H3K9me2 orchestrates inheritance of spatial positioning of peripheral heterochromatin through mitosis
Abstract
Cell-type-specific 3D organization of the genome is unrecognizable during mitosis. It remains unclear how essential positional information is transmitted through cell division such that a daughter cell recapitulates the spatial genome organization of the parent. Lamina-associated domains (LADs) are regions of repressive heterochromatin positioned at the nuclear periphery that vary by cell type and contribute to cell-specific gene expression and identity. Here we show that histone 3 lysine 9 dimethylation (H3K9me2) is an evolutionarily conserved, specific mark of nuclear peripheral heterochromatin and that it is retained through mitosis. During mitosis, phosphorylation of histone 3 serine 10 temporarily shields the H3K9me2 mark allowing for dissociation of chromatin from the nuclear lamina. Using high-resolution 3D immuno-oligoFISH, we demonstrate that H3K9me2-enriched genomic regions, which are positioned at the nuclear lamina in interphase cells prior to mitosis, re-associate with the forming nuclear lamina before mitotic exit. The H3K9me2 modification of peripheral heterochromatin ensures that positional information is safeguarded through cell division such that individual LADs are re-established at the nuclear periphery in daughter nuclei. Thus, H3K9me2 acts as a 3D architectural mitotic guidepost. Our data establish a mechanism for epigenetic memory and inheritance of spatial organization of the genome.
https://doi.org/10.7554/eLife.49278.001Introduction
In order for a dividing cell of a given lineage to maintain its identity, it must pass along to its progeny not only a complete copy of its genome, but also the memory of its specific cellular identity (Buchwalter et al., 2019; Towbin et al., 2013; Amendola and van Steensel, 2014). It is well appreciated that the spatial arrangement of the genome inside the nucleus contributes to regulation of cell-fate choices and differentiation (Peric-Hupkes et al., 2010; Phillips-Cremins et al., 2013). However, the mechanistic underpinnings of how the blueprint for cell-type-specific nuclear architecture is transmitted from mother to daughter cells in order to maintain cell identity remain poorly understood (Dekker et al., 2017).
The chromatin in eukaryotic cells is organized both structurally and functionally into subnuclear compartments (Towbin et al., 2013; Kohwi et al., 2013; Stadhouders et al., 2019) and recent developments in super-resolution microscopy (Cremer et al., 2017; Ricci et al., 2017), chromosome capture methods (Dekker et al., 2002; Dekker et al., 2013), and chromatin immunoprecipitation (ChIP) (Collas, 2010; Kubben et al., 2010) have greatly increased our understanding of 3D nuclear architecture (Naumova et al., 2013). Separation of transcriptionally active and inactive chromatin in three-dimensional space reinforces efficient regulation of gene expression and maintains silencing of heterochromatic loci (reviewed in Andrey and Mundlos, 2017; Buchwalter et al., 2019; Amendola and van Steensel, 2014; Bickmore, 2013). This is illustrated by examples of aberrant gene expression patterns that occur upon disruption of topological domains and, in extreme cases, are associated with oncogenic transformation (Andrey and Mundlos, 2017; Flavahan et al., 2016). Heterochromatin is segregated into spatially distinct subnuclear compartments including peripherally located lamina-associated domains (LADs) (Guelen et al., 2008), which encompass approximately 30–40% of the genome (Peric-Hupkes et al., 2010; Poleshko et al., 2017). Multiple examples in mammalian cell types indicate that proper positioning of LADs contributes to cell-type-specific gene expression (Peric-Hupkes et al., 2010; Poleshko et al., 2017; Robson et al., 2016). Likewise, in Drosophila, competence of neuroblasts to respond to inductive signals depends upon stage-specific reorganization of peripheral heterochromatin (Kohwi et al., 2013), and muscle differentiation in Caenorhabditis elegans requires anchoring of heterochromatin to the nuclear periphery (Gonzalez-Sandoval et al., 2015). These findings, combined with the observation that many developmental and lineage-specific genes reside in LADs, suggest a key role for peripheral heterochromatin in establishment and maintenance of cellular identity (Zullo et al., 2012; Poleshko et al., 2017; Peric-Hupkes et al., 2010). LADs are defined by their interaction with the nuclear lamina which is disassembled during cell division, posing a conundrum as to how cell-type specific LADs are remembered through mitosis.
The molecular mechanisms by which LADs are established and maintained at the nuclear periphery remain poorly understood. For example, there does not appear to be a clear targeting sequence that localizes areas of the genome to the nuclear periphery (Zullo et al., 2012; Meuleman et al., 2013). However, histone post-translational modifications have been implicated in LAD regulation. Proline Rich Protein 14 (PRR14) has been shown to recognize H3K9me3, found on both peripheral and nucleoplasmic heterochromatin, through an interaction with HP1 (Poleshko et al., 2013). In addition, work from our group and others has demonstrated a specific enrichment for H3K9me2 at the nuclear periphery, raising the possibility of a regulatory role in LAD positioning (Poleshko et al., 2017; Kind et al., 2013). CEC-4, a C. elegans chromodomain-containing protein, localizes to the nuclear periphery and has been shown to be a reader of H3K9 methylated chromatin (Gonzalez-Sandoval et al., 2015). Depletion studies using RNAi and loss-of-function mutants demonstrated that CEC-4 is required for peripheral heterochromatin anchoring but not transcriptional repression. While not all of the tethering complexes and molecular determinants responsible for the interaction of heterochromatin with the nuclear lamina have been determined, it is clear that these associations must be disrupted upon mitotic entry when the nuclear envelope breaks down and the chromosomes condense. Furthermore, these interactions must be precisely re-established upon mitotic exit when the cell reforms an interphase nucleus.
Entry into mitosis involves eviction of proteins, including RNA polymerase and many transcription factors, and reorganization of chromosomes into their characteristic metaphase form (Naumova et al., 2013). Remarkably, at mitotic exit, cell-type-specific chromatin architecture, transcription factor binding, and gene expression are re-established (reviewed in Oomen and Dekker, 2017; Palozola et al., 2019; Hsiung and Blobel, 2016; Probst et al., 2009; Festuccia et al., 2017). While both interphase nuclear architecture and post-mitotic restoration of transcription factor association with the genome have been extensively studied (Palozola et al., 2019; Kadauke and Blobel, 2013), our understanding of how cell-type-specific genome organization including LADs is restored in daughter cells after mitosis is less well developed.
Pioneering studies in the 1980 s revealed the necessity for DNA in the process of nuclear lamina reassembly after mitosis, and the activity of kinases and phosphatases were implicated in mediating interactions between lamin and chromosomes (Foisner and Gerace, 1993; Newport, 1987; Burke and Gerace, 1986; Gerace and Blobel, 1980), although the mechanistic explanation for the dependence of reassembly on chromatin has been unclear. Here, we utilize high resolution, single-cell imaging and oligopaints to simultaneously track 82 LAD and non-LAD genomic loci through mitosis. We show that the H3K9me2 modification of nuclear lamina-associated heterochromatin, revealed upon dephosphorylation of H3S10 at mitotic exit, provides a 3D spatial guidepost for genomic regions that are to be re-localized to the nuclear periphery following mitosis and that the nuclear lamina of daughter cells reassembles around the exposed H3K9me2 mark.
Results
H3K9me2 is an evolutionarily conserved mark of peripheral heterochromatin
Heterochromatin is organized in multiple compartments throughout the nucleus (Pueschel et al., 2016), and H3K9me2 is a posttranslational histone modification that specifically marks heterochromatin at the nuclear periphery (Poleshko et al., 2017). Immunostaining of murine NIH/3T3 fibroblasts for repressive histone modifications demonstrates the distribution of the major types of heterochromatin in the nucleus of a single cell (Figure 1a). H3K9me2 marks only peripheral heterochromatin, whereas H3K9me3 and H3K27me3 co-localize with heterochromatin in the nuclear interior, or at both the interior and the periphery (Figure 1a, Figure 1—figure supplement 1). The close association between H3K9me2 and the nuclear lamina marker Lamin B in single cell immunostaining is consistent with the correlation between H3K9me2 and Lamin B ChIP-seq data (Figure 1—figure supplement 1). The adjacency of H3K9me2 chromatin to the nuclear lamina was verified by super-resolution microscopy (Figure 1b). Stochastic Optical Reconstruction Microscopy (STORM) using a Voronoi tessellation confirms a non-random distribution of the H3K9me2 signal at the periphery of the nucleus (Figure 1—figure supplement 2). We further examined H3K9me2-marked heterochromatin across species and observe that restriction to the nuclear periphery is evolutionarily conserved from C. elegans to humans (Figure 1c) suggesting functional significance of the localization of this histone post-translational modification.

Localization of H3K9me2-marked chromatin at the nuclear periphery is evolutionarily conserved.
(A) Immunofluorescent confocal images illustrating localization of the indicated repressive chromatin marks in the nucleus of a NIH/3T3 cell, counterstained with DAPI; dashed line indicates position of the line signal intensity profiles. Scale bar: 5 μm (B) Representative super-resolution images of a NIH/3T3 cell stained for H3K9me2 and Lamin B obtained using Stochastic Optical Reconstruction Microscopy (STORM). Scale bars: 5 μm (left panel) and 1 μm (right panel) (C) Localization of H3K9me2-marked chromatin in distinct species, co-stained with nuclear lamina markers (Lamin one for C. elegans; Lamin B all others), counterstained with DAPI. Scale bars: 5 μm.
Previously, distinctions between genomic regions marked by H3K9me2 versus H3K9me3 were unclear, perhaps because of lack of specificity of relevant antibodies. Therefore, we extensively characterized the specificity of the H3K9me2 antibody employed in these studies (Figure 2, Figure 2—figure supplement 1). By preincubating the anti-H3K9me2 antibody with peptides representing each of the possible histone tail modifications before use in immunostaining, we were able to determine that the H3K9me2 antibody detects only the dimethyl modification and only on lysine 9 of histone H3 (Figure 2a, Figure 2—figure supplement 1). Additionally, by blocking the H3K9me2 antibody with an H3K9me2 peptide, the specific signal observed at the nuclear periphery can be distinguished from non-specific background signal observed in the nuclear interior and detected with signal intensity analysis (Figure 2b). This observation was further confirmed by STORM imaging (Figure 2c).

Anti-H3K9me2 antibody used in immunofluorescence assays is specific.
(A) Murine C2C12 cells stained with nuclear lamina marker Lamin A/C and H3K9me2 antibodies preincubated with indicated blocking peptides. (B) Starred images (*) from panel A, with H3K9me2 signal displayed in grayscale and signal intensity spectral view; line signal intensity profile, below, illustrates H3K9me2-specific signal (green) and non-specific antibody background (red). (C) STORM images of NIH/3T3 cell stained for H3K9me2 and blocked with mock or H3K9me2 peptide; line signal intensity profile below as in panel B.
H3K9me2 is required for nuclear peripheral localization of chromatin
Given the specificity of H3K9me2 for peripheral heterochromatin, we hypothesized that this epigenetic histone modification is necessary for peripheral localization of chromatin and might be recognized by a nuclear peripheral protein ‘reader’ to tether chromatin to the nuclear lamina (Figure 3a). In C. elegans, CEC-4 functions as a reader of methylated H3K9 and is localized to the nuclear periphery where it is thought to function as part of a tethering complex for peripheral heterochromatin (Gonzalez-Sandoval et al., 2015). Mammalian functional orthologues of CEC-4 have not yet been identified. Since CEC-4 is required for peripheral heterochromatin anchoring (Gonzalez-Sandoval et al., 2015), we compared the localization of H3K9me2 in wild-type and cec-4-null embryo cells. Immunostaining revealed a dramatic alteration in spatial patterning in which H3K9me2 is no longer restricted to the periphery in cec-4-null cells (Figure 3b and c, Figure 3—source data 1). Localization of the H3K9me2-marked chromatin at the nuclear lamina was restored by expression of the CEC-4-mCherry transgene (Figure 3c, Figure 3—figure supplement 1). Despite previous observations of CEC-4 binding to all methylated forms of H3K9 in vitro (Gonzalez-Sandoval et al., 2015), in vivo loss of CEC-4 does not affect H3K9me3 localization. H3K9me3 is found both at the nuclear periphery and in the nucleoplasm, but its localization does not vary between wide-type and cec-4-null embryo cells (Figure 3—figure supplement 1). These data suggest loss of a peripheral heterochromatin tether, CEC-4, results in a specific effect on H3K9me2-marked chromatin and not H3K9me3-marked chromatin.

H3K9me2 is essential for histone H3 positioning at the nuclear periphery.
