1. Cell Biology
  2. Neuroscience
Download icon

Ser/Thr kinase Trc controls neurite outgrowth in Drosophila by modulating microtubule-microtubule sliding

  1. Rosalind Norkett
  2. Urko del Castillo
  3. Wen Lu
  4. Vladimir I Gelfand  Is a corresponding author
  1. Feinberg School of Medicine, Northwestern University, United States
Research Article
  • Cited 1
  • Views 778
  • Annotations
Cite this article as: eLife 2020;9:e52009 doi: 10.7554/eLife.52009


Correct neuronal development requires tailored neurite outgrowth. Neurite outgrowth is driven in part by microtubule-sliding – the transport of microtubules along each other. We have recently demonstrated that a ‘mitotic’ kinesin-6 (Pavarotti in Drosophila) effectively inhibits microtubule-sliding and neurite outgrowth. However, mechanisms regulating Pavarotti itself in interphase cells and specifically in neurite outgrowth are unknown. Here, we use a combination of live imaging and biochemical methods to show that the inhibition of microtubule-sliding by Pavarotti is controlled by phosphorylation. We identify the Ser/Thr NDR kinase Tricornered (Trc) as a Pavarotti-dependent regulator of microtubule sliding in neurons. Further, we show that Trc-mediated phosphorylation of Pavarotti promotes its interaction with 14-3-3 proteins. Loss of 14-3-3 prevents Pavarotti from associating with microtubules. Thus, we propose a pathway by which microtubule-sliding can be up- or downregulated in neurons to control neurite outgrowth, and establish parallels between microtubule-sliding in mitosis and post-mitotic neurons.


In order to communicate, neurons must develop an extensive and precisely regulated network of axons and dendrites, collectively called neurites. Studying the mechanisms that form these processes is key to understanding early nervous system development. Neurites are filled with cytoskeletal components including microtubules. Neurons are exceptionally dependent on microtubules for long-range transport of cargo. Also, microtubule organization is essential for powering initial neurite outgrowth (Kapitein and Hoogenraad, 2015; Lu et al., 2013; Winding et al., 2016). In order to drive initial neurite outgrowth, microtubules themselves become the cargo and are transported relative to each other by molecular motors – a process known as microtubule sliding. Indeed, in cultured Drosophila neurons, microtubules can be seen pushing the plasma membrane at the tips of growing processes (del Castillo et al., 2015; Lu et al., 2013). Previous work from our group has identified the classical kinesin – Kinesin-1 – as the motor responsible for the majority of microtubule sliding in neurons (Lu et al., 2013; Winding et al., 2016).

Observation of microtubule sliding in neurons is of particular interest as this process is best described during vast cytoskeletal reorganization in mitosis, rather than in terminally differentiated neurons (Baas, 1999; Del Castillo et al., 2019). Microtubule sliding is observed in young neurons in culture, but decreases as neurons mature (Lu et al., 2013). Therefore, in addition to promoting neurite extension via microtubule sliding, there must also exist mechanisms to downregulate this process. This prevents overextension of neurites when their intended synaptic targets are correctly reached. Work from our group and others has previously identified the kinesin-6 Pavarotti/MKLP1 as a powerful regulator of microtubule-microtubule sliding. Depletion of Pavarotti/MKLP1 by RNAi leads to axon hyperextension and more motile microtubules (Del Castillo et al., 2015; Lin et al., 2012). Identifying a neuronal role for this kinesin was of interest as Kinesin-6 has well-studied roles in mitosis. It exists as a heterotetramer with MgcRacGAP (Tumbleweed in Drosophila) to form the centralspindlin complex (Adams et al., 1998; Basant and Glotzer, 2018; Mishima et al., 2002). This complex bundles microtubules at the bipolar spindle in late anaphase (Hutterer et al., 2009). Here, it can locally activate RhoA and promote assembly of the contractile actin ring at the cortex, and so, cytokinesis (Basant and Glotzer, 2018; Verma and Maresca, 2019).

How Pavarotti itself is temporally regulated to inhibit microtubule sliding as neurons mature is unknown. Mitosis exhibits tight temporal regulation. We speculated that similar mechanisms might be at play in regulating Pavarotti activity in neurons with regard to microtubule sliding. One well-studied facet of centralspindlin regulation in regards to mitotic progression is that of phosphorylation (Douglas et al., 2010; Guse et al., 2005). Based on bioinformatics and a literature search, we targeted Ser/Thr kinases known to modify Pavarotti during mitosis and tested their ability to modulate microtubule sliding in interphase cells. One potential kinase was the NDR kinase Tricornered (Trc, LATS in mammals) – shown to phosphorylate MKLP1, the human ortholog of Pavarotti, in vitro at S710 (S745 in Pavarotti) (Okamoto et al., 2015; Figure 1—figure supplement 1A). Trc regulates cell cycle exit (Hergovich et al., 2006) and also has conserved roles in neurite outgrowth, described in Drosophila, C. elegans and mammals (Emoto et al., 2006; Emoto et al., 2004; Gallegos and Bargmann, 2004; Ultanir et al., 2012). How this kinase acts warrants further investigation.

Here, we use Drosophila S2 cells, neuronal culture and in vivo imaging to show Trc regulates microtubule sliding and dendrite outgrowth in neurons. We validate Pavarotti as a Trc substrate and demonstrate that phosphorylation of Pavarotti at S745 by Trc is necessary for proper control of microtubule sliding. We also show that phosphorylation of Pavarotti affects its subcellular distribution via interaction with 14-3-3 proteins in interphase cells – a mechanism conserved from mitosis. We demonstrate the function of this pathway in regulating development of Drosophila neurons.


