1. Cancer Biology
Download icon

NRG1 is a critical regulator of differentiation in TP63-driven squamous cell carcinoma

Short Report
  • Cited 4
  • Views 1,781
  • Annotations
Cite this article as: eLife 2019;8:e46551 doi: 10.7554/eLife.46551


Squamous cell carcinomas (SCCs) account for the majority of cancer mortalities. Although TP63 is an established lineage-survival oncogene in SCCs, therapeutic strategies have not been developed to target TP63 or it’s downstream effectors. In this study we demonstrate that TP63 directly regulates NRG1 expression in human SCC cell lines and that NRG1 is a critical component of the TP63 transcriptional program. Notably, we show that squamous tumors are dependent NRG1 signaling in vivo, in both genetically engineered mouse models and human xenograft models, and demonstrate that inhibition of NRG1 induces keratinization and terminal squamous differentiation of tumor cells, blocking proliferation and inhibiting tumor growth. Together, our findings identify a lineage-specific function of NRG1 in SCCs of diverse anatomic origin.



Within the past decade, lineage addiction has emerged as a common paradigm to explain how certain tumors depend on co-opted survival and self-renewal programs that drive the normal development of the tissues from which they arise (Garraway and Sellers, 2006). During normal development and tissue homeostasis, ‘master regulator’ transcription factors control large sets of genes regulating cellular identity, differentiation and survival (Chan and Kyba, 2013). Amplifications of master regulators act as oncogenic drivers in cancers arising in the tissues whose development they normally control. Examples include MITF, which directs melanocyte development and is amplified in some melanomas and NKX2.1, which directs development of the distal lung epithelium and is amplified in some lung adenocarcinomas (Kendall et al., 2007). Some cancers remain fully dependent on transcription factors expressed by precursor cells of the lineage from which they develop, even in the absence of genetic alterations in these genes. Examples include AR in prostate cancer and ESR1 in luminal breast cancers (Garraway and Sellers, 2006).

Despite varied anatomic origins, squamous cell cancers (SCCs) share many common properties, including genetic and epigenetic alterations (Dotto and Rustgi, 2016). The TP63 transcription factor exemplifies an important lineage dependency in SCCs (Ramsey et al., 2013). Amplification of TP63 is prevalent in SCCs, and TP63 expression is used to distinguish SCCs from other cancer subtypes in multiple tissues (Dotto and Rustgi, 2016). SCCs arise in numerous organ systems that contain stratified or pseudo-stratified epithelia, including the lung, head and neck, esophagus, skin, bladder and cervix. Interestingly, like other lineage survival oncogenes, TP63 is a key regulator of the progenitor cells in the basal cell compartment during normal development and homeostasis of most stratified or pseudostratified epithelia (Mills et al., 1999; Yang et al., 1999). Despite its established role as a driver of lineage dependency, TP63 is a transcription factor, and as such is challenging to target therapeutically.

Here we show that NRG1 expression is directly regulated by TP63 in SCCs of various organs, and that co-expression of NRG1 and its receptor ERBB3 is prevalent in SCCs. Moreover, we find that many of the SCC models that co-express NRG1 and ERBB3 depend on NRG1 autocrine signaling in vivo, in contrast to non-squamous cancers that exhibit NRG1 autocrine signaling but are not dependent on it.

Results and discussion

TP63 regulates NRG1 expression

TP63 is highly expressed in basal cells of various epithelia and is required for the progenitor cell function. In addition, TP63 acts as a key survival factor and driver of SCCs (Rocco et al., 2006; Thurfjell et al., 2005). Interestingly, studies of normal mammary basal cells established that TP63 can directly activate NRG1 transcription (Forster et al., 2014). Therefore, we evaluated whether this transcriptional wiring exists in SCCs. We found that NRG1 and TP63 expression significantly correlated in both esophageal and lung squamous cell carcinomas (LUSC) as determined from The Cancer Genome Atlas (TCGA) transcriptome data (Figure 1A). TP63 has two isoform classes that either contain (TA-TP63) or lack (DeltaN-TP63) an N-terminal transactivation domain. Despite lacking this domain, deltaN-TP63, the major isoform expressed in SCCs, functions as both a positive and negative transcriptional regulator of different target gene subsets (Hibi et al., 2000; Moll and Slade, 2004). We evaluated whether TP63 regulates NRG1 expression in SCCs using siRNAs to knockdown all TP63 isoforms (siTP63 # 14) or only the TA-TP63 isoforms (siTA-TP63 # 13) and assessing expression of both isoforms of the NRG1 EGF-like domain, NRG1α and NRG1β, by qPCR in the OE-21 and KYSE-140 SCC cell lines. Knockdown of just the TA isoforms modestly reduced NRG1 expression, whereas silencing of all isoforms robustly decreased NRG1 expression (Figure 1B). We further expanded this finding in an additional cell line, KYSE-180 (Figure 1C). Knockdown of deltaN-TP63 significantly reduced NRG1 transcripts, confirming that deltaN-TP63 regulates NRG1 expression in SCCs. Immunoblotting confirmed knockdown of deltaN-TP63 at the protein level. In addition, we determined whether NRG1 is a direct transcriptional target of deltaN-TP63 by ChIP-PCR using antibodies for TP63alpha and deltaN-TP63 and PCR primers that amplify the NRG1 promoter. Binding of both TP63 isoforms was significantly enriched at the region −30 kB from the transcriptional start site (TSS), which encompasses the TP63 binding motif, compared to the control locus at −21 kB (Figure 1D). Together, these data suggest that deltaN-TP63 directly regulates NRG1 transcription in SCC.