(A) Schematic illustrating C. elegans protein CEC-4 tethering H3K9me2-marked chromatin to the nuclear periphery; INM: inner nuclear membrane. (B) Localization of H3K9me2-marked chromatin (green) in wild-type (WT) and cec-4-null C. elegans embryo cells, counterstained with nuclear lamina marker Lamin 1 (red) and DAPI (blue); 3D reconstruction (top); immunofluorescent confocal images of C. elegans embryo cells (bottom). Scale bars: 3 μm (C) Dot plot of the proportion of total H3K9me2-marked chromatin at the nuclear lamina in WT, cec-4-null, and cec-4-rescued embryo cells (mean ± SD); n = 25 cells per condition. (D) Localization of indicated histone H3-GFP fusion proteins in NIH/3T3 cells; counterstained with H3K9me2 (green) and nuclear lamina marker Lamin B (red); spectral views (magnifications of top panels as indicated by dashed squares) illustrate H3-GFP signal intensity. Localization of the H3-GFP at the nuclear periphery (yellow arrowheads) or loss of peripheral localization (white arrowheads). Scale bars: 5 μm (top panels) and 1 μm (bottom panels). (E) Dot plot of the proportion of indicated H3-GFP fusion protein at the nuclear lamina (marked by Lamin B, top) or within the layer of peripheral heterochromatin (marked by H3K9me2, bottom), normalized to wt H3-GFP, calculated using Lamin B or H3K9me2 signal as a mask (mean ± SD); n = 30 cells per condition. (F) Line signal intensity profiles of corresponding images in panel D indicated by dashed lines. Statistical analyses performed using two-tailed student’s t-test for panel C and one-way ANOVA test for panel E; ****p<0.0001, **p=0.0024, ns: not significant; all comparisons relative to wild type (wt).
-
Figure 3—source data 1
Numerical data related to Figure 3C.
- https://doi.org/10.7554/eLife.49278.010
-
Figure 3—source data 2
Numerical data related to Figure 3E.
- https://doi.org/10.7554/eLife.49278.011
To extend our results and probe the role of H3K9 in chromatin positioning in mammalian cells, we expressed GFP-tagged histone H3 (hereafter H3) or GFP-tagged mutant forms of H3 in which Lys9 was substituted with alanine (H3K9A) or glutamic acid (H3K9E); both substitutions preclude methylation at this position in H3. GFP-tagged proteins were expressed in NIH/3T3 cells at relatively low levels compared to endogenous H3 (Figure 3—figure supplement 2) and attempts to drive higher levels of expression resulted in cell death. Wild-type GFP-H3 was observed throughout the nucleus including at the nuclear periphery, where it overlapped with endogenous H3K9me2 staining, immediately adjacent to Lamin B (Figure 3d). In contrast, GFP-H3K9A and GFP-H3K9E failed to partition to the nuclear periphery (Figure 3d–f, Figure 3—source data 2). Given that wild-type GFP-H3 is incorporated and observed at the nuclear periphery, we interpret the inability of the K9A and K9E mutants to partition to the periphery to suggest that lysine nine dimethylation is required for either incorporation into peripheral nucleosomes, or for retention within nucleosomes at the periphery. Combined with the CEC-4 results, this indicates that dimethylation of H3K9 orchestrates positioning of chromatin to the nuclear periphery.
A phospho-methyl switch controls peripheral heterochromatin localization
H3S10 phosphorylation is associated with mitotic chromosome condensation (Wei et al., 1999; Prigent and Dimitrov, 2003) and, together with the neighboring Lys9 residue, has been proposed to function as a ‘phospho-methyl switch’ to modulate binding of H3 to effector proteins (Varier et al., 2010; Fischle et al., 2003; Wang and Higgins, 2013). Expression of a GFP-tagged H3 mutant in which Ser10 is replaced with the phospho-mimic glutamic acid (H3S10E) resulted in distribution of the GFP-H3S10E throughout the nucleus, but notably not at the nuclear periphery (Figure 3d–f). This is consistent with the ability of phosphorylated Ser10 to inhibit interaction of the reader with H3K9me2 and suggests that phosphorylation of Ser10 can prevent H3 peripheral localization. Replacement of H3 Ser10 with an alanine (H3S10A) precludes phosphorylation at this site and did not disrupt peripheral localization. Instead, H3S10A produced a pattern similar to wild-type GFP-H3 in interphase cells (Figure 3d–f). Together, these H3 mutant results suggest that H3K9me2 is required for localization of heterochromatin to the nuclear periphery. Further, they indicate that phosphorylation of Ser10 can prevent or disrupt this association as part of a phospho-methyl switch. Indeed, experimental results from the Gasser lab demonstrated that CEC-4 binds methylated H3K9 peptides and this binding is reduced by 2 orders of magnitude if the adjacent Ser10 is phosphorylated (Gonzalez-Sandoval et al., 2015).
H3K9me2 persists through mitosis and associates with reassembling nuclear lamina in daughter cells at mitotic exit
Given the requirement for H3K9me2 to position heterochromatin at the nuclear lamina in interphase, we asked whether the H3K9me2 mark is maintained through cell division or if the histone modification is lost and re-acquired de novo in daughter cells. Examination of cells progressing through the consecutive phases of mitosis revealed persistence of H3K9me2 on mitotic chromatin (Figure 4a, Figure 4—figure supplement 1). Prior to disassembly of the nuclear lamina in prophase, H3K9me2-marked chromatin begins to detach from the nuclear periphery. Concordant with this detachment, we observe phosphorylation of Ser10 on the H3 tail adjacent to dimethylated Lys9 (H3K9me2S10p) beginning in prophase and persisting until late telophase (Figure 4a and b). Similar to the anti-H3K9me2 antibody (Figure 2, Figure 2—figure supplement 1), we carefully tested the specificity of the anti-H3K9me2S10p antibody used in these experiments and verified that it does not recognize the H3K9me2 epitope without an adjacent phosphate group on S10, nor does it recognize H3S10p alone (Figure 4—figure supplement 2). H3S10 phosphorylation in prophase may contribute to release of H3K9me2 readers/tethers (Eberlin et al., 2008; Hirota et al., 2005) and detachment from the nuclear periphery. Our data suggest that not every histone H3 Ser10 adjacent to H3K9me2 is phosphorylated since we observe some overlap of staining with the H3K9me2 and H3K9me2S10p antibodies.

H3K9me2-marked chromatin is maintained throughout mitosis to be re-established at the nuclear lamina during nuclear lamina reassembly.
(A) Representative immunofluorescent confocal images of murine C2C12 cells illustrating localization of H3K9me2- and H3K9me2S10p-marked chromatin and Lamin B during different stages of mitosis; DNA visualized with DAPI. Scale bars: 5 μm. (B) Magnified images of Interphase and Prophase from panel (A) demonstrating detachment of the H3K9me2-chromatin from the nuclear lamina concomitant with H3K9me2S10p phosphorylation; scale bar: 1 μm. (C) Representative images of cells progressing through telophase as the layer of peripheral H3K9me2-marked heterochromatin (green) is re-established and nuclear lamina (Lamin B, red) is reassembled; dashed boxes in top panels indicate higher resolution images. Scale bars: 5 μm (top) and 1 μm (bottom panels). (D) Magnified images of telophase and daughter cells from panel A demonstrating de-phosphorylated H3K9me2-chromatin (green) assembled at the nuclear lamina (Lamin B, red), while the phosphorylated form (H3K9me2S10p, cyan, enchanced brightness) remains localized in the nuclear interior; scale bar: 1 μm. Dashed lines indicate location of corresponding representative line signal intensity profiles (bottom row).
We also examined cells at successive points in telophase. As telophase progresses, re-establishment of the H3K9me2 layer occurs in parallel with reassembly of the nuclear lamina. We observed aggregation of H3K9me2-marked chromatin and the reformation of this heterochromatin layer at the interface with the newly forming nuclear lamina structure (Figure 4c, Figure 4—figure supplement 3). However, chromatin marked with H3K9me2S10p was not enriched at the interface of the forming nuclear lamina but remained in the nucleoplasm (Figure 4d), suggesting that loss of S10 phosphorylation occurs prior to association of chromatin with the nuclear lamina. We detected little or no H3K9me2S10p in daughter cells after mitosis was complete (Figure 4d).
A subset of H3K9me3-marked chromatin is at the nuclear periphery, though it is not restricted to the periphery as is H3K9me2. H3K9me3 is enriched in microsatellite heterochromatin and persists through mitosis (Figure 5a). In addition, in telophase we noted strong differences in localization of other repressive (H3K9me3, H3K27me3) and active (H3K4me3) histone marks in contrast to H3K9me2 (Figure 5b). Trimethylated H3K9 is also distinct from H3K9me2 in that H3K9me3 chromatin is not enriched at the interface with the forming nuclear lamina during telophase and mitotic exit. In the newly formed daughter cells, we observed H3K9me2- but not H3K9me3-marked chromatin preferentially associated with the nuclear lamina.

Localization of H3K9me2- and H3K9me3-marked chromatin differs during mitosis.
(A) Representative immunofluorescent confocal images of murine C2C12 cells illustrating a difference in localization of H3K9me2 (green) and H3K9me3 (red) chromatin marks in interphase, during mitosis, and upon mitotic exit; co-stained with Lamin B (cyan) and DAPI (blue). (B) Representative immunofluorescent confocal images of C2C12 cells in telophase illustrating difference in localization of different histone modifications (green) in relation to Lamin B (red); co-stained with DAPI (blue). Dashed boxes in panels of middle row indicate higher resolution images (top row). Scale bars: 5 μm.
Specific LADs positioned at the nuclear periphery prior to mitosis re-associate with forming nuclear lamina in telophase
Restoration of H3K9me2-marked chromatin at the nuclear lamina prior to mitotic exit suggests a mechanism for inheritance of spatial localization of specific genomic loci within the peripheral heterochromatin layer. Our experiments thus far demonstrate that H3K9me2-marked chromatin, in general, is re-established at the nuclear lamina. Conflicting reports have emerged regarding whether LADs are stochastically reshuffled at every cell division or directed through a locus-specific, regulated mechanism to localize in other, non-lamina-associated heterochromatic subcompartments (Kind et al., 2013; Zullo et al., 2012; Kind et al., 2015). To determine whether specific genomic regions are re-established at the nuclear periphery at mitotic exit, we used fluorescence in situ hybridization (FISH)-based imaging to monitor the localization of individual genomic regions in single cells. We designed libraries of fluorescent DNA oligo probes (oligopaints) targeting domains of the genome that were identified through population-based studies (Meuleman et al., 2013; Peric-Hupkes et al., 2010; Poleshko et al., 2017) to be either cell-type invariant regions of nuclear peripheral, H3K9me2-marked heterochromatin (LADs) or cell-type invariant regions of euchromatin (non-LADs). The pool of probes (41 LAD and 41 non-LAD regions) includes regions from every mouse autosome (Figure 6—figure supplement 1, Supplementary file 1). We performed immunofluorescent in situ hybridization (immuno-FISH) with the probes in individual cells in interphase and mitosis; reconstruction of stacks of confocal images allowed us to visualize the 3D positions of each set of specific genomic loci (Figure 6, Videos 1–3).

H3K9me2-enriched LADs are positioned at the nuclear lamina in interphase cells and the position is inherited through mitosis.
(A) Localization of LADs and non-LADs in interphase mouse embryonic stem cells (mESCs). Left panels show representative immuno-FISH images (top) and 3D image reconstructions (bottom) of cells hybridized with fluorescent DNA oligopaint probes targeting individual LADs (red) and non-LADs (green), and immunostained for Lamin B1 (cyan) and DAPI (blue). Scale bar: 5 μm. Dot plots show distribution of distances to the nuclear periphery (as defined by Lamin B1) of individual LAD and non-LAD probes for individual cells (middle) and cumulative over all cells (right) in interphase. (B) As in panel A for prometaphase-metaphase-anaphase cells. (C) As in panel A for telophase cells. For dot plots, nuclear periphery defined by Lamin B1 or DNA edge; black line: median value; cyan boxes indicate average thickness of H3K9me2 peripheral heterochromatin layer. Box plots display 5, 25, 50, 75 and 95 percentiles. n ≥ 20 individual nuclei; N = 870–1399 individual LADs or non-LADs per condition. Statistical analysis performed using two-tailed t-test; ****p<0.0001; ns: not significant.
-
Figure 6—source data 1
Numerical data related to Figure 6.
- https://doi.org/10.7554/eLife.49278.023
3D reconstruction of mESC in interphase.
Immunostained for Lamin B1 (cyan) and hybridized with fluorescent oligopaint probes for LADs (red) and non-LADs (green), and counterstained with DAPI (blue).
3D reconstruction of mESC in metaphase.
Immunostained for Lamin B1 (cyan) and hybridized with fluorescent oligopaint probes for LADs (red) and non-LADs (green), and counterstained with DAPI (blue); pericentromeric heterochromatin displayed in dark blue.