Tricornered kinase inhibits neurite outgrowth and microtubule sliding

We have previously demonstrated the requirement of microtubule-microtubule sliding, by kinesin-1, for neurite outgrowth in Drosophila (Lu et al., 2013; Winding et al., 2016). This sliding is opposed by the mitotic kinesin-6 ‘Pavarotti’/MKLP1 (Del Castillo et al., 2015). However, the mechanism by which Pavarotti itself is regulated in this neuronal context is unclear. We hypothesized that Pavarotti may be regulated by phosphorylation, as in mitosis (Basant and Glotzer, 2017; Guse et al., 2005; Figure 1—figure supplement 1A). We targeted kinases known to modify Pavarotti during mitosis (AuroraB, Plk1 and Trc), and tested their ability to modulate neuronal development and microtubule sliding in non-dividing cells. Initially, we measured microtubule sliding using the model system of S2 cells, a Drosophila cell line. We have previously demonstrated that kinesin-1 carries out microtubule-microtubule sliding in these cells and that Pavarotti inhibits this (Del Castillo et al., 2015; Jolly et al., 2010). Based on these preliminary experiments, we chose to focus on the NDR kinase Trc. To test the role of Trc, we decreased its levels using dsRNA. To measure microtubule sliding, we expressed a photoconvertible tubulin probe (tdEos-αTubulin84b) in S2 cells. Tubulin was photoconverted in a region of interest, and this specific population of microtubules was imaged by timelapse confocal microscopy (Barlan et al., 2013). Sliding is measured as percentage of photoconverted tubulin outside the original photoconversion zone – see Materials and methods. We found a significant increase in microtubule sliding upon depletion of Trc compared to control (Figure 1A, quantified in B, Video 1). We also carried out sliding experiments in S2 cells to ensure this effect was specific to Trc depletion and not an off-target effect. To do this, we decreased Trc levels with dsRNA against a non-coding region of Trc, and co-expressed wild-type Trc. The non-coding dsRNA increased microtubule sliding and expression of wild-type Trc rescued this effect. Therefore, the effect is specific to Trc depletion (Figure 2A,B). As shown in Figure 1—figure supplement 1 Figure 1B, Trc is depleted and Pavarotti levels are unaffected.

Figure 1 with 1 supplement see all
The kinase Trc regulates neurite outgrowth and microtubule sliding.

(A) Example images of timelapse imaging to measure microtubule sliding in Drosophila S2 cells. Microtubules are shown at time zero in green. Magenta indicates photoconverted region. Photoconverted region is highlighted by dotted yellow line at other timepoints. Red box indicates region shown in inset in A’ Scale bar 10 µm. (B) Quantification of microtubule sliding rate shows an increase upon Pavarotti or Trc depletion. n = 16–20 cells. Ctrl = 1.0 ± 0.1 upper 95% CI = 1.2, lower 95% CI = 0.8, Pav RNAi = 3.4 ± 1.0, 5.5, 1.4 Trc RNAi = 2.1 ± 0.4, 3.0, 1.2. Ctrl vs Trc RNAi p=0.03. (C) Representative images of 3rd instar larvae cultured neurons under control or elav > Trc RNAi conditions. (D) Quantification of total neurite length per cell over time in culture. The total neurite length is increased from control upon Trc depletion. 24 hr; ctrl = 137.8 ± 12.0 µm, Trc RNAi 254 ± 19.1 µm. p=0.0001. 48 hr; ctrl = 163.7 ± 15.3 µm, Trc RNAi = 251.2 ± 19.9 µm, p=0.001, 72 hr; ctrl = 156.3 ± 13.8 µm, TrcRNAi = 314.4 ± 36.5 µm, p=0.009. N = 11–23 cells from three independent experiments. (E) Example images from timelapse imaging of photoconverted microtubules in neurons under control conditions or upon Trc depletion. Tubulin was labeled with tdMaple3 alpha tubulin84b. After photoconversion, cells were imaged every minute for 10 min. Scale bar = 5 µm. (F) Quantification of microtubule sliding rates. Trc depletion leads to an increase in microtubule sliding rates in neurons. Ctrl = 1.0 ± 0.14, TrcRNAi = 1.69 ± 0.30. N = 20 cells from three independent experiments. p=0.04 Student’s T-test.

Figure 2 with 1 supplement see all
Trc regulates microtubule sliding in kinase-dependent manner.

(A) Sliding experiments in S2 cells show increased sliding upon depletion of Trc with dsRNA targeting the non-coding region. The effect can be rescued with overexpression of WT Trc, but not kinase dead Trc. Scale bar 10µm. (B) Quantification of sliding experiments in A. n=18-50 cells from four independent experiments. Ctrl = 1.0 ± 0.11, Lower 95% CI 0.77, Upper 95% CI 1.23, Trc3’UTR RNAi = 1.54 ± 0.16, 1.218, 1.86, Trc3’UTR RNAi + WT Trc = 0.93 ± 0.08, 0.77, 1.09 Trc3’UTR RNAi + CA Trc = 0.95 ± 0.17, 0.59, 1.30, Trc3’UTR RNAi + kinase dead Trc = 1.49 ± 0.22, 1.05, 1.92. Ctrl vs Trc 3’UTR RNAi p = 0.03, Trc 3’UTR RNAi vs Trc 3’UTR RNAi + Trc WT p = 0.01. One-way ANOVA with Sidak’s post hoc correction. (C) Sliding experiments in S2 cells show increased sliding upon depletion of Fry. Scale bar 10 µmD. Quantification of sliding experiments in C. n=26-37 cells from four independent experiments. Ctrl = 1 ± 0.13, Fry RNAi = 1.75 ± 0.26. Lower 95% CI ctrl = 0.72, Fry RNAi 1.23. Upper 95% CI ctrl = 1.268, Fry RNAi = 2.265. p = 0.024 Student’s T-test. (E) Representative images from timelapse imaging of photoconverted microtubules in neurons under control conditions or upon Fry depletion. Tubulin was labeled with tdMaple3 alpha tubulin84b. After photoconversion, cells were imaged every 30s for 10 min. Scale bar = 5µm (F). Quantification of microtubule sliding rates. Fry depletion leads to an increase in microtubule sliding rates in neurons. n = 31-42 cells from four independent experiments. Ctrl = 1.0 ± 0.13, 0.78, 1.3, Fry RNAi = 1.7 ± 0.26, 2.3, 1.2. Ctrl vs Fry RNAi p = 0.02 Student’s T-test.