TP63 regulates NRG1 in SCC.

(A) Correlation of TP63 and NRG1 in LUSC (n = 223) and Esophageal (n = 263) patient samples in TCGA data set. Statistical significance was determined by two-tailed test and Pearson correlation (r) was determined. (B) Relative expression of TP63, NRG1α and NRG1β upon TP63 knockdown using siRNA in OE21 and KYSE-140 SCCs. (C) Relative expression of TP63 (all, TA and deltaN isoforms), NRG1α, NRG1β upon TP63 knockdown using siRNA in KYSE-180 SCC. Expression of TA and deltaN TP63 and upon TP63 knockdown by siRNA. siRNAs for TA-TP63 (#13), all isoform-TP63 (#14), deltaN-TP63 [#1, #2, #3) and non-target control (NTC#3, NTC#4). Relative quantitation by qPCR in B and C is mean with standard deviation relative to dharmafect transfection reagent control. (D) ChIP analysis of p63alpha and deltaNp63 binding −30 kB from the NRG1 transcriptional start site (TSS) in KYSE-180 SCC. IgG and primers amplifying the −21 kB region were used as controls. Data is represented as average with standard error of mean from three independent experiments. One-way ANOVA test was used to determine the statistical significance in comparison to IgG. *p<0.05.


Efficacy of anti-NRG1 in in vivo models of SCC

Emerging evidence suggest that high ERBB3 or high NRG1 expression is associated with poor clinical outcome in SCCs (Qian et al., 2015). We reasoned that in order for NRG1 to promote SCC growth, tumors would have to co-express NRG1 and its receptor ERBB3. Interestingly, NRG1/ERBB3 co-expression appeared prevalent in lung and head and neck SCCs, but was notably rare in lung adenocarcinoma across the various cancer datasets available in TCGA (Figure 2A). To ascertain whether SCCs co-expressing NRG1 and ERBB3 are responsive to inhibition of NRG1 signaling, we screened a panel of cell lines from SCC indications including lung, esophageal and skin for growth sensitivity to an NRG1 blocking antibody (Hegde et al., 2013) in vitro. Anti-NRG1 treatment modestly inhibited the growth of cell lines expressing both NRG1 and ERBB3 (Figure 2B). Because the p63 transcriptional program is critical for both maintenance and cell fate determination of epithelial progenitor cells, we reasoned that perturbation of this program would be more impactful in vivo. We assessed the effect of NRG1 inhibition on xenograft tumors derived from the FaDu head and neck, HCC95 lung and KYSE-180 esophageal squamous cell carcinoma lines. Importantly, anti-NRG1 treatment markedly inhibited tumor growth in each of these models to an extent that far exceeded that observed in vitro. (Figure 3A). In addition, increased keratinization and changes in tumor cell morphology were observed in tumors from anti-NRG1 treated mice (Figure 4—figure supplement 1). To further evaluate the NRG1-dependency in ERBB3/NRG1 co-expressing squamous cell cancers, we tested the efficacy of anti-NRG1 in lung SCC PDX models. Again, anti-NRG1 significantly inhibited the tumor growth of three models that co-express NRG1 and ERBB3, resulting in tumor stasis (Figure 3B and Figure 3—figure supplement 1).

Modest but significant growth inhibition of SCCs by anti-NRG1 treatment in vitro.

(A) NRG1 and ERBB3 mRNA levels in head and neck squamous carcinoma (HNSC), lung squamous carcinoma (LUSC) and lung adenocarcinoma (LUAD) patient samples from TCGA. (B) In vitro growth of different SCC cell lines in the presence of anti-NRG1 or control anti-Ragweed antibody. Expression levels of NRG1, Erbb3, Erbb4 and TP63 (RPKM) for each cell line are shown below the respective in vitro growth data. Average growth is presented as is mean with standard error of mean relative to anti-Ragweed from four independent experiments with more than three replicates in every experiment. Statistical significance was determined using t-test with * indicates p<0.05.

Figure 3 with 2 supplements see all
Anti-NRG1 significantly inhibits the tumor growth in vivo of SCCs that express both NRG1 and ERBB3.

Effect of anti-NRG1 or anti-Ragweed (control) antibodies in (A) FaDu (head and neck), HCC95 (lung) and KYSE-180 (esophagus) SCC cell lines in preclinical mouse xenograft models, N = 8–12 mice/group, (B) Lung SCC PDX models, n = 4 mice/group, and (C) Lgr5CreERT2; Ptenflox/flox; KrasLSL-G12D/+ skin GEMM, n = 7–8 mice/group. Statistical significance was determined by Log-rank test. Red arrow indicates the time of the final antibody dose. (D) H and E staining for GEMM skin at the end of study.