3D reconstruction of mESC in telophase.
Immunostained for Lamin B1 (cyan) and hybridized with fluorescent oligopaint probes for LADs (red) and non-LADs (green), and counterstained with DAPI (blue).
In a population of interphase cells, we found the LAD probes to be at the periphery of individual nuclei at a frequency consistent with previous observations of haploid cells in studies using single-cell DamID (Kind et al., 2015). An average of 82% of LAD probes (74–90% in individual cells) were positioned at the nuclear periphery within the measured thickness of the H3K9me2 chromatin layer in interphase cells (Figure 6a, Video 1, Figure 6—source data 1). Non-LAD probes, assessed in each of the same interphase cells, were more frequently found in the nucleoplasm, as expected: an average of 89% of non-LAD probes (79–95% in individual cells) segregated outside of the peripheral chromatin layer (Figure 6a, Figure 6—source data 1).
Next, we examined the location of these pools of representative LAD and non-LAD genomic loci in cells undergoing mitosis. Both LAD and non-LAD probes are present at similar distances from the DNA surface in cells in metaphase, a point in mitosis at which the nuclear lamina has disassembled (Figure 6b, Figure 6—figure supplement 2, Video 2, Figure 6—source data 1). However, by telophase, LAD probes have repositioned to the nuclear periphery (Figure 6c, Video 3, Figure 6—source data 1), indicating that H3K9me2-marked domains that were at the periphery in parent cells are specifically repositioned at the periphery in daughter nuclei before mitotic exit. In these same cells in telophase, non-LAD probes remained largely in the nucleoplasm, away from the nuclear lamina (Figure 6c, Video 3). Thus, specific LADs found at the nuclear periphery in parental cells are repositioned at the periphery at mitotic exit.
Discussion
Our results provide experimental support of a model for nuclear peripheral localization and mitotic inheritance of lamina-associated heterochromatin (Figure 7). We show that H3K9me2 marks chromatin domains that are specifically positioned at the nuclear lamina during interphase. In mitosis, these domains retain and are bookmarked by H3K9me2. H3S10 phosphorylation promotes release from the nuclear periphery, likely by masking the Lys9 dimethyl modification from recognition by its reader/tether (Fischle et al., 2003; Wang and Higgins, 2013; Eberlin et al., 2008). In late stages of mitosis, dephosphorylation of H3S10 unmasks bookmarked LADs which are then reassembled at the nuclear periphery during nuclear lamina reformation in the nuclei of daughter cells.

Model illustrating the role of the H3K9me2 chromatin modification in inheritance of peripheral heterochromatin localization through cell division.
https://doi.org/10.7554/eLife.49278.024How cells convey information related to cellular identity to daughter cells has been a long-standing focus of investigation. Although mitotic chromosomes are condensed and transcriptionally silent, it is now appreciated that many nuclear factors remain associated with specific regions of mitotic chromatin, and some histone post-translational modifications are also retained. The concept of ‘mitotic bookmarking’ has been put forth to describe mechanisms by which transcriptionally active regions of euchromatin may be ‘remembered’ and rapidly re-activated upon mitotic exit (Kadauke and Blobel, 2013; Palozola et al., 2019; Sureka et al., 2018). Here, we extend this concept by elucidating a mechanism for transmitting a blueprint of the 3D organization of the genome from mother to daughter cell with a specific focus on peripheral heterochromatin associated with the inner nuclear lamina. Our data indicate that H3K9me2 acts as a 3D architectural mitotic guidepost.
Our results highlight the role of H3S10 phosphorylation adjacent to dimethylated Lys9 in 3D mitotic bookmarking. H3K9me2S10 phosphorylation allows for dissociation of peripheral heterochromatin from the nuclear lamina while retaining memory of genomic regions that will be reattached to the newly formed nuclear lamina upon dephosphorylation and mitotic exit. This example of a phospho-methyl switch extends previous studies that implicated related phospho-methyl switch mechanisms in transcriptional bookmarking without invoking regulation of 3D genome organization or nuclear reassembly. For example, H3S10 phosphorylation can displace HP1 binding to trimethylated Lys9 during mitosis (Hirota et al., 2005; Fischle et al., 2005). In another example, the active histone mark H3K4me3 is bound by TFIID and the basal transcriptional machinery during interphase. While H3K4me3 is maintained through mitosis, phosphorylation of Thr3 results in dissociation of TFIID and transcriptional silencing. The retention of H3K4me3 is thought to allow for rapid re-initiation of transcription after mitosis when Thr3 is dephosphorylated (Varier et al., 2010; Sawicka and Seiser, 2014). Our results supporting an H3K9me2S10 phospho-methyl switch suggest that this conserved mechanism also is employed for mitotic memory of nuclear architecture. During cell division, this mechanism is utilized to release all peripheral heterochromatin from the nuclear lamina, but it will be of interest to determine if a similar process occurs during interphase to release specific LADs from the periphery, perhaps endowing these domains with competence to be accessed by nuclear regulators of transcription. Histone phosphorylation, including H3S10, has been well documented to occur in response to classic signal transduction pathways such as Mapk signaling (Winter et al., 2008) suggesting a potential mechanism for the regulation of LAD release as a component of signal transduction.
The importance of the spatial organization of the genome has attracted increasing attention in recent years with a growing appreciation for unique, lineage-specific LADs and other architectural features. Largescale efforts have focused on characterizing genome organization in interphase, with less attention to how 3D architecture is transmitted through mitosis. Indeed, an early study suggested that LADs might be stochastically formed de novo following each cell division rather than inherited from the mother cell following mitosis (Kind et al., 2013). Unless all heterochromatic subcompartments are functionally equivalent, this would be somewhat inconsistent with the role that LADs are thought to play in cell identity (Robson et al., 2016; Peric-Hupkes et al., 2010; Kohwi et al., 2013; Gonzalez-Sandoval et al., 2015; Poleshko et al., 2017). Many reports have documented consistent, cell-type-specific LAD architecture as well as restoration of particular heterochromatin domains at the lamina after cell division (Zullo et al., 2012; Kind et al., 2015). It is conceivable that cell-type-specific LAD organization is ‘rediscovered’ after mitosis rather than ‘remembered’ and it has been reported that LADs can reshuffle between peripheral heterochromatin and perinucleolar heterochromatin. A recent study demonstrated that a subset of Nucleolus-Associated Domains (NADs) that exchange between nuclear lamina and nucleolar periphery are enriched for H3K9me3 (Vertii et al., 2019). Our results showing localization of H3K9me2-enriched lamina-associated chromatin, including those produced with LAD-specific oligopaints, suggest that H3K9me2-marked LADs which are re-established at the nuclear periphery at the end of mitosis concomitant with nuclear lamina re-assembly are likely distinct from the H3K9me3-marked NADs.
Mitosis and the period shortly following in G1 may provide a vulnerable period to regulate or modify genome organization. Consistent with this, pioneering experiments artificially tethering areas of the genome to the nuclear lamina noted the requirement for a mitotic event to precede efficient tethering of the genome to the nuclear lamina (Finlan et al., 2008; Reddy et al., 2008; Kumaran and Spector, 2008). Moreover, nuclear transfer experiments demonstrated that mitotic chromatin can be reprogrammed to activate the core pluripotency network 100 times more efficiently than interphase chromatin (Halley-Stott et al., 2014). This may be, in part, because three-dimensional reorganization of the genome after mitosis helps to regulate accessibility. In particular, it is possible that the period during which H3S10 phosphorylation is lost in late mitosis, but before H3K9me2-marked chromatin is fully re-established as lamina-associated heterochromatin at the nuclear periphery, is a particularly vulnerable time to change LAD positioning in daughter cells. Hence, this may also coincide with a window in which cell fate changes associated with modifications in nuclear architecture occur (Gilbert, 2010). This would be in accord with the ‘quantal theory of differentiation’ put forth by Howard Holtzer over 50 years ago which proposed that major steps in lineage determination and cell fate restriction required mitotic events (Holtzer et al., 1972).
Classic cell biology experiments have demonstrated the necessity of kinase-phosphatase activity for mitotic progression and the requirement for chromatin to allow nuclear membranes to reform in daughter cells after mitosis (Gerace and Blobel, 1980; Newport, 1987; Foisner and Gerace, 1993; Burke and Gerace, 1986; Wei et al., 1999; Prigent and Dimitrov, 2003; Wandke and Kutay, 2013; Haraguchi et al., 2008). Our model provides a mechanistic explanation for these requirements and advances current models of mitotic bookmarking by introducing the concept of 3D architectural mitotic bookmarking. This model for epigenetic inheritance may have implications for understanding how cells adopt new fates in the setting of asymmetric cell divisions, and how cellular identity may be lost or altered in the context of cancer or trans-differentiation. For example, it will be of great interest to determine if the re-establishment of spatial chromatin organization is disrupted in cells as they undergo oncogenic transformation and/or cellular reprogramming.
Materials and methods
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (C. elegans) | WT | CGC | N2, RRID:WB-STRAIN:N2_(ancestral) | |
Strain, strain background (C. elegans) | Cec-4 deletion | CGC | RB2301, RRID:WB-STRAIN:RB2301 | |
Strain, strain background (C. elegans) | CEC4-mCherry transgene | Gonzalez-Sandoval et al. (2015) | GW849 | |
Strain, strain background (C. elegans) | Cec-4 rescue with Cec-4-mCherry transgene | This paper | ||
Cell line (D. melanogaster) | S2 | Maya Capelson lab | CVCL_TZ72, RRID:CVCL_TZ72 | Late embryonic stage cells |
Cell line (Xenopus laevis) | S3 | Matthew Good lab | CVCL_GY00, RRID:CVCL_GY00 | Embryonic cells |
Cell line (Mus musculus) | C2C12 | ATCC | CRL-1772, RRID:CVCL_0188 | C2C12 skeletal myoblast |
Cell line (Mus musculus) | NIH/3T3 | ATCC | CRL-1658, RRID:CVCL_0594 | NIH/3T3 fibroblasts |
Cell line (Mus musculus) | mESC | ATCC | CRL-1934, RRID:CVCL_4378 | Embryonic stem cells |