Video 1
Pavarotti and Trc RNAi increase microtubule sliding in S2 cells.

Timelapse imaging of photoconverted microtubules in Drosophila S2 cells under control conditions or with depletion of Pavarotti or Trc. Microtubules were labeled with tdEOS alpha Tubulin 84b. 1 frame per minute.

Having established that Trc regulates microtubule sliding in S2 cells, we were next interested in investigating the potential role of Trc in neurite development. We analyzed primary neuronal cultures from third instar larvae expressing Trc RNAi. Neuron specific expression was achieved by elav gal4 >UAS Trc RNAi. This driver is derived from the elav locus which is expressed post-mitotically, exclusively in neurons and is active throughout development (Robinow and White, 1988). We found a dramatic increase in total neurite length per cell in vitro (Figure 1C and D). Neuronal knockdown of Trc was confirmed by western blot of brain lysates of Drosophila 3rd instar larvae (Figure 1—figure supplement 1C).

Next, we directly tested the ability of Trc to regulate microtubule sliding in Drosophila cultured neurons. To do this, we expressed the photoconvertible tdMaple3 tubulin84b under the control of the motor neuron-specific D42 Gal4 driver and prepared dissociated neuronal cultures from brains of 3rd instar larvae (Figure 1E, Video 2). Photoconversion was carried out in a constrained region of the cell (as indicated by the yellow dotted line) and photoconverted signal was imaged over time to determine microtubule sliding rate, in a similar fashion to S2 cells. We compared control cells to those expressing Trc RNAi under the same driver. Consistent with our data in S2 cells, we found that depleting Trc levels led to an increase in microtubule sliding rate in cultured primary neurons (Figure 1F). Therefore, Trc has the ability to modulate microtubule sliding in order to control neurite outgrowth.

Video 2
Trc depletion increases microtubule sliding in neurons.

Timelapse imaging of photoconverted microtubules in Drosophila cultured neurons under control conditions or with depletion of Trc. Microtubules were labeled with UAS tdMaple alpha Tubulin 84b under control of a motor neuron specific D42 gal4 driver. Trc was depleted with UAS Trc RNAi under control of a motor neuron-specific D42 gal4 driver. 1 frame per minute. Scale bar 10 µm.

Together, these data describe a role for Trc as a negative regulator of neuronal development, independent from cell division, and suggest that the mechanism by which Trc regulates neurite outgrowth is via microtubule sliding. This effect could likely be intrinsic, rather than dependent on external cues, as the effect can be seen in dissociated cultures.

Trc kinase activity is necessary to control microtubule sliding

We also confirmed that this effect on sliding was dependent upon the kinase activity of Trc in two ways. Firstly, we depleted the endogenous Trc with a dsRNA targeting a non-coding region and expressed either WT Trc, constitutively active Trc (Trc CA), or kinase-dead Trc (Figure 2A,B, Video 3; He et al., 2005). We confirmed expression of each of these mutants by fluorescence microscopy for BFP-Trc. We found that while WT and constitutively active Trc were able to reduce microtubule sliding to similar levels as control samples, the kinase dead mutant was not. Secondly, we depleted Furry (Fry) in S2 cells. Furry is a large protein shown to promote Trc kinase activity without affecting expression level (Figure 2—figure supplement 1A; Emoto et al., 2006). Upon knockdown of Fry, and so decrease in Trc kinase activity, we found an increase in microtubule sliding (Figure 2C,D Video 4).

Video 3
Microtubule sliding in S2 cells is dependent upon Trc kinase activity.

Timelapse imaging of photoconverted microtubules in Drosophila S2 cells under control conditions or with depletion of Trc using dsRNA against a non-coding region. Expression of WT Trc can rescue the effect of Trc RNAi. Expression of Kinase dead Trc is unable to rescue the effect of Trc RNAi. Microtubules were labeled with tdEOS alpha Tubulin 84b. 1 frame per minute.

Video 4
Fry depletion increases microtubule sliding in S2 cells.

Timelapse imaging of photoconverted microtubules in Drosophila S2 cells under control conditions or with depletion of Furry (Fry). Microtubules were labeled with tdEOS alpha Tubulin 84b. 1 frame per minute.

Further, we confirmed this effect in neurons by driving expression of photoconvertible maple tubulin, either alone or in conjunction with RNAi against Fry in motor neurons. We confirmed decrease of Fry protein level by immunostaining (Figure 2—figure supplement 1B and C). We carried out neuronal cultures from 3rd instar larvae and sliding experiments in the same way as for Trc knockdown. We found that depleting Fry, and so decreasing Trc kinase activity, led to an increase in microtubule sliding (Figure 2E,F Video 5) Taken together, these experiments show that the kinase activity of Trc is required to regulate microtubule sliding and that these findings are consistent between Drosophila neurons and S2 cells.

Video 5
Fry depletion increases microtubule sliding in neurons.

Timelapse imaging of photoconverted microtubules in Drosophila cultured neurons under control conditions or with depletion Fry. Microtubules were labeled with UAS tdMaple alpha Tubulin 84b under control of a motor neuron specific D42 gal4 driver. Fry was depleted with UAS Fry RNAi under control of a motor neuron specific D42 gal4 driver. 2 frames per minute. Scale bar 10 µm.