Although NRG1 is not widely recognized as an important factor in cutaneous SCC, downregulation of endogenous NRG1 expression occurs during differentiation of cultured keratinocytes, and activation of NRG1 signaling inhibits keratinocyte differentiation and promotes neo-epidermal outgrowth in human skin explant cultures (De Potter et al., 2001). Furthermore, mice with Krt5-Cre-driven knockout of Erbb3 in basal progenitor cells are resistant to carcinogen-induced skin tumorigenesis and exhibit defective wound healing (Dahlhoff et al., 2015), while Krt5-driven overexpression of deltaN-TP63 enhances carcinogen-induced skin tumorigenesis (Devos et al., 2017). Therefore, we tested the effect of inhibiting NRG1 in the Lgr5CreERT2; Ptenflox/flox; KrasLSL-G12D/+ genetically engineered model of cutaneous SCC. In this highly aggressive tumor model, anti-NRG1 dramatically increased the progression free survival (PFS) compared to control treatment, nearly doubling time to progression from 14 to 27 days (p<0.002) (Figure 3C–D). Progression was defined as enlargement and redness of the lips and snout, as this was the only clinical observation in the animals and macroscopic skin tumors were observed only upon necropsy. In control animals, the dermis was expanded by confluent nests of squamous cells forming tumors that > 80% of the dermis in skin lesions sampled from 5 of 7 animals. In contrast, in 5 of 6 anti-NRG1 treated animals, lesions were limited to central dilated keratinization without dermal expansion, consistent with epidermal inclusion cyst, a benign squamous proliferation (Figure 3D).

Our analysis of RNAseq data across tumor indications also revealed prevalent NRG1/ERBB3 co-expression in ovarian cancer. We tested the effect of anti-NRG1 on a panel of ovarian cancer cell lines and indeed proliferation of cell lines expressing both NRG1 and ERBB3 was inhibited by anti-NRG1 in vitro (Figure 3—figure supplement 2A). However, unlike the SCC models, ovarian PDX models expressing NRG1 and ERBB3 were not sensitive to anti-NRG1 treatment in vivo (Figure 3—figure supplement 2B–C) suggesting that dependence on NRG1 signaling may be specific to the TP63 driven cancer types. Together these data support a role for NRG1 in mediating p63 lineage dependency in SCCs.

Anti-NRG1 induces squamous differentiation

To explore the mechanism mediating the robust tumor growth inhibition observed in anti-NRG1 treated SCC models, we repeated the in vivo studies for three SCC xenograft models of different anatomic origins and collected tumors after treatment. Histological analysis revealed that in all models anti-NRG1-treated tumors exhibited a more well-differentiated appearance, with increased eosinophilic cytoplasm consistent with enhanced keratinization, indicating that anti-NRG1 treatment was driving differentiation in these tumors (Figure 4—figure supplement 1 and Figure 4A). Moreover, anti-NRG1-treated tumors showed a dramatic increase in the expression of KRT10, a differentiation-specific keratin normally restricted to the post-mitotic layers of stratified-keratinizing and cornifying epithelia (Figure 4A). Immunoblot analyses of treated tumors showed that anti-NRG1 inhibited ERBB3 activation and decreased the levels of multiple proliferation markers, consistent with a mechanism in which differentiation is induced at the expense of proliferation (Figure 4B and Figure 4—figure supplement 2). Markers of apoptosis were not affected (Figure 4B).

Figure 4 with 3 supplements see all
Anti-NRG1 induces squamous differentiation and inhibits proliferation in SCCs.

(A) Representative image of KRT10 (differentiation marker) staining of tumor from FaDu and HCC95 SCC models upon anti-NRG1 treatments compared to anti-Ragweed control. N = 5 mice/group. (B) Protein levels of apoptosis markers upon anti-NRG1 treatment in vivo in HCC95 SCC xenografts. phospho-ERBB3 level was used to assess inhibition of signaling. Expression of proliferation markers upon one and three doses of anti-NRG1 relative to anti-Ragweed treatment in vivo in HCC95 lung SCC by RNAseq. (C) Expression of lung basal cell differentiation markers after one or three doses of anti-NRG1 and one dose of anti-Ragweed treatment in HCC95 lung SCC xenograft tumors by RNAseq. N = 5 mice/group. Expression of (D) squamous differentiation markers and progenitor cell related markers following three doses of anti-NRG1 relative to anti-Ragweed treatment in HCC95 lung SCC xenograft tumors by RNAseq. Average fold change relative to anti-ragweed from n = 5 mice/group.

Figure 4—source data 1

Panel of human airway basal cell gene signature in Figure 4C (as published by Hackett et al., 2011).


To broadly assess changes in expression of differentiation markers, we analyzed RNAseq data, focusing on a gene expression signature of human airway basal cells (Hackett et al., 2011). Anti-NRG1 treatment caused significant changes in the levels of nearly all the genes in the panel (Figure 4C). Notably, many of the genes upregulated by anti-NRG1 treatment are associated with differentiation of stratified epithelia, such as KLK7, BNC1 and ADAMTS1, demonstrating a profound effect on the differentiation state of the tumor cells that becomes more pronounced with ongoing treatment. Of note, NRG1 is itself a marker of airway basal cells, and anti-NRG1 treatment resulted in downregulation of the NRG1 transcript. Upon differentiation, airway basal cells cluster with keratinocytes in unsupervised analyses (Hackett et al., 2011). Therefore, we evaluated markers of keratinocyte differentiation and found that anti-NRG1 treatment resulted in strong upregulation of several well-established keratinocyte differentiation markers (Figure 4D and Figure 4—figure supplement 2), while the expression of several lung progenitor cell markers was decreased (Figure 4D and Figure 4—figure supplement 2). Treatment of SCC cell lines with anti-NRG1 in vitro also increased expression of the differentiation markers KRT1, KRT10, IVL and KRTDAP (Figure 4—figure supplement 3). However, the magnitude of upregulation was much lower than in the tumors, consistent with the more modest effects of anti-NRG1 treatment on the proliferation of cell lines in vitro.

