1. Genetics and Genomics
Download icon

Analysis of the genomic architecture of a complex trait locus in hypertensive rat models links Tmem63c to kidney damage

  1. Angela Schulz
  2. Nicola Victoria Müller
  3. Nina Anne van de Lest
  4. Andreas Eisenreich
  5. Martina Schmidbauer
  6. Andrei Barysenka
  7. Bettina Purfürst
  8. Anje Sporbert
  9. Theodor Lorenzen
  10. Alexander M Meyer
  11. Laura Herlan
  12. Anika Witten
  13. Frank Rühle
  14. Weibin Zhou
  15. Emile de Heer
  16. Marion Scharpfenecker
  17. Daniela Panáková  Is a corresponding author
  18. Monika Stoll
  19. Reinhold Kreutz  Is a corresponding author
  1. Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Germany
  2. Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Germany
  3. Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Electrochemical Signaling in Development and Disease, Germany
  4. Leiden University Medical Center (LUMC), The Netherlands
  5. Westfälische Wilhelms University, Genetic Epidemiology, Institute for Human Genetics, Germany
  6. Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Core Facility Electron Microscopy, Germany
  7. Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Advanced Light Microscopy, Germany
  8. Center for Human Disease Modeling, Duke University School of Medicine, United States
  9. DZHK (German Centre for Cardiovascular Research), Partner site Berlin, Germany
  10. Maastricht University, Genetic Epidemiology and Statistical Genetics, The Netherlands
Research Article
  • Cited 2
  • Views 815
  • Annotations
Cite this article as: eLife 2019;8:e42068 doi: 10.7554/eLife.42068


Unraveling the genetic susceptibility of complex diseases such as chronic kidney disease remains challenging. Here, we used inbred rat models of kidney damage associated with elevated blood pressure for the comprehensive analysis of a major albuminuria susceptibility locus detected in these models. We characterized its genomic architecture by congenic substitution mapping, targeted next-generation sequencing, and compartment-specific RNA sequencing analysis in isolated glomeruli. This led to prioritization of transmembrane protein Tmem63c as a novel potential target. Tmem63c is differentially expressed in glomeruli of allele-specific rat models during onset of albuminuria. Patients with focal segmental glomerulosclerosis exhibited specific TMEM63C loss in podocytes. Functional analysis in zebrafish revealed a role for tmem63c in mediating the glomerular filtration barrier function. Our data demonstrate that integrative analysis of the genomic architecture of a complex trait locus is a powerful tool for identification of new targets such as Tmem63c for further translational investigation.


eLife digest

The human kidneys filter the entire volume of the blood about 300 times each day. This ability depends on specialized cells, known as podocytes, which wrap around some of the blood vessels in the kidney. These cells control which molecules leave the blood based on their size. Normally large molecules like proteins are blocked, while smaller molecules including waste products, toxins, excess water and salts pass through into the urine.

If this filtration system is damaged, by high blood pressure, for example, it can lead to chronic kidney disease. A hallmark of this disease, often called CKD for short, is high levels of the protein albumin in the urine. Previous studies involving rats with high blood pressure have found several regions of the genome that contribute to high levels of albumin in the urine, including one on chromosome 6. However, this region contains several genes and it was unclear which genes affected the condition.

Schulz et al. set out to narrow down the list and find specific genes that might contribute to elevated albumin in the urine of rats with high blood pressure. This search identified the gene for a protein called TMEM63c as a likely candidate. This protein spans the outer membrane of podocyte cells. Analysis of kidney biopsies showed that patients with chronic kidney disease also had low levels of this protein in their podocytes. Further experiments, this time in zebrafish, showed that reducing the activity of the gene for tmem63c led to damaged podocytes and a leakier filter in the kidneys.

The results suggest that this gene plays an important role in the integrity of the kidneys filtration barrier. It is possible that faulty versions of this gene are behind some cases of chronic kidney disease. If this proves to be the case, a better understanding of the role of this gene may lead to new treatments for the condition.



The analysis of the genetic basis of common diseases remains challenging due to their complex pathogenesis and genetic heterogeneity in human populations (Deng, 2015; Glazier et al., 2002; McCarthy et al., 2008). This applies also to elevated blood pressure (BP) or hypertension, as recent meta-analyses of genome-wide association studies (GWAS) identified more than 100 gene loci associated with BP (Hoffmann et al., 2017; Warren et al., 2017). The effect size of the identified gene loci, however, is in general rather modest and less than 4% of the variance of BP phenotypes can be explained by these loci (Hoffmann et al., 2017; Warren et al., 2017), while around 40% to 50% of the variability appears heritable (Levy et al., 2007; Miall and Oldham, 1963). Considerable evidence supports a major role of the kidney in BP regulation, and for the renal damage such as albuminuria development as a consequence of long-term BP elevation (Coffman and Crowley, 2008; Mancia et al., 2013). Interestingly, genetic risk scores deploying BP genetic variants predict also hypertensive target organ damage in the heart, cerebral vessels, and eye, while only little evidence exists for an effect on kidney damage (Ehret et al., 2016). In this regard, several inbred hypertensive rat models provide valuable complementary tools to uncover the genetics of kidney damage in hypertension (Schulz and Kreutz, 2012; Yeo et al., 2015). These hypertensive models belong to the large panel of inbred strains that have been generated for a range of physiological and disease phenotypes by selective breeding (Atanur et al., 2013). Of interest, compensatory alleles that protect against hypertensive organ damage have also been inadvertently co-selected in this process and explain the impressive resistance of some hypertensive strains against target organ damage (Jacob, 2010; Jeffs et al., 1997; Rubattu et al., 1996; Schulz and Kreutz, 2012; Yeo et al., 2015). Quantitative trait loci (QTL) mapping strategies took advantage of these findings by intercrossing hypertensive strains with contrasting kidney damage phenotypes (Schulz and Kreutz, 2012). It remains challenging, however, to identify the molecular changes at a complex trait QTL that account for gene-gene or gene-environment interactions, incomplete penetrance, and epigenetic inheritance (Buchner and Nadeau, 2015; Deng, 2015).

Here, we successfully overcome the obstacles of QTL mapping in rodents by analyzing two inbred hypertensive rat strains with contrasting kidney damage with albuminuria phenotypes. We used the Munich Wistar Frömter (MWF) rat as a suitable hypertensive model system to target the genetic basis of the albuminuria phenotype in contrast to the spontaneously hypertensive rat (SHR) representing a model that is protected against albuminuria development (Schulz and Kreutz, 2012; van Es et al., 2011). Following initial QTL mapping in intercrosses of contrasting hypertensive strains (Schulz and Kreutz, 2012), we successfully combined conventional fine mapping using congenic strains with characterization of the genomic architecture in sub-QTLs by targeted next-generation sequencing (NGS), and compartment-specific RNA sequencing (RNA-Seq) analysis. This comprehensive approach allowed us to prioritize transmembrane protein Tmem63c as a novel positional target for albuminuria development among several candidates. Functional relevance of Tmem63c was supported by allele-specific and BP-independent differential glomerular expression during onset of albuminuria in allele-specific minimal congenic rat lines derived from the contrasting rat models. Loss of glomerular TMEM63C expression in podocytes of patients with focal segmental glomerulosclerosis (FSGS) provided strong evidence for translational relevance. Loss-of-function studies in zebrafish induced a glomerular filtration barrier (GFB) defect compatible with the albuminuria phenotype, which was rescued upon co-injection of zebrafish tmem63c mRNA or rat Tmem63c mRNA, showing not only the specificity of the observed knockdown phenotype, but also conservation of the gene’s function across species. Ultrastructural analysis by electron microscopy, demonstrated severe morphological defects including podocyte damage with foot process effacement in tmem63c-deficient embryos. Altogether, our findings reveal TMEM63C being integral to podocyte physiology, and identified its potential role in glomerular renal damage in patients with chronic kidney disease. Our data demonstrate, despite the difficulties of QTL analysis in experimental models such as inbred strains, the feasibility to identify novel targets by combining conventional congenic substitution mapping with integrative analysis of genomic architecture of identified susceptibility loci and functional studies.


Congenic substitution mapping in the MWF rat model refines the albuminuria QTL to a chromosomal region linked to both albuminuria and nephron deficit

We previously confirmed the pivotal role of a major albuminuria QTL on rat chromosome 6 (RNO6) in the MWF model by generating a consomic MWF-6SHR strain, which carries RNO6 from the contrasting albuminuria-resistant SHR strain in the MWF genetic background (Figure 1A–D) (Schulz et al., 2007). In addition, MWF rats inherit a deficit in nephron (and glomeruli) number, which represents a predisposition for the development of both hypertension and kidney damage (Wang and Garrett, 2017). We performed congenic substitution mapping for both albuminuria and glomerular density phenotypes by generating eight congenic lines by introgression of nested chromosomal fragments from SHR onto the MWF genetic background, and compared the renal phenotypes between congenic lines and the parental MWF strain (Figure 1E,F). We successfully narrowed the original region identified by QTL mapping, spanning about 55 Mb between genetic markers D6Rat106 and D6Rat9 (Schulz et al., 2003), to a smaller interval comprising 4.9 Mb between D6Mgh4 and D6Rat81 (Figure 1E,F). The comparison between the two informative congenic lines MWF.SHR-(D6Rat1-D6Mgh4) and MWF.SHR-(D6Rat1-D6Rat81) revealed that 95% of the difference in albuminuria and 89% of the difference in glomerular density observed between the MWF and consomic MWF-6SHR strains is attributable to this interval (Figure 1E,F). Subsequently, we set out to analyze the BP phenotype by direct intra-arterial measurements in the two congenic lines in comparison to the MWF and SHR strains. This analysis revealed similar mean arterial BP values in the two congenic lines and parental MWF strain (Figure 2). This findings clearly indicate the UAE difference between MWF.SHR-(D6Rat1-D6Mgh4) and MWF.SHR-(D6Rat1-D6Rat81) are not attributable to BP differences (Figure 2). Thus, we dissected away a role of this region for BP regulation and show that both the albuminuria and glomerular density phenotype co-localize in the same refined locus (sub-QTL), supporting further exploration of this region as an independent candidate region for kidney damage. Direct comparison of glomerular density (Figure 1G–J) with the total glomerular number as previously estimated by the physical fractionator method (Figure 1K) (Schulz et al., 2007) confirmed the nephron deficit in MWF compared to SHR (Figure 1J, p<0.0001). We further demonstrated that this phenotype maps also to RNO6 (Figure 1F) when determined by glomerular density analysis in kidney sections (Figure 1G–J).

Congenic substitution mapping of the albuminuria and nephron deficit QTL on rat chromosome 6.

(A) Urinary albumin excretion (UAE) in Munich Wistar Frömter (MWF) and spontaneously hypertensive rats (SHR) at 8 weeks of age. MWF (n = 18); SHR (n = 10); values plotted: median ±interquartile range (IQR); Mann-Whitney U test; *p<0.0001. (B) Genetic map of RNO6 with genetic markers and distance in centi Morgan (cM). (C) 1-LOD (thick bar) and 2-LOD (thin bar) confidence intervals for placement of the albuminuria QTL by linkage mapping. (D) The chromosomal fragment for the MWF (black) and SHR (white) genome are indicated for the MWF (n = 18/11§), consomic MWF-6SHR (n = 19/11§), and SHR (n = 10/11§) strains. (E–F) The chromosomal fragment for congenic strains designated as MWF.SHR-(D6Rat1-D6Rat184) (n = 17/0§), MWF.SHR-(D6Rat1-D6Rat115) (n = 10/0§), MWF.SHR-(D6Rat1-D6Rat81) (n = 25/11§), MWF.SHR-(D6Rat1-D6Mgh4) (n = 24/11§), MWF.SHR-(D6Rat1-D6Rat121) (n = 29/6§), MWF.SHR-(D6Rat1-D6Mit8) (n = 18/6§), MWF.SHR-(D6Rat1-D6Rat106) (n = 10/0§), and MWF.SHR-(D6Rat1-D6Rat30) (n = 10/0§) (E). Corresponding phenotypes for UAE and glomerular density (GD) (F). Red values indicate disease phenotypes and blue values an amelioration of phenotypes for informative strains. § n is presented for the phenotypes in the following order UAE/GD; values shown for UAE: median ±IQR, Kruskall-Wallis test with Dunn’s multiple comparisons test; *p<0.0001; values shown for GD: mean ±SD; one-way ANOVA with post hoc Bonferroni’s multiple comparisons test and Mann-Whitney U test; *p<0.0001 vs. SHR, MWF-6SHR, MWF.SHR-(D6Rat1-D6Mgh4), respectively; #p<0.0001 vs. MWF.SHR-(D6Rat1-D6Mgh4), respectively; ##p=0.029 vs. MWF.SHR-(D6Rat1-D6Rat30). (G–K) Evaluation of nephron deficit in MWF and SHR rats by determination of GD. Right kidneys at 4 weeks of age were cut into 5 µm thick histological sections (G). For evaluation of glomerular diameter and glomerular number adjacent pictures were taken for each periodic acid-Schiff (PAS) stained histological section (white rectangles) (H). Calculation of GD (10x magnification) (I). Direct comparison of GD evaluation (J) vs. total glomerular number as previously estimated by the physical fractionator method (K). Total glomerular number (n = 7 each); GD (n = 11 each); values plotted: mean ±SD; two-tailed student’s t-test; *p<0.0001 vs. SHR; **p=0.0024 vs. SHR.

Mean arterial blood pressure (MAP) in consomic and congenic rat strains.

Measurement of MAP is shown for SHR (n = 9), MWF-6SHR (n = 6), congenic MWF.SHR-(D6Rat1-D6Mgh4) (Rat1-Mgh4, n = 8) and congenic MWF.SHR-(D6Rat1-D6Rat81) (Rat1-Rat81, n = 8) and MWF (n = 7) at week 14; values plotted: mean ±SD; one-way ANOVA with Bonferroni’s post hoc analysis; *p<0.0001 vs. other strains, respectively.