Cell line (Homo-sapiens) | HeLa | ATCC | CCL-2, RRID:CVCL_0030 | |
Cell line (Homo-sapiens) | IMR-90 | ATCC | CCL-186, RRID:CVCL_0347 | IMR-90 fibroblasts |
Cell line (Homo-sapiens) | hESC | Rajan Jain lab | RRID:CVCL_EL23 | Induced pluripotent stem cells |
Antibody | anti-H3K9me2 (Rabbit polyclonal) | Active Motif | Cat# 39239, RRID:AB_2793199 | IF (1:1000), WB (1:3000) |
Antibody | anti-H3K9me2 (Rabbit polyclonal) | Active Motif | Cat# 39375, RRID:AB_2793234 | IF (1:1000) |
Antibody | anti-H3K9me2 (Mouse monoclonal) | Abcam | Cat# ab1220, RRID:AB_449854 | IF (1:1000), WB (1:3000) |
Antibody | Mouse anti-H3K9me2S10p | Active Motif | Cat# 61429, RRID:AB_2793632 | IF (1:1000) |
Antibody | anti-H3K9me3 (Rabbit polyclonal) | Abcam | Cat# ab8898, RRID:AB_306848 | IF (1:1000) |
Antibody | anti-H3K27me3 (Rabbit polyclonal) | EMD Millipore | Cat# 07–499, RRID:AB_310624 | IF (1:1000) |
Antibody | anti-Lamin B1 (Rabbit polyclonal) | Abcam | Cat# ab16048, RRID:AB_10107828 | IF (1:1000) |
Antibody | Goat anti-Lamin B (Goat polyclonal) | Santa Cruz | Cat# sc-6216, RRID:AB_648156 | IF (1:1000) |
Antibody | Goat anti-Lamin B (Goat polyclonal) | Santa Cruz | Cat# sc-6217, RRID:AB_648158 | IF (1:1000) |
Antibody | anti-Lamin A/C (Mouse monoclonal) | Santa Cruz | Cat# sc-376248, RRID:AB_10991536 | IF (1:1000) |
Antibody | anti-LMN1 (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# LMN1, RRID:AB_10573809 | IF (1:1000) |
Antibody | anti-histone H3 (Rabbit polyclonal) | Abcam | Cat# ab1791, RRID:AB_302613 | IF (1:1000) |
Antibody | anti-GFP (Rabbit polyclonal) | Abcam | Cat# ab290, RRID:AB_303395 | IF (1:1000) |
Antibody | anti-Rabbit AlexaFluor 555 (Donkey polyclonal) | Invitrogen | Cat# A31572, RRID:AB_162543 | IF (1:1000) |
Antibody | anti-Rabbit AlexaFluor 488 (Donkey polyclonal) | Invitrogen | Cat# A21206, RRID:AB_2535792 | IF (1:1000) |
Antibody | anti-Rabbit AlexaFluor 568 (Donkey polyclonal) | Invitrogen | Cat# A10042, RRID:AB_2534017 | IF (1:1000) |
Antibody | anti-Rabbit AlexaFluor 647 (Donkey polyclonal) | Invitrogen | Cat# A31573, RRID:AB_2536183 | IF (1:1000) |
Antibody | anti-Mouse AlexaFluor 488 (Donkey polyclonal) | Invitrogen | Cat# A21202, RRID:AB_141607 | IF (1:1000) |
Antibody | anti-Mouse AlexaFluor 568 (Donkey polyclonal) | Invitrogen | Cat# A10037, RRID:AB_2534013 | IF (1:1000) |
Antibody | anti-Goat AlexaFluor 488 (Donkey polyclonal) | Invitrogen | Cat# A11055, RRID:AB_2534102 | IF (1:1000) |
Antibody | anti-Goat AlexaFluor 568 (Donkey polyclonal) | Invitrogen | Cat# A11057, RRID:AB_2534104 | IF (1:1000) |
Antibody | anti-Goat AlexaFluor 647 (Donkey polyclonal) | Invitrogen | Cat# A21447, RRID:AB_2535864 | IF (1:1000) |
Antibody | anti-Rabbit IgG, HRP-linked | Cell Signaling | Cat# 7074, RRID:AB_2099233 | WB (1:7500) |
Antibody | anti-Mouse IgG, HRP-linked | Cell Signaling | Cat# 7076, RRID:AB_330924 | WB (1:7500) |
Peptide array | MODified Histone Peptide Array | Active Motif | Cat# 13001 | |
Peptide | H3K9me2 | Abcam | Cat# ab1772 | IF (1:500) |
Peptide | H3K9me3 | Abcam | Cat# ab1773 | IF (1:500) |
Peptide | H3K27me2 | Abcam | Cat# ab1781 | IF (1:500) |
Peptide | H4K20me2 | Abcam | Cat# ab14964 | IF (1:500) |
Peptide | H3K9me0 | EpiCypher | Cat# 12–0001 | IF (1:500) |
Peptide | H3K9me1 | EpiCypher | Cat# 12–0010 | IF (1:500) |
Peptide | H3K9me2 | EpiCypher | Cat# 12–0011 | IF (1:500) |
Peptide | H3K9me3 | EpiCypher | Cat# 12–0012 | IF (1:500) |
Peptide | H3K9me2S10p | EpiCypher | Cat# 12–0093 | IF (1:500) |
Peptide | H3S10p | EpiCypher | Cat# 12–0041 | IF (1:500) |
Recombinant DNA reagent | mEmerald-H3-23 (plasmid) | Addgene | Cat# 54115,RRID:Addgene_54115 | Histone H3 mEmerald-tag, deposited by Michael Davidson |
Recombinant DNA reagent | H3 K9A (plasmid) | This paper | Histone H3 with K9A substitution | |
Recombinant DNA reagent | H3 K9E (plasmid) | This paper | Histone H3 with K9E substitution | |
Recombinant DNA reagent | H3 S10A (plasmid) | This paper | Histone H3 with S10A substitution | |
Recombinant DNA reagent | H3 S10E (plasmid) | This paper | Histone H3 with S10E substitution | |
Sequence-based reagent | H3 K9A forward | This paper | PCR primers | ACTAAACAGACAGCTCGGGCATCCACCGGCGGTAAAGCG |
Sequence-based reagent | H3 K9A reverse | This paper | PCR primers | CGCTTTACCGCCGGTGGATGCCCGAGCTGTCTGTTTAGT |
Sequence-based reagent | H3 K9E forward | This paper | PCR primers | ACTAAACAGACAGCTCGGGAATCCACCGGCGGTAAAGCG |
Sequence-based reagent | H3 K9E reverse | This paper | PCR primers | CGCTTTACCGCCGGTGGATTCCCGAGCTGTCTGTTTAGT |
Sequence-based reagent | H3 S10A forward | This paper | PCR primers | ACTAAACAGACAGCTCGGAAAGCCACCGGCGGTAAAGCG |
Sequence-based reagent | H3 S10A reverse | This paper | PCR primers | CGCTTTACCGCCGGTGGCTTTCCGAGCTGTCTGTTTAGT |
Sequence-based reagent | H3 S10E forward | This paper | PCR primers | ACTAAACAGACAGCTCGGAAAGAAACCGGCGGTAAAGCG |
Sequence-based reagent | H3 S10E reverse | This paper | PCR primers | CGCTTTACCGCCGGTTTCTTTCCGAGCTGTCTGTTTAGT |
Commercial assay or kit | QuikChange II XL Site-Directed Mutagenesis Kit | Agilent technologies | Cat# 200521 | |
Software, algorithm | Imaris 9.0.1 | Bitplane | RRID:SCR_007370 | http://www.bitplane.com/imaris/imaris |
Software, algorithm | Image J | National Institute of Health | RRID:SCR_003070 | https://imagej.net/ |
Software, algorithm | Vutara SRX | Bruker Corporation | https://www.bruker.com/products/fluorescence-microscopes/vutara-super-resolution-microscopy/overview/srx-software-vutara-super-resolution.html | |
Software, algorithm | GraphPad Prism 8 | GraphPad Software | RRID:SCR_002798 | http://www.graphpad.com/ |
Cell lines
Request a detailed protocolMammalian cell lines were obtained from the American Type Culture Collection: murine NIH/3T3 fibroblast (ATCC, cat#CRL-1658), murine C2C12 skeletal myoblast (ATCC, cat#CRL-1772), murine embryonic stem cell (ATCC, cat# CRL-1934), human IMR-90 fibroblast (ATCC, cat#CCL-186) and HeLa cells (ATCC, cat#CCL-2). Xenopus S3 cells were obtained from the Matthew Good lab (University of Pennsylvania). Drosophila S2 cells were obtained from the Maya Capelson lab (University of Pennsylvania). All cell lines tested negative for mycoplasma contamination. NIH/3T3, C2C12, IMR-90 and HeLa cells were maintained at 37°C in DMEM supplemented with 10% FetalPlex serum complex (Gemini, cat#100–602), penicillin, and streptomycin. Mouse ESCs were maintained at 37°C on a feeder layer of mitotically inactivated MEFs in DMEM with 15% FBS (Fisher Scientific #SH3007003) and ESGRO LIF (EMD Millipore, cat#ESG1106). Human ES cells were maintained at 37°C in StemMACS iPS-Brew XF media (Miltenyi Biotec GmbH, cat#130-104-368), supplemented with penicillin, and streptomycin. Xenopus S3 cells were maintained at 25°C in 66% L-15 media (Gibco, cat#11415–064) with 10% fetal bovine serum (Atlanta Biologicals, cat#S11550), sodium pyruvate, penicillin, and streptomycin.
Plasmids, mutagenesis and transfection
Request a detailed protocolExpression plasmids for Histone H3-mEmerald was received from Addgene (cat#54115, deposited by Michael Davidson). This plasmid was used to create Histone H3 tail mutant constructs: H3 K9A, H3 K9E, H3 S10A and H3 S10E using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies, cat#200521) according to manufacturer’s instruction. Plasmid transfections were performed with FuGENE 6 (Promega, cat#E2691) according to manufacturer instructions. For confocal imaging cells were plated on coverslips (EMS, cat#72204–01), then transfected at 50% confluency and fixed 48 hr post-transfection. Primers used for mutagenesis:
H3 K9A (5’-ACTAAACAGACAGCTCGGGCATCCACCGGCGGTAAAGCG, 5’-CGCTTTACCGCCGGTGGATGCCCGAGCTGTCTGTTTAGT); H3 K9E (5’-ACTAAACAGACAGCTCGGGAATCCACCGGCGGTAAAGCG, 5’-CGCTTTACCGCCGGTGGATTCCCGAGCTGTCTGTTTAGT); H3 S10A (5’-ACTAAACAGACAGCTCGGAAAGCCACCGGCGGTAAAGCG, 5’-CGCTTTACCGCCGGTGGCTTTCCGAGCTGTCTGTTTAGT); H3 S10E (5’-ACTAAACAGACAGCTCGGAAAGAAACCGGCGGTAAAGCG, 5’-CGCTTTACCGCCGGTTTCTTTCCGAGCTGTCTGTTTAGT).
C. elegans strains, embryo cell isolation for immunofluorescence
Request a detailed protocolThe wild-type strain is N2; the cec-4 null is deletion strain RB2301 from the Caenorhabditis Genetics Center (CGC); CEC4-mCherry transgene is the GW849 strain (gwSi17 [cec-4p::cec-4::WmCherry::cec-4 3'UTR] II) obtained from Susan Gasser (Gonzalez-Sandoval et al., 2015). The rescue strain was created by crossing cec-4 mutant [cec-4 (ok3124) deletion] males to GW849 hermaphrodites. Animals were grown as previously described (Stiernagle, 2006). For immunostaining, worms were bleached, then washed off the plate with M9 solution (86 mM NaCl, 42 mM Na2HPO4, 22 mM KH2PO4, and 1 mM Mg2SO4, pH 6.5). They were washed with a bleach solution (15 ml MilliQ water, 4 ml Clorox, and 2 ml 5 M KOH) with shaking until adult bodies were dissolved. Then, embryos were washed twice with M9 solution, fixed with 4% formaldehyde solution (incubated at room temperature (RT) for 15 min). Embryos were then flash frozen by immersing tube in an ethanol/dry ice bath for 2 min, thawed to RT, and then incubated on ice for 20 min and washed twice with PBS. Fixed embryos were spun on the coverslips at 1000 g for 10 min in cushion buffer (100 mM KCl, 1 mM MgCl2, 0.1 mM CaCl2, 10 mM HEPES pH7.7, 250 mM sucrose, 25% glycerol), then post-fixed with 2% PFA for 10 min at RT. A single-cell suspension of embryonic cells was prepared in a similar manner, but after the beach solution washing step embryos were washed three times in L15 media (Corning Cellgro, cat#10–045-CV), and then incubated in the 0.5 mg/ml Chitinase (Sigma, cat#C6137) in Boyd Buffer (25 mM HEPES pH 7.3, 118 mM NaCl, 48 mM KCl, 2 mM CaCl2, 2 mM MgCl2) at RT with rotation/aspiration to dissociate cells. Cells were pelleted at 1000 g for 5 min at 4°C and dissolved in PBS. Cells were kept at 4°C before immunostaining.
Immunofluorescence
Request a detailed protocolNIH/3T3 cells, C2C12 cells, IMR-90 cells, HeLa cells, undifferentiated mouse and human ES cells, Xenopus laevis S3 cells utilized for immunofluorescence experiments were grown on glass coverslips, fixed with 2% paraformaldehyde (PFA) (EMS, cat#15710) for 10 min at RT, washed 3 times with DPBS (Gibco, cat#14190–136), then permeabilized with 0.25% Triton X-100 (Thermo Scientific, cat#28314) for 10 min. After permeabilization, cells were washed 3 times with DPBS for 5 min, then blocked in 1% BSA (Sigma, cat#A4503) in PBST (DPBS with 0.05% Tween 20, pH 7.4 (Thermo Scientific, cat#28320)) for 30–60 min at RT. Incubated with primary antibodies for 1 hr at RT, then washed 3 times with PBST for 5 min. Incubated with secondary antibodies for 30–60 min at RT, then washed 2 times with PBST for 5 min. Samples were counterstained with DAPI solution (Sigma, cat#D9542) for 10 min at RT, then rinsed with PBS. Coverslips were mounted on slides using 80% glycerol mounting media: 80% glycerol (Invitrogen, cat#15514–011), 0.1% sodium azide (Sigma, cat#S2002), 0.5% propyl gallate (Sigma, cat#02370), 20 mM Tris-HCl, pH 8.0 (Invitrogen, cat#15568–025).