NRG1 signaling supports progenitor cell function and regeneration in a diverse set of normal tissues (Bartus et al., 2016; Bersell et al., 2009). Our data suggest that NRG1 may serve a similar function downstream of TP63 in tumors derived from squamous epithelia. We show that treating squamous tumors with an NRG1 blocking antibody reduced proliferation, concomitant with induced cellular differentiation and increased keratin production. The marked difference in response between in vitro and in vivo models is consistent with a pro-differentiation effect of anti-NRG1 treatment, as cancer cells are known to undergo dedifferentiation and lose tissue-specific expression patterns and differentiation capacity when cultured long term on plastic. In contrast, although NRG1 and ERBB3 co-expression is prevalent in ovarian tumors, ovarian cancer models did not respond to NRG1 inhibition in vivo. Our model predicts such a result, given that fewer than 10% of epithelial ovarian tumors express p63 and it is not a lineage oncogene in this cancer type.

EGFR signaling is known to be an important driver in SCCs and anti-EGFR therapies have been approved for the treatment of head and neck and lung SCCs (Sacco and Worden, 2016; Thakur and Wozniak, 2017). In contrast, NRG1-ERBB3 signaling has been implicated as a resistance mechanism to anti-EGFR therapies (Wheeler et al., 2008). However, dual inhibition of ERBB3 and EGFR did not show significant clinical benefit compared to EGFR inhibition alone. Our findings on the role of NRG1 in SCCs raise the possibility that NRG1 may still provide resistance to EGFR therapeutics through ERBB4 receptor activation when ERBB3 is inhibited, and provide rationale for exploring the clinical benefit of NRG1 inhibition in combination with EGFR inhibition in SCCs.

Materials and methods

Key resources table
Reagent type
(species)or resource
DesignationSource or referenceIdentifiersAdditional information
Strain, strainbackground
(M. musculus)
C.B-17 SCID beige miceCharles River LabsCB17.Cg-PrkdcscidLystbg-J/Crl
Strain, strainbackground
(M. musculus)
Athymic nude miceHarlan Sprague Dawley (Livermore facility)Hsd:Athymic Nude-Foxn1nu
Genetic reagent
(M. musculus)
Lgr5CreERT2+; tdTomato; KrasG12Dwt/ki; PTENloxP/loxPLgr5CreERT2+; pubmed id:21927002
tdTomato; pubmed id: PMC2840225
KrasG12Dwt/ki; pubmed id: 11751630
PTENloxP/loxP; pubmed id: 11691952
LAR, Genentech
AntibodyAnti-RagweedGenentech9652In vivo: 20 mg/kg, i.p.,qwk
In vitro: 20 ug/ml
AntibodyAnti-NRG1GenentechYW538.24.71In vivo: 20 mg/kg, i.p.,qwk
In vitro: 20 ug/ml
AntibodydeltaNTP63 (Rabbit Polyclonal IgG)BiolegendRRID:AB_2256361
Cat. #: 619001
WB (1:1000)
AntibodyActin (Mouse IgG)BD BioscienceRRID:AB_2289199
Cat. #: 612656
WB (1:5000)
Antibodyp-ERBB3 (Rabbit mAb)Cell Signaling TechnologiesRRID:AB_2099709
Cat. #: 4791
WB (1:500)
AntibodyERBB3 (Rabbit mAb)Cell Signaling TechnologiesRRID:AB_2721919
Cat. #: 12708
WB (1:500)
AntibodyRabbit PARP (Rabbit polyclonal)Cell Signaling TechnologiesRRID:AB_2160739
Cat. #: 9542
WB (1:1000)
AntibodyCleaved caspase-3 (Rabbit mAb)Cell Signaling TechnologiesCat. #: 9664WB (1:1000)
AntibodyTP63 alpha (Rabbit mAb)Cell Signaling TechnologiesRRID:AB_2637091
Cat. #: 13109
CHIP (1:100)
WB (1:1000)
AntibodyKRT10 (Rabbit polyclonal)Covance BiologicalsRRID:AB_291580
Cat. #: PRB-159P
IHC (1:1000)
Commercial assay or kitTP63-allLife TechnologiesHs00978340_m1qPCR
Commercial assay or kitTA-TP63-TALife TechnologiesHs00186613_m1qPCR
Commercial assay or kitdeltaN-TP63Life TechnologiesHs00978339_m1qPCR
assay or kit
NRG1aLife TechnologiesHs01103794_m1qPCR
Commercial assay or kitNRG1bLife TechnologiesHs00247624_m1qPCR
Commercial assay or kitKRTDAPLife TechnologiesHs00415563_m1qPCR
Commercial assay or kitKRT1Life TechnologiesHs00196158_m1qPCR
Commercial assay or kitKRT10Life TechnologiesHs00166289_m1qPCR
Commercial assay or kitIVLLife TechnologiesHs00846307_s1qPCR
OtherTA-TP63Dharmacon#13 = J-003330–13siRNA
Otherall isoform-TP63Dharmacon#14 = J-003330–14siRNA
Software,algorithmGraphPad Prismgraphpad.comRRID:SCR_002798

Cell culture

Request a detailed protocol

Cancer cell lines were sourced, authenticated, tested for mycoplasma and maintained by the Genentech cell bank (gCELL) as described (Yu et al., 2015). Cell lines were cultured in either RPMI-1640 or Dulbecco’s modified Eagle’s medium (DMEM) growth medium supplemented with 10% of fetal bovine serum (FBS), 2 mmoL glutamine and penicillin/streptomycin. For growth assays, tumor cells were cultured in media containing 2% FBS in 96-well plates, and treated for 96 hr with 20 ug/ml of anti-NRG1 YW538.24.71 (previously described in Hegde et al., 2013) or anti-Ragweed (control) antibodies in triplicate, and assayed using cell titer blue (Promega). For effect of antibodies on differentiation in vitro, FaDu, HCC95 and KYSE-180 tumor cells were cultured with 20 ug/ml of antibodies for three days. RNA was analyzed and qPCR was performed using ABI TaqMan primer/probes as explained below. Detailed characterization of this anti-NRG1 (YW538.24.71) was previously described (Hegde et al., 2013). Statistical significance was determined by t-test from at least three independent experiments. Expression of NRG1, ERBB3 and ERBB4 was assessed by RNAseq.