Targeted NGS analysis of the identified kidney damage candidate region

We employed targeted NGS on the region ranging from nucleotide positions 105,780,000 to 111,425,000 on RNO6. After genotype calling and comparing genotypes of consomic and congenic rats, we refined coordinates of the kidney damage locus from 106,400,000 bp to 111,360,000 bp (Figure 3A,B). This region contains 75 predicted protein-coding genes. In comparison to the reference genome (Rattus norvegicus, ENSEMBL rn6.0) (Yates et al., 2016), we identified 5,158 SNPs and 1893 small insertions and deletions (INDELs) in MWF, and 5326 single nucleotide polymorphisms (SNPs) and 1804 INDELs in SHR (Figure 3—figure supplement 1). Direct comparison between MWF and SHR revealed that both strains differ for 5376 SNPs and for 1613 INDELs (Figure 3—figure supplement 1), showing a remarkable pattern of stretches of variants either coming from the MWF or the contrasting SHR strain (Figure 3A). As selective sweeps have recently been reported as a consequence of inbreeding in rats (Atanur et al., 2013), we performed a formal analysis of selective processes such as directional selection or balancing selection, genetic hitchhiking, or introgression using the Tajima’s D statistics (Tajima, 1989). We observe such traces of selection with the majority of Tajima’s D values exceeding the generally accepted threshold of D > 2 (Figure 3C). Functional annotation using PROVEAN scores identified eight potentially deleterious non-synonymous variants in five genes (Table 1). In addition, in the contrasting SHR reference strain one frameshift deletion was detected in the gene encoding neuroglobin (Ngb). However, this deletion is also present in the entire clade of SHR-related rat strains derived from one ancestor including other strains with normal urinary albumin excretion and normal kidney function (Table 2) (Atanur et al., 2013). Consequently, this frameshift deletion is not to be considered involved in the kidney damage phenotype and was not further pursued. Thus, we identified no obvious single candidate by NGS analysis in the sub-QTL.

Figure 3 with 1 supplement see all
Next-generation sequencing (NGS) analysis of the kidney damage region on rat chromosome 6 and RNA sequencing (RNA-Seq) analysis in isolated glomeruli.

(A–B) DNA sequencing (DNA-Seq) analysis revealed the numbers of DNA variants in comparison to the reference genome across the sequenced region for the Munich Wistar Frömter (MWF) and spontaneously hypertensive rat (SHR) strains (n = 3, each) (A). The physical map between nucleotide position 106,405,000 and 111,405,000 is shown together with positions of potential candidate genes (in green) (B); in addition, the two genes at the 5’-position and 3’-position of the candidate region are visualized in black. (C) The Tajima’s D variation across the sequenced region. (D–E) Volcano plots illustrating the differential expression results (MWF vs. SHR) in RNA-Seq analysis in isolated glomeruli using the Cuffdiff (D) and DESeq2 (E) analysis tools. For each gene, the log10 transformed differential expression P-value adjusted for false discovery rate is plotted against the log2 transformed expression fold change. The color gradient refers to the P-values given on the y-axis. The applied significance threshold of adjusted p-value<0.05 is indicated as dashed horizontal line. Dashed vertical lines indicate fold changes > 1.5. Genes of interest are highlighted in grey and are annotated with gene symbols. (See Figure 3—figure supplement 1).

Table 1
Significant variants in the candidate kidney damage region on rat chromosome 6.
GeneGene coordinatesVariant positionVariant typeAllelic variantsAmino acid exchangeEffect of sequence variantPROVEAN score
Start position (bp)Stop position (bp)MWFSHR
Acot4107,517,668107,522,952107,518,131exonicAGGly → Argnon-synonymous−5.660
Acot5107,550,904107,557,688107,551,446exonicACArg → Sernon-synonymous−2.842
107,551,528exonicAGArg → Hisnon-synonymous−2.646
107,551,717exonicGCPro → Argnon-synonymous−5.314
107,557,092exonicATLeu → Glnnon-synonymous−5.291
Acot6107,581,608107,590,373107,590,006exonicCTLeu → Pronon-synonymous−5.091
Ptgr2108,009,251108,029,859108,029,833exonicTCArg → Cysnon-synonymous−3.672
Ngb111,126,261111,132,320111,128,730exonicGALeu → Pronon-synonymous−3.000
111,131,291exonicACTANAframeshift deletionNA
  1. MWF, Munich Wistar Frömter; SHR, spontaneously hypertensive rat. NA, not applicable.

Table 2
Presence of the frameshift deletion in inbred rat strains in neuroglobin (Ngb) at 111,131,291 bp.
StrainPresence of deletionStrainPresence of deletion
  1. The inbred rat strains with presence of the Ngb frame shift deletion in bold belong to a clade of Wistar rat derived strains from Japan.

Positional candidate gene identification by transcriptome analysis in isolated glomerular tissue by RNA-Seq

In order to identify other positional candidates at the sub-QTL on RNO6, we next embarked on RNA-Seq analysis in isolated glomeruli from MWF and SHR to assess global mRNA transcription patterns in the target compartment. We performed gene-based differential expression analysis using Cuffdiff and DESeq2 software tools (Figure 3D,E). After correcting for multiple testing, 1838 genes were assigned a p-value<0.05 for Cuffdiff analysis and 1841 genes for DESeq2, respectively, yielding a total set of 2454 unique differentially expressed genes. When filtering the results for those genes residing in the candidate region, we identified a total of 10 genes to be significantly differentially expressed between MWF and SHR (Table 3, Figure 3D,E) at significant p-values. These genes were taken forward to validation by quantitative real-time PCR (qPCR) analysis in isolated glomeruli obtained from the two parental and MWF-6SHR consomic animals during onset of albuminuria occurring between 4 and 8 weeks of age (Figure 4A). This analysis revealed that from the nine genes, which could be analyzed, only Tmem63c, showed consistent and allele-dependent differential expression during the crucial time window (Figure 4A,B).

Validation of differentially expressed genes in isolated glomeruli by quantitative real-time PCR (qPCR) analysis.

(A) qPCR analysis showed no consistent differential expression for eight genes from overall 10 genes identified with differential expression in RNA sequencing (RNA-Seq) analysis (Table 3) between parental Munich Wistar Frömter (MWF), spontaneously hypertensive rats (SHR), and consomic MWF-6SHR during the crucial time window for onset of albuminuria between weeks 4 and 8. Only transmembrane protein 63c (Tmem63c) demonstrated differential mRNA expression at both time points. Acyl-CoA thioesterase 3 (Acot3) (Table 3) showed very low mRNA expression in qPCR analysis precluding quantitative analysis. Consequently, Acot3 and the genes shown were excluded from and Tmem63c was included for further functional analysis. Rats per strain (n = 7–8, each); values for Acot5 (week 8),Tgfb3 (week 4) and Tmem63c (week 8) are plotted as median ±IQR, while the rest of data are plotted as mean ±SD; data for Acot5 (week 8), Tgfb3 (week 4) and Tmem63c (week 8) were analyzed using Kruskal-Wallis test with Dunn’s post-hoc analysis and Mann-Whitney U test, while the rest of data was analyzed by one-way ANOVA with Bonferroni’s post hoc analysis and Mann-Whitney U test. (B) mRNA expression analysis for Tmem63c in isolated glomeruli by qPCR analysis is shown for MWF, SHR, congenic MWF.SHR-(D6Rat1-D6Mgh4) (Rat1-Mgh4) and congenic MWF.SHR-(D6Rat1-D6Rat81) (Rat1-Rat81), at week 4 and week 8. Rats per strain (n = 6–8, each); data for week 8 are plotted as median ±IQR and analyzed using Kruskal-Wallis test with Dunn’s post hoc analysis and Mann-Whitney U test; the other data are plotted as mean ±SD and analyzed by one-way ANOVA with Bonferroni’s post hoc analysis and Mann-Whitney U test (C) Representative immunohistochemical stainings of TMEM63C and Wilms tumor 1 (WT1) on kidney sections from SHR and MWF at 8 weeks of age; the insert indicates expression in podocytes. Scale bar = 50 µm. Quantitative analysis of TMEM63C intensity in podocytes using one-way ANOVA revealed lower intensity in MWF (n = 7) vs. SHR (n = 6) at 8 weeks (p=0.0032).

Table 3
Genes in the candidate kidney damage region with differential expression in RNA-Seq analysis.
(bp position)
(bp position)
  1. MWF, Munich Wistar Frömter; RNA-Seq, RNA sequencing; SHR, spontaneously hypertensive rat. Genes shown in bold were found to be significantly differentially expressed using both CuffDiff and DeSeq2 analysis. a The strain name is given for upregulation of mRNA expression.

Tmem63c represents a positional candidate gene in MWF with differential glomerular expression

RNA-Seq and qPCR analysis indicated a significant 2.5- to 3-fold upregulation of Tmem63c mRNA expression in isolated glomeruli in the MWF model, which was abolished by transfer of RNO6 from SHR onto the MWF genetic background in the corresponding MWF-6SHR consomic line (Figure 4A). Moreover, comparison of Tmem63c mRNA expression between the two informative congenic lines MWF.SHR-(D6Rat1-D6Rat81) and MWF.SHR-(D6Rat1-D6Mgh4) confirmed an allelic (cis) regulation of Tmem63c mRNA expression in MWF and SHR, and its association with albuminuria (Figure 4B). Further evaluation of the NGS data for Tmem63c in MWF and SHR revealed no significant sequence variants, with the exception of one detected variant in intron 18 (ENSRNOT00000015571) at 111,101,251 bp at a potential splice site position. However, when analyzing our RNA-Seq data concerning differential exon usage in Tmem63c, we found no significant difference in exon usage between both parental strains.

We then set out to perform immunohistochemistry analysis of TMEM63C in MWF kidney. This revealed TMEM63C expression in a podocyte-specific pattern (Figure 4C). In contrast to the clearly elevated mRNA expression in isolated glomeruli, this analysis indicated no elevated glomerular protein expression in MWF, and only somewhat lower TMEM63C protein expression in podocytes in MWF compared to SHR at onset of albuminuria at 8 weeks of age (Figure 4C).

Patients with focal segmental glomerulosclerosis exhibit loss of glomerular TMEM63C expression

Aging MWF rats develop histopathological changes similar to those observed in patients with FSGS (Remuzzi et al., 1992; Schulz and Kreutz, 2012). Podocyte injury with the development of glomerular proteinuria represents a pivotal hallmark of FSGS (D'Agati et al., 2011; Lim et al., 2016). Thus, we explored TMEM63C expression in patients with FSGS and healthy controls to evaluate its potential role for human kidney damage (Yu et al., 2016). This analysis demonstrated that TMEM63C is expressed in podocytes of all glomeruli in healthy controls (Figure 5A,E), while patients with FSGS exhibit a significant decrease of TMEM63C expression (Figure 5B–E) with a global loss of glomerular TMEM63C in the majority of patients analyzed (Figure 5D–F). In addition to TMEM63C expression, we analyzed the expression of nephrin protein as a pivotal component of the slit diaphragm of the GFB (Figure 5G–J) (Kestilä et al., 1998). Nephrin expression was also significantly reduced in patients with FSGS (Figure 5H,I), which is in accordance with previously published results (Kim et al., 2002). Moreover, we observed a shift from the normal linear staining pattern to a granular staining pattern as reported (Figure 5H,J) (Doublier et al., 2001; Wernerson et al., 2003).

Transmembrane protein 63c (TMEM63C) protein and Nephrin expression deficiency in patients with focal segmental glomerulosclerosis (FSGS).

(A–D) High-intensity TMEM63C staining in a glomerulus of a healthy human control subject (A) and representative glomeruli of FSGS patients with high (+++) (B), intermediate (+) TMEM63C staining intensity (C), or loss (-) of TMEM63C protein expression (D). The inserts indicate TMEM63C-positive podocytes. Scale bar = 50 µm. (E) Scoring of the TMEM63C staining intensity in controls (n = 11) and FSGS patients (n = 9). Percentage of cases with high intensity (green); intermediate intensity (blue); low intensity (yellow) and no TMEM63C staining (magenta). Linear-by-Linear association; p=0.005. (F) Scoring of the percentage of TMEM63C positivity in glomeruli. Green: no loss; blue:<25% loss; yellow: 25–50% loss; magenta:>50% loss of TMEM63C expression. Controls (n = 11) and FSGS patients (n = 9); values plotted: median ±IQR; Mann-Whitney U test; *p<0.0001 vs. control; **p=0.021 vs. control. (G–J) Linear nephrin staining in a glomerulus of a healthy human control subject (G) and segmental loss of nephrin staining in a glomerulus of a patient with FSGS (H), indicated by arrowheads. Nephrin expression was significantly reduced in patients with FSGS compared to healthy controls (I). Moreover, we observed a shift from a normal linear staining pattern, following the glomerular capillary wall, to a granular staining pattern (H and J). values plotted: median ±IQR; Mann-Whitney U test; *p=0.05 vs. control; **p<0.01 vs. control; ***p<0.001 vs. controls.


Knockdown of TMEM63C expression in human podocytes impairs cell viability and survival signaling

We further analyzed the effect of reduced TMEM63C expression in human podocytes in culture using small interfering RNA (siRNA) methodology (Figure 6A). We found significantly impaired cell viability in response to TMEM63C downregulation (Figure 6B). In addition, reduction of TMEM63C expression by siRNA decreased pro-survival signaling in human podocytes as indicated by reduced levels of pAKT (Figure 6C), and increased pro-apoptotic transition of cytochrome C from mitochondria to the cytoplasm (Figure 6D).

Functional role of TMEM63C in human podocytes (hPC) in vitro.

Shown is the impact of siRNA-mediated inhibition of TMEM63C (siTMEM63C) or treatment of hPC with a corresponding nonsense negative control (siControl). (A) TMEM63C protein expression normalized against GAPDH as a loading control (*p=0.011). Shown is a representative Western blot. (B) Cell viability determined via measurement of calcein acetoxymethyl (AM) fluorescence intensity in hPC (**p=0.024). (C) Phosphorylation state of protein kinase B (pAKT) normalized against the expression of total AKT (AKT) (#p=0.0094). Shown is a representative Western blot, GAPDH is used as a loading control. (D) Pro-apoptotic cytochrome C transition from mitochondria to the cytoplasm of hPC (##p=0.0096). The mean ±SD of at least three independent experiments is shown, respectively. Two-tailed Student´s t-test was performed for all experiments.


