
Lipids are structural components of cellular membranes and signaling molecules that are widely involved in development and diseases, but the underlying molecular mechanisms are poorly understood, partly because of the vast variety of lipid species and complexity of synthetic and turnover pathways. From a genetic screen, we identify that mannosyl glucosylceramide (MacCer), a species of glycosphingolipid (GSL), promotes synaptic bouton formation at the Drosophila neuromuscular junction (NMJ). Pharmacological and genetic analysis shows that the NMJ growth-promoting effect of MacCer depends on normal lipid rafts, which are known to be composed of sphingolipids, sterols and select proteins. MacCer positively regulates the synaptic level of Wnt1/Wingless (Wg) and facilitates presynaptic Wg signaling, whose activity is raft-dependent. Furthermore, a functional GSL-binding motif in Wg exhibiting a high affinity for MacCer is required for normal NMJ growth. These findings reveal a novel mechanism whereby the GSL MacCer promotes synaptic bouton formation via Wg signaling.
https://doi.org/10.7554/eLife.38183.001Introduction
The glycosphingolipids (GSLs) are particularly abundant in the nervous system and are essential for brain development (Fantini and Yahi, 2015; Yu et al., 2009). Specific deletion of GSLs in mouse brain leads to severe neural defects or lethality (Jennemann et al., 2005). Nevertheless, the molecular and cellular functions of GSLs in development are poorly understood, partially due to the complexity of GSL metabolism and the variety of GSL structures in vertebrates. Because of the comparatively simple metabolic pathways and the power of genetic studies in invertebrates (Bellen and Yamamoto, 2015; Zhu and Han, 2014), a mechanistic understanding of the role of GSLs in development and function of the nervous system is beginning to be established (Dahlgaard et al., 2012; Huang et al., 2016; Kniazeva et al., 2015; Yonamine et al., 2011).
GSLs and sphingomyelins (SMs, another class of sphingolipids) assemble with sterol into detergent-resistant membrane microdomains known as lipid rafts, which are critical for signal transduction and membrane trafficking (Lingwood and Simons, 2010). In neural development, multiple processes such as neuronal proliferation, recognition, migration, and synapse formation are regulated by lipid rafts (Aureli et al., 2015). For instance, disruption of rafts by depletion of sphingolipid or sterol leads to enlargement and gradually loss of synapses in cultured hippocampal neurons (Hering et al., 2003). Many growth factors or their receptors are preferentially located within and functionally dependent on membrane rafts (Wang and Yu, 2013; Watanabe et al., 2009; Zhai et al., 2004). Specifically, GSLs interact with raft-associated signaling proteins, such as epidermal growth factor receptor (EGFR) and Notch, thereby facilitating signal transduction (Coskun et al., 2011; Hamel et al., 2010; Wang and Yu, 2013). Our previous study uncovered that the GSL mannosyl glucosylceramide (MacCer) promotes NMJ overgrowth (Huang et al., 2016). However, the mechanisms by which GSLs mediate in vivo neural development remain elusive.
Normal brain function depends on proper formation of synaptic connections. The Drosophila larval glutamatergic neuromuscular junction (NMJ) is an advantageous model for dissecting mechanisms underlying synaptic development (Bayat et al., 2011; Khuong et al., 2013; Khuong et al., 2010; Korkut and Budnik, 2009). To uncover potential functions of lipids at synapses, we used the Drosophila NMJ as a model synapse and performed a genetic screen targeting genes involved in lipid biosynthesis and turnover pathways. From this screen, we identified multiple genes involved in sphingolipid de novo synthesis affecting NMJ development. We further found that MacCer is both required and sufficient for promoting NMJ growth and bouton formation in presynaptic neurons. MacCer promotes NMJ growth in a raft-dependent manner. We revealed that MacCer positively regulates synaptic Wg level and the presynaptic activity of Wg signaling. Further multiple independent assays showed MacCer physically interacts with Wg via a previously unidentified GSL-binding motif in Wg. Mutations in this motif disrupt the MacCer-Wg binding and normal NMJ growth. These findings demonstrate that the GSL MacCer plays a crucial role in bouton formation and NMJ growth and uncover a novel regulatory mechanism of Wg signaling pathway by MacCer.
Results
Mutations in de novo sphingolipid synthetic enzymes affect NMJ growth
To gain novel insights into the role of lipids in regulating synaptic development, we carried out a genetic screen targeting genes involved in the biosynthesis and turnover of fatty acids, glycerophospholipids, and sphingolipids. We tested over 60 candidate genes by examining NMJ morphology (Supplementary file 1) and identified two enzymes, serine palmitoyltransferase 2 Lace and ceramide synthase Schlank, promoting NMJ bouton formation as mutations in either of the two proteins led to fewer and larger boutons (Figure 1B–F,H,I,K). Mutations in lace and schlank disrupt the de novo synthesis of ceramides, the central intermediate in sphingolipid synthesis/metabolism (Figure 1A; Adachi-Yamada et al., 1999; Bauer et al., 2009; Fyrst et al., 2004). These data indicate that depletion in de novo synthesis of ceramides inhibits bouton formation. In addition to the de novo ceramide synthesis, the ceramide precursor sphingosines can be phosphorylated by sphingosine kinase 2 (Sk2) to produce phosphorylated sphingosines (Figure 1A). In Sk2 mutants, the level of phosphorylated sphingosines is reduced, while sphingosines accumulate (Fyrst et al., 2004; Yonamine et al., 2011). We found that mutations in Sk2 resulted in more satellite boutons at NMJs (Figure 1G,J), in contrast to the fewer and larger bouton phenotype in lace and schlank mutants. These results indicate that the de novo synthesis of ceramides, their downstream derivatives, or both promote bouton formation and NMJ growth.
GSL and ceramide phosphoethanolamine (CerPE, the Drosophila analogue of SM) are major membrane sphingolipids modified from ceramides (Figure 1A). However, we did not study the effects of CerPE in NMJ growth because there are multiple genes encoding candidates of CerPE synthase in the Drosophila genome (Vacaru et al., 2013); Supplementary file 1).