Tricornered kinase phosphorylates Pavarotti to Brake microtubule sliding

Next, we investigated if the effect of Trc on microtubule sliding was dependent upon Pavarotti. In order to address this, we carried out sliding assays in S2 cells. We overexpressed Trc, either alone, or in conjunction with Pavarotti knockdown. Overexpression of Trc in S2 cells resulted in a decrease in microtubule sliding. This is in good agreement with our data describing Trc as a negative regulator of sliding (Figure 3A,B, Video 6). Importantly, upon depletion of Pavarotti, this decrease in sliding was lost (Figure 3A,B). Therefore, Pavarotti must be present for Trc to oppose microtubule-microtubule sliding.

Figure 3 with 2 supplements see all
Trc regulates microtubule sliding via phosphorylation of Pavarotti.

(A) Sliding experiments in S2 cells show a decrease in microtubule sliding with Trc overexpression. Trc overexpression in conjunction with depletion of Pavarotti increases sliding beyond control levels Scale bar 5 µm. (B) Quantification of sliding experiments in A. n = 27–41 cells per condition. Ctrl = 1.0 ± 0.11, Upper 95% CI = 1.2, Lower 95% CI = 0.8, Pav RNAi = 1.6 ± 0.25, 2.1, 1.0, Trc OE = 0.61 ± 0.0.8, 0.8, 0.44, Pav RNAi + Trc OE = 1.4 ± 0.22, 1.9, 0.9. Ctrl vs Trc OE p=0.04, Trc OE vs Pav RNAi + Trc OE p=0.003. One-way ANOVA with Sidak’s post-hoc test. (C) Sliding experiments in S2 cells show an increase in microtubule sliding with Pavarotti depletion. The effect can be rescued with WT Pavarotti but not with Phospho null mutant S745A. (D) Quantification of sliding experiments shown in C. n = 39–48 cells from 4 independent experiments. Ctrl = 1 ± 0.10 Upper 95% CI = 1.2, Lower 95% CI = 0.79, Pav RNAi = 3.16 ± 0.26, 2.65, 3.70, Pav RNAi + WT = 1.96 ± 0.28, 1.40, 2.52 Pav RNAi + Pav S745A = 3.49 ± 0.48, 2.53, 4.44. Ctrl vs Pav RNAi p=0.0001, Pav RNAi vs pav RNAi + WT p=0.04, Pav RNAi vs Pav RNAi + S745A p=0.94, Pav RNAi + WT vs Pav RNAi + S745A p=0.0025. One-way ANOVA with Sidak’s post hoc correction. (E) Example images of extracted S2 cells expressing mCherry Tubulin and WT Pavarotti GFP under control or Trc RNAi conditions. (F) Quantification of microtubule area colocalized with Pavarotti. n = 18–26 cells from three independent experiments. Ctrl = 23.5 ± 2.4%, Upper 95% CI = 28.6, Lower 95% CI = 18.3 Trc RNAi = 12.78 ± 1.9%, 16.62, 8.94. p=0.001 Student’s T-test Scale bar = 10 µm. (G) Example images of extracted S2 cells expressing mCherry Tubulin and WT Pavarotti GFP or Pavarotti S745A GFP. Endogenous Pavarotti was depleted with dsRNA targeting non-coding regions. (H) Quantification of microtubule area colocalized with Pavarotti. n = 12–17 cells from three independent experiments. Scale bar = 10 µm. WT = 29.4 ± 5.0%, Upper 95% CI = 40.4, Lower 95% CI = 18.4, S745A = 7.79 ± 1.8%, 11.5, 4.08. p=0.0001 Student’s T-test (I) Western blot of S745 phospho-Pavarotti from HEK cell lysates shows an increase in this species with Trc overexpression. (J) Western blot of immunoprecipitated Pavarotti prepared from dissected 3rd instar larvae brains shows a decrease in phospho Pavarotti at S745 upon depletion of Trc.

Figure 4 with 1 supplement see all
Phospho-Pavarotti brakes microtubule sliding via interaction with 14-3-3 proteins.

(A) Western blot from HEK cell lysate showing co immunoprecipitation of Pavarotti and 14-3-3. The interaction is lost upon mutation of S745 to Alanine and increased upon co-expression of the kinase Trc. (B) Sliding experiments in S2 cells show the ability of Pavarotti to brake microtubule sliding is dependent upon 14-3-3 proteins. Scale bar = 10µm. (C) Quantification of sliding experiments in B. n=21-26 cells from three independent experiments. Ctrl = 1 ± 0.14 Upper 95% CI = 1.28, Lower 95% CI = 0.72, PavOE = 0.35 ± 0.08, 0.52, 0.18 14-3-3 RNAi = 1.05 ± 0.17, 1.41, 0.70, 14-3-3RNAi + PavOE = 1.20 ± 0.20, 1.6, 0.8. ctrl vs pav OE p = 0.01, ctrl vs 1433RNAi p = 0.99, ctrl vs 1433 RNAi + PavOE p = 0.78, Pav OE vs 1433 RNAi p = 0.007, pav OE vs 1433 RNAi + Pav OE p = 0.0004, 1433 RNAi vs 1433 RNAi + Pav OE p = 0.91 One-way ANOVA with Tukey’s post-hoc correction. (D) Example images of extracted S2 cells expressing mCherry Tubulin and WT Pavarotti GFP. Depletion of 14-3-3s decreases microtubule area decorated with Pavarotti. Scale bar = 10µm (E). Quantification of microtubule area colocalized with Pavarotti. n = 22-26 cells from three independent experiments. Ctrl = 15.4 ± 2.1, Upper 95% CI = 19.72, Lower 95% CI = 11.07, 14-3-3 RNAi = 5.54 ± 2.0, 9.78, 1.30. p = 0.0017 Student’s T-test. (F) Western blot from S2 cell lysate demonstrating knockdown of 14-3-3.