Functional analysis of tmem63c in zebrafish

To assess the functional role of tmem63c for albuminuria development, we utilized the transgenic zebrafish line Tg[fabp10a:gc-EGFP] (Zhou and Hildebrandt, 2012). This model expresses a vitamin D binding protein tagged with enhanced green fluorescent protein (gc-EGFP) in the liver, from which it is released into the blood stream and circulates under the normal conditions in the blood (Figure 7A,G). Upon GFB damage, gc-EGFP leaks through the glomerular filtration barrier, indicated by a marked decrease in fluorescence in the trunk vasculature of Tg[fabp10a:gc-EGFP] embryos mimicking an albuminuria-like phenotype (Figure 7A). To reduce tmem63c levels in developing zebrafish embryos, we used the morpholino knockdown technology as well as CRISPR/Cas9-mediated somatic mutagenesis (Bassett et al., 2013; Burger et al., 2016) (Figure 7B). In both morpholino-injected embryos and crispants (CRISPR/Cas9-mediated somatic mutants), loss of tmem63c did not result in any visible developmental malformations apart from mild pericardial edema (Figure 7C–F). Knockdown of tmem63c using morpholino technology resulted in a significant decrease in gc-EGFP fluorescence in the trunk vasculature at 120 hr post fertilization (hpf) (Figure 7H). We corroborated this finding in tmem63c crispants (Figure 7J, Figure 7—figure supplement 1D) as well as by using another splice-blocking morpholino (Figure 7—figure supplement 1E–I); both experiments showed a similar albuminuria-like phenotype. To verify the specificity of the observed phenotype rescue experiments were carried out by co-injection of zebrafish tmem63c mRNA with tmem63c sgRNA/Cas9 complexes and rat Tmem63c mRNA (mRNA sequence identity vs. zebrafish = 65.82% (Clustal 2.1), Figure 7—figure supplement 2) with tmem63c ATG-MO, respectively. For both cases similarly, the albuminuria-like phenotype could be specifically rescued proving knockdown specificity on the one hand and functional conservation of tmem63c across species on the other hand (Figure 7I,K and L). Our data indicate that tmem63c may regulate the GFB integrity.

Figure 7 with 2 supplements see all
Functional assessment of the glomerular filtration barrier (GFB) after loss of transmembrane protein 63c (tmem63c) in zebrafish.

(A) Scheme of the GFB in healthy and albuminuric zebrafish embryos. Green fluorescent protein (gc-EGFP) represents an albumin surrogate and is filtrated after impairment of the GFB. fe, fenestrated endothelium; fp, foot processes of podocytes; GBM, glomerular basement membrane. (B) Schematic of tmem63c showing the target regions in Exon 2 (ex2) used for Morpholino (MO)- and CRISPR/Cas9-mediated somatic mutagenesis. (C–F) Bright field view of wildtype embryos at 48 hr post-fertilization (hpf) in uninjected controls (C), ATG-MO injected (D), 159.6 ng/µl ex2-sgRNA injected (E), and 250 ng/µl ex2-sgRNA injected embryos (F). Scale bar = 1 mm. (G–K) Fluorescence microscopy of Tg[fabp10a:gc-EGFP] embryos at 120 hpf. Uninjected control with clearly visible gc-EGFP fluorescence in the trunk vasculature (‘fluorescent’) (G). tmem63c ATG-MO-injected embryo with partial or a complete loss of trunk fluorescence (‘deficient-fluorescent’) (H) and tmem63c ATG-MO +Tmem63c mRNA (Rat) co-injected embryo (I) showing rescue of the phenotype. Tmem63c ex2-sgRNA-injected embryo with partial or a complete loss of trunk fluorescence (‘deficient-fluorescent’) (J) and tmem63c ex2-sgRNA + tmem63c mRNA (ZF) co-injected embryo (K) showing rescue of the phenotype. Scale bar = 1 mm. (L) Analysis of gc-EGFP in the trunk vasculature. Shown are embryos categorized as ‘deficient-fluorescent’ (df), see Materials and method section and Figure 7—figure supplement 2 for details. Experimental groups are normalized to the corresponding uninjected control group per experiment. Uninjected Control (n = 1198); Control-MO (n = 189); tmem63c ATG-MO (n = 227); tmem63c ATG-MO +Tmem63c mRNA (Rat) (n = 230); tmem63c ex2-sgRNA (n = 371); tmem63c ex2-sgRNA + tmem63c mRNA (ZF) (n = 126); One-way ANOVA with Bonferroni’s multiple comparisons test. Values plottet: mean ±SD, dashed line at y = 1 indicates the uninjected control level; *p=0.0002 vs. uninjected Control, #p<0.0001 vs. tmem63c ATG-MO. **p=0.0014 vs. uninjected Control, ##p<0.0001 vs. tmem63c ex2-sgRNA. Data points in the graph represent the ratio per independent experiment, %(Uninjected Control (df)) / %(experimental group (df)), N ≥ 3. (See Figure 7—figure supplement 1 and Figure 7—figure supplement 2).


To understand the possible functional changes in GFB in more detail, we deployed electron microscopy to visualize the GFB ultrastructure in embryos with reduced tmem63c levels. We observed significant changes in podocyte foot process morphology manifested by foot process effacement (Figure 8A–C). Quantitative analysis in tmem63c crispants revealed a significant increase in the foot process width compared to uninjected controls and Cas9-controls (Figure 8D) with concomitant significant decrease of the number of slit diaphragms per µm glomerular basement membrane (GBM) (Figure 8E). To analyze, whether the observed albuminuria-like phenotype upon tmem63c-deficiency is associated with the loss of podocytes, we utilized confocal microscopy to image glomeruli of Tg(wt1b:EGFP) embryos. In this analysis, tmem63c crispants (tmem63c ex2-sgRNA) showed a widened Bowman´s space and increased glomerular volumes compared to uninjected controls (133457 ± 59547 µm3 vs 67067 ± 21933 µm3, p=0.04) as quantified by 3D surface reconstruction. In addition, we observed dilated capillary loops in the crispants (Figure 8F–H). Quantification of podocyte cell number in embryos with reduced tmem63c levels revealed no changes in absolute cell number (Figure 8I, Videos 13), while relative podocyte cell number normalized to the total glomerular volume was significantly decreased compared to uninjected controls (Figure 8J, Videos 13). Collectively, our data indicate the conserved role for tmem63c in GFB function between fish, rodents, and humans.

Ultrastructural and morphological analysis of glomerular structures after loss of tmem63c in zebrafish.

(A–E) Electron microscopy and quantitative assessment of GFB ultrastructure. Representative electron microscopy pictures of the GFB in uninjected Controls (A), Cas9-Controls (B) and after tmem63c knockdown (C), asterisks indicate effaced podocyte foot processes). Quantitative analysis of podocyte foot process width (D) and number of slit diaphragms per µm GBM (E). Uninjected Control (n = 5); Cas9-Control (n = 4); tmem63c ex2-sgRNA (n = 4); Scale bar = 1 µm; values plottet: mean ±SD; One-way ANOVA with Bonferroni’s multiple comparisons test; *p=0.0019 vs. uninjected Control, *p=0.0017 vs Cas9-Control; # p=0.0171 vs. uninjected Control, # p=0.0148 vs. Cas9-Control. (F–J) Confocal microscopy and analysis of absolute and relative podocyte cell number in Tg(wt1b:EGFP) at 96 hpf. Representative confocal microscopy pictures of glomeruli in uninjected Controls (F), Cas9-Controls (G) and after tmem63c knockdown (H). Quantitative analysis of absolute (I) and relative (J) podocyte cell number. Relative podocyte cell number has been obtained after normalization to the glomerular volume. Uninjected Control (n = 6); Cas9-Control (n = 6); tmem63c ex2-sgRNA (n = 7); Scale bar = 15 µm; values plottet: mean ±SD; One-way ANOVA with Bonferroni’s multiple comparisons test; **p=0.0421 vs. uninjected Control.

Video 1
Representative spot segmentation of podocyte nuclei and 3D surface reconstruction of glomeruli in uninjected controls of Tg(wt1b:EGFP) zebrafish embryos.

The videos show a maximum intensity projection of the masked DAPI channel acquired by confocal microscopy of Tg(wt1b:EGFP) zebrafish embryos at 96 hpf. The DAPI channel of DAPI+/EGFP+-cells visualized here represents podocyte nuclei. Blue spots show the podocyte nuclei identified by software-based spot segmentation. Spots were counted for quantification of the absolute podocyte cell number. The grey surface represents the 3D surface reconstruction of glomeruli containing all DAPI+/EGFP+ nuclei, which was used for quantification of the total glomerular volume. Shown here are representative analysis results of uninjected controls (Video 1), Cas9-Controls (Video 2) and tmem63c ex2-sgRNA-injected embryos (Video 3).

Video 2
Representative spot segmentation of podocyte nuclei and 3D surface reconstruction of glomeruli in Cas9 - injected controls (Cas9 - controls) of Tg(wt1b:EGFP) zebrafish embryos.
Video 3
Representative spot segmentation of podocyte nuclei and 3D surface reconstruction of glomeruli in tmem63c ex2-sgRNA - injected Tg(wt1b:EGFP) zebrafish embryos


Previous genetic analysis in the fawn-hooded hypertensive (FHH) rat model led to the identification of naturally occurring genetic variants in RAB38, member RAS oncogene family (Rab38), and shroom family member 3 (Shroom3) that successfully complemented studies in humans supporting their role for albuminuria (Rangel-Filho et al., 2013; Yeo et al., 2015). Interestingly, the genetic variant in Rab38 was linked to altered tubular (Rangel-Filho et al., 2013; Teumer et al., 2016), and the variant in Shroom3 to altered glomerular (Yeo et al., 2015) albumin handling. Thus, animal models have been proven useful not only for the explanation of missing heritability (Chatterjee et al., 2013), but also for the elucidation of the differences between glomerular and tubular origins of albuminuria (Rangel-Filho et al., 2013; Yeo et al., 2015). Currently, in GWAS meta-analyses in general population cohorts, only cubilin (CUBN) has been significantly associated with albuminuria (Böger et al., 2011). In addition, variants in HS6ST1 and near RAB38/CTSC were implicated in albuminuria in patients with diabetes (Teumer et al., 2016). Nevertheless, in parallel to the findings obtained in BP GWAS (Hoffmann et al., 2017; Warren et al., 2017), only a small fraction of the estimated heritability of albuminuria can be attributed to the identified genes (Langefeld et al., 2004; Teumer et al., 2016). The MWF rat, in which we identified at least 11 albuminuria QTL, highlights the polygenic nature of complex traits such as kidney damage with albuminuria in hypertension (Schulz and Kreutz, 2012). Here, we focused on a major albuminuria QTL (Schulz and Kreutz, 2012; Schulz et al., 2003) and refined the candidate region to a sub-QTL comprising 4.9 Mb. We confirmed that both the albuminuria and the nephron deficit phenotype map to the same genomic region supporting a genetic link between albuminuria and embryonic/fetal nephron development (Wang and Garrett, 2017). In addition, the informative congenic lines with differential albuminuria development showed similar BP values by which we showed that this genomic region affects albuminuria development independently from BP changes. In the targeted NGS analysis, multiple non-deleterious variants but no clear candidate was identified. However, significant signs of selective sweeps in this region, potentially leading to an enrichment of multiple non-deleterious alleles due to genetic hitchhiking, were detected. This is in agreement with a recent systematic genome sequencing study of laboratory inbred rat strains indicating that private single-nucleotide variants are highly concentrated in a small number of discrete regions of the genome (Atanur et al., 2013). The authors of this report hypothesized that variants that are unique to a single strain reside within these regions because many of these regions were positively selected in the initial phenotype-driven derivation of these strains. Surprising - and challenging however - remains our observation that no obvious causative variant for the kidney damage phenotype was observed in our targeted NGS analysis. Notwithstanding, complex traits can also be a consequence of gene expression changes resulting in dysregulation of physiological pathways, a concept which becomes increasingly recognized as RNA sequencing is employed to distinguish tissue-specific gene expression patterns in a variety of complex diseases (Joehanes et al., 2017; Kirsten et al., 2015).

We therefore complemented the DNA re-sequencing by compartment-specific RNA-Seq analysis which is rational, because MWF rats develop early glomerular changes that precede albuminuria development and show early podocyte injury in parallel with the onset of albuminuria (Ijpelaar et al., 2008). We identified Tmem63c as a positional candidate based on its mRNA expression pattern with differential glomerular expression in allele-specific rat models. Immunohistochemistry analysis in MWF kidneys identified TMEM63C protein in podocytes, and in contrast to the observed marked glomerular mRNA upregulation only a modest downregulation. Bioinformatics analysis of our NGS and RNA-Seq data has not yet provided a potential explanation for this discrepancy, for example interstrain differences related to exon usage or other events shown to mediate protein expression control on the post-transcriptional level. The relationship between protein levels and their coding transcripts is, however, rather complex and factors such as spatial and temporal variations of mRNAs, as well as the local availability of resources for protein biosynthesis, strongly influence this relationship (Liu et al., 2016). Spatial variation in expression regulation during renal injury development could be specifically important in podocytes due to their unique ultrastructural and molecular anatomy (Endlich et al., 2017). To explore the potential clinical relevance of TMEM63C for kidney damage, we selected patients with FSGS because they mirror the disease pattern observed in the MWF model (D'Agati et al., 2011; Lim et al., 2016; Yu et al., 2016). Importantly, patients with FSGS exhibit a significant decrease of TMEM63C protein levels in podocytes with a global loss of glomerular expression in the majority of patients. Furthermore, the loss of TMEM63C was associated with a decrease and altered granular staining pattern of nephrin protein in glomeruli of FSGS patients as previously reported (Doublier et al., 2001; Wernerson et al., 2003). The latter has been previously shown to correspond to the degree of foot process effacement (Wernerson et al., 2003). While our data cannot establish a functional link between changes in nephrin and TMEM63c in FSGS, they nonetheless demonstrate a concomitant deficiency of both proteins in this setting.