GSL synthases Egh and Brn bi-directionally regulate NMJ growth presynaptically
In contrast to the complex CerPE synthesis, the first three steps of GSL synthetic pathway are catalyzed by single GSL synthases in Drosophila (Figure 2A; Chen et al., 2007; Schwientek et al., 2002; Wandall et al., 2003). Disruption of the first one glucosylceramide synthase (GlcT1) to block GSL biosynthesis by feeding larvae with a specific GlcT1 inhibitor D, L-threo-PDMP at 0.5 mg/ml (Delgado et al., 2006) resulted in fewer and larger boutons at NMJ synapses (Figure 2C,N), without affecting the developmental time and larval size (muscle 4 size was normal; Figure 2—figure supplement 1). GlcCer can be further converted into MacCer by Egghead (Egh) (Wandall et al., 2003). It has been previously shown that the enzymatic activity of Egh is reduced in egh62d18 and egh7 mutants (Wandall et al., 2005). Here we show that both homozygous egh62d18 and hetero-allelic egh62d18/egh7 mutants also displayed fewer and larger synaptic boutons (Figure 2,D,O and Figure 2—figure supplement 1; Huang et al., 2016). In contrast, neuronal (presynaptic) overexpression of Egh driven by the pan-neuronal nSyb-Gal4 or motor neuronal specific OK6-Gal4 led to synaptic overgrowth with more and smaller boutons (Figure 2, D–H and O and Figure 2—figure supplement 1 ), indicating that Egh promotes bouton formation. However, expression of egh in muscles (postsynaptic) driven by C57-Gal4 or in glia driven by Repo-Gal4 did not affect NMJ growth in both wild type and egh62d18 mutant background (Figure 2—figure supplement 2). The cell-type specific manipulations of egh expression support that Egh promotes NMJ bouton formation in presynaptic motoneurons. Heterozygous mutation of egh significantly suppressed NMJ overgrowth in larvae neuronal overexpressing Egh, and homozygous mutation of egh in Egh-overexpressing background fully suppressed bouton number but not bouton size to the control level (Figure 2O), indicating that neuronal expression of egh promotes NMJ growth in a dose-dependent manner.
Brainiac (Brn) converts MacCer to GlcNAc-MacCer (Figure 2A; Schwientek et al., 2002). Hypomorphic brnfs.107 and brn1.6P6 mutants display MacCer accumulation in egg chambers (Pizette et al., 2009; Wandall et al., 2005). We observed more boutons and satellite boutons in homozygous brnfs.107 and trans-allelic brn1.6P6/brnfs.107 mutants; neuronal knockdown of brn by an RNAi under the control of nSyb-Gal4 or OK6-Gal4 also resulted in NMJ overgrowth. Conversely, neuronal overexpression of Brn driven by nSyb-Gal4 or OK6-Gal4 led to fewer and larger boutons (Figure 2, I–M and P; Huang et al., 2016), recapitulating the phenotype of egh mutants. Furthermore, overexpression and knockdown of brn in muscles by C57-Gal4 or in glia by Repo-Gal4 did not affect NMJ growth (Figure 2—figure supplement 2). The cell type specific rescue and RNAi knockdown results demonstrate that both Egh and Brn act presynaptically. The opposite effect of Egh and Brn in regulating bouton number suggests that the GSL MacCer promotes NMJ growth.
-
Figure 2—source data 1
- https://doi.org/10.7554/eLife.38183.006
GSL MacCer promotes NMJ growth
To verify if MacCer indeed promotes NMJ growth, we performed immunostaining and found that endogenous MacCer, detected by a specific anti-MacCer antibody (Wandall et al., 2003), was enriched at presynaptic NMJ boutons in a punctate pattern (Figure 3A). Compared to wild type, MacCer intensity at NMJs was reduced in egh mutant and brn-overexpressing larvae; conversely, MacCer intensity was increased at NMJs of brn mutant, brn RNAi knockdown, and egh-overexpressing larvae (Figure 3, B–H), demonstrating the specificity of the anti-MacCer. These findings are consistent with previous reports showing that MacCer is decreased in egh mutants but increased in brn mutants by high performance thin layer chromatography (Hamel et al., 2010; Wandall et al., 2005), which we confirmed (Figure 8—figure supplement 1). Based on the fact that the presynaptic MacCer levels positively correlate with synaptic bouton number, we conclude that the GSL MacCer promotes NMJ growth presynaptically.
-
Figure 3—source data 1
- https://doi.org/10.7554/eLife.38183.009
To characterize the synaptic structure in MacCer-deficient NMJs, we examined a few molecules that play important roles in synaptic growth and function, including the cell adhesion molecule Fasciclin II (Fas II) and SNARE protein Syntaxin 1A (Syx1A) (Schulze et al., 1995; Schuster et al., 1996). The synaptic levels of Fas II and Syx1A were not visibly affected in egh mutant and brn-overexpressing NMJs (Figure 3—figure supplement 1).
MacCer promotes NMJ bouton formation in a lipid raft-dependent manner
GSLs are constituents of lipid rafts that are detergent-resistant membrane microdomains composed of sphingolipids, sterols and proteins. Like other GSLs, Drosophila MacCer is enriched in detergent-insoluble membrane microdomains (Rietveld et al., 1999). Consistently, MacCer substantially overlaps with Syx1A, a lipid raft-localized protein in human and Drosophila cells (Chamberlain et al., 2001; Zhai et al., 2004), at NMJs (Figure 4A). Our results also show that mutations in lace and schlank result in fewer boutons at NMJs (Figure 1), probably due to a disruption of lipid rafts by depleting total sphingolipids. Thus, we asked if synaptic development requires the formation of lipid rafts. The assembly of lipid rafts is sterol-dependent (Lingwood and Simons, 2010); sterol depletion by methyl-β-cyclodextrin (MβCD), a cyclic oligosaccharide that absorbs sterols from the membrane, efficiently disrupts raft assembly in mammalian cells and Drosophila cells (Sharma et al., 2004; van Zanten et al., 2009; Zhai et al., 2004). Drosophila does not synthesize but takes sterols from food (Carvalho et al., 2010). Thus we used drug treatment rather than genetic means to deplete sterols. Feeding wild-type larvae with MβCD at concentrations higher than 25 mM led to early larval lethality, while MβCD treatment at 20 mM led to a mild developmental delay but normal larval and muscle size (Figure 4—figure supplement 1). MβCD treatment significantly reduced the co-localization of MacCer and Syx1A (Figure 4, B and C). We also treated larvae with another sterol binding drug filipin at 50 μg/ml, which did not affect larval developmental time but led to a mild but significant decrease in muscle size (Figure 4—figure supplement 1). Treatments with both drugs resulted in obviously fewer and larger boutons at NMJs, recapitulating the NMJ phenotype of sphingolipid- and MacCer-deficient larvae (Figure 4, D–G and Figure 4—figure supplement 1). These results suggest that a proper level of sterols is required for bouton formation.
-
Figure 4—source data 1
- https://doi.org/10.7554/eLife.38183.012
Depleting sterol with MβCD in egh-overexpressing background fully restrict the NMJ overgrowth to the level of the wild-type larvae treated with MβCD. Moreover, MβCD treatments in sphingolipid-deficient lacek05305/Df mutants and MacCer-deficient larvae (egh62d18 and nSyb-Gal4/UAS-brn) did not exacerbate the NMJ phenotype (Figure 4G, and Figure 4—figure supplement 1), suggesting that sterol may modulate NMJ growth in a common genetic pathway with sphingolipids and MacCer. We then determined if MβCD treatment suppresses NMJ growth via directly reducing the MacCer level. We found that MβCD completely suppressed the NMJ overgrowth without detectably reducing the synaptic MacCer level in wild-type and Egh-overexpressing larvae; similarly, Filipin treatment did not affect the synaptic level of MacCer (Figure 4, H–N).These data suggest that restriction of synaptic growth by MβCD may be due to defects of MacCer function by disrupting raft assembly rather than a reduction in the synaptic level of MacCer per se. This finding is consistent with a previous report that disrupting the formation of membrane rafts may compromise the function of raft-associated factors but not necessarily affecting their levels; more specifically, the localization of a raft protein LFA-1 was unaltered examined by confocal microscopy at subcellular level but altered by single-molecule near-field optical microscopy at molecular level upon raft disruption (van Zanten et al., 2009). Together, these data suggest that the NMJ growth-promoting effect of MacCer depends on normal lipid rafts.
