Robo2 regulates synaptic oxytocin content by affecting actin dynamics
- Weizmann Institute of Science, Israel
Figures
Figure 1 with 1 supplement
Identification and quantification of synaptic OXT content in neurohypophyseal axonal termini.
(A–C) Scheme describing the neurohypophyseal vasculature and synapses in 5 days post-fertilization (dpf) transgenic reporter Tg(oxt:EGFP). The dense neurohypophyseal synapses (NS) were used as an …
-
Figure 1—source data 1
Experimental data for Figure 1: colocalization analysis of synaptic OXT and EGFP fluorescence.
The excel sheet includes values for weighted colocalization coefficients calculated from confocal images of immunostained transgenic (oxt:gal4; UAS:Syp-EGFP) larval neurohypophysis.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig1-data1-v3.xlsx
Figure 1—video 1
Confocal Z-stack images and three-dimensional render of 5 days post-fertilization (dpf) transgenic reporter zebrafish Tg(oxt:EGFP) following immunostaining with anti-EGFP and a specific antibody against endogenous OXT protein.
Figure 2
Osmotic challenge decreases synaptic OXT neuropeptide content.
(A) Transgenic Tg(oxt:EGFP) larvae at eight dpf were treated with hypertonic solution (25% artificial sea salt in Danieau buffer) for 20 or 60 min. The larvae that underwent 60 min treatment were …
-
Figure 2—source data 1
Experimental data for Figure 2: Neurohypophyseal synaptic parameters upon hyperosmotic challenge.
The excel sheet includes values for number and volume of neurohypophyseal synapses and OXT puncta upon hyperosmotic challenge.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig2-data1-v3.xlsx
Figure 3 with 1 supplement
Actin polymerization regulates synaptic OXT content.
(A–D) Spatial relationship between actin and neuropeptide in hypophysis revealed by super-resolution microscopy. Stochastic optical reconstruction microscopy (STORM) images of the neurohypophyseal …
-
Figure 3—source data 1
Experimental data for Figure 3: Neurohypophyseal synaptic parameters upon actin perturbation.
The excel sheet includes values for number and volume of neurohypophyseal synapses and OXT puncta from confocal imaging of larvae that were subjected to DMSO vs cytochalasin treatment or embryos that underwent transgenesis experiment for OXT-neuron specific EGFP vs cofilin expression.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig3-data1-v3.xlsx
Figure 3—video 1
Three-dimensional render showing STORM images of endogenous OXT and Lifeact-EGFP in neurohypophyseal synapses.
Figure 4
Robo2 regulates synaptic actin dynamics.
(A) robo2 is expressed in larval zebrafish neurosecretory preoptic area (NPO) and colocalizes with Oxytocin neurons. Confocal Z-stack images showing fluorescent in situ hybridization (FISH) of …
-
Figure 4—source data 1
Experimental data for Figure 4: Actin dynamics in neurohypophyseal synapses.
The excel sheet includes values for FRAP data of neurohypophyseal synaptic Lifeact-EGFP in robo2 +/+ vs robo2 -/- larvae. The full-scale normalized values, dynamic and stable fraction generated from Easy-Frap software are shown.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig4-data1-v3.xlsx
Figure 5
Slit3-Robo2 signaling regulates synaptic OXT levels.
(A–E) Assessment of synaptic oxytocin content in robo2 mutant was performed as described in Figure 1F. Graph showing the number and size of neurohypophyseal synapses (NS) (A,B) and colocalizing OXT …
-
Figure 5—source data 1
Experimental data for Figure 5: Neurohypophyseal synaptic parameters upon gain- or loss-of function of slit3 or robo2.
The excel sheet includes values for number and volume of neurohypophyseal synapses and OXT puncta from confocal imaging of larval neurohypophysis of multiple experiments namely: 1) robo2 +/+ vs robo2 -/- 2) Mock vs morpholino-injected embryos 3) Mosaic transgenesis experiments by hypophyseal expression of tRFP vs slit3.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig5-data1-v3.xlsx
Figure 6 with 2 supplements
Robo2 regulates synaptic OXT dynamics.
(A) Schematic of novel transgenic OXT tool Tg(oxt:OXT-SP-EGFP-OXT), in which oxt promoter drives expression of Oxytocin precursor protein with an internally-tagged EGFP at the C-terminus of the …
-
Figure 6—source data 1
Experimental data for Figure 6: OXT-EGFP dynamics in neurohypophyseal synapses.