To further validate Tmem63c, we tested its functional relevance for albuminuria development in zebrafish (Danio rerio). Our data confirm that in both tmem63c morphants and crispants, loss of tmem63c leads to a phenotype indicative of a GFB defect. Importantly, rescue of the observed phenotypes in zebrafish with rat Tmem63c mRNA pointed to the functional conservation across species. Ultrastructural analysis in zebrafish embryos demonstrated the role of tmem63c for the GFB integrity by revealing overt effacement of podocyte foot processes upon gene deficiency. Further structural analysis by confocal microscopy revealed dilated capillary loops and enlarged glomerular volumes with a reduction of relative podocyte number in relation to glomerular volume (podocyte density) in tmem63c-deficient embryos. Thus, our data reveal an important role of tmem63c for normal development of capillary structure and podocyte function of the glomerulus in zebrafish.

Tmem63c belongs to the TMEM (transmembrane protein) gene family comprising more than 300 different proteins with about 580 transcript variants (Wrzesiński et al., 2015). These proteins are predicted components of cellular membranes. However, the function of the majority of TMEM proteins - including Tmem63c - is currently unclear. There are no previous reports that demonstrate TMEM63C expression in the kidney, while assessment of the human protein atlas database indicates TMEM63C expression in human kidney in both the glomerular and tubular compartments (Lundberg et al., 2010); ‘Tissue expression of TMEM63C - Staining in kidney’ - The Human Protein Atlas, 2019; Uhlén et al., 2015). Tmem234, another member of the TMEM family, may represent a component of the basal membrane of podocytes and has recently been associated with proteinuria development in zebrafish (Rodriguez et al., 2015). The mechanism by which changes in Tmem63c expression cause podocyte damage and thus contribute to the final common pathway of injury in FSGS (De Vriese et al., 2018) remains however unclear and cannot be elucidated by our current analysis. Accordingly, our data do not allow to describe possible interactions between TMEM63c and the heterogeneous group of known causative FSGS genes. Nevertheless, previous reports suggested that Tmem63c and two other genes of the tmem63-family, i.e. Tmem63a and Tmem63b, are mammalian homologues of the hyperosmolarity-activated cation channel proteins AtCSC1 and its paralogue OSCA1 in plants (Hou et al., 2014; Zhao et al., 2016). Based on these reports, it appeared tempting to speculate that Tmem63c may be involved in mechanosensing in podocytes providing thus a functional basis for interactions with cytoskeleton genes or slit pore proteins, for example nephrin, in podocytes. However, the potential role of Tmem63c as a hyperosmolarity-activated cation channel remains controversial, since the activation by hyperosmolarity was not confirmed in a more recent study (Murthy et al., 2018). Moreover, the latter report indicated that Tmem63c is phylogenetically divergent from Tmem63a and Tmem63b and lacks their function to induce stretch-activated ion currents. Consequently, further studies are needed to characterize the functional role of Tmem63c and to explore its potential to influence podocyte function as a novel target for therapeutic intervention (Endlich et al., 2017; Forst et al., 2016; Wieder and Greka, 2016). In contrast to our experiments in zebrafish, in the explorative analysis in biopsies of FSGS patients we cannot differentiate between a primary (causative) or secondary effect of TMEM63C expression loss in patients. Nevertheless, taken together with our experimental analysis, the data clearly support Tmem63c as a novel candidate for further translational research on kidney damage.

Materials and methods

Key resources table
Reagent type
(species) or
DesignationSource or
Antibodyanti-TMEM63CPerbio Science Germany; this paperepitope: GLRGFARELDPAQFQEGLE1:1600 for rat tissue,
1:800 for human
Antibodyrabbit anti-WT1Santa CruzRRID:AB_6326111:500
Antibodyrabbit anti-nephrinAbcamRRID:AB_9444001:750
AntibodyGoat anti-rabbit
EnVision HRP conjugate
AntibodyAKTMerck Chemicals GmbH
Antibodyphospho-AKT Ser473Merck Chemicals GmbH
Biological sample
(Homo sapiens)
Renal biopsy
samples of patients
with FSGS
archive of the
Department of
Pathology of the Leiden
University Medical Center
For patient information

see Table 4
ell line
(Homo sapiens)
hPCSaleem et al., 2002RRID:CVCL_W186
(Danio rerio)
tmem63cNAZFIN: ZDB-GENE-120928–2
(Homo sapiens)
TMEM63CNAEnsembl: ENST00000298351.4
(Rattus norvegicus)
Tmem63cNAEnsembl: ENSRNOT00000015571.6
OtherDAPI stainSigma Aldrichstock solution
1 mg/ml
diluted 1:2000 in PBS
OtherDNA-Seq databasethis paperGEO and SRA:
Submission ID:
SUB2950675 and
BioProject ID:
See Data availability
OtherRNA-Seq databasethis paperGEO and SRA:
accession GSE102546
See Data availability
DNA reagent
(cDNA) zebrafish
this paperInfusion cloning primer
sequences for cDNA synthesis:
Sequence additional
primer for amplification of ORF:
tmem63c (cDNA); pBluescript II SK(+)
based reagent
Gene Tools
LLC Philomath
based reagent
Gene Tools
LLC Philomath
based reagent
this paperSequence
synthesis forward primer with CRISPR target site underlined:
based reagent
tmem63c ex2-
sgRNA primers
CRISPR target site
siTMEM63CSigma-Aldrich Chemie GmbH
Strain, strain
(Danio rerio)
Tg(fabp10a:gc-EGFP)Zhou and Hildebrandt, 2012
Strain, strain
(Danio rerio)
Tg(wt1b:GFP)Perner et al., 2007
Strain, strain
(Rattus norvegicus)
MWF/RkbOwn colony Charité – Universitätsmedizin Berlin, Germanyhttp://dels.nas.edu/ilar/ (laboratory code Rkb); Schulz and Kreutz, 2012;
Strain, strain
(Rattus norvegicus)
SHR/RkbOwn colony Charité – Universitätsmedizin Berlin, Germanyhttp://dels.nas.edu/ilar/
(laboratory code Rkb);
Schulz and Kreutz, 2012;
Strain, strain
(Rattus norvegicus)
MWF-6SHROwn colony Charité – Universitätsmedizin Berlin, Germanyhttp://dels.nas.edu/ilar/
(laboratory code Rkb);
Schulz and Kreutz, 2012;
Strain, strain
(Rattus norvegicus)
Congenic strains see Figure 1Own colony Charité –
Universitätsmedizin Berlin,
Germany; this paper
For generation of congenic strains seeMaterials and method

Rat animals

Request a detailed protocol

Male rats were obtained from our MWF/Rkb (RRID:RGD_724569, laboratory code Rkb, http://dels.nas.edu/ilar/) and SHR/Rkb (RRID:RGD_631696, laboratory code Rkb, http://dels.nas.edu/ilar/) colonies at the Charité – Universitätsmedizin Berlin, Germany. The consomic MWF-6SHR (RRID:RGD_1641831) was previously described (Schulz et al., 2007). Rats were grouped under conditions of regular 12 hr diurnal cycles with an automated light switching device and climate-controlled conditions at a room temperature of 22°C. The rats were fed a normal diet containing 0.2% NaCl and had free access to food and water.

A panel of eight congenic rat lines MWF.SHR-(D6Rat1-D6Rat30), MWF.SHR-(D6Rat1-D6Rat106), MWF.SHR-(D6Rat1-D6Mit8), MWF.SHR-(D6Rat1-D6Rat121), MWF.SHR-(D6Rat1-D6Mgh4), MWF.SHR-(D6Rat1-D6Rat81), MWF.SHR-(D6Rat1-D6Rat115), and MWF.SHR-(D6Rat1-D6Rat184) was generated by transfer of different nested SHR segments onto the MWF background. For this procedure, male and female rats of the MWF-6SHR breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed (Schulz et al., 2003). All experimental work in rat models was performed in accordance with the guidelines of the Charité-Universitätsmedizin Berlin and the local authority for animal protection (Landesamt für Gesundheit und Soziales, Berlin, Germany) for the use of laboratory animals. The registration numbers for the rat experiments are G 0255/09 and T 0189/02.

Determination of albuminuria, direct BP and glomerular density in rats

Request a detailed protocol

Urinary albumin excretion was measured as reported (Kreutz et al., 2000). Direct intra-arterial BP measurements were performed in awake male rats at 14 weeks of age as previously described (Kreutz et al., 1995; Schulz et al., 2010). For determination of glomerular density, animals were sacrificed under ketamine-xylazine anesthesia (87 and 13 mg/kg body wt, respectively) at week 4. The right kidney was fixed in methacarn and embedded in paraffin. Tissue samples were cut into 5-μm-thick histological sections (Figure 1G–I) and stained with the periodic acid-Schiff (PAS) technique. Section analysis was performed by a photomicroscope Axiophot (Zeiss) and a digital camera system AxioCam MRc Rev. 3 FireWire (Zeiss) at a 10x magnification. Glomerular density was calculated using the formula n = G/FA(D + T) as reported (ELIAS et al., 1961; Lucas et al., 1997). Glomeruli in 20–25 fields for each sample were counted in the outer cortex zone (Figure 1H,I). Glomerular diameter was calculated by the AxioVision release 4.8.2 software program (Zeiss). This method was validated by comparison with the absolute nephron numbers as determined by the physical fractionator method in rat strains as previously reported (Gundersen, 1986; Schulz et al., 2007).

NGS of the candidate region on RNO6

Request a detailed protocol

Based on the fine mapping results of the congenic MWF strains, a target candidate region of about 5.63 Mbp (chr6:105.8–111.43 Mb, R. norvegicus, ENSEMBL rn6.0) (Yates et al., 2016) was defined for subsequent next-generation resequencing analysis. The solution-based SureSelectXT (Agilent Technologies) capture method was applied for custom target enrichment of the defined region according to the manufacturer’s instructions starting with 3 μg genomic rat DNA of MWF, SHR, MWF-6SHR, MWF.SHR-(D6Rat1-D6Mgh4), and MWF.SHR-(D6Rat1-D6Rat81) (n = 3, each), uniquely labelled by index tags.

Library quality control and final quantification for subsequent pooling of the 16 sequencing libraries was performed using the 2100 Bioanalyzer instrument (Agilent Technologies). The pooled library was paired end sequenced (2 × 76 cycles plus index read) on a MiSeq system (Illumina) using the MiSeq reagent kit v3 (Illumina). The CASAVA software package v1.8.2 (Illumina) was used for demultiplexing of the sequencing reads and conversion to fastq data for further analysis. The resulting high-quality reads for identification of SNPs and short INDELs were mapped to the reference genome according to the annotation release Rat Genome Sequencing Consortium (RGSC) genome assembly v6.0 using BWA software, version 0.6.2 (Li and Durbin, 2009). Mapped reads were processed and calling of SNPs and short INDELs were performed by the GATK pipeline, version 2.8 (Van der Auwera et al., 2013). Effects of the genomic variations were evaluated with the SnpEff software tool, version 3.3 (Cingolani et al., 2012). Impairment of protein function by common exonic variants in MWF and SHR were analysed using the PROVEAN algorithm (Choi et al., 2012). A PROVEAN Score <2.5 was considered significant for genes.

The Tajima’s D statistic (Tajima, 1989) was used to test for signatures of selection in the region of interest utilizing the vcftools software (Vs. 0.1.13) (Danecek et al., 2011).

Rat glomeruli isolation

Request a detailed protocol

Different protocols were used for isolation of glomeruli from male rats at 4 and 8 weeks of age, due to the different body size. Rats were anesthetized with ketamine-xylazine (87 and 13 mg/kg body weight, respectively). In 4-week-old rats, the abdominal artery was catheterized and kidneys were perfused with 10 ml 1x phosphate buffered saline (PBS) and subsequently with 20 ml ferrous solution (12.5 g ferric oxide (Iron(II/III) powder <5 micron, 98%; Sigma- Aldrich Chemie GmbH) suspended in 1000 ml 1x PBS. Kidneys were removed, decapsulated and passed through a 125 μm steel sieve (Retsch GmbH) with 1x PBS. The glomeruli containing ferrous particles were gathered by a magnet, snap-frozen and stored at −80°C. Kidneys of 8-week-old rats were removed, decapsulated and passed through a 125 μm steel sieve with 1x PBS. The filtrate was put on a 71 μm steel sieve (Retsch GmbH) to separate glomeruli from the flow-through. Glomeruli were washed off the sieve with 1x PBS, centrifuged, immediately snap-frozen and stored at −80°C.

Transcriptome analysis

Request a detailed protocol

RNA sequencing (RNA-Seq) was performed in glomerular RNA of male MWF and SHR rats at week 4 (n = 3, each). The NEBNext Poly(A) mRNA magnetic isolation module followed by library preparation using NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs) was applied on 1 μg total RNA to generate a cDNA library for subsequent paired end (80 cycles) sequencing on the NextSeq 500 system (Illumina) using v2 chemistry yielding in about 415M single reads. RNA and library quality control was performed using the Bioanalyzer RNA 600 Nano and High-Sensitivity DNA Analysis Kit (Agilent Technologies), respectively. The KAPA Library Quantification Kit (Kapa Biosystems) was used for library quantification.

Initial quality control of the raw data was performed using Cutadapt version 1.9 (Martin, 2012) program. Raw reads were quality trimmed (minimal base quality: 25, minimal read length after trimming: 70 nt), adapter sequences were removed from reads 3’ ends. TopHat2 version 2.1.0 (Trapnell et al., 2009; Trapnell et al., 2010) software tool together with Bowtie2 aligner version 2.2.3 (Langmead and Salzberg, 2012) was used for read mapping against ENSEMBL rn6.0 reference assembly (Yates et al., 2016). After the reads have been mapped to the reference genome, the Cufflinks version 2.2.1 (Trapnell et al., 2010) program together with Ensembl (release 81) gene annotation (Aken et al., 2016), baw093) were used to assemble transcripts and estimate their abundances. Differential expression analysis was performed using both Cuffdiff version 2.2.1 software package (Trapnell et al., 2010) and DESeq2 R package version 1.12.4 (Love et al., 2014). Genes having absolute fold change value <1.5 were excluded from further analysis. Genes were considered significantly differentially expressed if the corresponding adjusted p-value was less than 0.05.