MacCer promotes NMJ bouton formation via Wg signaling
NMJ development is controlled in part by growth factors and pathways (Bayat et al., 2011; Harris and Littleton, 2015; Korkut and Budnik, 2009). Bone morphogenic protein (BMP) is an important growth promoting signaling in NMJs (Bayat et al., 2011). However, we found that the NMJ growth-promoting effect of MacCer is not mediated through the BMP signaling pathway (Huang et al., 2016). Wnt1/Wingless (Wg) activates another signaling pathway promoting NMJ growth (Korkut and Budnik, 2009). Because Wg is a lipid raft-associated protein (Zhai et al., 2004), we further investigated if Wg signaling play roles in MacCer-mediated NMJ growth. Previous reports showed that loss-of-function mutations of Wg signaling components, including the ligand Wg, the receptor dFrizzled2 (Fz2), the co-receptor Arrow (Arr), and the Wg-binding protein Evenness Interrupted/Wntless (Evi/Wls), decrease synaptic bouton number, while overexpression of Wg in motor neurons results in synaptic overgrowth (Korkut et al., 2009; Miech et al., 2008; Packard et al., 2002). In addition, the proper secretion, binding with the receptor Frizzled, and activation of Wg requires lipidation at the conserved serine at amino acid 239 (Janda et al., 2012; Takada et al., 2006). Specifically, the synaptic level of Wg and the downstream signaling are positively regulated by the acyltransferase Porcupine (Packard et al., 2002), which activates the lipidation and raft-association of Wg (Zhai et al., 2004). We hypothesized that the NMJ growth-promoting effect of Wg depends on its association with membrane rafts. Indeed, raft disruption by MβCD treatment which depletes sterol significantly reduced Wg staining intensity at NMJs and constrained NMJ overgrowth in Wg-overexpressing larvae (Figure 5—figure supplement 1), suggesting that normal Wg signaling at NMJs requires intact lipid rafts.
Next, we determined whether Wg signaling cooperates with MacCer in promoting NMJ growth. Genetic analysis showed that loss of one copy of egh62d18 had no effect on NMJ morphology but fully suppressed the NMJ overgrowth phenotype of Wg-overexpressing larvae. Homozygous mutation of egh or overexpression of brn on a Wg-overexpressing background led to a decrease in bouton number, recapitulating the phenotype of egh mutants and brn-overexpressing larvae (Figure 5, A–E, K and Figure 5—figure supplement 1). These results together indicate that the NMJ growth-promoting effect of Wg signaling depends on the proper level of MacCer. Conversely, mutation in wg1/wgCX4 restricted NMJ overgrowth in Egh-overexpressing larvae to the wg mutant level (Figure 5, G–I and K). In addition, although bouton number was normal in wg1 and egh62d18 single heterozygotes (wg1/+and egh62d18/+), there were fewer and larger boutons in egh62d18/+; wg1/+ transheterozygotes. Similarly reduced bouton numbers were observed in egh62d18/+; arrk08131/+and egh62d18/+; evi2/+ transheterozygotes (Figure 5, J, K and Figure 5—figure supplement 1), suggesting that Egh and Wg signaling act in the same genetic pathway. Together, these results demonstrate that MacCer works synergistically with Wg signaling in promoting NMJ growth and bouton formation.
-
Figure 5—source data 1
- https://doi.org/10.7554/eLife.38183.016
MacCer facilitates local presynaptic Wg signaling at NMJs
To reveal the molecular mechanism by which MacCer promotes NMJ growth via Wg signaling, we first examined if there was colocalization between MacCer and Wg. Indeed, a substantial overlap between MacCer and Wg immunoreactivity was observed in NMJ boutons (Figure 6A and E). It is known that Wg secretion from presynaptic terminals requires the recycling endosomal small GTPase Rab11 (Koles et al., 2012; Korkut et al., 2009). It is also known that recycling endosomes are enriched with components of lipid rafts including Lactosylceramide (LacCer), the vertebrate analog of MacCer (Balasubramanian et al., 2007; Gagescu et al., 2000; Hortsch et al., 2010). Consistently, we found strong colocalization of MacCer with Rab11 at NMJ terminals (Figure 6, C and E). In contrast, MacCer puncta did not overlap with the early endosomal marker Rab5-YFP or the late endosome protein Spinster-GFP (Spin-GFP). Although GSLs are synthesized in the Golgi apparatus, there were few overlaps between MacCer and the Golgi marker Mannose II-GFP (Figure 5—figure supplement 1).
-
Figure 6—source data 1
- https://doi.org/10.7554/eLife.38183.022
The specific colocalization of MacCer with Wg and Rab11 suggests that the trafficking or distribution of Wg at NMJ synapses may be altered upon MacCer reduction. Indeed, the staining intensity of endogenous Wg was significantly decreased in egh62d18 mutant boutons and brn-overexpressing NMJs; Conversely, Wg intensity was increased in egh-overexpressing and brn-RNAi knockdown boutons (Figure 6B, F–I and Figure 6—figure supplement 2). Thus, MacCer is both required and sufficient for Wg level at NMJ synapses. Though the total protein level of Wg in egh mutant brains appeared normal by Western assay, we found an increase of Wg in the central neuropil but not in peripheral axons within segmental nerves of egh mutants (Figure 6—figure supplement 3), suggesting a defect in axonal transport of Wg. In contrast to reduced synaptic Wg, the staining intensities of Rab11 and the Wg receptor Fz2 were largely normal in egh NMJs (Figure 6D and Figure 6—figure supplement 4). Conversely, MacCer staining was normal in wg or rab11 mutants (Figure 6—figure supplement 4). These results together show that MacCer positively regulates Wg level, but not vice versa, at NMJs.