Animal studies

Request a detailed protocol

All animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) at Genentech (LASAR numbers 10-2319A, 16–1304, 16-1304A, 16–0098, 16–1120, 16–1143 and 16–2005, 16–1120). For cell line xenograft studies, tumor cells were subcutaneously inoculated into C.B-17 SCID beige mice (FaDu) or athymic nude mice (HCC95 and KYSE-180). Mice were randomized into treatment groups when tumor volumes reached ~200mm3. Antibodies were dosed once per week intraperitoneally (i.p.) at 20 mg/kg for three doses, and tumor volumes and body weights were measured twice a week. For RNAseq, histology and western blot, HCC95 tumors were collected 72 hr after the first or third dose. For patient-derived tumor xenografts, tumor fragments were subcutaneously implanted into Balb/C nude mice, which were randomized into treatment groups (n = 5) when tumor volumes reached 150–250 mm3. Dosing and measurements were performed as noted above for 3–4 weeks.

Genetically engineered mouse model

Request a detailed protocol

The Lgr5CreERT2+; tdTomato; KrasG12Dwt/ki; PTENloxP/loxP squamous skin cancer mouse model (manuscript in preparation), was used following Genentech IACUC guidelines. At 10–15 weeks of age, mice were dosed once with Tamoxifen (100 mg/kg, i.p.). Three days after a single tamoxifen dose, mice were divided into two groups with mice of similar proportion of age and sex, and dosed with anti-Ragweed or anti-NRG1 antibodies (20 mg/kg, i.p., once in a week).

Tumor growth analysis

Request a detailed protocol

A mixed-modeling approach was used to analyze tumor volumes for xenograft and PDX studies as explained earlier (Hegde et al., 2013). Cubic regression splines were used to fit a nonlinear profile to the time courses of log2 tumor volume for each treatment group and tumor volumes were plotted as fitted tumor volumes (mm3). Percent tumor growth inhibition (TGI) was calculated relative to the average tumor volume of control (anti-Ragweed) mice. Kaplan-Meier analysis was used to determine progression-free survival for the skin GEMM SCC mice. Log-rank analysis was used for statistical analysis to compare treatment groups.

RNA interference

Request a detailed protocol

Cells were plated in medium without antibiotics and transfected with 5 nmol/L of siRNA using Dharmafect transfection reagent (Dharmacon). siRNAs for TA-TP63 (#13 = J-003330–13), all isoform-TP63 (#14 = J-003330–14), deltaN-TP63 [#1 (S = GGACAGCAGCAUUGAUCAAUU, AS = UUGAUCAAUGCUGCUGUCCUU), #2 (S = CUUCUUAAGUAGAUUCAUAUU, AS = UAUGAAUCUACUUAAGAAGUU, #3(S = GGGACUUGAGUUCUGUUAUUU, AS = AUAACAGAACUCAAGUCCCUU)], and negative control non target control (NTC#3, NTC#4) were purchased from Dharmacon. RNA was isolated after 72 hr using a RNeasy Plus kit (Qiagen). cDNA was prepared using the Advantage RT for PCR kit (Clontech), and qPCR was performed using ABI master mix, and the results were validated by three independent experiments using the following Taqman assays (Life Technologies): TP63-all (Hs00978340_m1), TA-TP63-TA (Hs00186613_m1), deltaN-TP63 (Hs00978339_m1), NRG1a (Hs01103794_m1) and NRG1b (Hs00247624_m1).


Request a detailed protocol

72 hr after siRNA transfection, cells were washed twice with PBS and lysed in RIPA buffer containing protease/phosphatase inhibitors at 4°C. Protein concentrations were determined by BCA (Thermo Scientific). Proteins were separated by SDS-PAGE, transferred to nitrocellulose membrane and stained with the indicated antibodies. HCC95 tumors from the in vivo studies were processed similarly for analysis of pharmacodynamic and apoptotic markers. Antibodies: TP63 alpha (Cell Signaling Technologies, CST 13109), deltaNTP63 (Biolegend 619001), actin (BD Bioscience 612656), p-ERBB3 (CST 4791), ERBB3 (CST 12708), PARP (CST 9542) and Cleaved caspase-3 (CST 9664).