Reverse transcription and qPCR

Request a detailed protocol

First-strand cDNA synthesis was carried out on 2 µg of total RNA using the First Strand cDNA Synthesis Kit (Fermentas Life Sciences) following the manufacturer’s protocol. Isolated glomeruli preparations of rat strains were analyzed at week 4 and week 8. qPCR of each gene was performed in a 7000 Real-Time PCR System (Applied Biosystems) with version 1.2.3 software or a 7500 Fast Real-Time PCR System with version 2.0.6 software (Applied Biosystems) using the comparative quantification cycle method as reported (Fast SYBRGreen Master Mix or Power SYBR Green PCR Master Mix; Applied Biosystems) (Schulz et al., 2008). Primers are listed in Figure 4—source data 2. Normalization of expression data was done by the reference gene hydroxymethylbilane synthase (Hmbs) (Schulz et al., 2008). For all analyses, three technical replicates of each animal/experiment were performed. Genes with low mRNA expression levels were only considered when the quantification cycles (Cqs) were ≥30 and the Cqs of the no-template controls were at least 5 Cqs delayed. Acyl-CoA thioesterase 3 (Acot3) demonstrated low expression levels and was therefore not analyzed.

Immunohistochemistry of TMEM63C in rat and human kidneys

Request a detailed protocol

For determination of protein expression of TMEM63C an anti-TMEM63C antibody (epitope: GLRGFARELDPAQFQEGLE, custom antibody production: Perbio Science Germany) was generated. The epitope does not cross react with TMEM63A or TMEM63B or other genes. For Wilms tumor 1 (WT1) protein expression analysis, we used a rabbit anti-WT1 antibody (Santa Cruz). For nephrin protein expression analysis, we used a rabbit anti-nephrin antibody (Abcam). Paraffin embedded rat kidney sections and human biopsy samples were cut at 4 µm and incubated with the anti-TMEM63C antibody (1:1600 for rat tissue, 1:800 for human biopsies), the anti-WT1 antibody (1:500) or the anti-nephrin antibody (1:750). Rabbit IgG negative control fraction was used as a negative control in the same concentration as the primary antibody. Goat anti-rabbit EnVision HRP conjugate (Dako) was used as secondary antibody. The staining was visualized using diaminobenzidine as the chromogen and counterstained with haematoxylin.

Evaluation of TMEM63C staining in MWF and SHR rats

Request a detailed protocol

Consecutive slides of MWF and SHR kidney sections stained for TMEM63C and WT1 were evaluated to determine TMEM63C co-localization with podocytes. TMEM63C protein level in glomeruli was analyzed using ImageJ analysis.

FSGS patients

Request a detailed protocol

Renal biopsy samples of patients with FSGS (Table 4) were collected from the archive of the Department of Pathology of the Leiden University Medical Center (LUMC). Demographic data and laboratory data at time of biopsy were retrospectively retrieved from the patients’ medical records or pathology reports following the good practice guidelines of the LUMC. All biopsy samples were handled and analyzed anonymously in accordance with the Dutch National Ethics Guidelines (Code for Proper Secondary Use of Human Tissue, Dutch Federation of Medical Scientific Societies). This study is in agreement with the Declaration of Helsinki and the Department of Health and Human Services Belmont Report and the use of the patient biopsies was approved by the medical ethical committee of the LUMC (registration number G16.110). Samples obtained from Eurotransplant donors that were unsuited for transplantation because of technical problems, were used as healthy controls. All sections were scored separately by two observers for TMEM63C intensity as well as for percentage of glomeruli with loss of TMEM63C staining. Each case was given a score for TMEM63C staining intensity: high intensity in >50% of glomeruli, intermediate intensity in >50% of glomeruli, low intensity in >50% of glomeruli or no TMEM63C staining present in >50% of glomeruli. Secondly, sections were scored based on the percentage of glomeruli with loss of TMEM63C expression in podocytes. Per case, the percentage of glomeruli with 1) no loss 2) <25% loss 3) 25–50% loss or 4) >50% loss of TMEM63C expression in podocytes was determined. For nephrin staining analysis, each glomerulus was scored based on staining pattern (linear or granular) and loss of staining (no loss, segmental loss or global loss).

Table 4
Characteristics of focal segmental glomerulosclerosis patients.
Patient-specific featuresValues
Number of patients9
Age, years36 ± 23
Sex, male5 (55%)
SBP, mmHg*167 ± 38
DBP, mmHg106 ± 25
Hypertension7 (88%)
Proteinuria, g/day9.2 ± 4.4
Serum creatinine, µmol/l150 ± 43
eGFR, ml/min/1.73 m2*51 (42–66)
Nephrotic syndrome8 (89%)
  1. *n = 7; n = 6;  values are reported as number (%), mean ±SD or as median (interquartile range) for eGFR.

All biopsy samples were handled and analyzed anonymously in accordance with the Dutch National Ethics Guidelines (Code for Proper Secondary Use of Human Tissue, Dutch Federation of Medical Scientific Societies) and in agreement with the Declaration of Helsinki and the Department of Health and Human Services Belmont Report. The use of the patient biopsies was approved by the medical ethical committee of the LUMC.

Cell lines

Request a detailed protocol

Immortalized human podocytes (RRID:CVCL_W186, a kind gift from Professor Moin Saleem, MA, Academic and Children's Renal Unit, University of Bristol, Bristol, UK) (Saleem et al., 2002) were used as described (Eisenreich et al., 2016). The cell line has previously been authenticated (Saleem et al., 2002) and we have confirmed this by expression of podocyte specific markers such as podocin and synaptopodin as recently reported (Eisenreich et al., 2016). The cell line tested negative for mycoplasma contamination. Before transfection, human podocytes were starved with FBS-free RPMI 1640 medium overnight. Transfection of cells was performed using 200 nM of TMEM63C-specific siRNAs (siTMEM63C; Sigma-Aldrich Chemie GmbH) or non-sense control siRNAs (siControl; Sigma-Aldrich Chemie GmbH) as well as Lipofectamine 2000 (Life Technologies GmbH). The transfection efficacy of 25% in human podocytes was experimentally determined earlier (Eisenreich et al., 2016).

Western blotting

Request a detailed protocol

Western blot analyses were done as described earlier (Eisenreich et al., 2016; Langer et al., 2016). For detection, specific antibodies against TMEM63C (Thermo Fisher Scientific), GAPDH (Calbiochem), protein kinase B (AKT; Merck Chemicals GmbH), and phospho-AKT (Ser473, pAKT; Merck Chemicals GmbH) were used. Quantification of Western blot analyses were done using Gel-Pro Analyzer software version (Media Cybernetics).

Cytochrome C releasing apoptosis assay

Request a detailed protocol

The cytochrome C releasing apoptosis assay kit (BioVision Inc) was used following the manufacturer’s protocol as described previously (Eisenreich et al., 2016). In brief, 1 × 104 cells per well were transfected for 48 hr with siTMEM63C or siControl, respectively. After that, cells were lysed and the cytosolic fraction was separated from the mitochondrial fraction. Comparative Western blot analyses of these fractions using a cytochrome C-specific antibody were performed to determine pro-apoptotic translocation of cytochrome C from mitochondria into cytosol.

Cell viability assay

Request a detailed protocol

The calcein AM (acetoxymethyl) cell viability kit (Trevigen Inc) was used as earlier described following the manufacturer’s protocol (Eisenreich et al., 2016). In brief, 1 × 104 cells per well were transfected for 48 hr with siTMEM63C or siControl, respectively. Then, human podocytes were washed and incubated with calcein AM working solution for 30 min. Fluorescence was measured at 490 nm excitation and 520 nm emission.

Zebrafish animals

Request a detailed protocol

Zebrafish were bred, raised and maintained in accordance with the guidelines of the Max Delbrück Center for Molecular Medicine and the local authority for animal protection (Landesamt für Gesundheit und Soziales, Berlin, Germany) for the use of laboratory animals, and followed the ‘Principles of Laboratory Animal Care’ (NIH publication no. 86–23, revised 1985) as well as the current version of German Law on the Protection of Animals.

Zebrafish morpholino and single guide RNA (sgRNA) microinjections

Request a detailed protocol

Injection droplets of approximately 1 nl were injected into one-cell stage zygotes of the zebrafish wild type hybrid strain AB/Tülf and the transgenic lines Tg(fabp10a:gc-EGFP) (Zhou and Hildebrandt, 2012) and Tg(wt1b:GFP) (Bollig et al., 2009; Perner et al., 2007). Morpholinos (MO) of the following sequences were synthesized by Gene Tools LLC Philomath: tmem63c ATG-MO 5’-CAGGCCAGGACTCAAACGCCATTGC-3’, tmem63c ex2-sdMO 5'-TGTTATCATAGATGATGTACCAGCC-3', and standard control oligo (Control-MO) 5’-CCTCTTACCTCAGTTACAATTTATA-3’. Tmem63c ATG-MO was used at a final concentration of 0.3 mM (Figure 7B), tmem63c ex2-sdMO was used at a final concentration of 0.5 mM (Figure 7—figure supplement 1). sgRNA targeting exon 2 (Figure 7B) was generated as described (Bassett et al., 2013; Burger et al., 2016) using the ex2-sgRNA forward primer with CRISPR target site underlined: GAAATTAATACGACTCACTATAGGACGTCAGGAGTTTCCTGAGTTTTAGAGCTAGAAATAGC and the invariant reverse primer: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC. PCR product was purified with GeneJET Gel Extraction Kit (Thermo Fisher Scientific, respectively). sgRNA was transcribed using the MEGAscript T7 Kit (Ambion) and extracted with RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. sgRNA was diluted to a final concentration of 159.6 ng/μl or 250 ng/µl, respectively using water and 1 M KCl (final concentration: 300 mM) and co-injected with Cas9-Protein of 600 ng/μl final concentration as described (Burger et al., 2016; Gagnon et al., 2014). To determine the efficiency of sgRNA-mediated mutagenesis crispants alleles were analyzed as described (Figure 7—figure supplement 1D) (Burger et al., 2016). The following primers (BioTez Berlin-Buch GmbH) were used to amplify the genomic region flanking the CRISPR target site; forward: CAAATGGTGAACACTTGTGAATC, reverse: CTGCGGTTTACTGCGGAGATG. Computational sequence analysis was performed using CrispR Variants (Lindsay et al., 2016). For an injection control Cas9 was diluted to a final concentration of 600 ng/µl using water and 1 M KCl (final concentration: 300 mM; Cas9-Control).

Reverse transcriptase (RT)-PCR in zebrafish embryos

Request a detailed protocol

For efficiency analysis of the tmem63c ex2-sdMO a reverse transcriptase (RT)-PCR was carried out (Figure 7—figure supplement 1F). At 24 hpf, RNA from 50 pooled embryos was isolated using Trizol Reagent (Invitrogen); DNase I digestion was performed using the RNAse-free DNase set (Qiagen) and samples were purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. After determination of RNA quality and quantity, equal amounts of mRNA for each group analyzed were transcribed to cDNA using First strand cDNA synthesis kit (Thermo Fisher) according to the manufacturer’s protocol.

We amplified tmem63c from cDNA using DreamTaq DNA Polymerase (Thermo Fisher) with the following primers: forward: CTGATGGAGGAGAACAGCACGG, reverse: ATACAGCAGAGCGAAGATACTGTG. Eucaryotic elongation factor 1 alpha 1, like 1 (eef1a1l1) was used as a loading control and amplified using the following primers: forward: TGGAGACAGCAAGAACGACC, reverse: GAGGTTGGGAAGAACACGCC.

Cloning of tmem63c cDNA (Danio rerio)

Request a detailed protocol

Primers (BioTez Berlin-Buch GmbH) for the In-Fusion HD Cloning Kit (Takara) were designed using the web tool provided by TaKaRa (TaKaRa) (TaKaRa, 2018); forward: GCTTGATATCGAATTCATGGCGTTTGAGTCCTGGCCTGC, reverse: CGGGCTGCAGGAATTCTCACTGAAAAGCCACCGGACTG. tmem63c cDNA was amplified using Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific). The pBluescript II SK(+) vector was linearized using EcoRI FD enzyme. The tmem63c ORF was cloned into the pBluescript II SK (+) vector using the In-Fusion HD Cloning Kit (Takara). The tmem63c cDNA was sequence-verified using the common T7 forward and M13 reverse primers. For sequencing of the whole ORF, an additional primer was used, GTGCAGAAACTAATGAAGCTGG, located at 822–844 bp starting from the beginning of the ORF.

Rescue of CRISPR/Cas9-mediated tmem63c somatic mutants and tmem63c ex2-sdMO-mediated gene knockdown

Request a detailed protocol

For in vivo rescue experiments tmem63c cDNA (Danio rerio) was linearized using ApaI FD (Thermo Fisher Scientific) and purified using GeneJET Gel Extraction Kit (Thermo Fisher Scientific). In vitro transcription of capped RNA and following TurboDNase treatment were performed using mMessage mMachine T7 Kit (Ambion). For poly-A-tailing, the Poly(A)-tailing Kit (Ambion) was used, followed by RNA extraction using RNeasy Mini Kit (Qiagen). The mRNA was diluted to a concentration of 100 ng/μl and injected into one-cell stage zygotes. For in vivo rescue experiments, mRNA of a concentration of 100 ng/µl and ex2-sgRNA of a concentration of 159.6 ng/µl were subsequently injected into the same one-cell stage zygotes. For in vivo rescue of the tmem63c ex2-sdMO-mediated knockdown, mRNA with a concentration of 100 ng/µl and ex2-sdMO with a concentration of 0.5 mM were subsequently injected into the same zygote at one- or one-to-four cell stage, respectively.