Wg coordinates pre- and postsynaptic signaling cascades that modulate synapse development. The presynaptic Wg signaling pathway promotes formation of Futsch-associated microtubule loops without transcriptional regulation (Korkut and Budnik, 2009; Miech et al., 2008). Futsch is a microtubule-associated protein, and the formation of Futsch-positive microtubule loops is essential for synaptic growth (Roos et al., 2000). In wg and arr mutants with impaired Wg signaling, the number of Futsch loops is reduced while the percentage of boutons containing unbundled Futsch is increased (Miech et al., 2008; Packard et al., 2002). We observed similar Futsch staining phenotype in brn-overexpression larvae, egh62d18 mutants and egh62d18/+; wg1/+ transheterozygotes, i.e., a significant increase in the percentage of boutons containing unbundled and punctate Futsch signals, especially in large boutons (Figure 6, J–M and Figure 6—figure supplement 2), indicating that MacCer and Wg cooperate in controlling the formation of Futsch loops. Together, these results support that MacCer facilitates presynaptic Wg signaling during NMJ development.
MacCer is not required for postsynaptic differentiation
Distinct from the presynaptic Wg pathway, Wg regulates postsynaptic differentiation and bouton formation by activating the Fz2 nuclear import pathway in postsynaptic muscles (Ataman et al., 2006; Mathew et al., 2005; Mosca and Schwarz, 2010); defects in this pathway lead to a reduced number of boutons, altered distribution of the postsynaptic type A glutamate receptor (GluRIIA), a decrease of subsynaptic reticulum (SSR) with increase of ‘ghost bouton’ that lacks of Discs large (DLG) postsynaptic staining, and enlarged pockets in SSR juxtaposed to active zones (Mosca and Schwarz, 2010; Packard et al., 2002). However, we did not find these abnormalities in egh62d18 mutants except that the GluRIIA intensity was significantly but slightly increased (Figure 7, A, B and E); rather, the ghost bouton number, the GluRIIA cluster size, as well as the SSR ultrastructure were largely normal (Figure 7, C–I), suggesting that the postsynaptic Wg signaling remains unaffected upon MacCer reduction.
-
Figure 7—source data 1
- https://doi.org/10.7554/eLife.38183.024
Wg contains a functional MacCer-binding domain
The results shown above suggest that MacCer may interact with Wg and thus modulate its signaling activity. Previous in vitro studies show that GSLs are able to specifically bind proteins containing a structurally conserved GSL-binding motif (GBM), which contains both basic (Lys, Arg) and turn-inducing (Gly, Ser) residues (Fantini and Yahi, 2015; Hamel et al., 2010). By in silico analysis, we identified a potential GBM of Wg between amino acid residues 233 and 247, therein Lys and Met are required for the interaction with MacCer (Figure 8A). Interestingly, this region contains a palmitoylation site at Ser-239 by a palmitoleate (C16:1; Figure 8A and C) (Herr and Basler, 2012; Kakugawa et al., 2015; Takada et al., 2006), which is known to affect the association of membrane proteins to lipid rafts (Resh, 2004). Structure homology modeling and a series of molecular dynamics simulations showed that this acylated GBM is fully exposed on the protein surface and perfectly fit with MacCer. A remarkable feature of the molecular complex is that the ceramide part of MacCer interacts with the acyl chain of the GBM, whereas the sugars of MacCer bind the peptidic part of the GBM (Figure 8B and C).
We then analyzed the interaction of a synthetic peptide derived from the predicted GBM of Wg with monolayers of purified GSLs by Langmuir microtensiometer experiments (Di Scala et al., 2014). The amino acid sequence of the peptide contains four Cys residues with several possibilities of forming two disulfide bridges may not fully stable under our experimental conditions. Thus we designed a synthetic peptide in which the Cys residues were replaced by isosteric Ser residues (referred to as Wg233-247). This Cys/Ser substitution respects the electrostatic distribution of partial charges at the surface of the peptide. The Wg233-247 peptide showed high affinity with LacCer (Figure 8—figure supplement 1).
We further analyzed the interaction of Wg233-247 with GSLs extracted from Drosophila larvae of different genotypes. In agreement with previous findings (Hamel et al., 2010; Wandall et al., 2005), wild-type larvae expressed a broad range of GSLs including tetra- and penta-hexosylceramides, while egh62d18 mutants lacked MacCer and brn1.6P6 mutants contained almost exclusively MacCer (Figure 8—figure supplement 1). As expected, Wg233-247 showed strong interaction with MacCer-enriched GSLs from brn mutants but no interaction with MacCer-deficient GSLs from egh mutants (Figure 8D). In contrast, a GBM mutant containing mutations at key Lys and Met (K234E and M238R; Figure 8A) showed no interaction to GSLs from brn mutants (Figure 8—figure supplement 1). Moreover, we examined whether full-length Wg binds to MacCer-enriched GSLs. Myc-tagged full-length Wg was produced by an in vitro translation kit containing rabbit reticulocyte lysates and purified by anti-Myc immunoprecipitation. Wild-typed Wg showed high affinity to GSLs from brn but not egh mutants; in contrast, Wg with GBM deleted or mutated showed no affinity to GSLs from brn mutants (Figure 8E and F).
We further validated the GSL binding ability of Wg by pull-down assay. Wild-type Myc-Wg but not Wg with mutated GBM was substantially pulled down by LacCer-coated beads (Figure 8G). Taken together, these data support that Wg has an intrinsic affinity for MacCer/LacCer via GBM.
Wg GBM is critical for its colocalization with MacCer and normal NMJ growth
To further test the physiological role of the Wg GBM, we generated double site-directed point mutations of K234E and M238R in Wg (Figure 8A) by CRISPR/Cas9-mediated mutagenesis. This double point-mutation wg allele was named wgGBM. Homozygous wgGBM or in combination with a null allele wgCX4 (wgGBM/wgCX4) led to larval lethality before 3rd instar stage. However, wgGBM in combination with a hypomorphic allele wg1 (wg1/wgGBM) resulted in escapers survived to adults. The Wg protein level in wg1/wgGBM mutants was largely normal in whole larvae by western analysis and at NMJs by immunostaining compared with wg1 heterozygotes (wg1/+) (Figure 9, A–D). MacCer level was not altered in wg1/wgGBM mutants compared with that of wg1/+ heterozygous control (Figure 9, A–C). However, the colocalization between Wg and MacCer was significantly decreased in wg1/wgGBM mutants compared with that of wg1/+ heterozygous and wild-type control (Figure 9, E–H), suggesting that wgGBM mutation, presumably a null allele, affect proper localization of Wg in synaptic boutons.
-
Figure 9—source data 1
- https://doi.org/10.7554/eLife.38183.028
To determine if Wg GBM interacts with MacCer in regulating Wg signaling and bouton formation, we examined the genetic interaction between wgGBM and egh mutation. We found that wgGBM/wg1 mutants and egh62d18/+; wgGBM/+ transheterozygotes showed fewer and larger boutons, and the phenotype in wgGBM/wg1 mutants was rescued by neuronal expression of Wg but not by expression of Egh (Figure 9I–N). The NMJ phenotype of wgGBM/wg1 was insensitive to egh overexpression (Figure 9L and N), supporting that wg is epistatic to egh. We also observed significantly fewer boutons with Futsch loops and more boutons with unbundled Futsch staining in both wgGBM/wg1 mutants and egh62d18/+; wgGBM/+ transheterozygotes (Figure 9O-R). Together, these findings suggest that the intact Wg GBM is critical for proper Wg localization, Wg signaling and thus bouton formation.