Immunofluorescence and DNA oligo FISH
Request a detailed protocolMouse ESCs were grown on 0.1% porcine gelatin (Sigma, cat#G2500) coated glass coverslips (EMS, cat#3406), fixed with 2% PFA for 10 min at RT. Then cells were immunostained as described above. DNA oligo hybridization protocol was adopted from Rosin et al. (2018) (Rosin et al., 2018). In brief, after incubation with secondary antibodies, samples were washed with DPBS and post-fixed with 2% PFA for 10 min at RT, washed 3 times with DPBS and permeabilized with 0.7% Triton X-100 for 10 min at RT, then rinsed with DPBS. Incubate coverslips in 70% ethanol, 90% ethanol, and 100% ethanol for 2 min each, then incubate in 2X SSC (Corning, cat#46–020 CM) for 5 min. Incubate coverslips in 2X SSCT (2X SSC with 0.1% Tween) for 5 min at RT, then incubate in 2X SSCT with 50% Formamide for 5 min at RT. DNA denaturation was performed in 2X SSCT with 50% Formamide for 2.5 min at 92°C, then additional 20 min at 60°C. After DNA denaturation, samples were cooled to RT in humid conditions for 2–3 min, then hybridized with DNA oligo probes in ~50–100 pmol primary DNA probe. Coverslips were heated at 92°C for 2.5 min on a heat block. Samples were hybridized with DNA oligo probes overnight at 37°C in a humid chamber. After hybridization with primary DNA oligo probes samples were washed in 2X SSCT for 15 min at 60°C, then for 10 min in 2X SSCT for 10 min at RT, then transferred in 2X SSC for 5 min. Next samples were hybridized with a secondary fluorescent DNA oligo probes in dark humidified chamber for 3 hr at RT. Hybridization mix: 10% Formamide, 10% dextran sulfate, 10 pmol secondary DNA probe. After secondary hybridization samples were washed for 5 min in 2X SSCT at 60°C, then 2X SSCT at RT, and 2X SSC buffer with DAPI. Samples were rinsed with DPBS and mounted on a slide.
Image acquisition
Request a detailed protocolAll confocal immunofluorescent images were taken using a Leica TCS SP8 3X STED confocal microscope using 63x/1.40 oil objective. DAPI staining (blue channel) were acquired using a PMT detector with offset −0.1%. All other staining (green, red and far red channels) were acquired using HyD detectors in the standard mode with 100% gain. All images were taken with minimal laser power to avoid saturation. 3D images were taken as Z-stacks with 0.05 μm intervals with a range of 80–250 Z-planes per nucleus. Confocal 3D images were deconvoluted using Huygens Professional software using the microscope parameters, standard PSF and automatic settings for background estimation. Stochastic Optical Reconstruction Microscopy (STORM) images were obtain using Vutara SRX STORM system. Cells for STORM imaging were plated on confocal plates (MatTek, cat#P35GC-1.5–14 C). After immunostaining cells were kept in DPBS until image acquisition. STORM imaging was performed in fresh imaging buffer (50 mM Tris-HCl, pH 8.0, 10 mM NaCl, 10% (w/v) glucose (Sigma, cat#G8270), 1.5 mg MEA (Sigma, cat#30070), 170 AU Glucose oxidase (Sigma, cat#G2133), 1400 AU Catalase (Sigma, cat#C40)). Confocal channel shift alignment and STORM point spread function (PSF) calibration and channel shift alignment were performed using 0.1 μm TetraSpeck fluorescent beads (Invitrogen, cat#T7279).
Image analysis
Request a detailed protocolImage analysis were performed using Image J, Imaris 9.0.1, and Vutara SRX software. Representative confocal images show a single focal plane. 2D image analysis was performed using Image J software (National Institute of Health, USA). Line signal intensity profile plots were created using Plot Profile tool. Measurement of localization of the IF signal at the nuclear periphery was performed as a proportion of the signal at the nuclear periphery measured using a mask of the nuclear lamina or H3K9me2 signals to total signal in the nucleus. 3D image reconstructions were performed using Imaris 9.0.1 software (Bitplane AG, Switzerland) as described (Poleshko et al., 2017). In brief, nuclear lamina, nuclear DNA volume, and H3K9me2-marked chromatin structure were created using Surfaces tool with automatic settings based on the fluorescent signals from the anti-Lamin B, DAPI staining, and anti-H3K9me2 antibodies. DNA oligo FISH probe spots were generated using the Spots tool with a 250 nm diameter, created at the intensity mass center of the fluorescent probe signal. Distance from the center of the DNA oligo FISH spot to the edge of the nuclear lamina surface was quantified using the Distance Transformation tool. The thickness of the peripheral heterochromatin layer in mESC was calculated previously (Poleshko et al., 2017) as the distance from the H3K9me2 surface inner edge to nuclear lamina inner edge again using the Measurement Points tool. If the distance from the DNA oligo FISH spot to the nuclear lamina was smaller than (or equal to) the average thickness of peripheral chromatin, then the spot was counted as localized to nuclear periphery. In cases when the DNA oligo FISH signal was imbedded into the nuclear lamina layer, the measurement returned negative distances. STORM image and cluster analysis were performed using Vutara SRX software (Bruker, USA) and Voronoi Tessellation Analysis of H3K9me2 STORM images was performed in MATLAB 2016a in a fashion similar to Andronov et al. (2016) (Andronov et al., 2016). First, the lateral x,y localizations were input into the ‘delaunayTriangulation’ function, and then used to construct Voronoi polygons using the ‘Voronoidiagram’ function. Areas of the Voronoi polygons were determined from the vertices with the function ‘polyarea’. Multiscale segmentation of the STORM images was carried out using an automatic thresholding scheme in which the thresholds were defined by comparing the Voronoi area distribution of the localizations to a reference distribution of the expected Voronoi areas of random coordinates drawn from a spatial uniform distribution (Levet et al., 2015). The reference distribution was estimated with a Monte-Carlo simulation. The first threshold was selected as ρ=δ, where ρ is the threshold and δ is the average Voronoi area for a uniform distribution of localizations. After applying this first threshold, the intersection between the Voronoi polygon area distribution and the distribution of Voronoi polygon areas corresponding to the Monte Carlo simulation was identified and applied as the second threshold. This procedure was iterated multiple times to define several thresholds at increasing density.
Antibody validation
Request a detailed protocolTo test anti-H3K9me2 antibodies specificity for immunofluorescence assay, a set of short peptides mimicking histone tail lysine methylation was used. H3K9me2 antibodies were preincubated with blocking peptides according to manufacturer’s recommendations (1 μg of the antibody with 1–2 μg of a peptide) in 1 ml of antibody blocking buffer (1% BSA in PSBT), then used for immunostaining. Anti-H3K9me2S10p antibody was tested on a MODified Histone Peptide Array (Active Motif, Cat#13001), anti-H3K9me2 antibodies were tested previously (Poleshko et al., 2017). Array analysis software (Active Motif) were use for analysis and graphical representation. Western blot using acid extracted histone (according to the manufacturer’s protocol, Abcam) from C2C12 cells using anti-H3K9me2 antibodies demonstrated a single band corresponding to the histone H3.
DNA oligo FISH probe design and generation
Request a detailed protocolTarget regions were based on constitutive LADs (LADs) or constitutive inter-LADs (non-LADs) as previously defined (Meuleman et al., 2013). For LADs, regions were selected only if they were also defined as LADs according to both LaminB and H3K9me2 ChIP-seq data from Poleshko et al. (2017); for non-LADs, regions were selected only if they were also defined as non-LADs according to both LaminB and H3K9me2 ChIP-seq data from Poleshko et al. (2017). Two to three of each, LAD and non-LAD, regions per mouse autosome were chosen for generation of DNA oligo libraries (Supplementary file 1). Oligopaint libraries were designed using the OligoMiner pipeline (Beliveau et al., 2018). Sequences of 42 nucleotides of homology to the regions of interest were mined from the mouse mm9 genome build using the default parameters of OligoMiner. Each probe was designed to target a 250 kb region of sequence at a density of 4 probes/kb when possible. Single stranded probes were produced using PCR, T7 RNA synthesis, and reverse transcription as described previously (Rosin et al., 2018).
Western blot
Request a detailed protocolLysates were run on 4–12% Bis-Tris protein gels (Invitrogen #NP0335) and blots were probed with anti-H3K9me2 (Active Motif #39239, 1:3000 and Abcam #ab1220, 1:3000), anti-GFP (Abcam #ab290, 1:5000) or anti-H3 (Abcam #ab1791, 1:7500) primary antibodies according to the instructions of the manufacturer. Anti-rabbit or anti-mouse HRP-conjugated secondary antibodies (Cell Signaling #7074, #7076) were used at 1:7500. Visualization was achieved using ECLPrime (GE Life Sciences #RPN2232).
ChIP-seq tracks
Request a detailed protocolThe accession number for the ChIP-seq data referenced (Poleshko et al., 2017) is NCBI GEO: GSE97878.
Statistical analysis
Request a detailed protocolStatistical analyses were performed with Graphpad PRISM 8.0.1 software (Graphpad Software, Inc) using ANOVA one-way non-parametric (Kruskal-Wallis) test with Dunn's multiple comparison or unpaired non-parametric Student’s t-test (Mann-Whitney).
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files.
References
-
Mechanisms and dynamics of nuclear lamina-genome interactionsCurrent Opinion in Cell Biology 28:61–68.https://doi.org/10.1016/j.ceb.2014.03.003
-
The spatial organization of the human genomeAnnual Review of Genomics and Human Genetics 14:67–84.https://doi.org/10.1146/annurev-genom-091212-153515
-
Coaching from the sidelines: the nuclear periphery in genome regulationNature Reviews Genetics 20:39–50.https://doi.org/10.1038/s41576-018-0063-5
-
The current state of chromatin immunoprecipitationMolecular Biotechnology 45:87–100.https://doi.org/10.1007/s12033-009-9239-8
-
Exploring the three-dimensional organization of genomes: interpreting chromatin interaction dataNature Reviews Genetics 14:390–403.https://doi.org/10.1038/nrg3454
-
Mitotic bookmarking in development and stem cellsDevelopment 144:3633–3645.https://doi.org/10.1242/dev.146522
-
Cell fate transitions and the replication timing decision pointThe Journal of Cell Biology 191:899–903.https://doi.org/10.1083/jcb.201007125
-
Live cell imaging and electron microscopy reveal dynamic processes of BAF-directed nuclear envelope assemblyJournal of Cell Science 121:2540–2554.https://doi.org/10.1242/jcs.033597
-
The cell cycle, cell lineages, and cell differentiationCurrent Topics in Developmental Biology 7:229–256.https://doi.org/10.1016/S0070-2153(08)60073-3
-
A new bookmark of the mitotic genome in embryonic stem cellsNature Cell Biology 18:1124–1125.https://doi.org/10.1038/ncb3432
-
Mitotic bookmarking by transcription factorsEpigenetics & Chromatin 6:6.https://doi.org/10.1186/1756-8935-6-6
-
A genetic locus targeted to the nuclear periphery in living cells maintains its transcriptional competenceThe Journal of Cell Biology 180:51–65.https://doi.org/10.1083/jcb.200706060
-
Epigenetic characteristics of the mitotic chromosome in 1D and 3DCritical Reviews in Biochemistry and Molecular Biology 52:185–204.https://doi.org/10.1080/10409238.2017.1287160
-
A changing paradigm of transcriptional memory propagation through mitosisNature Reviews Molecular Cell Biology 20:55–64.https://doi.org/10.1038/s41580-018-0077-z
-
Phosphorylation of serine 10 in histone H3, what for?Journal of Cell Science 116:3677–3685.https://doi.org/10.1242/jcs.00735
-
Epigenetic inheritance during the cell cycleNature Reviews Molecular Cell Biology 10:192–206.https://doi.org/10.1038/nrm2640
-
Super resolution imaging of chromatin in pluripotency, differentiation, and reprogrammingCurrent Opinion in Genetics & Development 46:186–193.https://doi.org/10.1016/j.gde.2017.07.010
-
Sensing core histone phosphorylation — A matter of perfect timingBiochimica Et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1839:711–718.https://doi.org/10.1016/j.bbagrm.2014.04.013
-
Mechanisms of heterochromatin subnuclear localizationTrends in Biochemical Sciences 38:356–363.https://doi.org/10.1016/j.tibs.2013.04.004
-
Histone modifications and mitosis: countermarks, landmarks, and bookmarksTrends in Cell Biology 23:175–184.https://doi.org/10.1016/j.tcb.2012.11.005
Decision letter
-
Andrés AguileraReviewing Editor; CABIMER, Universidad de Sevilla, Spain
-
Jessica K TylerSenior Editor; Weill Cornell Medicine, United States
-
Andrew S BelmontReviewer; University of Illinois at Urbana Champaign, United States
In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.
Thank you for submitting your article "H3K9me2 orchestrates inheritance of spatial positioning of peripheral heterochromatin through mitosis" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Jessica Tyler as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Andrew S Belmont (Reviewer #3).