Rescue of tmem63c ATG-MO-mediated gene knockdown

Request a detailed protocol

Tmem63c cDNA (Rattus norvegicus) was synthesized by Thermo Fisher Scientific using their GeneArt Gene synthesis service. For in vivo rescue experiments, Tmem63c cDNA was linearized using XbaI FD (Thermo Fisher Scientific) and purified using GeneJET Gel Extraction Kit (Thermo Fisher Scientific). In vitro transcription of capped RNA followed by TurboDNase treatment were performed using mMessage mMachine T7 Kit (Ambion). For poly-A-tailing, the Poly(A)-tailing Kit (Ambion) was used, followed by RNA extraction by RNeasy Mini Kit (Qiagen). The mRNA was diluted to a concentration of 100 ng/μl and injected into one-cell stage zygotes. For in vivo rescue of the tmem63c ATG-MO-mediated knockdown, mRNA with a concentration of 100 ng/µl and ATG-MO with a concentration of 0.3 mM were subsequently injected into the same zygote at one- or one to four cell-stage, respectively.

Functional assessment of the GFB

Request a detailed protocol

To assess the functionality of the GFB, the gc-EGFP fluorescence in the trunk vasculature of Tg(fabp10a:gc-EGFP) embryos were evaluated at 120 hpf by epifluorescence microscopy. For CRISPR-Cas9-mediated somatogenesis of tmem63c the above described sgRNA was used in a concentration of 159.6 ng/µl. Each embryo was visually assigned to the ‘fluorescent group’, ‘deficient-fluorescent group’, or ‘crippled/dead’ and their number quantified. Due to the heterogeneous genotype of the used transgenic Tg(fabp10a:gc-EGFP) zebrafish families, the ‘deficient-fluorescent group’ included the embryos with reduced fluorescence in the trunk as well as embryos that did not carry the transgene (Figure 7—figure supplement 1A–C). The percentage of injected embryos was normalized to the percentage of the control group for each category. Quantifications were performed for at least three individual injections.

Electron microscopy in zebrafish embryos

Request a detailed protocol

Tg(fabp10a:gc-EGFP) embryos at 120 hpf were fixed in 4% formaldehyde/0.5% glutaraldehyde (EM-grade) in 0.1 M phosphate buffer for 2 hr at RT. For knockdown analysis embryos were injected with tmem63c ex2-sgRNA of a concentration of 250 ng/µl to enhance the observed phenotype (Figure 7E,F). Prior to analysis embryos were sorted for a clear knockdown phenotype. Samples were stained with 1% OsO4 for 2 hr, dehydrated in a graded ethanol series and propylene oxide and embedded in Poly/BedR 812 (Polysciences, Eppelheim, Germany). Ultrathin sections were contrasted with uranyl acetate and lead citrate. Sections were examined with a FEI Morgagni electron microscope and a Morada CCD camera (EMSIS GmbH, Münster, Germany). Image acquisition and quantification of podocyte foot process width and number of slit diaphragms per µm GBM was performed with the iTEM software (EMSIS GmbH, Münster, Germany).

Confocal microscopy of zebrafish embryos and quantification of podocyte cell number and glomerular volume

Request a detailed protocol

Tg(wt1b:EGFP) embryos at 96 hpf were fixed in PEM buffer containing 4% formaldehyde and 0.1% Triton-X 100 for 2 hr at RT or overnight at 4°C. For knockdown analysis embryos were injected with tmem63c ex2-sgRNA with a concentration of 250 ng/µl to enhance the observed phenotype. Nuclei were stained using 4′,6-Diamidin-2-phenylindol (DAPI, Sigma Aldrich, stock solution 1 mg/ml diluted 1:2000 in PBS) overnight at 4°C. After removal of the yolk and mounting in 0,7% low-melting agarose, the kidneys of whole-mount fixed embryos were imaged using a Zeiss LSM 710 or LSM 700 microscope with a LD C-Apochromat 40 x NA1.1 water objective and ZEN 2.1 software by sequentially acquiring confocal z-stacks of the GFP (488 nm laser, emission 495–550 nm) and the DAPI signal (405 nm laser, emission 420–480 nm) with a pixel size of 102.4 nm. Care was taken to apply identical settings to all samples and not to oversaturate pixels.

Quantification of podocyte cell number and glomerular volume was done using Imaris version 9.21 software (RRID:SCR_007370, Bitplane AG, Zurich, Switzerland). A 3D surface covering the total glomerular volume was manually edited by tracing the outlines of EGFP-positive cells for every second section of the z-stack. EGFP-positive cells of the glomerulus were included, while cells of the pronephric ducts were excluded. For quantification of podocyte cell number, the DAPI channel was masked with the EGFP channel using Fiji software (RRID:SCR_002285) (Schindelin et al., 2012) to include DAPI+/EGFP+ cells only, thus representing nuclei of podocyte cells. Subsequently, a spot segmentation of the DAPI channel was performed. Estimated spot diameter was 4 µm. Spots were filtered for a minimum intensity of the EGFP channel and by using the Imaris quality filter for the occurrence of unspecific spots not matching the EGFP signal. Spots located outside the glomerular surface were manually deleted.


Data are presented as mean ±SD for normally distributed data or median (25% percentile – 75% percentile, that is interquartile range [IQR]) for non-normally distributed data with the indicated number of experiments. Normal distribution was determined using the Shapiro-Wilk test. For identification of outliers, Grubbs’ outliers test (α = 0.05) was performed. Where appropriate, sample size calculations were performed by the power analyses program G*Power according to Cohen (Cohen, 1988; Faul et al., 2009). Differences between experimental rat and zebrafish groups were analyzed using One-way ANOVA with post-hoc Bonferroni’s multiple comparisons test and non-parametric Mann-Whitney-U or Kruskall-Wallis test with Dunn’s multiple comparisons post-hoc test, when appropriate. For the analysis shown in Figure 7L and Figure 7—figure supplement 1I Gaussian distribution was assumed due to the number of embryos categorized. Differences between FSGS patients and controls were analyzed using the Linear-by-Linear association test and the Mann-Whitney U test. Differences in human cultured podocytes were analyzed using two-tailed Student’s t-test. Statistical analysis was performed using SPSS and GraphPad Prism 6 software 6.00 (RRID:SCR_002798, GraphPad Software, La Jolla, CA). p values < 0.05 were considered as statistically significant.

Data availability

Request a detailed protocol

The genomic and transcriptomic data from this publication have been deposited to the NCBI (https://www.ncbi.nlm.nih.gov/) curated repositories, GEO, and SRA, and assigned the identifier SubmissionID: SUB2950675 and BioProject ID: PRJNA398197 (DNA-Seq) and accession GSE102546 (RNA-Seq).


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
    Statistical Power Analysis for the Behavioral Sciences (Second Edition)
    1. J Cohen
    Hillsdale: Lawrence Erlbaum.
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
    The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals
    1. GB Ehret
    2. T Ferreira
    3. DI Chasman
    4. AU Jackson
    5. EM Schmidt
    6. T Johnson
    7. G Thorleifsson
    8. J Luan
    9. LA Donnelly
    10. S Kanoni
    11. AK Petersen
    12. V Pihur
    13. RJ Strawbridge
    14. D Shungin
    15. MF Hughes
    16. O Meirelles
    17. M Kaakinen
    18. N Bouatia-Naji
    19. K Kristiansson
    20. S Shah
    21. ME Kleber
    22. X Guo
    23. LP Lyytikäinen
    24. C Fava
    25. N Eriksson
    26. IM Nolte
    27. PK Magnusson
    28. EL Salfati
    29. LS Rallidis
    30. E Theusch
    31. AJP Smith
    32. L Folkersen
    33. K Witkowska
    34. TH Pers
    35. R Joehanes
    36. SK Kim
    37. L Lataniotis
    38. R Jansen
    39. AD Johnson
    40. H Warren
    41. YJ Kim
    42. W Zhao
    43. Y Wu
    44. BO Tayo
    45. M Bochud
    46. D Absher
    47. LS Adair
    48. N Amin
    49. DE Arking
    50. T Axelsson
    51. D Baldassarre
    52. B Balkau
    53. S Bandinelli
    54. MR Barnes
    55. I Barroso
    56. S Bevan
    57. JC Bis
    58. G Bjornsdottir
    59. M Boehnke
    60. E Boerwinkle
    61. LL Bonnycastle
    62. DI Boomsma
    63. SR Bornstein
    64. MJ Brown
    65. M Burnier
    66. CP Cabrera
    67. JC Chambers
    68. IS Chang
    69. CY Cheng
    70. PS Chines
    71. RH Chung
    72. FS Collins
    73. JM Connell
    74. A Döring
    75. J Dallongeville
    76. J Danesh
    77. U de Faire
    78. G Delgado
    79. AF Dominiczak
    80. ASF Doney
    81. F Drenos
    82. S Edkins
    83. JD Eicher
    84. R Elosua
    85. S Enroth
    86. J Erdmann
    87. P Eriksson
    88. T Esko
    89. E Evangelou
    90. A Evans
    91. T Fall
    92. M Farrall
    93. JF Felix
    94. J Ferrières
    95. L Ferrucci
    96. M Fornage
    97. T Forrester
    98. N Franceschini
    99. OHF Duran
    100. A Franco-Cereceda
    101. RM Fraser
    102. SK Ganesh
    103. H Gao
    104. K Gertow
    105. F Gianfagna
    106. B Gigante
    107. F Giulianini
    108. A Goel
    109. AH Goodall
    110. MO Goodarzi
    111. M Gorski
    112. J Gräßler
    113. C Groves
    114. V Gudnason
    115. U Gyllensten
    116. G Hallmans
    117. AL Hartikainen
    118. M Hassinen
    119. AS Havulinna
    120. C Hayward
    121. S Hercberg
    122. KH Herzig
    123. AA Hicks
    124. AD Hingorani
    125. JN Hirschhorn
    126. A Hofman
    127. J Holmen
    128. OL Holmen
    129. JJ Hottenga
    130. P Howard
    131. CA Hsiung
    132. SC Hunt
    133. MA Ikram
    134. T Illig
    135. C Iribarren
    136. RA Jensen
    137. M Kähönen
    138. H Kang
    139. S Kathiresan
    140. BJ Keating
    141. KT Khaw
    142. YK Kim
    143. E Kim
    144. M Kivimaki
    145. N Klopp
    146. G Kolovou
    147. P Komulainen
    148. JS Kooner
    149. G Kosova
    150. RM Krauss
    151. D Kuh
    152. Z Kutalik
    153. J Kuusisto
    154. K Kvaløy
    155. TA Lakka
    156. NR Lee
    157. IT Lee
    158. WJ Lee
    159. D Levy
    160. X Li
    161. KW Liang
    162. H Lin
    163. L Lin
    164. J Lindström
    165. S Lobbens
    166. S Männistö
    167. G Müller
    168. M Müller-Nurasyid
    169. F Mach
    170. HS Markus
    171. E Marouli
    172. MI McCarthy
    173. CA McKenzie
    174. P Meneton
    175. C Menni
    176. A Metspalu
    177. V Mijatovic
    178. L Moilanen
    179. ME Montasser
    180. AD Morris
    181. AC Morrison
    182. A Mulas
    183. R Nagaraja
    184. N Narisu
    185. K Nikus
    186. CJ O'Donnell
    187. PF O'Reilly
    188. KK Ong
    189. F Paccaud
    190. CD Palmer
    191. A Parsa
    192. NL Pedersen
    193. BW Penninx
    194. M Perola
    195. A Peters
    196. N Poulter
    197. PP Pramstaller
    198. BM Psaty
    199. T Quertermous
    200. DC Rao
    201. A Rasheed
    202. N Rayner
    203. F Renström
    204. R Rettig
    205. KM Rice
    206. R Roberts
    207. LM Rose
    208. J Rossouw
    209. NJ Samani
    210. S Sanna
    211. J Saramies
    212. H Schunkert
    213. S Sebert
    214. WH Sheu
    215. YA Shin
    216. X Sim
    217. JH Smit
    218. AV Smith
    219. MX Sosa
    220. TD Spector
    221. A Stančáková
    222. A Stanton
    223. KE Stirrups
    224. HM Stringham
    225. J Sundstrom
    226. AJ Swift
    227. AC Syvänen
    228. ES Tai
    229. T Tanaka
    230. KV Tarasov
    231. A Teumer
    232. U Thorsteinsdottir
    233. MD Tobin
    234. E Tremoli
    235. AG Uitterlinden
    236. M Uusitupa
    237. A Vaez
    238. D Vaidya
    239. CM van Duijn
    240. EPA van Iperen
    241. RS Vasan
    242. GC Verwoert
    243. J Virtamo
    244. V Vitart
    245. BF Voight
    246. P Vollenweider
    247. A Wagner
    248. LV Wain
    249. NJ Wareham
    250. H Watkins
    251. AB Weder
    252. HJ Westra
    253. R Wilks
    254. T Wilsgaard
    255. JF Wilson
    256. TY Wong
    257. TP Yang
    258. J Yao
    259. L Yengo
    260. W Zhang
    261. JH Zhao
    262. X Zhu
    263. P Bovet
    264. RS Cooper
    265. KL Mohlke
    266. D Saleheen
    267. JY Lee
    268. P Elliott
    269. HJ Gierman
    270. CJ Willer
    271. L Franke
    272. GK Hovingh
    273. KD Taylor
    274. G Dedoussis
    275. P Sever
    276. A Wong
    277. L Lind
    278. TL Assimes
    279. I Njølstad
    280. PE Schwarz
    281. C Langenberg
    282. H Snieder
    283. MJ Caulfield
    284. O Melander
    285. M Laakso
    286. J Saltevo
    287. R Rauramaa
    288. J Tuomilehto
    289. E Ingelsson
    290. T Lehtimäki
    291. K Hveem
    292. W Palmas
    293. W März
    294. M Kumari
    295. V Salomaa
    296. YI Chen
    297. JI Rotter
    298. P Froguel
    299. MR Jarvelin
    300. EG Lakatta
    301. K Kuulasmaa
    302. PW Franks
    303. A Hamsten
    304. HE Wichmann
    305. CNA Palmer
    306. K Stefansson
    307. PM Ridker
    308. RJF Loos
    309. A Chakravarti
    310. P Deloukas
    311. AP Morris
    312. C Newton-Cheh
    313. PB Munroe
    314. CHARGE-EchoGen consortium
    315. CHARGE-HF consortium
    316. Wellcome Trust Case Control Consortium
    Nature Genetics 48:1171–1184.
  19. 19
  20. 20
    Some methods for the study of kidney structure
    1. H ELIAS
    2. A HENNIG
    3. PM ELIAS
    Zeitschrift Fur Wissenschaftliche Mikroskopie Und Mikroskopische Technik 65:70–82.
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
    Cutadapt removes adapter sequences from high-throughput sequencing reads
    1. M Martin
    Bioinformatics in Action 17:10–12.
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
    Pathophysiologic implications of proteinuria in a rat model of progressive glomerular injury
    1. A Remuzzi
    2. S Puntorieri
    3. M Alfano
    4. D Macconi
    5. M Abbate
    6. T Bertani
    7. G Remuzzi
    Laboratory Investigation; a Journal of Technical Methods and Pathology 67:572–579.
  57. 57
  58. 58
  59. 59
    A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression
    1. MA Saleem
    2. MJ O'Hare
    3. J Reiser
    4. RJ Coward
    5. CD Inward
    6. T Farren
    7. CY Xing
    8. L Ni
    9. PW Mathieson
    10. P Mundel
    Journal of the American Society of Nephrology : JASN 13:630–638.
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
    Statistical method for testing the neutral mutation hypothesis by DNA polymorphism
    1. F Tajima
    Genetics 123:585–595.
  67. 67
    Primer Design Tool for in-Fusion HD Cloning Kit
    1. TaKaRa
    Primer Design Tool for in-Fusion HD Cloning Kit.
  68. 68
  69. 69
    1. The Human Protein Atlas
    Accessed February 28, 2019.
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
    Altered ultrastructural distribution of nephrin in minimal change nephrotic syndrome. nephrology, dialysis
    1. A Wernerson
    2. F Duner
    3. E Pettersson
    4. SM Widholm
    5. U Berg
    6. V Ruotsalainen
    7. M Soderberg
    Transplantation 18:70–76.
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84