Discussion
In the present study, based on genetic analysis of cell-type specific manipulations of Egh, Brn and Wg expression, together with immunochemical, genetic interaction and lipid-protein interaction analysis, we demonstrate that MacCer promotes NMJ bouton formation by interacting with Wg, thereby facilitating presynaptic Wg signaling. This is the first report defining a critical role of a specific class of sphingolipids in synapse development.
A crucial role for sphingolipids in NMJ synapse development
Sphingolipids are essential components of lipid rafts which regulate multiple signaling pathways and neural functions. The present study provides compelling evidence implicating sphingolipids in regulating NMJ growth (Figure 1 and Figure 2; Supplementary file 1). Previous studies revealed that various mutations in either egh or brn result in similar ovarian defects and neuronal hypertrophy during embryogenesis (Goode et al., 1996). The similarity of egh and brn mutant phenotypes suggests that both are caused by a lack of complex GSLs downstream of brn. A more recent study showed that egh mutations result in overgrowth of subperineurial glia through elevated phosphatidylinositol-3 kinase (PI3K) signaling; the glial phenotype is due to the accumulation of GlcCer, the substrate of Egh (Dahlgaard et al., 2012). At NMJs, however, our data demonstrate that the NMJ defects in egh mutants are caused by lack of MacCer.
Do other classes of sphingolipids besides MacCer also regulate synapse development? Many sphingolipids, such as phosphorylated sphingosines and CerPE, the most abundant sphingolipid in lipid rafts, play a diverse array of functions in the nervous system (Fantini and Yahi, 2015; Yonamine et al., 2011). It will be intriguing to define the molecular mechanisms by which these structural and signaling sphingolipids regulate synapse development.
MacCer promotes synaptic growth via presynaptic Wg signaling
Drosophila NMJ development is mediated by multiple signaling cascades. How does MacCer function in synaptic growth? Consistent with previous findings that GSL/lipid rafts are enriched in recycling endosomes (Balasubramanian et al., 2007; Gagescu et al., 2000; Hortsch et al., 2010), we observed a substantial colocalization between MacCer and recycling endosomal marker Rab11 at NMJ synapses (Figure 6). We note, however, the impact of MacCer and Rab11 on NMJ growth is opposite. The NMJ bouton formation is positively regulated by MacCer but negatively regulated by Rab11 (Huang et al., 2016; Khodosh et al., 2006; Liu et al., 2014; this study). The opposite effect on NMJ growth of the two might be caused by the fact that MacCer and Rab11 regulate different signaling pathways. For example, Rab11 inhibits BMP signaling (Huang et al., 2016; Liu et al., 2014) while MacCer facilitates Wg signaling (this study) at NMJ terminals.
Our results showed that MacCer facilitates the presynaptic Wg signaling in promoting NMJ growth (Figure 5). In contrast to the abnormal microtubule cytoskeleton (Figure 6), egh mutants showed normal postsynaptic differentiation with no increase in ghost bouton number as well as normal SSR ultrastructure (Figure 7), suggesting a specific regulation of presynaptic rather than postsynaptic Wg activity by MacCer. A recent study showed that at NMJs, Wg is secreted from glial cells as well as presynaptic motor neurons, and that this glia-derived Wg controls the assembly of postsynaptic machinery at NMJs without affecting the bouton number (Kerr et al., 2014). The normal postsynaptic differentiation in egh mutants may be due to normal postsynaptic Wg signaling triggered by glia-derived Wg. This postulation is supported by the observation that manipulations of glial MacCer by genetic means did not affect NMJ growth (Figure 2—figure supplement 2).
How does MacCer affect Wg signaling at the molecular and cellular levels? Wg associates with lipid rafts via its acylation (Zhai et al., 2004), enabling its access to the raft-component MacCer. Upon lipid raft disruption by sterol depletion, Wg de-localizes from the lipid rafts (detergent-resistant, cholesterol-rich membrane microdomains) revealed by biochemical fractionation (Zhai et al., 2004). We envisage that delocalization of Wg does not allow its binding to MacCer, compromises its transport to the NMJ terminals (Figure 5—figure supplement 1), and in turn restricts NMJ growth (Figure 4). This notion is supported by colocalization of MacCer and Wg on specific membrane domains of presynaptic organelles (Figure 6) and direct MacCer-Wg binding (Figure 8). As MacCer is both required and sufficient for normal Wg expression at NMJ boutons, but not vice versa (Figures 6 and 9), we propose that MacCer acts as an adaptor for Wg at the presynaptic recycling endosomes (Figure 9). Our in silico data combined with biochemical and genetic analysis of GSL-Wg interaction further showed that the 233 – 247 domain of Wg, which is acylated at Ser-239, is a functional GBM that mediates high affinity binding to MacCer. Although we could not exclude the possibility that Wg GBM might have other function independent of MacCer binding, our in vivo data support that the GBM plays important roles in Wg-MacCer colocalization, Wg signaling and NMJ development (Figure 9).
The association of Wg with membrane rafts requires the acylation at Ser-239 mediated by Porcupine, a process conserved from Drosophila to vertebrates (Galli et al., 2007; Herr and Basler, 2012; Zhai et al., 2004). Importantly, the acylation by Porcupine is essential for the recognition of Wg by Evi thereby affecting the transport and secretion of Wg through recycling endosomes and exosomes (Herr and Basler, 2012; Koles et al., 2012; Korkut et al., 2009). Furthermore, both Porcupine and Evi are known to regulate the synaptic level of Wg and the signaling activity (Korkut et al., 2009; Packard et al., 2002). In the present study, we showed a reduction in Wg level at NMJ terminals but an increase in the neuropil of the ventral nerve cord of egh mutants (Figure 6 and Figure 6—figure supplement 2), similar to that in evi mutants with impaired Wg transport and secretion (Korkut et al., 2009). These findings suggest that the transport and trafficking of Wg via endosomes may be compromised when MacCer is deficient. The detailed mechanism by which MacCer regulates Wg transport and trafficking remains to be further investigated. As Wnt signaling, which is widely involved in various developmental processes and diseases including neurological and psychological diseases, is evolutionally conserved (Herr et al., 2012; Korkut and Budnik, 2009; Salinas, 2012), our finding that MacCer facilitates Wg signaling transduction suggests a new target for intervening Wnt signaling associated pathogenesis.