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
Summary:
This is a nice paper on an important topic that significantly advances mechanistic understanding of how nuclear lamina-associated domains of silenced chromatin can be remembered through mitosis and faithfully re-established in daughter cells. It also clarifies why/how H3K9me2 differs from H3K9me3 in its role and localization in cells. The authors address several fundamental points with regard to (a) the degree to which H3K9me2 marks peripheral heterochromatin; (b) the degree to which LADs are positioned specifically at the nuclear periphery versus also at other heterochromatin compartments in the nuclear interior, such as nucleoli or peri-centric heterochromatin; and (c) how LADs and these H3K9me2-marked domains position during the reformation of the nucleus after mitosis. The manuscript demonstrates that H3K9 di-methylation marks peripheral, lamina-associated heterochromatin through the cell cycle and proposes a phospho-methyl switch mechanism for displacing H3K9me2-lamina contacts during mitosis and resuming those contacts during nuclear reassembly. The authors propose that this allows the stable transmittance of 3D genome organization and faithful repression of LAD resident genes through cell divisions. This assertion would represent a significant and exciting advance to our understanding of how nuclear organization and thus cell-type-specific gene expression programs can be transmitted faithfully through cell division. The article is very well written and a pleasure to read. However, in its current status, there are questions that need to be resolved in order to proceed with acceptance of the manuscript.
Essential revisions:
1) The authors rightly describe the confusion in the field due to conflicting results in the literature concerning the distribution of the H3K9 mark relative to the nuclear periphery. They rightly attribute this to issues with regard to antibody specificity. But then they based their entire manuscript on exactly one antibody against H3K9me2. Given the importance of these results, and the existing conflicting data from many laboratories, it is important for the authors to validate their results with more than one antibody. The blocking peptide experiments are very valuable. But they just show that the antibody binds to the relevant peptide in solution. They do not address whether an epitope could be on a non-histone protein or if it recognizes the histone peptide sequence and modification but is also dependent on other properties surrounding the H3 histone in its native context.
2) How similar is the reported H3K9me2 staining relative to the previously described "epichromatin" epitope displayed by another anti-histone antibody by Don and Ada Olins? A direct comparison would be valuable. The similarity in comparing the figures in this manuscript with published papers from Olins and Olins is striking! This epichromatin staining is clearly context and conformation dependent – although the antibody is specific for histones, it only stains in situ the chromatin at the periphery of mitotic plates and at the nuclear periphery in nuclei, but this specificity is not shown for purified nucleosomes or sonicated chromatin using ChIP.
3) The ability of H3S10 phosphorylation to block peripheral tethering of H3K9me2-modified chromatin is supported by the inability of a phosphomimetic mutant of H3S10 (GFP-tagged H3S10E, Figure 3) to enrich at the nuclear periphery and by the anti-correlation between H3K9me2/S10 phosphorylation and lamina assembly around H3K9me2 (Figure 4B, 4C). However, in some images (Figure 4A) it seems that H3K9me2 and H3K9me2S10p both seem quite peripherally enriched through all stages of mitosis. The "increased" separation from the lamina actually seems to be just the visualization of a lower level of staining within the body of the condensed prophase chromatids. Are the line scans in Figure 4C single examples from one image? This point would be more convincing if the extent of H3K9me2's peripheral enrichment through mitosis were quantified similarly to the quantification done in Figure 3C. This would be complicated by the lack of an intact lamina to use as a fiducial mark, but the centroid of the chromatin mass could be used instead. Indeed, how do the authors reconcile the apparent contradiction between the peripheral staining of mitotic plates throughout mitosis using the H3K9me2 antibody (Figure 4) with the loss of peripheral localization until telophase for the LAD FISH (Figure 6)? This again opens the possibility that they are looking at an "epichromatin" like staining pattern with their antibodies.
4) These experiments use an antibody that recognizes the Histone H3 tail when dually modified with H3K9 dimethylation and H3S10 phosphorylation. This antibody is blocked by an H3K9me2S10p peptide but not by an H3K9me2 peptide. Is it blocked by an S10phospho peptide? If any S10phospho cross-reactivity exists, this may contribute central nucleoplasmic signal that may be more prominent especially as the specific antigen is removed (H3K9me2S10p). A different way to answer this question might be, how does S10phospho distribution compare to H3K9me2S10p distribution in mitotic cells? This may be an important point needed to support the argument that H3K9me2S10p must be de-phosphorylated for peripheral enrichment to resume.
5) Similarly, the authors have demonstrated the specificity of the H3K9me2 antibody for H3K9me2 over other methylation states. However, the ability of the H3K9me2 antibody to detect the H3K9me2S10p dual modification is not conclusively proven. For example, can the H3K9me2 antibody also be blocked by an H3K9me2S10p peptide? If not, this would suggest that this antibody has a lower affinity for the dually modified H3 tail than the H3K9me2/unmodified Ser10 tail. This would then open up the alternative interpretation that "enrichment" of H3K9me2 at the nuclear periphery over H3K9me2S10p is due to a higher affinity of the H3K9me2 antibody for un-phosphorylated H3 tails.
6) The idea of a phosphorus-switch by which H3K9me2S10 phosphorylation leads to loss of lamina association during mitosis, being a major punchline of the manuscript, does not appear to be demonstrated by the current manuscript. The argument used by authors rests on the lack of GFP-H3 localization of certain deletion mutants and some line scans of mitotic cells which were not convincing of showing loss of H3K9me2S10 phosphorylation from the peripheral staining. Overall, the authors show that H3K9me2 modification of genomic loci correlates with lamina association, and that histone S10 phosphorylation is anti-correlated with lamina association. However, functional tests to link these elements together are lacking. The authors assert that S10 phosphorylation disrupts the interaction of H3K9me2 with its tether. This could be tested, for instance, with Cec-4; if Cec-4 interacts specifically with H3K9me2 and not with H3K9me2S10p, this would support this model.
7) To what degree does the reduced z-resolution, projection through the depth of focus, and intensity scaling play a role in their conclusions of an exclusively peripheral localization of H3K9me2. Thus, in Results subsection “H3K9me2 is an evolutionarily conserved mark of peripheral heterochromatin”: "H3K9me2 marks only peripheral heterochromatin, whereas H3K9me3 and H3K27me3 co-localize with heterochromatin in the nuclear interior, or at both the interior and the periphery." However, the ratio of peripheral rim staining seems not that different for H3K9me2 and K3K9me3. If it is ignored the very intense staining over chromocenters in mouse cells that have large PCH, the ratio of the peripheral rim and internal foci staining does not seem that different for H3K9me2 and H3K9me3 staining. Eyeballing Figure 1A I see ratios of peripheral to interior foci intensities ranging from ~80:25 to 80-10 for H3K9me2, versus ~40:10 for H3K9me3 – a factor only of about 2-fold difference. Indeed, peripheral rim staining of chromatin in individual optical sections represents actually a z-projection through the z-depth of focus. Because of the finite thickness of the heterochromatin rim, this leads to a significant enhanced intensity due to this projection effect – as would be seen even for DNA staining. This effect is especially true for confocal imaging but also true for STORM imaging – both have much worse resolution in z. This effect needs to be compensated for when comparing the "enrichment" of signal at the periphery versus interior. The comparison could be with the corresponding measurement done for DNA staining such as DAPI for the peripheral rim and interior condensed foci (other than chromocenters) or between the intensity of internally stained foci with grazing sections of nuclei. Nuclei from cells growing flat in a monolayer will tend to have flat nuclear surfaces, particularly basal. These grazing sections will not have this superposition, projection effect. Finally, what is the actual comparison of intensity between the internal foci seen with H3K9me2 STORM staining and foci at the periphery. The beautiful STORM images in Figure 1B appear to show internal foci (spots and short fiber-like segments) at relatively the same brightness as foci at the periphery.
8) How exactly do the authors explain the GFP-H3 mutant results, given the documented low level of expression of the GFP-H3 variants? Can the authors elaborate on their logic? Thus, the H3K9me2 antibody rim staining appears unperturbed by any of the H3 mutants, suggesting that LAD distribution overall is unperturbed. Also, only a small fraction of the nucleosomes should contain the exogenous H3. But then why should this matter? Specifically, why should a 500-1000 kb LAD change position because a small percentage of the nucleosomes have the mutant H3? If there were actually some type of cooperative effect actually causing displacement, then why is the H3K9me2 staining unperturbed? Conversely, how would a modified nucleosome be able to localize 100s of nm or microns away from the nuclear periphery while the surrounding nucleosomes with wtH3 are localized at the periphery. These LADs contain condensed chromatin and its compaction and the known size of the nucleosome and linker DNA would seem to preclude such spatial separation.
[Editors' note: further revisions were requested prior to acceptance, as described below.]
Thank you for resubmitting your work entitled "H3K9me2 orchestrates inheritance of spatial positioning of peripheral heterochromatin through mitosis" for further consideration at eLife. Your revised article has been favorably evaluated by Jessica Tyler as the Senior Editor, A. Aguilera as the Reviewing Editor, and three reviewers.
The manuscript demonstrates that H3K9 di-methylation marks peripheral, lamina-associated heterochromatin through the cell cycle and proposes a phospho-methyl switch mechanism for displacing H3K9me2-lamina contacts during mitosis and resuming those contacts during nuclear reassembly. The authors propose that this allows the stable transmittance of 3D genome organization and faithful repression of LAD resident genes through cell divisions. The study contributes an important mechanistic understanding that significantly advances the field of epigenetics. In the revised manuscript, the authors have addressed all major concerns by including additional data to support antibody specificity, additional images demonstrating positioning of H3K9me2 through mitosis, and by pointing out that it was already demonstrated that Cec-4:H3K9methyl binding is disrupted by Ser10 or Thr11 phosphorylation, a point that solidifies the phospho-methyl switch model.
The manuscript has certainly been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:
The way the manuscript is now written seems to be more focused on the phospho-switch, the exclusive localization of the H3K9me2 to the periphery, and the absolute requirement for the H3K9me2 for peripheral localization in mammalian cells, the latter a conclusion entirely based on the GFP-H3 mutant localization data. However, the explanation of how the GFP-H3 mutants can be interpreted if they are only a small fraction of the H3 in the cell is not clear and that the authors should address this point with a detailed explanation in the paper itself – taking account of the low percentage of H3 that is GFP-tagged and mutated. The authors acknowledge that either biased incorporation or biased positioning of nucleosomes at/away from the nuclear periphery could explain their results. Anyhow, biased incorporation would represent a very different process than biased positioning, one that is completely different from the way that endogenous assembled nucleosomes are regulated by histone modifications. The authors should provide an explanation of how a low fraction of mutant H3 incorporation could mislocalize LADs from the periphery and explain the absence of any change to the endogenous H3K9me2 enrichment at the nuclear periphery.
With respect to the nonrandom binding of LADs after mitosis, the authors describe resolving a conflict in the literature regarding random shuffling of LADs to different heterochromatin compartments (i.e. nuclear lamina versus nucleoli) versus specific targeting of the same set of LADs to the periphery or interior (i.e. nucleolus) from mother to daughter cells, but it unclear they can do this by their current methodologies. It looks like that all can be concluded is that the preferred localization of ~80% of cLADs to the nuclear periphery occurs early after reformation of the telophase/early G1 nucleus. Please revise and discuss in more detail.
Figure 4. Typical confocal microscope hardware/software often has the user define a "black" level which is the analog level which the analog to digital (A/D) converter sets as the 0 value. All analog values below this "black" level are truncated to zero. If the "black" level is set to a level that represents non-zero intensity then this introduces a nonlinearity which prevents measurement of relative intensity levels. The hallmark of this is spatial resolution higher than possible with the psf of the microscope due to this truncation effect (i.e. values going from high to zero in a short distance relative to the normal blurring predicted by the point spread function) and also zero values of intensities inside the stained region and/or immediately outside of it. There is no description of how the authors set the "black" level during their microscopy. The images and line-scans indicate a black and zero level of intensity immediately outside the lamin ring staining and even at locations inside the nucleus. This is weird, as nonspecific antibody staining, out of focus light, even the in-focus point-spread function, and the dark current and readout noise typically produces nonzero intensity values. Therefore, the authors should describe how the intensity levels were set and whether they allow actual linear measurements of intensities.
Related to above, the predicted banding pattern of LADs versus iLADs could be better appreciated if they did chromosome spreads or looked at isolated chromosomes. This would tell if the unusual telomeric concentration of intensities towards the telomeres was real or not. If the staining of isolated chromosomes is different from the staining of the cells, it would point to a staining issue when staining whole cells.
Figure 4D. There is peripheral H3K9me2S10p staining although not a brighter ring of staining. It would be nice to see some type of aggregate analysis of a number of nuclei at each of several different stages of telophase to establish this temporal correlation.
https://doi.org/10.7554/eLife.49278.028Author response
Essential revisions:
1) The authors rightly describe the confusion in the field due to conflicting results in the literature concerning the distribution of the H3K9 mark relative to the nuclear periphery. They rightly attribute this to issues with regard to antibody specificity. But then they based their entire manuscript on exactly one antibody against H3K9me2. Given the importance of these results, and the existing conflicting data from many laboratories, it is important for the authors to validate their results with more than one antibody. The blocking peptide experiments are very valuable. But they just show that the antibody binds to the relevant peptide in solution. They do not address whether an epitope could be on a non-histone protein or if it recognizes the histone peptide sequence and modification but is also dependent on other properties surrounding the H3 histone in its native context.