Decision letter

  1. Tim Aitman
    Reviewing Editor; University of Edinburgh, United Kingdom
  2. Mark I McCarthy
    Senior Editor; University of Oxford, United Kingdom

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Analysis of the genomic architecture of a complex trait locus in hypertensive rat models links Tmem63c to kidney damage" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Mark McCarthy as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

The manuscript describes mapping and putative identification of a QTL gene for rat albuminuria with subsequent experiments in zebrafish and human glomerulosclerosis indicating a role in mediating glomerular filtration and podocyte function. Whilst the work has been competently carried out and the manuscript is well written, reviewers have raised concerns that need to be addressed before considering publication in the journal. In particular, to demonstrate specificity, rescue of the morpholino injected zebrafish with tmem63c cRNA should be carried out. We are also keen to see results from the IF experiments listed in the reviewer responses below (though we do not see this as essential as the morpholino rescue). Other comments of the reviewers should be addressed in point-by-point responses.

Reviewer #1:

Dr. Schulz et al. conducted the comprehensive analysis of a major albuminuria susceptibility locus detected in inbred rat models of kidney damage associated with elevated blood pressure. They found the TMEM63C loss in podocytes of FSGS patients, as well as possible role of tmem63c in mediating the glomerular filtration barrier function in zebrafish model. However, the following concerns should be raised.

1) TMEM63C expression in human kidney: Are there any previous findings to demonstrate that TMEM63C is expressed in human kidney?

2) Other genes expression of causative genes in FSGS patients: How is the expression of other causative genes for FSGS such as ACTN4, TRCP6, PAX2 etc. in FSGS patients? Also could you provide the potential interaction between TMEM63C. Please provide the explanation for the possible interaction between TMEM63C and the known causative genes for FSGS.

Reviewer #2:

The authors convincingly show that transmembrane protein Tmem63c is a genetic component that can underlie albuminuria in rats by comparing the MWF rat and SHR rat models in a QTL trait mapping and target validation strategy. Following QTL, in the region of interest, the authors performed next generation sequencing analysis and assembled a list of gene candidates. To further identify relevant candidates as relates to kidney damage, they performed RNA-seq on glomeruli isolated from the rat models and compared transcriptional profiles between these models. They ultimately narrowed the gene list to 10 differentially expressed genes, and from this selected Tmem63c. They also found that patients with focal glomerulosclerosis have TMEM63C loss in podocytes and nicely used siRNA to determine the effect of reduced TMEM63C in human podocytes in culture. Finally, they performed loss of function studies in the zebrafish and present the findings that tmem63c is necessary for an intact glomerular filtration barrier. Overall, this is a very well written and presented study.

1) The authors show nicely that they can rescue the zebrafish tmem63c crispants with tmem63c cRNA. The ATG morpholino injected animals need to be assessed similarly for rescue, to demonstrate specificity of the morpholino reagent.

2) The authors should assess what happens to podocytes in the tmem63c morphants or crispants by whole mount in situ hybridization or immunofluorescence studies at stages after edema has developed, to determine whether proteinuria is associated with podocyte loss. The TEM images currently suggest GBM disruption, but quantification of podocyte retention on the GBM would improve the manuscript in this aspect.


Author response

Reviewer #1:

1) TMEM63C expression in human kidney: Are there any previous findings to demonstrate that TMEM63C is expressed in human kidney?

To the best of our knowledge, there are no previous reports in the literature that demonstrate TMEM63C expression in the human kidney.

Assessment of the human protein atlas database (https://www.proteinatlas.org/) indicates TMEM63C expression in the human kidney both in the glomerular and tubular compartment (https://www.proteinatlas.org/ENSG00000165548-TMEM63C/tissue/kidney#img).

2) Other genes expression of causative genes in FSGS patients: How is the expression of other causative genes for FSGS such as ACTN4, TRCP6, PAX2 etc. in FSGS patients? Also could you provide the potential interaction between TMEM63C.

Analysis of other causative genes in FSGS patients:

We realize that the exploration of other causative genes in FSGS patients appears intriguing. However, such analysis is challenging for several reasons: i) the increasing number of genes (>50) that are currently implicated in FSGS (De Vriese, Sethi, Nath, Glassock, and Fervenza, 2018; Lepori, Zand, Sethi, Fernandez-Juarez, and Fervenza, 2018); ii) the limited material of renal biopsy samples available; iii) and the limited number of antibodies, e.g. for PAX2, available for reliable immunohistochemistry analysis in human biopsy tissues. Furthermore, changes in expression may differ depending on the selected genes. For example, TRPC6 protein has been shown to be markedly upregulated in carriers of TRPC6 mutations but can be unchanged in patients with FSGS and proteinuria without TRPC6 mutations (Gigante et al., 2011). Thus, a conclusive analysis would require a comprehensive genotype-phenotype analysis (De Vriese et al., 2018; Lepori et al., 2018).

Nevertheless, we agree that determining the expression of selected podocyte related proteins would be insightful and in response to the reviewer´s comment, we set out to analyze expression of the slit pore protein nephrin (NPHS1) and the cytoskeleton protein ACTN4 in our set of FSGS patients. Mutations in both of these genes are known to cause FSGS (Kaplan et al., 2000; Kestila et al., 1998). Furthermore, reduced protein expression of both nephrin and ACTN4 has been shown in acquired forms of FSGS as well (Kim, Hong, Kim, and Lee, 2002; Testagrossa, Azevedo Neto, Resende, Woronik, and Malheiros, 2013). First, we investigated the expression of nephrin in our cohort of patients with FSGS. We found that nephrin expression was significantly reduced in parallel to TMEM63C in our set of patients with FSGS. This change of nephrin expression is in accordance with previously published results (Kim et al., 2002). Moreover, we observed a shift from the normal linear staining pattern to a granular staining pattern also in agreement with previous reports (Doublier et al., 2001; Wernerson et al., 2003). Although there is little known about the interaction between TMEM63C and nephrin, we can still speculate about a link between these two proteins: nephrin is involved in mechanosensing and integration of the slit pore with the mechanotransduction machinery of the podocyte and TMEM63C has originally been suggested as a mechanosensitive ion channel (Hou et al., 2014; Zhao, Yan, Liu, Zhang, and Ni, 2016). Therefore, both molecules could be involved in mechanosensing of the podocyte.

Next, we set out to investigate the expression of the cytoskeleton protein ACTN4. ACTN4 is involved in mechanotransduction as well (Feng et al., 2018) and could thus be functionally linked to TMEM63C. However, when we stained a cohort of healthy control subjects for ACTN4 (Santa Cruz Biotechnology), we observed a heterogeneous staining pattern and some cases did not show any staining. Staining of another cohort of healthy controls resulted in the same heterogeneous staining pattern. This is not in accordance with previously published results on ACTN4 expression in the normal glomerulus (Liu et al., 2011; Testagrossa et al., 2013). We therefore omitted the immunostaining for ACTN4 in patients with FSGS.

The new data on nephrin staining in FSGS patients are presented in revised Figure 5 together with the TMEM63c analysis.

The data obtained in podocytes in cell culture in Figure 5G-J of the original manuscript are presented in the new Figure 6 of the revised manuscript (because otherwise the new Figure 5 would be overloaded).

The text of the revised manuscript has been adapted with the corresponding information in the Results section:

“In addition to TMEM63C expression, we analyzed the expression of nephrin protein as a pivotal component of the slit diaphragm of the GFB (Figure 5G-J) (Kestila et al., 1998). […] Moreover, we observed a shift from the normal linear staining pattern to a granular staining pattern as reported (Figure 5H, J) (Doublier et al., 2001; Wernerson et al., 2003).”

In the Discussion section:

“Furthermore, the loss of TMEM63C was associated with a decrease and altered granular staining pattern of nephrin protein in glomeruli of FSGS patients as previously reported (Doublier et al., 2001; Wernerson et al., 2003). […] While our data cannot establish a functional link between changes in nephrin and TMEM63c in FSGS, they nonetheless demonstrate a concomitant deficiency of both proteins in this setting.”

In the Materials and methods section:

“For nephrin protein expression analysis we used a rabbit anti-nephrin antibody (Abcam). Paraffin embedded rat kidney sections and human biopsy samples were cut at 4 µm and incubated with the anti-TMEM63C antibody (1:1600 for rat tissue, 1:800 for human biopsies), the anti-WT1 antibody (1:500) or the anti-nephrin antibody (1:750).”

“For nephrin staining analysis, each glomerulus was scored based on staining pattern (linear or granular) and loss of staining (no loss, segmental loss or global loss).”

Please provide the explanation for the possible interaction between TMEM63C and the known causative genes for FSGS.

As indicated above multiple genes have been implicated to play a causative role or at least modify the susceptibility for the development of FSGS (De Vriese et al., 2018; Lepori et al., 2018; Yu et al., 2016). As indicated in the original manuscript, the function of the majority of the more than 300 TMEM proteins is currently unclear (Wrzesinski et al., 2015). The mechanism by which changes in Tmem63c expression cause podocyte damage and thus contribute to the final common pathway of injury in FSGS remains also unclear and cannot be elucidated by our current analysis. Accordingly, our data do not describe possible interactions between TMEM63c and the heterogeneous group of known causative FSGS genes. Nevertheless, previous reports suggested that Tmem63c and two other genes of the tmem63-family, e.g. Tmem63a and Tmem63b, are mammalian homologues of the hyperosmolarity-activated cation channel proteins AtCSC1 and its paralogue OSCA1 in plants (Hou et al., 2014; Zhao et al., 2016). Based on these reports it appeared tempting to speculate, that Tmem63c may be involved in mechanosensing in podocytes providing thus a functional basis for interactions with cytoskeleton genes, e.g. ACTN4 or slit pore proteins, e.g. nephrin, in podocytes. However the potential role of Tmem63c as a hyperosmolarityactivated cation channel remains controversial, since the activation by hyperosmolarity was not confirmed in a more recent study (Murthy et al., 2018). Moreover, the latter report indicated that Tmem63c is phylogenetically divergent from Tmem63a and Tmem63b and lacks their function to induce stretch-activated ion currents. Consequently, as indicated in the original manuscript further studies are needed to characterize the functional role of Tmem63c and to explore its potential to influence podocyte function as a novel target for therapeutic intervention (Endlich, Kliewe, and Endlich, 2017; Forst et al., 2016; Wieder and Greka, 2016).

In response to the reviewer´s comment revised the text in the Discussion as follows:

“The mechanism by which changes in Tmem63c expression cause podocyte damage and thus contribute to the final common pathway of injury in FSGS (De Vriese et al., 2018) remains however unclear and cannot be elucidated by our current analysis. […] Moreover, the latter report indicated that Tmem63c is phylogenetically divergent from Tmem63a and Tmem63b and lacks their function to induce stretch-activated ion currents.”

Reviewer #2:

1) The authors show nicely that they can rescue the zebrafish tmem63c crispants with tmem63c cRNA. The ATG morpholino injected animals need to be assessed similarly for rescue, to demonstrate specificity of the morpholino reagent.

We addressed this important issue as requested and performed rescue experiments using rat Tmem63c mRNA for the ATG morpholino injected zebrafish embryos. These experiments were carried out by co-injection of rat Tmem63c mRNA with tmem63c ATG-MO. In summary, we not only show the specificity of the observed knockdown phenotype in both crispants and morphants, but also conservation of the gene’s function across species. The new data on rescue experiments are presented in revised Figure 7I and L. For better visual inspection, the presentation in panel L was also adapted by showing in the revision the fluorescence deficiency rather than the presence of fluorescence as in the original submission.

The text of the revised manuscript has been adapted with the corresponding information in the Introduction:

“Loss-of-function studies in zebrafish induced a glomerular filtration barrier (GFB) defect compatible with the albuminuria phenotype, which was rescued upon co-injection of zebrafish tmem63c mRNA or rat Tmem63c mRNA, showing not only the specificity of the observed knockdown phenotype, but also conservation of the gene’s function across species.”

