Ataxin-7 and Non-stop coordinate SCAR protein levels, subcellular localization, and actin cytoskeleton organization
- University of Missouri - Kansas City, United States
- Stowers Institute for Medical Research, United States
- University of Kansas Medical Center, United States
Figures
Figure 1 with 1 supplement
Non-stop (Not) co-purifies with Spt Ada Gcn5 acetyltransferase (SAGA) complex and additional multi-protein complexes.
(A) Working model: The Non-stop-containing SAGA deubiquitinase module (DUBm) functions distally from SAGA. Non-stop is anchored to SAGA by Ataxin-7 (Atxn7) but is released to interact with unknown …
Figure 1—figure supplement 1
Anti-Non-stop antibody specifically recognizes Non-stop.
Denaturing whole cell protein extracts were prepared from brains isolated from 3rd instar larvae homozygous for P element insertion P{PZ}not02069 in the non-stop gene (not). Immunoblotting shows …
Figure 2
WAVE regulatory complex (WRC) and Arp2/3 interact with Non-stop.
(A) Mass spectrometry analysis of Group 2 fractions revealed Arp2/3 and WRC complexes stably interact with Non-stop. None of these proteins were identified using vector only Control purifications. (B…
Figure 3
Non-stop and Atxn7 regulate SCAR protein levels.
(A) Endogenous pull-down reveals increased interaction between Non-stop and SCAR in the absence of Atxn7. Whole cell extracts prepared from either OregonR (WT) or homozygous mutant Ataxin7[KG02020] …
Figure 4
Non-stop binds ubiquitinated SCAR, regulates SCAR ubiquitination, and entry into the proteasome degradation pathway.
(A) Non-stop catalytic mutation which increases substrate binding also increases interaction with SCAR. The Non-stop catalytic cysteine was mutated to alanine creating Non-stop C406A-2xFLAG-2xHA …
Figure 5
Overexpression of Non-stop increases SCAR levels, directs SCAR localization, and alters cell morphology – reducing cell area and number of cell protrusions.
(A) Augmenting Non-stop increases local levels of SCAR. Drosophila BG3 central nervous system cells were transfected with no plasmid (control) or with Non-stop-FH expression vector as indicated. …
Figure 6
Non-stop bears conserved WIRS motifs.
Mutating these reduces Non-stop’s ability to bind SCAR, increase SCAR levels, reduce cell area, and reduce number of cell protrusions. (A) Alignment of Non-stop protein sequences reveals a conserved …
Figure 7
Atxn7 and Non-stop, act through the SCAR pathway in order to regulate the actin cytoskeleton in vivo.
(A) Phalloidin staining in third instar larval brains dissected from not02069 reveals a decrease in neural F-actin. (B) Conversely, phalloidin staining in Atxn7KG02020 shows an increase in F-actin. …
Figure 8
Chaoptin staining in the optic lobe of third instar larval brains reveals similar defects in Atxn7, SCAR, and not knockdowns in vivo.
The elav-Gal4 driver was used to drive UAS-RNAi lines in larvae. Third instar larval brains were dissected and immunostained with a Chaoptin antibody. Images were adjusted with contrast limited …
Figure 9
Non-stop regulates SCAR protein levels and location.
Model showing Non-stop interacts with WRC in an Atxn7-dependent manner, where Non-stop then counteracts degradation of WRC subunit SCAR. Loss of Atxn7 leads to increased availability of Non-stop for …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) | not | NA | FLYB: FBgn0013717 | |
| Gene (D. melanogaster) | Atxn7 | NA | FLYB: FBgn0031420 | |
| Gene (D. melanogaster) | SCAR | NA | FLYB: FBgn0041781 | |
| Gene (D. melanogaster) | Gcn5 | NA | FLYB: FBgn0020388 | |
| Gene (D. melanogaster) | Ada2b | NA | FLYB: FBgn0037555 | |
| Strain, strain background (D. melanogaster) | Elav-Gal4 | Bloomington Drosophila Stock Center | BDSC:458 RRID:BDSC_458 | Genotype:P(w[+mW.hs]=GawB)elav[C155] |
| Strain, strain background (D. melanogaster) | Uas-Gcn5 RNAi | Vienna Drosophila Resource Center | VDRC:21786 RRID:FlyBase_FBst0454233 | Construct ID:11218 |