Chromatin immunoprecipitation (ChIP)

Request a detailed protocol

ChIP was performed from KYSE-180 cells (Diagenode iDeal CHIP-seq kit for Transcription factors). Cultures of 25 million cells were fixed and cross-linked with formaldehyde (1.1%) for 15 min at room temperature and stopped with glycine. The cell pellet was re-suspended in ChIP lysis buffers and sonicated using a Bioruptor sonicator (Diagenode) to produce chromatin fragments averaging 200–500 bp. Sheared chromatin was incubated overnight at 4°C with protein A-coated magnetic beads plus either anti-TP63 alpha (CST 13109), anti-deltaNTP63 (BioLegend 619001) or isotype control antibody. Beads were washed, DNA was eluted and crosslinks were reversed during an incubation overnight at 65°C. Samples were treated with iPure beads and DNA was purified. Quantitative PCR was performed using sybr green PCR master mix (Applied Biosystem) to assess enrichment at the NRG1 promoter. The results were validated by three independent experiments. The ChIP ratio was calculated as enrichment over noise, normalized to the input. Statistical significance was determined by one-way ANOVA. Primers used for CHIP PCR were −21 kB NRG1 promoter (5’-TTCAAAAGGGAGTGCCAACTTTTCC-3’, 5’-GGTGCCTCACCTTTCTTCTTCCTGTCC-3’) and −30 KB NRG1 promoter (5’-GCCCCAAATTCTTTTGCCCCTTAT-3’, 5’-TTGGTTGGCTTGCTGAAGCTGGTGT-3’) from NRG1 transcript start site as described earlier (Forster et al., 2014).


Request a detailed protocol

Tumors collected after one or three dose of antibodies were fixed in 10% neutral-buffered formalin overnight then transferred to 70% ethanol, processed and embedded into paraffin. Tumor sections were subjected to H and E and IHC using rabbit polyclonal anti-Cytokeratin10 (KRT10) antibody (Covance Biologicals, PRB-159P), incubated at a concentration of 1.0 ug/mL for 60 min at room temperature and binding was visualized using ABC-Peroxidase Elite followed by DAB chromagen and counter stained with Mayer’s hematoxylin. KRT10 expression was reviewed manually by a translational pathologist (JMG) and scored for the percentage of cells demonstrating moderate to strong immunoreactivity, excluding areas of necrosis (0–100%).


Request a detailed protocol

RNA-seq libraries were prepared using TruSeq RNA Sample Preparation kit (Illumina, CA) and sequenced on Illumina HiSeq 2500 sequencers, yielding an average of 34 million single-end reads (50 bp) per sample. Reads were aligned to the human genome version NCBI GRCh37 using GSNAP. Expression counts per gene were obtained by counting the number of reads aligned concordantly within a pair and uniquely to each gene locus as defined by NCBI, Ensembl gene annotations, and RefSeq mRNA sequences. Differential gene expression analysis was performed using edgeR. Gene enrichment analysis was performed on the edgeR differential expression results using the Gsea Preranked tool available through the Broad’s GSEA application. DESeq was used to compute the variance stabilized expression values for plotting the expression heat maps.

Statistical analysis

Request a detailed protocol

Graphical and statistical data were generated with Microsoft Excel or GraphPad Prism (GraphPad Software, La Jolla, CA, USA). Statistical significance of differences between the results was assessed using a standard 2-tailed t-test or one-way ANOVA using Prism. p<0.05 was considered statistically significant.


  1. 1
  2. 2
  3. 3
    What is a master regulator?
    1. SS Chan
    2. M Kyba
    Journal of Stem Cell Research & Therapy, 3, 10.4172/2157-7633.1000e114, 23885309.
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
    p63 and p73: roles in development and tumor formation
    1. UM Moll
    2. N Slade
    Molecular Cancer Research : MCR 2:371–386.
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24

Decision letter

  1. William C Hahn
    Reviewing Editor; Dana-Farber Cancer Institue, United States
  2. Kevin Struhl
    Senior Editor; Harvard Medical School, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "NRG1 is a critical component of the TP63 transcriptional program driving squamous cell cancers in multiple tissues" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Kevin Struhl as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


The reviewers believe that the findings are of potential significance and may have therapeutic implications. Although NRG1 has already been established as a TP63 target in breast cells and NRG1/ERBB signaling has already been reported to play a role in squamous cell carcinoma biology, a strength of the work is the use of human material, murine models and cancer cell lines as well as an antibody to block NRG, which suggests that blocking NRG may affect tumor maintenance. However, the reviewers request additional work to more clearly demonstrate the interaction of NRG and p63, to clarify the specificity of some of the reagents and to determine whether squamous differentiation is the basis of the observed findings.

Essential revisions:

1) The title is quite broad. The reviewers were unclear whether the findings are true in all squamous tissues or are specific for a particular squamous epithelium. This should be addressed, and the title should be changed to more accurately reflect the findings presented in the manuscript.

2) Further evidence to support co-expression/co-localization of NRG and p63 in SCC would strengthen the manuscript.

3) The use of the blocking antibody is powerful but the details of how specific this reagent is for NRG are lacking. Further evidence of specificity and/or the use of genetics to support the findings are necessary.

4) The authors should clarify whether tumors regress or arrest after treatment with the antibody. A waterfall plot of all of the tumors would be helpful.

5) Is there squamous differentiation in cell lines? This needs to be assessed. If so, it is surprising that this did not affect proliferation.

6) Although several experimental models are used, it would be helpful to perform similar experiments in at least three cell lines or to determine whether there are specific squamous tissues in which these findings are most relevant.

For your information, we have included the reviews below, as you might find them helpful when preparing the revised version of your manuscript.

Reviewer #1:

In this manuscript Jackson and co-workers investigated the role of p63-NRG in tumor cell proliferation and tumor maintenance. They found that p63 and NRG expression co-occurred in the TCGA lung and esophageal cancer datasets. They showed that suppressing p63 decreased NRG expression and was localized to the NRG. Using a NRG antibody they showed that there was a modest effect on cell proliferation but a stronger effect in some tumor models. They argue that the effects on tumors is due to SCC differentiation.

Overall these experiments are well described and well controlled. The observations are timely and important and may have therapeutic implications. However, there are a few points that require some additional clarification.