Localization of H3K9me2-marked chromatin at the nuclear periphery was previously confirmed with several independent antibodies and methods in our earlier publication (Poleshko et al., 2017) as mentioned in the text. In brief, localization of the H3K9me2-marked chromatin at the nuclear periphery was confirmed by immuno-fluorescence (IF) and ChIP-seq (see Figure 1—figure supplement 1B) using multiple validated antibodies. Furthermore, the OligoPaint experiment using probes to H3K9me2-enriched genomic regions correlates with the H3K9me2 IF staining (see Figure 4—figure supplement 1 and Figure 6—figure supplement 2).
To further address the reviewer’s concerns about antibody specificity, we have added a new Figure 2—figure supplement 1 that includes histone peptide array data for two H3K9me2 antibodies (Figure 2—figure supplement 1A-B), IF staining with 3 anti-H3K9me2 antibodies (Figure 2—figure supplement 1C) and a Western blot (Figure 2—figure supplement 1D). Note that IF staining with all 3 antibodies confirms the peripheral localization of H3K9me2-marked chromatin. Also, the Western blot shows only a single band at the appropriate size for H3, making recognition of a non-histone protein unlikely. The histone peptide arrays show that the antibodies recognize H3K9me2 in combination with other neighboring histone modifications, except S10p or T11p. This observation is consistent with the “phospho-methyl switch” model presented in the manuscript.
The histone peptide array data for the H3K9me2 antibodies were published previously and were referenced in the original text although some of the graphical representations shown in the revised figures are new. Given the reviewers’ concerns about antibody specificity, we believe that the manuscript will benefit from the added supplementary figure depicting this previously published data, which we have referenced appropriately in the figure legend.
2) How similar is the reported H3K9me2 staining relative to the previously described "epichromatin" epitope displayed by another anti-histone antibody by Don and Ada Olins? A direct comparison would be valuable. The similarity in comparing the figures in this manuscript with published papers from Olins and Olins is striking! This epichromatin staining is clearly context and conformation dependent – although the antibody is specific for histones, it only stains in situ the chromatin at the periphery of mitotic plates and at the nuclear periphery in nuclei, but this specificity is not shown for purified nucleosomes or sonicated chromatin using ChIP.
For current and previous studies we used two anti-H3K9me2 antibodies: Active Motif pAb #39239 and Abcam mAb #ab1220. Both antibodies were tested for specificity and the influence of neighboring modifications using a peptide array, and both antibodies showed a single, specific band by Western blot (new Figure 2—figure supplement 1). Peripheral localization of the H3K9me2-marked chromatin was confirmed by IF with 3 different antibodies. Given the extensive characterization of these antibodies and the confirmation of the peripheral location of H3K9me2-marked chromatin by multiple methods, we do not believe it would advance our work substantively to further explore the relationship of our work to the anti-nucleosome PL2-6 antibody used by Don and Ada Olins. Indeed, the cryoEM structure of the single chain antibody fragment from this antibody bound to a CENP-A nucleosome was recently published (Zhou et al., Nature Communications, 2019). Perhaps future studies from our lab, the Olins’ or others could address whether any connection exists between our findings and the pattern of staining seen with PL2-6 that recognizes a distinct epitope.
3) The ability of H3S10 phosphorylation to block peripheral tethering of H3K9me2-modified chromatin is supported by the inability of a phosphomimetic mutant of H3S10 (GFP-tagged H3S10E, Figure 3) to enrich at the nuclear periphery and by the anti-correlation between H3K9me2/S10 phosphorylation and lamina assembly around H3K9me2 (Figure 4B, 4C). However, in some images (Figure 4A) it seems that H3K9me2 and H3K9me2S10p both seem quite peripherally enriched through all stages of mitosis. The "increased" separation from the lamina actually seems to be just the visualization of a lower level of staining within the body of the condensed prophase chromatids. Are the line scans in Figure 4C single examples from one image? This point would be more convincing if the extent of H3K9me2's peripheral enrichment through mitosis were quantified similarly to the quantification done in Figure 3C. This would be complicated by the lack of an intact lamina to use as a fiducial mark, but the centroid of the chromatin mass could be used instead. Indeed, how do the authors reconcile the apparent contradiction between the peripheral staining of mitotic plates throughout mitosis using the H3K9me2 antibody (Figure 4) with the loss of peripheral localization until telophase for the LAD FISH (Figure 6)? This again opens the possibility that they are looking at an "epichromatin" like staining pattern with their antibodies.
We did not intend to suggest that H3K9me2 remains peripheral during all stages of mitosis and indeed, we did not state this. H3K9me2-/H3K9me2S10p-marked chromatin detaches from the nuclear lamina in prophase and is packed into mitotic chromosomes until the telophase stage when H3K9me2-chromatin is restored at the nuclear periphery (Figure 4). H3K9me2-chromatin and euchromatin remains distributed throughout the chromosome arms but is excluded from the center of the mitotic plate during prometaphase-metaphase. The center of the mitotic plate contains centromeres and pericentromeric heterochromatin enriched for H3K9me3 (Figure 5). We agree with the reviewer that a single confocal plane might not be definitive. Therefore, we have included a new Figure 4—figure supplement 1 that shows 3D image reconstructions of the images presented in Figure 4A.
Confocal images displayed in Figure 4C are representative and line profiles show an analysis of a single line. To address the reviewer’s point, we have included additional images and line profiles as new Figure 4—figure supplement 3.
As mentioned above, H3K9me2 staining is distributed throughout the chromosome arms during prometaphase-anaphase (new Figure 4—figure supplement 1). OligoFISH data using LAD and non-LAD probes are consistent with this observation. We have included a new Figure 6—figure supplement 2 that displays the 3-dimensional distribution of H3K9me2-enriched LAD and non-LAD probes throughout the chromosome arms with exclusion from the center of the mitotic plate where pericentromeric heterochromatin/chromocenters localize. This correlates well with the distribution of the H3K9me2 mark as shown in Figure 4A and Figure 4—figure supplement 1. We also modified Video 2 to highlight the central position of chromocenters and non-central distribution of LAD and non-LAD probes.
4) These experiments use an antibody that recognizes the Histone H3 tail when dually modified with H3K9 dimethylation and H3S10 phosphorylation. This antibody is blocked by an H3K9me2S10p peptide but not by an H3K9me2 peptide. Is it blocked by an S10phospho peptide? If any S10phospho cross-reactivity exists, this may contribute central nucleoplasmic signal that may be more prominent especially as the specific antigen is removed (H3K9me2S10p). A different way to answer this question might be, how does S10phospho distribution compare to H3K9me2S10p distribution in mitotic cells? This may be an important point needed to support the argument that H3K9me2S10p must be de-phosphorylated for peripheral enrichment to resume.
The H3K9me2S10p antibody does not recognize H3S10p. We extended the peptide blocking experiment with addition of the H3S10p peptide as the reviewer suggested (Figure 4—figure supplement 2A). We also added histone peptide array data demonstrating antibody specificity of the H3K9me2S10p antibody (Figure 4—figure supplement 2B).
5) Similarly, the authors have demonstrated the specificity of the H3K9me2 antibody for H3K9me2 over other methylation states. However, the ability of the H3K9me2 antibody to detect the H3K9me2S10p dual modification is not conclusively proven. For example, can the H3K9me2 antibody also be blocked by an H3K9me2S10p peptide? If not, this would suggest that this antibody has a lower affinity for the dually modified H3 tail than the H3K9me2/unmodified Ser10 tail. This would then open up the alternative interpretation that "enrichment" of H3K9me2 at the nuclear periphery over H3K9me2S10p is due to a higher affinity of the H3K9me2 antibody for un-phosphorylated H3 tails.
The H3K9me2 antibody does not recognize the H3K9me2S10p epitope. We have added histone peptide array data (Figure 2—figure supplement 1B) demonstrating antibody specificity. The antibody cannot recognize H3K9me2 if neighboring S10 or T11 is phosphorylated. As the reviewer suggested, we also tested anti-H3K9me2 antibodies in IF assays to determine that binding is not blocked by H3K9me2S10p peptides (Figure 2—figure supplement 1E-F). Each antibody used is specific for its epitope.
We believe that any confusion is the result of partial colocalization of H3K9me2 and H3K9me2S10p staining in Figure 4. We interpret this finding to suggest that not every S10 adjacent to K9me2 is phosphorylated during mitosis. Note that during telophase the separation of the two epitopes becomes more clear (Figure 4D). To avoid confusion, we have modified the text to address this point (subsection “H3K9me2 persists through mitosis and associates with reassembling nuclear lamina in daughter cells at mitotic exit”):
“Our data suggest that not every histone H3 Ser10 adjacent to H3K9me2 is phosphorylated since we observe some overlap of staining with the H3K9me2 and H3K9me2S10p antibodies.”
6) The idea of a phosphorus-switch by which H3K9me2S10 phosphorylation leads to loss of lamina association during mitosis, being a major punchline of the manuscript, does not appear to be demonstrated by the current manuscript. The argument used by authors rests on the lack of GFP-H3 localization of certain deletion mutants and some line scans of mitotic cells which were not convincing of showing loss of H3K9me2S10 phosphorylation from the peripheral staining. Overall, the authors show that H3K9me2 modification of genomic loci correlates with lamina association, and that histone S10 phosphorylation is anti-correlated with lamina association. However, functional tests to link these elements together are lacking. The authors assert that S10 phosphorylation disrupts the interaction of H3K9me2 with its tether. This could be tested, for instance, with Cec-4; if Cec-4 interacts specifically with H3K9me2 and not with H3K9me2S10p, this would support this model.
In order to address this point, we have provided additional antibody validation data which demonstrates that phosphorylation of S10 adjacent to H3K9me2 (H3K9me2S10p) blocks recognition of the epitope by the H3K9me2 antibodies (Figure 2—figure supplement 1B, E-F).
The functional experiment suggested by the reviewer has been published previously (Gonzalez-Sandoval et al., 2015) and we have referenced this result in the text. Briefly, the Gasser lab demonstrated that S10 or T11 phosphorylation reduces K9 methylation-dependent CEC-4 binding by 75 or 105 times, respectively. Combined, these results support the “phospho-methyl switch” model.
“Indeed, experimental results from the Gasser lab demonstrated that CEC-4 binds methylated H3K9 peptides and this binding is reduced by 2 orders of magnitude if the adjacent Ser10 is phosphorylated (Gonzalez-Sandoval et al., 2015).”
7) To what degree does the reduced z-resolution, projection through the depth of focus, and intensity scaling play a role in their conclusions of an exclusively peripheral localization of H3K9me2. Thus, in Results subsection “H3K9me2 is an evolutionarily conserved mark of peripheral heterochromatin”: "H3K9me2 marks only peripheral heterochromatin, whereas H3K9me3 and H3K27me3 co-localize with heterochromatin in the nuclear interior, or at both the interior and the periphery." However, the ratio of peripheral rim staining seems not that different for H3K9me2 and K3K9me3. If it is ignored the very intense staining over chromocenters in mouse cells that have large PCH, the ratio of the peripheral rim and internal foci staining does not seem that different for H3K9me2 and H3K9me3 staining. Eyeballing Figure 1A I see ratios of peripheral to interior foci intensities ranging from ~80:25 to 80-10 for H3K9me2, versus ~40:10 for H3K9me3 – a factor only of about 2-fold difference. Indeed, peripheral rim staining of chromatin in individual optical sections represents actually a z-projection through the z-depth of focus. Because of the finite thickness of the heterochromatin rim, this leads to a significant enhanced intensity due to this projection effect – as would be seen even for DNA staining. This effect is especially true for confocal imaging but also true for STORM imaging – both have much worse resolution in z. This effect needs to be compensated for when comparing the "enrichment" of signal at the periphery versus interior. The comparison could be with the corresponding measurement done for DNA staining such as DAPI for the peripheral rim and interior condensed foci (other than chromocenters) or between the intensity of internally stained foci with grazing sections of nuclei. Nuclei from cells growing flat in a monolayer will tend to have flat nuclear surfaces, particularly basal. These grazing sections will not have this superposition, projection effect. Finally, what is the actual comparison of intensity between the internal foci seen with H3K9me2 STORM staining and foci at the periphery. The beautiful STORM images in Figure 1B appear to show internal foci (spots and short fiber-like segments) at relatively the same brightness as foci at the periphery.
We do not rely solely on the immunofluorescence experiments to conclude that H3K9me2-marked chromatin is localized at the nuclear periphery. Localization of H3K9me2-marked chromatin was observed at the nuclear periphery by multiple methods presented in the manuscript and previously published, including genome-wide ChIP-seq results demonstrating high LB1-H3K9me2 co-occupancy (Poleshko et al., 2017) as mentioned in the original text.