| Strain, strain background (D. melanogaster) | Uas-SCAR RNAi | Bloomington Drosophila Stock Center | BDSC:36121 RRID:BDSC_36121 | Genotype: y[1] sc[*] v[1]; P(y[+t7.7] v[+t1.8]=TRiP.HMS01536)attP40 |
| Strain, strain background (D. melanogaster) | Uas-Not RNAi | Bloomington Drosophila Stock Center | BDSC:28725 rebalanced with Tm6b, Tb RRID:BDSC_28725 | Genotype: y[1] v[1]; P(y[+t7.7] v[+t1.8]=TRiP.JF03152)attP2/TM6B, Tb |
| Strain, strain background (D. melanogaster) | Uas-Atxn7 RNAi | Vienna Drosophila Resource Center | VDRC:102078 RRID:FlyBase_FBst0473949 | Construct ID:110634 |
| Strain, strain background (D. melanogaster) | OreR | DGGR | Catalog number: 109612 RRID:DGGR_109612 | |
| Strain, strain background (D. melanogaster) | Non-stop[02069] | Bloomington Drosophila Stock Center | BDSC:11553 Rebalanced with Tm3 GFP RRID:BDSC_11553 | Genotype: P(ry[+t7.2]=PZ)not[02069] ry[506]/TM3, P(w[+mC]=GAL4 twi.G)2.3, P(UAS-2xEGFP)AH2.3, Sb[1] Ser[1] |
| Strain, strain background (D. melanogaster) | SCAR [Delta37] | Bloomington Drosophila Stock Center | BDSC:8754 Rebalanced with CyoGFP RRID:BDSC_8754 | Genotype: w[*]; SCAR[Delta37] P(ry[+t7.2]=neoFRT)40A/CyO,, P(w[+mC]=GAL4 twi.G)2.2, P(UAS-2xEGFP)AH2.2. Cross BDSC:6662 and BDSC:8754 |
| Strain, strain background (D. melanogaster) | Atxn7[KG02020] | Bloomington Drosophila Stock Center | BDSC: 14255 Rebalanced with CyoGFP RRID:BDSC_14255 | Genotype: y[1] w[67c23]; P(y[+mDint2] w[BR.E.BR]=SUPor P)CG9866[KG02020]/CyO, P(w[+mC]=GAL4 twi.G)2.2, P(UAS-2xEGFP)AH2.2. |
| Strain, strain background (D. melanogaster) | Uas-Atxn7 RNAi, SCARΔ37 | This Paper | Materials and methods Subsection Fly Strains Genotype: w[*]; SCAR[Delta37] P(ry[+t7.2]=neoFRT)40A/CyO, P(w[+mC]=GAL4 twi.G)2.2, P(UAS-2xEGFP)AH2.2.; P{KK110634} VIE-260B/TM6C, cu[1] Sb[1] Tb[1] | |
| Cell line (D. melanogaster) | ML-DmBG3-c2 | Drosophila Genomics Resource Center #68 | FLYB: FBtc0000068; RRID:CVCL_Z728 | FlyBase symbol: ML-DmBG3-c2 |
| Cell line (D. melanogaster) | S2-DRSC | Drosophila Genomics Resource Center #181 | FLYB: FBtc0000181; RRID:CVCL_Z992 | FlyBase symbol: S2-DRSC |
| Antibody | Guinea Pig anti Non-stop | (Mohan et al., 2014a) | Western Blot Dilution (1:1000) IF Dilution (1:150) | |
| Antibody | Mouse anti Chaoptin (Monoclonal) | Developmental Studies Hybridoma Bank | 24B10 RRID:AB_528161 | IF Dilution (1:250) |
| Antibody | Goat anti Rat IGG −568 (Polyclonal) | Invitrogen | A-11077 RRID:AB_141874 | IF Dilution (1:1000) |
| Antibody | Goat anti Mouse IGG-488 (Polyclonal) | Invitrogen | A-11001 RRID:AB_2534069 | IF Dilution (1:1000) |
| Antibody | Goat anti Guinea pig IGG- 488 (Polyclonal) | Invitrogen | A11073 RRID:AB_142018 | IF Dilution (1:1000) |
| Other | Phalloidin-488 | Invitrogen | A12379 | IF Dilution (1:20) |
| Other | Phalloidin-568 | Invitrogen | A12380 RRID:AB_2810839 | IF Dilution (1:20) |
| Other | Vecta Shield | Vector Labs | H-1200 | |
| Antibody | Rat anti HA-HRP (Monoclonal) | Roche | 12013819001 RRID:AB_390917 | Western Blot Dilution (1:500) |
| Antibody | Mouse anti SCAR (Monoclonal) | Developmental Studies Hybridoma Bank | P1C1-SCAR RRID:AB_2618386 | Western Blot Dilution (1:250) IF Dilution (1:100) |
| Antibody | Rabbit anti Atxn7 | (Mohan et al., 2014a) | Western Blot Dilution (1:2000) | |
| Antibody | Guinea Pig anti Ada2b | Gift from Jerry L Workman (Kusch et al., 2003) | Western Blot Dilution (1:1000) | |
| Antibody | Goat anti Guinea Pig HRP (Polyclonal) | Jackson ImmunoResearch INC | 106-035-003, RRID:AB_2337402 | Western Blot Dilution (1:10000) |
| Antibody | Goat anti mouse HRP (Polyclonal) | Jackson ImmunoResearch INC | 115-035-003, RRID:AB_10015289 | Western Blot Dilution (1:5000) |
| Antibody | Goat anti Rabbit HRP (Polyclonal) | Jackson ImmunoResearch INC | 111-035-003 RRID:AB_2313567 | Western Blot Dilution (1:10000) |
| Antibody | Rat anti HA (Monoclonal) | Roche | 11867423001 RRID:AB_390918 | IF Dilution (1:250) |