The authors argue that the NRG plays a key role in SCC or those that co-express NRG and p63. However, they do not show this directly. It would be helpful to perform experiments in a panel of cell lines in which these markers are noted so that the point can be made clear. This is particularly important since the authors show that some tumors don't respond to anti-NRG, suggesting that they don't co-express p63 and NRG but this is not shown.

It is also not clear whether the tumors regress or simply arrest. It would be helpful to show a waterfall plot for each tumor.

It is also not clear why squamous differentiation would not affect proliferation. Have the authors formally assessed whether there is evidence of squamous differentiation in the 2D cultures?

Reviewer #2:

The authors show that NRG1 is a transcriptional target of p63 and argue that anti-NRG1 could be an effective therapy for a wide variety of squamous cell carcinomas. This data is interesting; however, the authors use a very limited number of cell lines and in vivo models. To strengthen the manuscript, the authors should focus on one type of SCC with a more robust number of cell lines and in vivo models.

Reviewer #3:

In this manuscript Hedge et al. show that TP63 directly regulates NRG1 expression in squamous cell carcinoma (SCC) cell lines. In addition, they show that treatment with an anti-NRG1 antibody inhibits the growth of SCC xenograft models and provide evidence that inhibition of NRG1 induces keratinization and terminal squamous differentiation of tumor cells. Although the data are potentially interesting, there are some major issues with the experimental design, which include the following:

1) All experiments aimed at elucidating NRG1 function utilize an NRG1 blocking antibody. However, the authors fail to demonstrate (e.g. by using genetic tools) that the phenotype observed in their model systems upon antibody treatment is specifically mediated by NRG1 inhibition.

2) NRG1 has already been established as a TP63 target in breast cells and NRG1/ERBB signaling has already been reported to play a role in squamous cell carcinoma biology. The authors provide some evidence that NRG1 inhibition decreases SCC cell proliferation and promotes cell differentiation. This hypothesis should be further investigated in properly controlled in 3D cell culture models where the role of ERBB3 and ERBB4 signaling could also be addressed.

3) In Figure 1, it would be important to perform double IHC/IF to demonstrate co-localization of deltaN-TP63 and NRG1 at the protein level in tumor cells within human SCC tissue samples.

4) In Figure 3, immunoblotting data documenting inhibition of Nrg1/ErbB signaling in the treated in vivo models should be provided.

5) In Figure 4, data for anti-Ragweed control (3 dose) should be showed for all experiments.


Author response

Essential revisions:

1) The title is quite broad. The reviewers were unclear whether the findings are true in all squamous tissues or are specific for a particular squamous epithelium. This should be addressed, and the title should be changed to more accurately reflect the findings presented in the manuscript.

We revised the title to better reflect the findings. The new title is “NRG1 is a Critical Regulator of Differentiation in TP63-driven Squamous Cell Carcinoma”.

2) Further evidence to support co-expression/co-localization of NRG and p63 in SCC would strengthen the manuscript.

This is a great suggestion to demonstrate the co-localization of NRG1/p63. Unfortunately, the available NRG1 antibodies do not work for immunofluorescence, IHC or even western blot. We have tested many different antibodies for NRG1 in the past and have found them to be non-selective. We always perform shRNA knockdown of NRG1 to validate any commercial antibodies and so far, we have not found one that shows a specific staining pattern. Moreover, the blocking antibodies used in this paper are also not suitable for those applications. However, we would like to bring to the reviewer’s attention that we have provided TP63, NRG1, ERBB3 and ERBB4 mRNA levels in a table format just below the in vitro growth assay in Figure 2.

3) The use of the blocking antibody is powerful but the details of how specific this reagent is for NRG are lacking. Further evidence of specificity and/or the use of genetics to support the findings are necessary.

Details on antibody selectivity can be found in our earlier publication (Hegde et al., 2013). We have added a sentence pointing the readers to this publication for additional details on the antibody properties.

4) The authors should clarify whether tumors regress or arrest after treatment with the antibody. A waterfall plot of all of the tumors would be helpful.

We have included a waterfall plot of all tumors as a supplementary figure. The tumors indeed undergo stasis not regression, consistent with the role of NRG1 in regulating differentiation, not cell survival. As discussed in our final paragraph, EGFR and other signaling pathways also play an important role in driving these tumors and inhibition of NRG1 could drive deeper responses when combined with EGFR inhibition.

5) Is there squamous differentiation in cell lines? This needs to be assessed. If so, it is surprising that this did not affect proliferation.

We thank the reviewers for raising this critical question. We carried out qPCR analysis of four differentiation markers in three different squamous cell carcinoma lines treated with anti-NRG1 or control antibody in vitro. The result are provided in Figure 4—figure supplement 3. Consistent with our in vivo findings, the cell lines treated in vitro also showed significant increases in multiple differentiation markers. However, the magnitude of induction was much lower in vitro, consistent with the more modest effects on proliferation observed in vitro compared to the tumor growth inhibition in vivo.

6) Although several experimental models are used, it would be helpful to perform similar experiments in at least three cell lines or to determine whether there are specific squamous tissues in which these findings are most relevant.

We have conducted additional experiments as mentioned above with 3 cell lines; FaDu (Head and Neck), HCC95 (lung) and KYSE-180 (esophageal) squamous cell carcinomas. The induction of differentiation markers upon treatment was highest in the lung and esophageal lines.