Video 6
Trc requires Pavarotti to inhibit microtubule sliding in S2 cells.

Timelapse imaging of photoconverted microtubules in Drosophila S2 cells. Trc overexpression inhibits microtubule sliding only in the presence of Pavarotti. Microtubules were labeled with tdEOS alpha Tubulin 84b. 1 frame per minute.

In order to confirm Pavarotti was indeed phosphorylated by Trc at the predicted site S745, we carried out immunoblotting with a phospho-specific antibody for Pavarotti S745. We expressed GFP Pavarotti in HEK 293FT cells and performed pull downs with anti-GFP antibody. Western blot analysis of precipitated GFP Pavarotti showed basal phosphorylation at S745. Mutation of Pavarotti Ser745 to Ala eliminated signal with the phospho-specific antibody, confirming the antibody specificity. Importantly, ectopic expression of constitutively active Trc (Trc CA), resulted in a roughly twofold increase in Pavarotti phosphorylated at S745. Therefore, Trc phosphorylates Pavarotti at Ser 745 in cells (Figure 3I). Notably, we confirmed these findings in brain tissue (Figure 3J). We dissected brains from either control 3rd instar larvae or brains of those expressing Trc RNAi under control of the pan neuronal driver elav Gal4. We immunoprecipitated endogenous Pavarotti from these brains and immunoblotted for phosphorylation of Pavarotti at serine 745. We found that phospho Pavarotti was reduced by around 35% upon Trc depletion when compared to total immunoprecipitated Pavarotti. Therefore, Trc phosphorylates Pavarotti at serine 745 in neurons in vivo and depletion of the kinase leads to a greater pool of unphosphorylated Pavarotti at S745.

Next, we tested if phosphorylation at S745 was necessary for Pavarotti to inhibit microtubule sliding. We once more carried out sliding assays, this time with a knockdown and rescue approach. Knockdown of Pavarotti by this approach was confirmed by western blot. Expression of WT and S745A GFP Pavarotti was confirmed by immunofluorescence (Figure 3—figure supplement 1). Depletion of Pavarotti with a dsRNA against a non-coding region increased sliding which could be reduced again by expression of wild-type Pavarotti. However, expression of Pavarotti S745A mutant failed to reduce sliding levels to their control levels (Figure 3C,D, Video 7). Therefore, Pavarotti can no longer inhibit microtubule sliding when phosphorylation of S745 is prevented.

Video 7
Pavarotti phosphorylation at Ser745 is required to inhibit sliding.

Timelapse imaging of photoconverted microtubules in Drosophila S2 cells under control conditions or with depletion of Pavarotti using dsRNA against a non-coding region. Expression of WT Pav can rescue the effect of Pav RNAi. Expression of Phopsho-null Pavarotti is unable to rescue the effect of Pav RNAi. Microtubules were labeled with tdEOS alpha Tubulin 84b. 1 frame per minute.

To understand why phosphorylation of Pavarotti is required for sliding inhibition, we compared microtubule binding of GFP Pavarotti in S2 cells under control conditions, after Trc depletion, or after mutation of S745. In order to visualize microtubule-bound Pavarotti, we extracted S2 cells with Triton X-100 under conditions preserving microtubules (see Materials and methods). This approach removes soluble Pavarotti from the cell. Therefore, we analyzed microtubule area that colocalized with Pavarotti signal. In this way, nuclear Pavarotti is excluded from the analysis. A more detailed description of this analysis and images in individual channels are shown in Figure 3—figure supplement 2A and B. We found that depletion of Trc led to around a 50% decrease in association of Pavarotti with microtubules (Figure 3E,F). Similar experiments with the phospho-null mutant S745A also show a decrease in association of Pavarotti with microtubules (Figure 3G,H). Therefore, Pavarotti in its unphosphorylated state has lower affinity for microtubules. Under these conditions, microtubule sliding is permitted.

Inhibition of microtubule sliding by pavarotti requires interaction with 14-3-3 proteins

Our data so far show a role for phospho-regulation of Pavarotti in microtubule sliding, beyond its canonical function in cytokinesis. We chose to continue investigating parallels between mitosis and interphase/post-mitotic microtubule sliding, this time testing the involvement of 14-3-3 proteins. These proteins have been shown to form a complex with Pavarotti dependent upon phosphorylation at the identified S745 site (Douglas et al., 2010; Fesquet et al., 2015). This association influences microtubule bundling (Douglas et al., 2010). We chose to further probe this mechanism, both with regard to Pavarotti S745 phosphorylation by Trc and microtubule sliding. Initially, we carried out co-immunoprecipitation experiments from HEK293 FT cells. We over- expressed WT or S745A GFP Pavarotti. We found a robust interaction between WT Pavarotti and endogenous 14-3-3 ξ. Mutation of S745 to alanine, mimicking a non-phosphorylated form of Pavarotti, abrogated the interaction. Co-expression of exogenous Trc with GFP Pavarotti, generating a greater pool of phosphorylated Pavarotti at S745, increases the interaction between Pavarotti and 14-3-3 ξ by roughly 60% (Figure 4A). Therefore, we confirm that phosphorylation of Pavarotti, by Trc, leads to the recruitment of 14-3-3 proteins.