The excel sheet includes values for FRAP data of neurohypophyseal synaptic OXT-EGFP in robo2 +/+ vs robo2 -/- larvae. The full-scale normalized values generated from Easy-Frap software are shown.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig6-data1-v3.xlsx
Figure 6—figure supplement 1
Specificity of antibodies to oxytocin and neurophysin.
(A) Schema of protein coded by oxt gene. Antibodies anti-OXT and PS45 were targeted to processed OXT and neurophysin respectively. SP denotes signal peptide, arrow indicates cleavage site. …
Figure 6—video 1
Three-dimensional render showing STORM images of endogenous OXT in neurohypophyseal synapses of 5 days post-fertilization (dpf) old zebrafish larvae.
Figure 7 with 1 supplement
Robo2 regulates synaptic OXT levels via Cdc42.
(A,B) Assessment of the effect of Oxytocin neuron-specific overexpression of actin-regulating protein Cdc42 in Tg(oxt:Gal4) larvae. Transgenic embryos expressing the oxt:Gal4 driver were injected …
-
Figure 7—source data 1
Experimental data for Figure 7: Synaptic fluorescence values upon OXT-neuron specific Cdc42 over-expression.
The excel sheet includes values for EGFP- and OXT- fluorescence values of neurohypophyseal synapses in larvae that were subjected to OXT-neuron specific EGFP or Cdc42(T17N) or Cdc42(G12V) expression in robo2 +/+ vs robo2 -/-.
- https://cdn.elifesciences.org/articles/45650/elife-45650-fig7-data1-v3.xlsx
Figure 7—figure supplement 1
Cdc42 regulates synaptic OXT levels.
(A) Assessment of the effect of Oxytocin neuron-specific overexpression of actin-regulating protein Cdc42 in Tg(oxt:Gal4) larvae. Transgenic embryos expressing the oxt:Gal4 driver were injected with …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent, TL (D. rerio) | Tg(oxt:EGFP)wz01 | (Blechman et al., 2011) | ZDB-ALT-111103–1 | |
| Genetic reagent, TL (D. rerio) | Tg(oxt:gal4)wz06 | (Anbalagan et al., 2018) | ZDB-ALT-171113–2 | |
| Genetic reagent, TL (D. rerio) | Tg(oxt:OXTSP-EGFP-OXT)wz14 | This manuscript | ZDB-ALT-181219–3 | |
| Genetic reagent, TL (D. rerio) | Tg(UAS:sypb-EGFP)biu5 | (Zada et al., 2014) | ZDB-ALT-150115–1 | Lior Appelbaum (Bar-Ilan Univ.) |
| Genetic reagent, TL (D. rerio) | Tg(UAS:Lifeact-GFP)mu271 | (Helker et al., 2013) | ZDB-ALT-130624–2 | Wiebke Herzog (Univ. of Muenster) |
| Genetic reagent, TL (D. rerio) | Tg(UAS:BotxLCB-GFP)icm21 | (Sternberg et al., 2016) | ZDB-ALT-160119–9 | Claire Wyart (ICM, Paris) |
| Genetic reagent, TL (D. rerio) | Tg(UAS:NTR-mCherry)c264 | (Davison et al., 2007) | ZDB-ALT-070316–1 | |
| Genetic reagent, TL (D. rerio) | Tg(−1.0pomca:Gal4-VP16)wz05 | (Anbalagan et al., 2018) | ZDB-ALT-171113–1 | |
| Genetic reagent, TL (D. rerio) | robo2ti272z | (Fricke et al., 2001) | ZDB-ALT-980203–1097 | Joshua Bonkowsky (Univ. of Utah) |
| Recombinant DNA reagent | Tol2 pDEST myl7:mCherry | (Golan et al., 2016) | Berta Levavi-Sivan, HUJI, Rehovot | |
| Recombinant DNA reagent | Tol2 10xUAS:EGFP; myl7:mCherry | This manuscript | Materials and methods - Transgenesis experiments | |
| Recombinant DNA reagent | Tol2 oxt:OXTSP-EGFP-OXT; myl7:EGFP | This manuscript | Materials andmethods -Transgenesis experiments | |
| Recombinant DNA reagent | Tol2 UAS:Cdc42-G12V-EGFP | (Ando et al., 2013) | Naoki Mochizuki (NCVC, Osaka) | |
| Recombinant DNA reagent | Tol2 UAS:Cdc42-T17N-EGFP | (Ando et al., 2013) | Naoki Mochizuki (NCVC, Osaka) | |
| Recombinant DNA reagent | Tol2 pME mCherry-Utrophin-CH | (Andersen et al., 2011) | Mary Hallaron (Univ. of Wisconsin) | |