As stated in the text, H3K9me3 and H3K27me3 heterochromatin are observed in multiple regions of the nucleus in addition to the nuclear periphery thus both are non-specific to the nuclear periphery. In contrast, the H3K9me2 predominantly localized at the nuclear periphery. These observations are consistent between IF and ChIP-seq data (see Poleshko et al., 2017).
The described effect has no influence on image analysis/quantifications or any conclusions presented in the manuscript. To address the reviewer’s concern, we have provided additional supplementary images to display XY, XZ and YZ-projections as well as 3D image reconstruction of the H3K9me2 staining (Figure 1—figure supplement 1A).
To address the nature of the internal H3K9me2 foci, a blocking peptide was used to distinguish specific from background signal of the H3K9me2 antibody (Figure 2, Figure 1—figure supplement 2 and Figure 2—figure supplement 1). As mentioned in the original text, the signal in the nuclear interior is largely background as confirmed by both confocal and STORM microscopies.
8) How exactly do the authors explain the GFP-H3 mutant results, given the documented low level of expression of the GFP-H3 variants? Can the authors elaborate on their logic? Thus, the H3K9me2 antibody rim staining appears unperturbed by any of the H3 mutants, suggesting that LAD distribution overall is unperturbed. Also, only a small fraction of the nucleosomes should contain the exogenous H3. But then why should this matter? Specifically, why should a 500-1000 kb LAD change position because a small percentage of the nucleosomes have the mutant H3? If there were actually some type of cooperative effect actually causing displacement, then why is the H3K9me2 staining unperturbed? Conversely, how would a modified nucleosome be able to localize 100s of nm or microns away from the nuclear periphery while the surrounding nucleosomes with wtH3 are localized at the periphery. These LADs contain condensed chromatin and its compaction and the known size of the nucleosome and linker DNA would seem to preclude such spatial separation.
As the reviewer points out, the GFP-H3 mutants are expressed at relatively low levels, and they do not appear to alter endogenous H3K9me2 staining. We therefore do not think that they are displacing LADs, i.e. LADs do not change position. We interpret the inability of the K9A (and other) mutants to partition to the periphery to suggest that lysine 9 dimethylation is required for either incorporation into peripheral nucleosomes, or for retention within nucleosomes at the periphery. Perhaps interaction with a dimethyl reader at the periphery stabilizes and incorporates a K9 dimethylated histone H3 protein. We have added our interpretation of these results to further address this point.
“We interpret the inability of the K9A and K9E mutants to partition to the periphery to suggest that lysine 9 dimethylation is required for either incorporation into peripheral nucleosomes, or for retention within nucleosomes at the periphery.”
[Editors' note: further revisions were requested prior to acceptance, as described below.]
[…] The manuscript has certainly been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:
The way the manuscript is now written seems to be more focused on the phospho-switch, the exclusive localization of the H3K9me2 to the periphery, and the absolute requirement for the H3K9me2 for peripheral localization in mammalian cells, the latter a conclusion entirely based on the GFP-H3 mutant localization data. However, the explanation of how the GFP-H3 mutants can be interpreted if they are only a small fraction of the H3 in the cell is not clear and that the authors should address this point with a detailed explanation in the paper itself – taking account of the low percentage of H3 that is GFP-tagged and mutated. The authors acknowledge that either biased incorporation or biased positioning of nucleosomes at/away from the nuclear periphery could explain their results. Anyhow, biased incorporation would represent a very different process than biased positioning, one that is completely different from the way that endogenous assembled nucleosomes are regulated by histone modifications. The authors should provide an explanation of how a low fraction of mutant H3 incorporation could mislocalize LADs from the periphery and explain the absence of any change to the endogenous H3K9me2 enrichment at the nuclear periphery.
We disagree that the focus of the manuscript has changed. In the revised manuscript, we haven’t changed any of our conclusions and we have not removed any data. We provided additional data as requested by the reviewers.
The conclusion that H3K9me2 acts as a 3D architectural mitotic guidepost is based on multiple experiments and observations and not solely on the GFP-H3 mutant localization.
Given that both wild-type GFP-tagged H3 and the S10A mutant GFP-tagged H3 proteins are incorporated and observed at the nuclear periphery, the most straight-forward conclusion is that only certain H3 mutants, namely those that preclude critical modifications, are not localized to the nuclear periphery. We clarify our reasoning in the text.
“Given that wild-type GFP-H3 is incorporated and observed at the nuclear periphery, we interpret the inability of the K9A and K9E mutants to partition to the periphery to suggest that lysine 9 dimethylation is required for either incorporation into peripheral nucleosomes, or for retention within nucleosomes at the periphery.”
Further, we do not observe any alteration of the endogenous H3K9me2 staining at the nuclear periphery upon expression of low levels of mutant H3 as we stated in the prior response, and we do not think that LADs are displaced from the nuclear lamina. The reviewer previously asked why we think LADs are being displaced in this experiment and we responded “We therefore do not think that they are displacing LADs, i.e. LADs do not change position”. We therefore do not understand why we are asked again why LADs are mislocalized. They are not.
With respect to the nonrandom binding of LADs after mitosis, the authors describe resolving a conflict in the literature regarding random shuffling of LADs to different heterochromatin compartments (i.e. nuclear lamina versus nucleoli) versus specific targeting of the same set of LADs to the periphery or interior (i.e. nucleolus) from mother to daughter cells, but it unclear they can do this by their current methodologies. It looks like that all can be concluded is that the preferred localization of ~80% of cLADs to the nuclear periphery occurs early after reformation of the telophase/early G1 nucleus. Please revise and discuss in more detail.
In order to avoid any confusion that we were “resolving a conflict”, and to indicate that our data support (but do not prove) the model in which H3K9me2-marked LADs are specifically repositioned at the nuclear periphery, we have substituted the word “suggest” in the Discussion:
“Our results showing localization of H3K9me2-enriched lamina-associated chromatin, including those produced with LAD-specific oligopaints, suggest that H3K9me2-marked LADs which are re-established at the nuclear periphery at the end of mitosis concomitant with nuclear lamina re-assembly are likely distinct from the H3K9me3-marked NADs.”
Figure 4. Typical confocal microscope hardware/software often has the user define a "black" level which is the analog level which the analog to digital (A/D) converter sets as the 0 value. All analog values below this "black" level are truncated to zero. If the "black" level is set to a level that represents non-zero intensity then this introduces a nonlinearity which prevents measurement of relative intensity levels. The hallmark of this is spatial resolution higher than possible with the psf of the microscope due to this truncation effect (i.e. values going from high to zero in a short distance relative to the normal blurring predicted by the point spread function) and also zero values of intensities inside the stained region and/or immediately outside of it. There is no description of how the authors set the "black" level during their microscopy. The images and line-scans indicate a black and zero level of intensity immediately outside the lamin ring staining and even at locations inside the nucleus. This is weird, as nonspecific antibody staining, out of focus light, even the in-focus point-spread function, and the dark current and readout noise typically produces nonzero intensity values. Therefore, the authors should describe how the intensity levels were set and whether they allow actual linear measurements of intensities.
To address the reviewer’s concern, we extended the Methods section that describes image acquisition (see below). Confocal images were taken using the HyD detectors. Only DAPI staining was acquired with a PMT detector with a “black” level defined as an offset -0.1%. Images were taken using minimal laser power to ensure there was no signal saturation. The concerns raised by the reviewer are not relevant to images taken with HyD detectors.
“All confocal immunofluorescent images were taken using a Leica TCS SP8 3X STED confocal microscope using 63x/1.40 oil objective. DAPI staining (blue channel) was acquired using a PMT detector with offset -0.1%. All other staining (green, red and far red channels) were acquired using HyD detectors in the standard mode with 100% gain. All images were taken with minimal laser power to avoid saturation. 3D images were taken as Z-stacks with 0.05μm intervals with a range of 80-250 Z-planes per nucleus. Confocal 3D images were deconvoluted using Huygens Professional software using the microscope parameters, standard PSF and automatic settings for background estimation.”
Related to above, the predicted banding pattern of LADs versus iLADs could be better appreciated if they did chromosome spreads or looked at isolated chromosomes. This would tell if the unusual telomeric concentration of intensities towards the telomeres was real or not. If the staining of isolated chromosomes is different from the staining of the cells, it would point to a staining issue when staining whole cells.
Based on the proposed mitotic spread experiments, we assume that the reviewer refers to prometaphase-anaphase staining. We do not rely on these images to draw any conclusions. Note that we show markedly different patterns of staining in telophase for H3K9me2 and several other histone marks (Figure 5) making artifactual staining exceedingly unlikely. We do not feel that staining of isolated chromosomes would add substantially to our work.
Figure 4D. There is peripheral H3K9me2S10p staining although not a brighter ring of staining. It would be nice to see some type of aggregate analysis of a number of nuclei at each of several different stages of telophase to establish this temporal correlation.
The proposed additional analyses will not change the overall conclusions and we do not feel that it would add any clarity to our manuscript.
https://doi.org/10.7554/eLife.49278.029Article and author information
Author details
Funding
National Institutes of Health (R35 HL140018)
- Jonathan A Epstein
National Institutes of Health (DP2-HL147123)
- Rajan Jain
National Institutes of Health (R35 GM127093)
- John Isaac Murray
Cotswold Foundation
- Jonathan A Epstein
WW Smith Endowed Chair
- Jonathan A Epstein
Burroughs Wellcome Fund (Career Award for Medical Scientists)
- Rajan Jain
National Science Foundation (CMMI-1548571)
- Rajan Jain
- Jonathan A Epstein
Gilead Sciences (Gilead Research Scholars Program)
- Rajan Jain
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank Andrea Stout from the Penn CDB Microscopy Core for help with imaging. We thank Matt Good, Nicolas Plachta and Gerd Blobel for discussions and comments on the manuscript. This work was supported by NIH (R35 HL140018 to JAE, DP2-HL147123 to RJ, and R35 GM127093 to JIM) and the Cotswold Foundation (to JAE), the WW Smith endowed chair (to JAE), Burroughs Welcome Career Award for Medical Scientists and the Gilead Research Scholars Program (to RJ). RJ and JAE received support from the NSF (CMMI-1548571).
Senior Editor
- Jessica K Tyler, Weill Cornell Medicine, United States
Reviewing Editor
- Andrés Aguilera, CABIMER, Universidad de Sevilla, Spain
Reviewer
- Andrew S Belmont, University of Illinois at Urbana Champaign, United States
Version history
- Received: June 12, 2019
- Accepted: September 30, 2019
- Accepted Manuscript published: October 1, 2019 (version 1)
- Version of Record published: October 16, 2019 (version 2)
Copyright
© 2019, Poleshko et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 7,657
- Page views
-
- 1,188
- Downloads
-
- 56
- Citations
Article citation count generated by polling the highest count across the following sources: Scopus, Crossref, PubMed Central.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Biochemistry and Chemical Biology
- Cell Biology
The ATPase p97 (also known as VCP, Cdc48) has crucial functions in a variety of important cellular processes such as protein quality control, organellar homeostasis, and DNA damage repair, and its de-regulation is linked to neuromuscular diseases and cancer. p97 is tightly controlled by numerous regulatory cofactors, but the full range and function of the p97–cofactor network is unknown. Here, we identify the hitherto uncharacterized FAM104 proteins as a conserved family of p97 interactors. The two human family members VCP nuclear cofactor family member 1 and 2 (VCF1/2) bind p97 directly via a novel, alpha-helical motif and associate with p97-UFD1-NPL4 and p97-UBXN2B complexes in cells. VCF1/2 localize to the nucleus and promote the nuclear import of p97. Loss of VCF1/2 results in reduced nuclear p97 levels, slow growth, and hypersensitivity to chemical inhibition of p97 in the absence and presence of DNA damage, suggesting that FAM104 proteins are critical regulators of nuclear p97 functions.
-
- Cell Biology
- Neuroscience
The amyloid beta (Aβ) plaques found in Alzheimer’s disease (AD) patients’ brains contain collagens and are embedded extracellularly. Several collagens have been proposed to influence Aβ aggregate formation, yet their role in clearance is unknown. To investigate the potential role of collagens in forming and clearance of extracellular aggregates in vivo, we created a transgenic Caenorhabditis elegans strain that expresses and secretes human Aβ1-42. This secreted Aβ forms aggregates in two distinct places within the extracellular matrix. In a screen for extracellular human Aβ aggregation regulators, we identified different collagens to ameliorate or potentiate Aβ aggregation. We show that a disintegrin and metalloprotease a disintegrin and metalloprotease 2 (ADM-2), an ortholog of ADAM9, reduces the load of extracellular Aβ aggregates. ADM-2 is required and sufficient to remove the extracellular Aβ aggregates. Thus, we provide in vivo evidence of collagens essential for aggregate formation and metalloprotease participating in extracellular Aβ aggregate removal.