We next tested if the interaction between Pavarotti and 14-3-3s is necessary for microtubule sliding inhibition by Pavarotti in S2 cells. We depleted Drosophila 14-3-3 β and ξ isoforms in S2 cells by dsRNA and overexpressed Pavarotti. Knockdown is demonstrated by western blot in Figure 4F. Overexpression of Pavarotti caused a decrease in microtubule sliding. However, when we depleted 14-3-3 levels, we no longer observed this decrease in sliding upon Pavarotti overexpression (Figure 4B, quantified in C, Video 8). Thus, Pavarotti is not capable of inhibiting microtubule sliding in the absence of 14-3-3 proteins. These data are in good agreement with microtubule sliding assays performed with our S745A mutant (Figure 3D), where a complex between Pavarotti and 14-3-3s does not form. Observation of the microtubule network in this condition showed a decrease in GFP Pavarotti associated with microtubules (Figure 4D,E, analysis carried out as in Figure 3—figure supplement 2A, individual channels presented in Figure 3—figure supplement 2B), consistent with the effect seen with Trc depletion or the S745A mutation. Altogether, our data suggest Pavarotti locally brakes microtubule sliding and this is facilitated by interaction with 14-3-3 proteins. The formation of this complex requires phosphorylation at S745, by the kinase Trc.

Video 8
14-3-3 proteins are required for Pavarotti to inhibit microtubule sliding.

Timelapse imaging of photoconverted microtubules in Drosophila S2 cells. Pavarotti can inhibit sliding only in the presence of 14-3-3 proteins. Microtubules were labeled with tdEOS alpha Tubulin 84b. 1 frame per minute.

Pavarotti and Trc act in the same pathway to control microtubule sliding in neurons and dendrite outgrowth in vivo

Based on our data in S2 cells and Drosophila brain tissue, we were curious to determine if our proposed mechanism for microtubule sliding was replicated in neurons. Data in Figures 1F and 3J show that Trc regulates sliding in neurons and phosphorylates Pavarotti in neurons. To test if these observations were part of the same pathway, we carried out microtubule sliding assays in cultured neurons from Drosophila 3rd instar larvae upon depletion of Pavarotti, Trc, or both in concert. We found that, like Trc, depleting Pavarotti led to a roughly twofold increase in microtubule sliding rate in neurons (Figure 5A quantified in B, Video 9). This is consistent with our previous work showing the same effect in Drosophila embryonic neurons (Del Castillo et al., 2015). Importantly, knockdown of both Pavarotti and Trc together increased microtubule sliding to similar levels to those of either knockdown individually – double knockdown had no additive effect. This supports the hypothesis that Pavarotti and Trc regulate microtubule sliding in neurons via the same pathway decreasing Trc levels in neurons led to a decrease in phospho-Pavarotti, and it is the lack of this species that prevents the brake to microtubule sliding.

Figure 5 with 1 supplement see all
Pavarotti and Trc act in the same pathway to control dendrite outgrowth in vivo.

(A) Example images from timelapse imaging of photoconverted microtubules in neurons under control conditions or upon Pavarotti, Trc or Pavarotti and Trc depletion. Scale bar = 10 µm (B) Quantification of microtubule sliding rates. Ctrl = 1.0 ± 0.1, Upper 95% CI = 1.8, Lower 95% CI = 0.7, Pav RNAi = 2.1 ± 0.7, 3.5, 0.6, Trc RNAi = 2.0 ± 0.4, 2.8, 1.1, Pav and Trc RNAi = 1.8 ± 0.4, 2.6, 1.0. Ctrl vs Pav and Trc RNAi p = 0.014 Student’s T-test. (C) Example images showing DA neurons labeled with ppk::tdTomato in 3rd instar larvae under control conditions, with Pavarotti or Trc RNAi driven by elavGal4, or both RNAis together. Scale bar = 50 µm. n = 15–30 cells from at least 4 animals. Ctrl = 2549 ± 108 µm, Upper 95% CI = 2771, Lower 95% CI = 2328, Pav RNAi = 3803 ± 141 µm, 4099, 3507, Trc RNAi = 3577 ± 155 µm, 3904, 3250, Pav and Trc RNAi = 3455 ± 257 µm, 4005, 2905. (D) Pavarotti and Trc depletion cause an increase in dendritic length compared to control. Depletion of both proteins together has a non-additive effect compared with either RNAi. Ctrl vs Pav RNAi p<0.0001, Ctrl vs Trc RNAi, p<0.0001, Ctrl vs double RNAi p=0.0006, PavRNAi vs Trc RNAi p=0.76, Pav RNAi vs double RNAi p=0.48, Trc RNAi vs Double RNAi p=0.96. One-way ANOVA with Tukey’s post hoc correction.

Video 9
Pavarotti and Trc control microtubule sliding together in neurons.

Timelapse imaging of photoconverted microtubules in Drosophila cultured neurons under control conditions or with depletion Fry. Microtubules were labeled with UAS tdMaple alpha Tubulin 84b under control of a motor-neuron-specific D42 gal4 driver. Trc was depleted with UAS Fry RNAi under control of a motor-neuron-specific D42 gal4 driver. 2 frames per minute. Scale bar 10 µm.

We hypothesized that Trc and Pavarotti are in the same pathway in Drosophila neurons in vivo and that their coordination of microtubule sliding regulates neurite outgrowth. In order to test this, we measured the dendritic arbor of class IV DA (dendritic arborization) neurons (sensory neurons) in 3rd instar larvae either upon knockdown of Trc, Pavarotti, or both in conjunction. We have previously demonstrated that dendrite outgrowth in these cells is dependent upon microtubule sliding as expression of a sliding-deficient kinesin-1 leads to shorter dendritic arbors (Winding et al., 2016). Class IV neurons were labeled with ppk::tdTomato (membrane localized tdTomato under direct control of the classIV DA neuron specific pickpocket promoter) and pan-neuron specific expression of RNAis was achieved with elav gal4, which is expressed in all peripheral neurons, including the class IV DA neurons, (Luo et al., 1994). Knockdown of Pavarotti and Trc together was confirmed by western blot as presented in Figure 5—figure supplement 1A. In each case, we observed a roughly 40% increase in total dendrite length (Figure 5C,D). In the case of Trc, these data are consistent with previous reports (Emoto et al., 2004) where expression was abolished by mutation rather than neuron-specific RNAi. Notably, the effect upon double knockdown was equivalent to that of the single knockdowns (Figure 5C,D). This supports the hypothesis that Trc and Pavarotti regulate neurite outgrowth in concert.