| Recombinant DNA reagent | pMT-HA-Ub | gift from Jianhang Jia | gift from Jianhang Jia | |
| Recombinant DNA reagent | Scar-FH | Berkley Expression Clone Collection | FMO14142 | |
| Recombinant DNA reagent | Scar-Flag | This paper | Materials and methods Subsection Plasmids Quick change on FMO14142 F Primer:GATGACGACAAGGTCAAACTTGCTGCTTAGACTAGTTCTAGT R Primer: ACTAGAACTAGTCTAAGCAGCAAGTTTGACCTTGTCGTCATC | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA | This Paper | Sequence ID: AAD53181.1 | Materials and methods Subsection Plasmids |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-0FA | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA WIRS0 phenylalanine to alanine F: GCAGTGGCCGAAGCGCCGGCAGGGGAACGGAACGGTGGGC WIRS0 phenylalanine to alanine R: CCGTTCCCCTGCCGGCGCTTCGGCCACTGCTGCTGCTGC | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-1FA | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA WIRS1 phenylalanine to alanine F: CAGCTACGATACAGCCCGGGTCATCGACGCCTACTTCGCTGCTTGCG WIRS1 phenylalanine to alanine R: GGCGTCGATGACCCGGGCTGTATCGTAGCTGTGCTCCTTCACATAGC | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-2FA | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA WIRS2 phenylalanine to alanine F: CCAGCGTGGTGTCGGCCCATTTGAAACGCTTCGAGCACTCAGCTCTG WIRS2 phenylalanine to alanine R: CGAAGCGTTTCAAATGGGCCGACACCACGCTGGGCAGAGTGCGCAG | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-3FA | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA WIRS3 phenylalanine to alanine F: CGCAAGATCTCCTCGGCCATTCAATTCCCCGTGGAGTTCGACATG WIRS3 phenylalanine to alanine R: CCACGGGGAATTGAATGGCCGAGGAGATCTTGCGATCGATCAGAGC | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-WIRSFA | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA all of the above primers sequentially | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-C406A | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA Non-stop C406A F: CTTAATCTGGGCGCCACTGCCTTCATGAACTGCATCGTC Non-stop C406A R: GACGATGCAGTTCATGAAGGCAGTGGCGCCCAGATTAAG | |
| Recombinant DNA reagent | Prmha3-Non-stop-2XFlag-2XHA-C406S | This Paper | Materials and methods Subsection Plasmids Quick change mutagenesis on Prmha3-Non-stop-2XFlag-2XHA Non-stop C406S F: CTTAATCTGGGCGCCACTAGCTTCATGAACTGCATCGTC Non-stop C406S R: GACGATGCAGTTCATGAAGCTAGTGGCGCCCAGATTAAG | |
| Sequence-based reagent | dsRNA Lacz | dsRNA-LacZ-R: GCTAATACGACTCACTATAGGCCAAACATGACCARGATTACGCCAAGCT dsRNA-LacZ-F: GCTAATACGACTCACTATAGGCCAAACGTCCCATTCGCCATTCAGGC | ||
| Sequence-based reagent | dsRNA not | http://www.flyrnai.org | DRSC11378 | Primer F: TAATACGACTCACTATAGGCGCAGGCTGAACTGTTTG Primer R: TAATACGACTCACTATAGGTCTATTCCGGCTCCCGTT |
| Sequence-based reagent | dsRNA not | http://www.flyrnai.org | BKN21994 | Primer F: TAATACGACTCACTATAGGACTTGACCCACGTGTCCTTC Primer R:TAATACGACTCACTATAGGATTGACCAGATCTTCACGGG |
| Sequence-based reagent | dsRNA Atxn7 | http://www.flyrnai.org | DRSC35628 | Primer F:TAATACGACTCACTATAGGCGACATGGAAAAGGTCATCA Primer R:TAATACGACTCACTATAGGGGAAACCTGCCTTCGTGTAA |
| Sequence-based reagent | dsRNA Atxn7 | http://www.flyrnai.org | DRSC23138 | Primer F: TAATACGACTCACTATAGGCTGTTAAGCTGGAGGCCAAGPrimer R: TAATACGACTCACTATAGGGCCCTCTTATTGCACCTCAG |
| Sequence-based reagent | Taqman Assay: not | Thermofisher | TaqManID: Dm01823071_g1 | |
| Sequence-based reagent | Taqman Assay: Atxn7 | Thermofisher | TaqManID: Dm01800874_g1 | |
| Sequence-based reagent | Taqman Assay: SCAR | Thermofisher | TaqManID: Dm01810606_g1 | |
| Sequence-based reagent | Taqman Assay: RPL32 | Thermofisher | TaqMan ID: Dm02151827_g1 | |
| Commercial assay or kit | high capacity cDNA reverse transcription kit | ThermoFisher | 4374966 | |
| Commercial assay or kit | TaqMan Universal PCR Master Mix | ThermoFisher | 4364340 | |
| Chemical compound, drug | MG132 | Sigma-Aldrich | C2211 | |
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij/ |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.49677.012