Article and author information

Author details

  1. Ganapati V Hegde

    Discovery Oncology, Genentech, South San Francisco, United States
    Present address
    ORIC Pharmaceuticals, South San Francisco, United States
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing—original draft, Writing—review and editing
    For correspondence
    Competing interests
    employee of Genentech Inc at the time of participation in this study
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6473-153X
  2. Cecile de la Cruz

    Translational Oncology, Genentech, South San Francisco, United States
    Formal analysis, Managed PDX in vivo studies
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  3. Jennifer M Giltnane

    Pathology, Genentech, South San Francisco, United States
    Formal analysis, Histology data analysis
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  4. Lisa Crocker

    Translational Oncology, Genentech, South San Francisco, United States
    Methodology, Performed FaDu of in vivo study
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  5. Avinashnarayan Venkatanarayan

    Discovery Oncology, Genentech, South San Francisco, United States
    Formal analysis, Conducted experiments, Analyzed data during manuscript revision
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  6. Gabriele Schaefer

    Translational Oncology, Genentech, South San Francisco, United States
    Resources, Methodology, Provided some of reagents and involved in the discussion
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  7. Debra Dunlap

    Pathology, Genentech, South San Francisco, United States
    Methodology, Performed IHC
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  8. Joerg D Hoeck

    Molecular Oncology, Genentech, South San Francisco, United States
    Methodology, Developed skin SCC mouse model
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  9. Robert Piskol

    Bioinformatics, Genentech, South San Francisco, United States
    Software, Formal analysis, Bioinformatics data analysis
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  10. Florian Gnad

    Bioinformatics, Genentech, South San Francisco, United States
    Software, Formal analysis, Bioinformatics data analysis
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  11. Zora Modrusan

    Molecular Biology, Genentech, South San Francisco, United States
    Resources, Methodology, RNAseq
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  12. Frederic J de Sauvage

    Molecular Oncology, Genentech, South San Francisco, United States
    Writing—review and editing, Involved in discussion, writing and editing of the manuscript
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  13. Christian W Siebel

    Discovery Oncology, Genentech, South San Francisco, United States
    Writing—review and editing, Involved in discussion, writing and editing of the manuscript
    Competing interests
    employee of Genentech Inc at the time of participation in this study
  14. Erica L Jackson

    Discovery Oncology, Genentech, South San Francisco, United States
    Present address
    Pharmacyclics, Sunnyvale, United States
    Conceptualization, Formal analysis, Supervision, Writing—original draft, Writing—review and editing
    For correspondence
    Competing interests
    employee of Genentech Inc at the time of participation in this study
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7100-8021


The authors declare that there was no funding for this work


The authors would like to thank gCELL, Genentech LAR, the Genentech pCORE laboratories and computational biology group and Elizabeth Lu for their help in various aspects of this work.


Animal experimentation: All animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) at Genentech. The animal studies included herein were performed based on approved IACUC protocol numbers (LASAR 10-2319A, 16-1304, 16-1304A, 16-0098, 16-1120, 16-1143 and 16-2005, 16-1120).

Senior Editor

  1. Kevin Struhl, Harvard Medical School, United States

Reviewing Editor

  1. William C Hahn, Dana-Farber Cancer Institue, United States

Publication history

  1. Received: March 4, 2019
  2. Accepted: May 28, 2019
  3. Accepted Manuscript published: May 30, 2019 (version 1)
  4. Version of Record published: July 2, 2019 (version 2)


© 2019, Hegde et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,781
    Page views
  • 288
  • 4

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Biochemistry and Chemical Biology
    2. Cancer Biology
    Lavanya H Palavalli Parsons et al.
    Research Article

    PARP-7 (TiPARP) is a mono(ADP-ribosyl) transferase whose proteins substrates and biological activities are poorly understood. We observed that PARP7 mRNA levels are lower in ovarian cancer patient samples compared to non-cancerous tissue, but PARP-7 protein nonetheless contributes to several cancer-related biological endpoints in ovarian cancer cells (e.g., growth, migration). Global gene expression analyses in ovarian cancer cells subjected to PARP-7 depletion indicate biological roles for PARP-7 in cell-cell adhesion and gene regulation. To identify the MARylated substrates of PARP-7 in ovarian cancer cells, we developed an NAD+ analog-sensitive approach, which we coupled with mass spectrometry to identify the PARP-7 ADP-ribosylated proteome in ovarian cancer cells, including cell-cell adhesion and cytoskeletal proteins. Specifically, we found that PARP-7 MARylates α-tubulin to promote microtubule instability, which may regulate ovarian cancer cell growth and motility. In sum, we identified an extensive PARP-7 ADP-ribosylated proteome with important roles in cancer-related cellular phenotypes.

    1. Cancer Biology
    2. Stem Cells and Regenerative Medicine
    Madeline Sandoval et al.
    Research Article Updated

    Skin epithelium can accumulate a high burden of oncogenic mutations without morphological or functional consequences. To investigate the mechanism of oncogenic tolerance, we induced HrasG12V in single murine epidermal cells and followed them long term. We observed that HrasG12V promotes an early and transient clonal expansion driven by increased progenitor renewal that is replaced with an increase in progenitor differentiation leading to reduced growth. We attribute this dynamic effect to emergence of two populations within oncogenic clones: renewing progenitors along the edge and differentiating ones within the central core. As clone expansion is accompanied by progressive enlargement of the core and diminishment of the edge compartment, the intraclonal competition between the two populations results in stabilized oncogenic growth. To identify the molecular mechanism of HrasG12V-driven differentiation, we screened known Ras-effector in vivo and identified Rassf5 as a novel regulator of progenitor fate choice that is necessary and sufficient for oncogene-specific differentiation.