As well as total dendritic length, we also calculated the number of branch points per cell (Figure 5—figure supplement 1B). Trc has been previously shown to increase dendrite branching (Emoto et al., 2004). Our analyses reproduced these findings – Trc RNAi cells had roughly 30% more branch points than controls. Interestingly, Pavarotti depletion had no effect on number of branch points, and depletion of Trc and Pavarotti together mimics the effect of Trc RNAi alone. From these data, we infer that Trc and Pavarotti regulate neurite outgrowth together, but that Trc has another role, independent of Pavarotti phosphorylation, in regulating dendritic branching.

Taken together, our data demonstrate that Trc regulates microtubule sliding in neurons together with Pavarotti and that this kinase phosphorylates Pavarotti at S745. Pavarotti phosphorylation at S745 is required to brake microtubule sliding and so, correctly tailor neurite extension.


Developing neurons must extend neurites to form a network for correct communication. This outgrowth must be downregulated as the neurites reach their intended targets and form stable synapses. We have previously shown that microtubule-microtubule sliding is required for neurite outgrowth in young neurons and is diminished in mature neurons by the action of Drosophila kinesin-6, Pavarotti. However, the processes by which Pavarotti might temporally regulate microtubule sliding were unknown. Here, we report an inhibitory pathway for microtubule sliding. Our previous work has demonstrated roles for ‘mitotic’ processes (microtubule-microtubule sliding) and ‘mitotic’ motors (kinesin-6 Pavarotti) in regulating the neuronal cytoskeleton. In this study, we extended these parallels to identify the NDR kinase Trc (Tricornered) as a required component of the Pavarotti pathway, regulating neurite outgrowth (Figure 6).

Kinesin-1 slides microtubules along one another to facilitate neurite outgrowth.

The kinase Trc inhibits this process by phosphorylation of Pavarotti – a part of the centralspindlin complex with tumbleweed. Phosphorylated Pavarotti forms a complex with 14-3-3 proteins and associates with microtubules. Under these conditions, microtubules are cross-linked and can no longer undergo sliding by kinesin-1. Therefore, neurite outgrowth is inhibited.

Trc is a novel regulator of microtubule sliding

NDR kinases have well-studied roles in cell division and tissue morphogenesis. The yeast homologue of Trc (Dbf2p) promotes chromosome segregation and mitotic exit. These functions are conserved in mammals (Hergovich et al., 2006; Tamaskovic et al., 2003). However, neuronal expression of some NDR kinases has additionally been reported. In neurons, depletion of Trc has been linked to increased outgrowth of both axons and dendrites across multiple taxa (Emoto et al., 2004; Gallegos and Bargmann, 2004; Ultanir et al., 2012; Zallen et al., 1999). Our data are in good agreement with these previous reports as we measure an increase in neurite length in vitro and an increase in dendrite length in vivo. Further, our data uncover a mechanism for this increased outgrowth. Depletion of Trc leads to increased microtubule sliding in both S2 cells and in cultured primary neurons. This increased sliding allows microtubules to push at the tips of nascent neurites, providing the force required for their extension (del Castillo et al., 2015; Lu et al., 2013). Indeed, this sliding has been shown to translate into dendrite outgrowth in vivo – expression of a sliding deficient kinesin-1 mutant drastically decreases the dendritic arbors of Drosophila sensory neurons (Class IV DA neurons) (Winding et al., 2016).

Trc phosphorylates Pavarotti to Brake microtubule sliding

Similarly to Trc, the kinesin-6 Pavarotti was thoroughly studied with regard to cell division. It is a microtubule cross linker and signaling hub to promote cleavage furrow ingress (Adams et al., 1998; Basant and Glotzer, 2017; Verma and Maresca, 2019). Moreover, Pavarotti’s ability to localize to the spindle is dependent on its phosphorylation state (Guse et al., 2005). Here, we have shown that Pavarotti is a downstream effector of Trc in the sliding inhibition pathway – Trc overexpression could only decrease sliding in the presence of Pavarotti. In agreement with these data, in neurons, depletion of both Pavarotti and Trc together had the same effect as depletion of either protein individually. Using a similar approach, we have also demonstrated that Trc’s ability to regulate microtubule sliding is dependent upon its kinase activity. Knockdown and rescue experiments in S2 cells showed wild type and constitutively active Trc constructs could restore normal sliding levels but, a kinase dead variant was unable to do this. This is supported by data in neurons showing that decrease of Fry protein level increases microtubule sliding. Decreasing Fry decreases Trc kinase activity without affecting protein level (Emoto et al., 2004).

Further we have used a phospho-null mutant to demonstrate that phosphorylation of Pavarotti at the proposed Trc site of Serine 745 is necessary to inhibit sliding. Importantly, we confirm biochemically that Drosophila Pavarotti is phosphorylated at this site by Trc in neurons. This extends previous reports to show this pathway is conserved between humans and Drosophila (Fesquet et al., 2015). Our in vitro data suggest that these two proteins act together to regulate sliding in developing cultured neurons. In vivo, we demonstrate that these two proteins work in concert to regulate neuronal development. Depletion of either Trc or Pavarotti leads to increased dendrite length in class IV DA neurons. Depletion of both these proteins simultaneously has no additive effect either with regards to sliding or dendrite outgrowth, therefore these proteins act in a common pathway. Notably, this is the first report of Pavarotti regulating dendrite development in Drosophila. Previous work has shown Pavarotti prevents axon overgrowth (Del Castillo et al., 2015) and reports in mammalian systems have suggested roles in both compartments (Lin et al., 2012).