| Recombinant DNA reagent | Tol2 10xUAS:mCherry-Utrophin-CH; myl7:mCherry | This manuscript | Materials and methods - Visualization of synaptic F-actin | |
| Recombinant DNA reagent | Tol2 pME Slit3(SignalPeptide)-EmeraldGFP-Slit3 | This manuscript | Joshua Bonkowsky (Univ. of Utah) | |
| Recombinant DNA reagent | Tol2 10xUAS: Slit3(SignalPeptide)-EmeraldGFP-Slit3; myl7:mCherry | This manuscript | Materials and methods -Transgenesis experiments | |
| Antibody | Guinea pig polyclonal, anti-OXT | Peninsula labs | T-5021; RRID:AB_518526 | (1:200) |
| Antibody | Rabbit polyclonal, anti-GFP | ThermoFisher | A11122; RRID:AB_221569 | (1:200) |
| Antibody | Mouse monoclonal, anti-Neurophysin | (Ben-Barak et al., 1984) | PS45; RRID:AB_2062089 | Harold Gainer (NINDS, Bethesda) |
| Antibody | Alexa 488- or 647- Secondary antibodies | Jackson ImmunoResearch Laboratories | (1:200) Materials and methods - Immuno-fluorescent staining | |
| Antibody | Alexa 568- or 647- Secondary antibodies | Invitrogen | (1:2000) Materials andmethods - Visualization of synaptic F-actin | |
| Chemical compound | Cytochalasin D | Sigma | C8273 | 400 nM |
| Chemical compound | Glucose oxidase | Sigma | G2133 | 8440 AU |
| Chemical compound | Catalase | Sigma | C40 | 70200 AU |
| Software | R | (R Development Core Team, 2013) | Materials and methods – Statistical analysis | |
| Software | Turboreg plugin | (Thévenaz et al., 1998) | Materials andmethods – Statistical analysis | |
| Software | EasyFRAP | (Rapsomaniki et al., 2012) | Materials andmethods – FRAP analysis | |
| Sequence-based reagent | TATATCCTCTGAGGCTGATAGCAGC | Gene Tools, (Barresi et al., 2005) | ZDB-MRPHLNO-050927–3 | Materials andmethods -Transgenesis experiments. slit3 knockdown |
| Sequence-based reagent | gaatgactcctcgtcgctct and gctgaggcatcttgtctgta | Sigma | Materials andmethods -Animals. robo2 genotyping | |
| Sequence-based reagent | gcatttacaacagctccatc | Sigma | Materials andmethods -Animals.robo2 sequencing primer | |
| Sequence-based reagent | tgtacaggcagatgtcaggc and TAATACGACTCACTATAGGG-tcctcctccagtagagccag | Sigma | Materials andmethods - In situ hybridization. PCR primers for robo2 probe |
Additional files
-
Source code 1
R script for data extraction: R script to extract animal-wise neurohypophyseal synaptic parameters from the Volocity software-derived batch output files.
- https://cdn.elifesciences.org/articles/45650/elife-45650-code1-v3.r
-
Source code 2
R script for data transformation: R script to log-transform the neurohypophyseal synaptic volume data.
- https://cdn.elifesciences.org/articles/45650/elife-45650-code2-v3.r
-
Source code 3
R script for data analysis: R script to analyze log-transformed neurohypophyseal synaptic data.
- https://cdn.elifesciences.org/articles/45650/elife-45650-code3-v3.r
-
Source code 4
R script for Lifeact-EGFP FRAP data analysis: R script to analyze neurohypophyseal synapse.
Lifeact-EGFP FRAP data by linear-mixed model (Figure 4D).
- https://cdn.elifesciences.org/articles/45650/elife-45650-code4-v3.rmd
-
Source code 5
R script for OXT-EGFP FRAP data analysis: R script to analyze neurohypophyseal synapse.
OXT-EGFP FRAP data by linear-mixed model (Figure 6I).
- https://cdn.elifesciences.org/articles/45650/elife-45650-code5-v3.rmd
-
Source code 6
R script for correlation analysis: R script to analyze and plot neurohypophyseal synaptic.
EGFP vs OXT fluorescence by linear regression (Figure 7).
- https://cdn.elifesciences.org/articles/45650/elife-45650-code6-v3.r
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/45650/elife-45650-transrepform-v3.pdf