Materials and methods
Drosophila strains and genetics
Request a detailed protocolFlies were cultured on standard cornmeal media at 25°C. w1118 was used as the wild type control, unless otherwise indicated. egh62d18, brn1.6P6, UAS-Egh-Myc (Wandall et al., 2005) and UAS-Brn (Chen et al., 2007) were provided by S. M. Cohen and S. Pizette. evi2 was from V. Budnik (Korkut et al., 2009). UAS-ManII-GFP was from Y. N. Jan (Ye et al., 2007). UAS-Spin-GFP was from G. Davis (Sweeney and Davis, 2002). The following fly lines were obtained from the Bloomington Stock Center: Df(2L)Exel7063, Df(3L)BSC671, Sk2KG05894, lace2, lacek05305, schlankG0489, schlankG0061, egh7, brnfs107, arr2, arrk08131, wgCX4 (wg[l-17]), wg1, rab1193Bi, nSyb-Gal4, OK6-Gal4, C57-Gal4, Repo-Gal4, UAS-Wg-HA, UAS-brn-RNAi, UAS-YFP-Rab5 and act-Cas9. For fly strains used in the genetic screen, UAS-GalNAc-TA and UAS-GalNAc-TB were provided by S. M. Cohen (Chen et al., 2007). desat110A, desat111A, desat1119A and desat1EY07679 were provided by E. Hafen (Köhler et al., 2009). Other fly lines were obtained from the Bloomington Stock Center, Kyoto Stock Center and the Tsinghua Drosophila RNAi Center.
Site-directed mutation in wg
Request a detailed protocolWe generated double site-directed point mutations at K234E and M238R in Wg to test the function of GBM. The CRISPR/Cas9-mediated targeted mutagenesis of wg (CG4889) from w1118 was performed largely according to previously published homology-directed repair procedures (Gratz et al., 2014; Port et al., 2014) at Fungene Biotech (http://www.fgbiotech.com). sgRNA (synthetic guide RNA) targets were designed with CRISPR Optimal Target Finder (Gratz et al., 2014). Two sgRNAs recognized the region containing the mutations (gcgacaggagtgcaaatgccatgg and gcaaatgccatggcatgtccgg; the last three bases ngg denotes proto-spacer adjacent motif) were cloned into U6b-sgRNA vector (Ren et al., 2013). For donor vector construction, a 1.8 kb wg gene region containing the site-directed mutation was cloned into pBluescript SK (-) vector. The donor vector with the site-directed mutation and the sgRNA vector were injected into act-Cas9 transgenic embryos. PCR sequencing was performed to identify if the offspring flies carried the designed mutation.
Immunochemical analysis
Request a detailed protocolImmunostaining of larval preparations was performed as previously described (Liu et al., 2014). For most antibody staining, specimens were dissected in Ca2+-free HL3 saline, fixed in 4% paraformaldehyde for 30 min, and washed in 0.2% Triton X-100 in PBS. For MacCer staining, specimens were fixed in 4% paraformaldehyde at 4°C for 60 min and permeabilized with 0.1% Triton X-100 in cold PBS, incubated with undiluted anti-MacCer hybridoma supernatants for 18 hr at 4°C and detected with Fluor 568 conjugated goat anti-mouse IgM (1:1000; Invitrogen). For GluRIIA staining, specimens were fixed in cold methanol for 5 min. We used the following antibodies: mouse anti-cysteine string protein (CSP) (1:300; 6D6 from DSHB), mouse anti-Wg (1:10; 4D4 from DSHB), mouse anti-Futsch (1:50; 22C10 from DSHB), mouse anti-Rab11 (1:50; BD Biosciences), mouse anti-DLG (1:500; 4F3 from DSHB), mouse anti-GluRIIA (1:200; 8B4D2 from DSHB), mouse anti-Fas II (1:50; 1D4 from DSHB), mouse anti-Syx1A (1:20; 8C3 from DSHB), mouse anti-dFz2 (1:5; 12A7 from DSHB), mouse anti-HA (1:1000; MBL International), mouse anti-Myc (1:300; CWBIO, MBL International), rat anti-GFP (1:200; MBL International), and fluorescence-conjugated anti-horseradish peroxidase (HRP) (1:200; Jackson ImmunoResearch). Primary antibodies were visualized using corresponding secondary antibodies conjugated to Fluor 488, Cy3 (both at 1:1000; Invitrogen) or DyLight 649 (1:500; Jackson ImmunoResearch).
Western analysis was performed as previously described (Liu et al., 2014). Briefly, 3rd instar larval brains were dissected in cold PBS and homogenized in RIPA buffer (50 mM Tris-HCl at pH 7.4, 150 mM NaCl, 0.1% SDS, 1% NP-40) with proteinase inhibitors Set I (Calbiochemistry) on ice. Samples were then subjected to SDS-PAGE and immunoblotting according to standard procedures. The following antibodies were used: mouse anti-Wg (1:50; 4D4 from DSHB), mouse anti-Syx1A (1:1000; 8C3 from DSHB), and mouse anti-actin (1:50000; Millipore Bioscience Research Reagents). All Western blotting were performed at least for three independent biological replicates.
Image collecting and statistical analysis
Request a detailed protocolImage collecting was carried out as previously described (Liu et al., 2014). NMJ images were collected with an Olympus Fluoview FV1000 confocal microscope using a 40x/1.42 NA or 60 x/1.42 NA oil objective and FV10-ASW software, or with a Leica confocal microscope using a 40x/1.25 NA oil objective and LAS AF software. All images of muscle 4 or muscle 6/7 glutamatergic type Ib NMJ of abdominal segments A2 to A4 for a specific experiment were captured using identical settings for statistical comparison among different genotypes. High resolution confocal images were processed with the deconvolution software AutoQuant X2 (Media Cybernetics). Brightness, contrast, and color were adjusted using Photoshop CS5 (Adobe). NMJ morphological features were quantified using ImageJ (National Institutes of Health, Bethesda, MD).
For quantification analysis of NMJ growth, individual boutons were defined according to the discrete staining signal of anti-CSP. Satellite boutons were defined as extensions of five or fewer small boutons emanating from the main branch of the NMJ terminals. For quantification of bouton sizes, synaptic areas (μm2) were measured by assessing HRP-positive boutons, and normalized to bouton numbers. Ghost boutons were defined as boutons positive for HRP staining but negative for DLG staining. NMJ bouton number and size of schlank mutants were normalized to muscle surface area. For quantification of protein levels at NMJ, staining intensities of each protein were measured within HRP-positive NMJs using ImageJ. For colocalization analysis, single slices were analyzed using WCIF-ImageJ ‘Colocalization Analysis’ within HRP-labeled synaptic boutons. Statistical comparisons were performed using GraphPad Prism 6. Data of NMJ features are expressed as mean ± standard error of the mean (s.e.m.). Statistical significance between each genotype and the controls was determined by two tailed Student’s t test, whereas multiple comparisons between genotypes were determined by one-way ANOVA with a Tukey post hoc test. Asterisks above a column indicate comparisons of a specific genotype to wild type (denoted WT) or genetic control (denoted CT), whereas asterisks above a bracket denote comparisons between two specific genotypes. ns denotes p>0.05; * indicates p<0.05; ** denotes p<0.01; *** indicates p<0.001.