In the Results section:

“To verify the specificity of the observed phenotype rescue experiments were carried out by co-injection of zebrafish tmem63c mRNA with tmem63c sgRNA/Cas9 complexes and rat Tmem63c mRNA (mRNA sequence identity vs. zebrafish = 65.82% (Clustal 2.1), Figure 7—figure supplement 2) with tmem63c ATG-MO, respectively. For both cases similarly, the albuminuria-like phenotype could be specifically rescued proving knockdown specificity on the one hand and functional conservation of tmem63c across species on the other hand (Figure 7I, K and L). “

In the Discussion section:

“Importantly, rescue of the observed phenotypes in zebrafish with rat Tmem63c mRNA pointed to the functional conservation across species.”

In the Materials and methods section:

“Rescue of tmem63c ATG-MO-mediated gene knockdown.

Tmem63c cDNA (Rattus norvegicus) was synthesized by Thermo Fisher Scientific using their GeneArt Gene synthesis service. […] The mRNA was diluted to a concentration of 100 ng/μl and injected into one-cell stage zygotes. For in vivo rescue of the tmem63c ATG-MO-mediated knockdown, mRNA with a concentration of 100 ng/µl and ATG-MO with a concentration of 0.3 mM were subsequently injected into the same zygote at one- or one to four cell-stage, respectively.”

In addition we performed also similar rescue experiments in the ex2-sdMO, i.e. the splicing site morpholino, gaining a similar knockdown phenotype and positive rescue results as shown in Figure 7—figure supplement 1. To prove the efficiency of the tmem63c ex2-sdMO an additional reverse transcriptase (RT) – PCR was carried out as shown in Figure 7—figure supplement 1F.

The text of the revised manuscript has been adapted with the corresponding information in the Results section:

“We corroborated this finding in tmem63c crispants (Figure 7J, Figure 7—figure supplement 1D) as well as by using another splice-blocking morpholino (Figure 7—figure supplement 1E, I); both experiments showed a similar albuminuria-like phenotype.”

In the Materials and methods section:

“Morpholinos (MO) of the following sequences were synthesized by Gene Tools LLC Philomath: tmem63c ATG-MO 5’-CAGGCCAGGACTCAAACGCCATTGC-3’, tmem63c ex2sdMO 5'-TGTTATCATAGATGATGTACCAGCC-3', and standard control oligo (Control-MO) 5’-CCTCTTACCTCAGTTACAATTTATA-3’. Tmem63c ATG-MO was used at a final concentration of 0.3 mM (Figure 7B), tmem63c ex2-sdMO was used at a final concentration of 0.5 mM (Figure 7—figure supplement 1).”

Reverse transcriptase (RT)-PCR in zebrafish embryos

For efficiency analysis of the tmem63c ex2-sdMO a reverse transcriptase (RT)-PCR was carried out (Figure 7—figure supplement 1F). […] Eucaryotic elongation factor 1 α 1, like 1 (eef1a1l1) was used as a loading control and amplified using the following primers: forward: TGGAGACAGCAAGAACGACC, reverse: GAGGTTGGGAAGAACACGCC.”

“For in vivo rescue of the tmem63c ex2-sdMO-mediated knockdown, mRNA with a concentration of 100 ng/µl and ex2-sdMO with a concentration of 0.5 mM were subsequently injected into the same zygote at one- or one to four cell-stage, respectively.”

2) The authors should assess what happens to podocytes in the tmem63c morphants or crispants by whole mount in situ hybridization or immunofluorescence studies at stages after edema has developed, to determine whether proteinuria is associated with podocyte loss. The TEM images currently suggest GBM disruption, but quantification of podocyte retention on the GBM would improve the manuscript in this aspect.

As suggested, we performed immunofluorescence studies at 96 hours post fertilization (hpf), i.e. the time after development of edema, in crispants. To analyze, whether the observed albuminuria-like phenotype upon tmem63c-deficiency is associated with the loss of podocytes, we used confocal microscopy to image glomeruli of Tg(wt1b:EGFP) embryos. We employed the transgenic Tg(wt1b:EGFP) zebrafish line, because it allows specific visualization of the pronephros and is thus suitable for this analysis.(Perner, Englert, and Bollig, 2007).

In this analysis, we first observed that tmem63c crispants (tmem63c ex2-sgRNA) exhibit a widened Bowman´s space and increased glomerular volumes compared to uninjected controls (133457 ± 59547 µm3 vs 67067 ± 21933 µm3, P = 0.04) as quantified by 3D surface reconstruction. In addition, we observed dilated capillary loops in the crispants. The subsequent quantification of podocyte cell number revealed no changes in absolute cell number, while relative podocyte cell number normalized to the total glomerular volume was significantly decreased compared to uninjected controls.

The new data are presented in revised Figure 8 of the revised manuscript. In this regard, we also feel that it would be more appropriate to show the structural analysis of glomeruli together in one figure. Consequently, we added the TEM results, which we showed in Figure 6 of the original manuscript to the revised Figure 8. In addition, Videos 1-3 are supplied together with the revised manuscript to further illustrate the software-based 3D analysis done in confocal z-stacks.

The text of the revised manuscript has been adapted with the corresponding information in the Results section:

“To analyze, whether the observed albuminuria-like phenotype upon tmem63c-deficiency is associated with the loss of podocytes, we utilized confocal microscopy to image glomeruli of Tg(wt1b:EGFP) embryos. […] Collectively, our data indicate the conserved role for tmem63c in GFB function between fish, rodents, and humans.”

In the Discussion section:

“Further structural analysis by confocal microscopy revealed dilated capillary loops and enlarged glomerular volumes with a reduction of relative podocyte number in relation to glomerular volume (podocyte density) in tmem63c-deficient embryos. Thus, our data reveal an important role of tmem63c for normal development of capillary structure and podocyte function of the glomerulus in zebrafish.”

In the Materials and methods section:

Confocal microscopy of zebrafish embryos and quantification of podocyte cell number and glomerular volume.

Tg(wt1b:EGFP) embryos at 96 hpf were fixed in PEM buffer containing 4% formaldehyde and 0.1% Triton-X 100 for 2 hours at RT or overnight at 4°C. […] Spots located outside the glomerular surface were manually deleted.”

Video legend:

Video 1-3. Representative spot segmentation of podocyte nuclei and 3D surface reconstruction of glomeruli in Tg(wt1b:EGFP) zebrafish embryos.[…] Shown here are representative analysis results of uninjected controls (Video 1), Cas9-Controls (Video 2) and tmem63c ex2-sgRNA-injected embryos (Video 3).”


Article and author information

Author details

  1. Angela Schulz

    1. Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin, Germany
    2. Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing
    Contributed equally with
    Nicola Victoria Müller
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4576-8035
  2. Nicola Victoria Müller

    1. Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin, Germany
    2. Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    3. Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Electrochemical Signaling in Development and Disease, Berlin, Germany
    Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Contributed equally with
    Angela Schulz
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7261-830X
  3. Nina Anne van de Lest

    Department of Pathology, Leiden University Medical Center (LUMC), Leiden, The Netherlands
    Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  4. Andreas Eisenreich

    1. Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin, Germany
    2. Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing
    Competing interests
    No competing interests declared
  5. Martina Schmidbauer

    1. Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, Berlin, Germany
    2. Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  6. Andrei Barysenka

    Westfälische Wilhelms University, Genetic Epidemiology, Institute for Human Genetics, Münster, Germany
    Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Writing—review and editing
    Competing interests
    No competing interests declared
  7. Bettina Purfürst

    Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Core Facility Electron Microscopy, Berlin, Germany
    Resources, Data curation, Formal analysis, Validation, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  8. Anje Sporbert

    Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Advanced Light Microscopy, Berlin, Germany
    Resources, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  9. Theodor Lorenzen

    Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    Investigation, Writing—review and editing
    Competing interests
    No competing interests declared
  10. Alexander M Meyer

    Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  11. Laura Herlan

    Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  12. Anika Witten

    Westfälische Wilhelms University, Genetic Epidemiology, Institute for Human Genetics, Münster, Germany
    Formal analysis, Validation, Investigation, Methodology, Writing—review and editing
    Competing interests
    No competing interests declared
  13. Frank Rühle

    Westfälische Wilhelms University, Genetic Epidemiology, Institute for Human Genetics, Münster, Germany
    Resources, Formal analysis, Validation, Investigation, Visualization, Writing—original draft, Writing—review and editing
    Competing interests
    No competing interests declared
  14. Weibin Zhou

    Division of Nephrology, Department of Medicine, Center for Human Disease Modeling, Duke University School of Medicine, Durham, United States
    Resources, Writing—review and editing
    Competing interests
    No competing interests declared
  15. Emile de Heer

    Department of Pathology, Leiden University Medical Center (LUMC), Leiden, The Netherlands
    Conceptualization, Resources, Validation, Writing—review and editing
    Competing interests
    No competing interests declared
  16. Marion Scharpfenecker

    Department of Pathology, Leiden University Medical Center (LUMC), Leiden, The Netherlands
    Conceptualization, Supervision, Validation, Methodology, Writing—original draft, Project administration, Writing—review and editing
    Competing interests
    No competing interests declared
  17. Daniela Panáková

    DZHK (German Centre for Cardiovascular Research), Partner site Berlin, Berlin, Germany
    Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Validation, Methodology, Writing—original draft, Project administration, Writing—review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8739-6225
  18. Monika Stoll

    1. Westfälische Wilhelms University, Genetic Epidemiology, Institute for Human Genetics, Münster, Germany
    2. Department of Biochemistry, Maastricht University, Genetic Epidemiology and Statistical Genetics, Maastricht, The Netherlands
    Conceptualization, Data curation, Software, Supervision, Validation, Methodology, Writing—original draft, Project administration, Writing—review and editing
    Contributed equally with
    Reinhold Kreutz
    Competing interests
    No competing interests declared
  19. Reinhold Kreutz

    1. Institute of Clinical Pharmacology and Toxicology, Berlin Institute of Health, Berlin, Germany
    2. DZHK (German Centre for Cardiovascular Research), Partner site Berlin, Berlin, Germany
    Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Validation, Methodology, Writing—original draft, Project administration, Writing—review and editing
    Contributed equally with
    Monika Stoll
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4818-211X


Deutsche Forschungsgemeinschaft (DFG KR 1152-3-1)

  • Reinhold Kreutz

Helmholtz-Gemeinschaft (VH-NG-736)

  • Daniela Panáková

European Commission (WNT/CALCIUM IN HEART-322189)

  • Daniela Panáková

Deutsche Forschungsgemeinschaft (SCHU 2604/1-1)

  • Angela Schulz

Deutsche Forschungsgemeinschaft (Project number 394046635 - SFB 1365)

  • Reinhold Kreutz

Deutsche Hochdrckliga (DHL) (Stiftungsprofessur Hypertensiologie)

  • Reinhold Kreutz

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We acknowledge the contributions of Karen Böhme, Bettina Bublath, Marianne Jansen-Rust, Claudia Plum, Christiane Priebsch, Christina Schiel, Sabine Wunderlich, and Malu Zandbergen for excellent laboratory or animal assistance. Tg(wt1b:GFP) line was kindly provided by Christoph Englert. This study was supported by the Deutsche Hochdruckliga (DHL) Hypertensiologie Professur to RK, by the grants from the Deutsche Forschungsgemeinschaft (DFG) KR 1152-3-1 (RK) and SCHU 2604/1–1 (ASch), by the DFG (German Research Foundation) – Project number 394046635 – SFB 1365 (RK, DP), and by the grants from the Helmholtz Young Investigator Program VH-NG-736, and Marie Curie CIG from the European Commission (WNT/CALCIUM IN HEART-322189) (DP).


Human subjects: All biopsy samples were handled and analyzed anonymously in accordance with the Dutch National Ethics Guidelines (Code for Proper Secondary Use of Human Tissue, Dutch Federation of Medical Scientific Societies). Because this study concerned retrospectively collected anonymized material, no informed consent was necessary following the Dutch National Ethics Guidelines. This study is in agreement with the Declaration of Helsinki and the Department of Health and Human Services Belmont Report and the use of the patient biopsies was approved by the medical ethical committee of the LUMC (registration number G16.110).

Animal experimentation: All experimental work in rat models was performed in accordance with the guidelines of the Charité-Universitätsmedizin Berlin and the local authority for animal protection (Landesamt für Gesundheit und Soziales, Berlin, Germany) for the use of laboratory animals. The registration numbers for the rat experiments are G 0255/09 and T 0189/02. Zebrafish were bred, raised and maintained in accordance with the guidelines of the Max Delbrück Center for Molecular Medicine and the local authority for animal protection (Landesamt für Gesundheit und Soziales, Berlin, Germany) for the use of laboratory animals, and followed the 'Principles of Laboratory Animal Care' (NIH publication no. 86-23, revised 1985) as well as the current version of German Law on the Protection of Animals.

Senior Editor

  1. Mark I McCarthy, University of Oxford, United Kingdom

Reviewing Editor

  1. Tim Aitman, University of Edinburgh, United Kingdom

Publication history

  1. Received: September 16, 2018
  2. Accepted: March 20, 2019
  3. Accepted Manuscript published: March 22, 2019 (version 1)
  4. Version of Record published: April 23, 2019 (version 2)


© 2019, Schulz et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 815
    Page views
  • 166
  • 2

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Genetics and Genomics
    Bogdan Andrei Mirauta et al.
    Research Article

    Human disease phenotypes are ultimately driven primarily by alterations in protein expression and/or function. To date, relatively little is known about the variability of the human proteome in populations and how this relates to variability in mRNA expression and to disease loci. Here, we present the first comprehensive proteomic analysis of human induced pluripotent stem cells (iPSC), a key cell type for disease modelling, analysing 202 iPSC lines derived from 151 donors, with integrated transcriptome and genomic sequence data from the same lines. We characterised the major genetic and non-genetic determinants of proteome variation across iPSC lines and assessed key regulatory mechanisms affecting variation in protein abundance. We identified 654 protein quantitative trait loci (pQTLs) in iPSCs, including disease-linked variants in protein coding sequences and variants with trans regulatory effects. These include pQTL linked to GWAS variants that cannot be detected at the mRNA level, highlighting the utility of dissecting pQTL at peptide level resolution.

    1. Genetics and Genomics
    Constance Nugent, Katsunori Sugimoto

    A strain of budding yeast that contains one large chromosome reveals how the telomere capping complex CST maintains linear but not circular chromosomes.