Drug treatment of larvae
Request a detailed protocolLarvae of different genotypes were raised on vehicle- or drug-containing media from egg hatching. D,L-threo-PDMP (Matreya) and filipin III (Cayman) were dissolved in DMSO and then individually added to standard media at specific concentrations. All the treatments used DMSO vehicle at a concentration of 0.5%. MβCD (Sigma-Aldrich) was resolved in standard media at a final concentration of 20 mM.
Molecular simulation
Request a detailed protocolDocking of Wg onto MacCer was performed with the Hyperchem 8.0 program as described previously (Fantini and Yahi, 2011). Homology modeling of Wg fragment of 85 – 277 amino acids was based on the published crystal structure of XWnt8 (Janda et al., 2012).
Lipid–protein interaction assay
Request a detailed protocolSynthetic peptides of GBM (95%) were purchased from Sangon Biotech. Myc-tagged full-length Wg were produced by an in vitro translation kit containing rabbit reticulocyte lysates (Promega). pCDNA-Myc-Wg was expressed in the translation system at 30°C for 90 min. Myc-Wg was immunoprecipitated with anti-Myc affinity resin (Millipore), eluted with a Myc-peptide solution (Sigma), and concentrated using a 30kD filter column (Amicon).
GSL–protein interactions were determined with the Langmuir-film balance technique as previously described (Di Scala et al., 2014). It was monitored by surface pressure with a fully automated microtensiometer (μTrough SX; Kibron Inc.). All experiments were performed at 20 ± 1°C. Monomolecular films of GSLs were spread on pure water subphases (800 μl) from chloroform/methanol (1:1 vol/vol). The initial surface pressure of the monolayers was 12–15 mN/m. The accuracy of our experimental conditions was ±0.25 mN/m. Real-time measurements kinetically followed the increase in the surface pressure after injecting the peptide or protein (final concentration of 10 μM) into the aqueous phase underneath the GSL monolayer until equilibrium was reached. The data were analyzed with the FilmWareX program (version 3.57; Kibron Inc.).
Lipid–protein pull-down assay was modified following a previous protocol (Kunisaki et al., 2006). Wild-type and mutated Myc-Wg were produced by an in vitro translation kit containing rabbit reticulocyte lysates (Promega). The reticulocyte lysates were suspended in 400 μL lipid-binding/washing buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 0.35% NP-40) and incubated with 20 μL slurry of control or LacCer-coated beads (Echelon) at 4°C for 3 hr under rotary agitation. After extensive washing with lipid-binding/washing buffer, the bound proteins were eluted from beads with 2 × Laemmli sample buffer and subjected to Western analysis with mouse anti-Myc (1:1000; CWBIO).
GSL extraction and analysis
Request a detailed protocolGSL extraction was performed as described (Hamel et al., 2010; Wandall et al., 2005). 3rd instar larvae were homogenized in 1.5 ml solvent A (2-isopropanol/hexane/water; 55:25:20 vol/vol/vol). The homogenate was centrifuged at 2,000 rpm and the supernatant was collected. This step was repeated with 1.5 ml solvent B (chloroform/methanol; 1:1 vol/vol), 1.5 ml solvent A, and finally 1.5 ml solvent B. The four solvent extracts were combined, evaporated under a nitrogen flux, and re-suspended in chloroform/methanol (2:1 vol/vol) at a lipid concentration of 1 mg/ml. The extracts were again evaporated, then re-suspended in 5 ml methanol containing 0.1 M NaOH, and incubated for 1 hr at 37°C under agitation to remove most glycerolipids. The samples were evaporated and re-extracted in chloroform/methanol (2:1 vol/vol). Neutral GSLs were finally purified on a column (DEAE-Sephadex A-25; Sigma-Aldrich) and eluted with chloroform/methanol/water (30:60:8 vol/vol/vol). GSL extracts were analyzed by high performance thin layer chromatography (HPTLC) using silica gel 60 HPTLC plates (Merck) in chloroform/methanol/water (60:35:8 vol/vol/vol). The HPTLC plates were sprayed with orcinol and heated at 110°C for GSL detection. GSLs bands were identified by their mobility relative to GSL standards (Matreya).
Electron microscopy
Request a detailed protocolElectron microscopy (EM) was performed as described (Liu et al., 2014). Briefly, dissected 3rd instar larvae were fixed overnight at 4°C in 2% glutaraldehyde plus 2% paraformaldehyde in 0.1 M cacodylate buffer (pH 7.4), and post-fixed in 1% OsO4 in cacodylate buffer for 90 min at room temperature. Samples were stained in saturated aqueous uranyl acetate for 1 hr, dehydrated in a graded acetone series and embedded in Spurr resin (Electron Microscopy Sciences). Type 1b boutons from NMJ 6/7 in abdominal segments A2 to A4 were serially sectioned with a Leica UC6 ultramicrotome, stained with uranyl acetate and Sato’s lead, and observed using a JEOL 1400 electron microscope. The number of synaptic vesicles within a 200 nm radius of the active zones (AZs) in egh mutants and wild type was quantified. Other features were quantified as previously described (Packard et al., 2002).
References
-
Lipid membrane domains in the brainBiochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 1851:1006–1016.https://doi.org/10.1016/j.bbalip.2015.02.001
-
Arf6 and microtubules in adhesion-dependent trafficking of lipid raftsNature Cell Biology 9:1381–1391.https://doi.org/10.1038/ncb1657
-
The BMP signaling pathway at the Drosophila neuromuscular junction and its links to neurodegenerative diseasesCurrent Opinion in Neurobiology 21:182–188.https://doi.org/10.1016/j.conb.2010.08.014
-
Survival strategies of a sterol auxotrophDevelopment 137:3675–3685.https://doi.org/10.1242/dev.044560
-
Inhibitors of sphingolipid metabolism enzymesBiochimica et Biophysica Acta (BBA) - Biomembranes 1758:1957–1977.https://doi.org/10.1016/j.bbamem.2006.08.017
-
Brain Lipids in Synaptic Function and Neurological Disease87–103, Chapter 4 - Variations of Brain Lipid Content, Brain Lipids in Synaptic Function and Neurological Disease, San Francisco, Elsevier Academic Press.
-
Characterization of free endogenous C14 and C16 sphingoid bases from Drosophila melanogasterJournal of Lipid Research 45:54–62.https://doi.org/10.1194/jlr.M300005-JLR200
-
The recycling endosome of Madin-Darby canine kidney cells is a mildly acidic compartment rich in raft componentsMolecular Biology of the Cell 11:2775–2791.https://doi.org/10.1091/mbc.11.8.2775
-
The neurogenic genes egghead and brainiac define a novel signaling pathway essential for epithelial morphogenesis during Drosophila oogenesisDevelopment 122:3863–3879.
-
Notch ligand activity is modulated by glycosphingolipid membrane composition in Drosophila melanogasterThe Journal of Cell Biology 188:581–594.https://doi.org/10.1083/jcb.200907116
-
Lipid rafts in the maintenance of synapses, dendritic spines, and surface AMPA receptor stabilityThe Journal of Neuroscience 23:3262–3271.https://doi.org/10.1523/JNEUROSCI.23-08-03262.2003
-
Porcupine-mediated lipidation is required for Wnt recognition by WlsDevelopmental Biology 361:392–402.https://doi.org/10.1016/j.ydbio.2011.11.003
-
WNT secretion and signalling in human diseaseTrends in Molecular Medicine 18:483–493.https://doi.org/10.1016/j.molmed.2012.06.008
-
Glycolipid trafficking in Drosophila undergoes pathway switching in response to aberrant cholesterol levelsMolecular Biology of the Cell 21:778–790.https://doi.org/10.1091/mbc.e09-01-0005
-
Acsl, the Drosophila ortholog of intellectual-disability-related ACSL4, inhibits synaptic growth by altered lipidsJournal of cell science 129:4034–4045.https://doi.org/10.1242/jcs.195032
-
Mechanism of evenness interrupted (Evi)-exosome release at synaptic boutonsJournal of Biological Chemistry 287:16820–16834.https://doi.org/10.1074/jbc.M112.342667
-
WNTs tune up the neuromuscular junctionNature Reviews Neuroscience 10:627–634.https://doi.org/10.1038/nrn2681
-
DOCK2 is a Rac activator that regulates motility and polarity during neutrophil chemotaxisThe Journal of Cell Biology 174:647–652.https://doi.org/10.1083/jcb.200602142
-
Membrane targeting of lipid modified signal transduction proteinsSub-Cellular Biochemistry 37:217–232.https://doi.org/10.1007/978-1-4757-5806-1_6
-
Association of sterol- and glycosylphosphatidylinositol-linked proteins with Drosophila raft lipid microdomainsJournal of Biological Chemistry 274:12049–12054.https://doi.org/10.1074/jbc.274.17.12049
-
Wnt signaling in the vertebrate central nervous system: from axon guidance to synaptic functionCold Spring Harbor Perspectives in Biology 4:a008003.https://doi.org/10.1101/cshperspect.a008003
-
The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesisJournal of Biological Chemistry 277:32421–32429.https://doi.org/10.1074/jbc.M206213200
-
Ceramide phosphoethanolamine biosynthesis in Drosophila is mediated by a unique ethanolamine phosphotransferase in the Golgi lumenJournal of Biological Chemistry 288:11520–11530.https://doi.org/10.1074/jbc.M113.460972
-
Drosophila egghead encodes a beta 1,4-mannosyltransferase predicted to form the immediate precursor glycosphingolipid substrate for brainiacJournal of Biological Chemistry 278:1411–1414.https://doi.org/10.1074/jbc.C200619200
-
Egghead and brainiac are essential for glycosphingolipid biosynthesis in vivoJournal of Biological Chemistry 280:4858–4863.https://doi.org/10.1074/jbc.C400571200
-
Enhancement of Notch receptor maturation and signaling sensitivity by Cripto-1The Journal of Cell Biology 187:343–353.https://doi.org/10.1083/jcb.200905105
-
Sphingosine kinases and their metabolites modulate endolysosomal trafficking in photoreceptorsThe Journal of Cell Biology 192:557–567.https://doi.org/10.1083/jcb.201004098
-
The role of glycosphingolipid metabolism in the developing brainJournal of Lipid Research 50:S440–S45.https://doi.org/10.1194/jlr.R800028-JLR200
-
Drosophila wnt-1 undergoes a hydrophobic modification and is targeted to lipid rafts, a process that requires porcupineJournal of Biological Chemistry 279:33220–33227.https://doi.org/10.1074/jbc.M403407200
Article and author information
Author details
Funding
Ministry of Science and Technology of the People's Republic of China (2014CB942803)
- Yong Q Zhang
Ministry of Science and Technology of the People's Republic of China (2016YFA0501002)
- Yong Q Zhang
National Natural Science Foundation of China (31490590)
- Yong Q Zhang
National Natural Science Foundation of China (31500846)
- Yan Huang
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank S M Cohen, S Pizette, V Budnik, E Hafen, Y N Jan and G Davis, Tsinghua Drosophila RNAi Center and the Bloomington Stock Center for fly stocks. We thank H Chahinian for his help in the purification and analysis of GSLs and W Li for her help in Wg production and site-directed mutation in wg. We thank Z Liu and R K Yu for discussion and comments on the manuscript. This work was supported by grants from the Ministry of Science and Technology of the people's Republic of China; and the National Science Foundation of China (NSFC). The authors declare no competing financial interests
Version history
- Received: May 10, 2018
- Accepted: September 9, 2018
- Version of Record published: October 25, 2018 (version 1)
Copyright
© 2018, Huang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 2,251
- Page views
-
- 343
- Downloads
-
- 15
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Developmental Biology
- Neuroscience
The cell-type-specific expression of ligand/receptor and cell-adhesion molecules is a fundamental mechanism through which neurons regulate connectivity. Here, we determine a functional relevance of the long-established mutually exclusive expression of the receptor tyrosine kinase Kit and the trans-membrane protein Kit Ligand by discrete populations of neurons in the mammalian brain. Kit is enriched in molecular layer interneurons (MLIs) of the cerebellar cortex (i.e., stellate and basket cells), while cerebellar Kit Ligand is selectively expressed by a target of their inhibition, Purkinje cells (PCs). By in vivo genetic manipulation spanning embryonic development through adulthood, we demonstrate that PC Kit Ligand and MLI Kit are required for, and capable of driving changes in, the inhibition of PCs. Collectively, these works in mice demonstrate that the Kit Ligand/Kit receptor dyad sustains mammalian central synapse function and suggest a rationale for the affiliation of Kit mutation with neurodevelopmental disorders.
-
- Developmental Biology
- Neuroscience
Autism spectrum disorder (ASD) is defined by common behavioral characteristics, raising the possibility of shared pathogenic mechanisms. Yet, vast clinical and etiological heterogeneity suggests personalized phenotypes. Surprisingly, our iPSC studies find that six individuals from two distinct ASD-subtypes, idiopathic and 16p11.2 deletion, have common reductions in neural precursor cell (NPC) neurite outgrowth and migration even though whole genome sequencing demonstrates no genetic overlap between the datasets. To identify signaling differences that may contribute to these developmental defects, an unbiased phospho-(p)-proteome screen was performed. Surprisingly despite the genetic heterogeneity, hundreds of shared p-peptides were identified between autism subtypes including the mTOR pathway. mTOR signaling alterations were confirmed in all NPCs across both ASD-subtypes, and mTOR modulation rescued ASD phenotypes and reproduced autism NPC associated phenotypes in control NPCs. Thus, our studies demonstrate that genetically distinct ASD subtypes have common defects in neurite outgrowth and migration which are driven by the shared pathogenic mechanism of mTOR signaling dysregulation.