Whilst protein translation presents a clear alternative in regulating protein activity, we favor a phosphorylation model. Pavarotti expression is inhibited by Toll-6-FoxO signaling and Toll-6-FoxO mutants have increased microtubule stability (McLaughlin et al., 2016). However, phosphorylation would provide more dynamic method for modulating Pavarotti. Moreover, phosphorylation would provide tighter spatial regulation which could be necessary in inhibiting sliding in primary neurites while secondary processes are still developing. Indeed, examining the subcellular distribution of Pavarotti showed clear differences in microtubule association based on Trc-mediated phosphorylation state. We found Pavarotti localized more robustly to microtubules in the presence of Trc and that the phospho null mutant had a decreased ability to associate with microtubules. Upon association with microtubules, Pavarotti acts as a crosslinker and inhibits microtubule sliding. These observations are consistent with our sliding data – preventing Pavarotti phosphorylation by Trc upregulated microtubule sliding. It is possible that Pavarotti phosphorylation inhibits kinesin-1-mediated microtubule sliding initially, and is subsequently regulated at the protein translational level.

Pavarotti requires 14-3-3 proteins to Brake microtubule sliding in S2 cells

Extending our hypothesis that mitotic mechanisms regulating Pavarotti may be prevalent in neurons, we chose to investigate the role of 14-3-3s in microtubule sliding. 14-3-3s are conserved acidic proteins which bind phospho-threonine and phospho-serine residues (Cornell and Toyo-oka, 2017). Interaction and complex formation with phosphorylated proteins to facilitate cytoskeleton remodelling and axon extension has been described multiple times (Cornell and Toyo-oka, 2017; Taya et al., 2007). In C. elegans in mitosis, 14-3-3s have been shown to bind to the centralspindlin complex when Zen-4 (the C. elegans orthologue of Pavarotti/MKLP1) is phosphorylated at S710 (equivalent of Pavarotti S745) (Douglas et al., 2010). Here, we show by co-immunoprecipitation experiments that Trc-mediated phosphorylation at this site promotes formation of a complex between Pavarotti and 14-3-3s, in good agreement with previous data (Fesquet et al., 2015). This complex has previously been proposed to prevent stable microtubule binding in vitro. Interestingly, our data in S2 cells are not in full agreement with in vitro data. Previous studies have proposed phosphorylation by aurora B kinase at S708/S743 in Drosophila as a way to release 14-3-3 binding from centralspindlin. Perhaps, this phosphorylation is differently regulated during mitosis, where the centralspindlin complex must accumulate at microtubule tips, and interphase, where the microtubule cytoskeleton must be stabilized (Douglas et al., 2010). Our data suggest 14-3-3 interaction with Pavarotti promotes stable microtubule association. Considering our data together with previously published work, perhaps this is a facet of microtubule sliding regulation that is differentially controlled between mitosis and interphase. Beyond interphase, the role of 14-3-3 proteins in sliding inhibition and neurite outgrowth warrants further investigation in neurons.

Here, we present a microtubule-based mechanism for Trc and Pavarotti controlling neurite development and show how the kinase Trc directs Pavarotti intracellular localization. Beyond this, it would be of interest to investigate a concurrent role for actin remodelling in process outgrowth. Pavarotti is a component of the centralspindlin complex (Mishima et al., 2002). The other component, tumbleweed/MgcRacGAP, gives an axon overextension phenotype upon depletion, like Pavarotti (Goldstein et al., 2005) and the expression levels of each are dependent on the other (Del Castillo et al., 2015). However, there are no described Trc kinase phosphorylation sites in tumbleweed. Therefore, while our experiments have focussed on Pavarotti phosphorylation, it is likely the downstream effects described here are a result of the centralspindlin complex. MgcRacGAP is a major orchestrator of RhoA signaling via Pebble/RhoGEF (Basant and Glotzer, 2018). This RhoGEF promotes formation of the cytokinetic furrow via actin assembly. Further, Trc has been proposed to inhibit Rac activity in a kinase-dependent manner (Emoto et al., 2004). It has recently been demonstrated that the centralspindlin complex acts as a signaling hub to spatially and temporally regulate contraction of the actin cortex (Verma and Maresca, 2019). Might these signaling pathways be acting in developing neurites to tailor their development in addition to mechanical regulation via microtubule sliding?

The data presented here raise new questions beyond regulating microtubule sliding regulation. These data along with previous work from our group and others show a role for Pavarotti in controlling both axon and dendrite outgrowth (Del Castillo et al., 2015; Lin et al., 2012). This is consistent with our findings that kinesin-1 mediated microtubule sliding is necessary for proper development of both these compartments (Winding et al., 2016). Further, does microtubule sliding play a role in specifying axon formation? A crucial and distinctive feature of axons and dendrites is that of their microtubule polarity – axonal microtubules have a uniform, plus end out microtubule orientation, whereas dendritic microtubules are of mixed polarity or uniformly minus ends out (Baas et al., 1988; Stone et al., 2008). Kinesin-6 has been previously proposed to confer dendritic identity via transport of minus ends distal microtubules into dendrites and away from axons (Lin et al., 2012; Yu et al., 2000). Does the regulation of microtubule sliding via Pavarotti/kinesin-6 phosphorylation contribute to the microtubule polarity of nascent processes? How might these regulatory processes change over the course of axonal and dendritic development?

As well as neurite initiation, microtubule sliding occurs during axon regeneration (Lu et al., 2015). After axon or dendrite severing, in vitro or in vivo, large-scale rearrangements of the microtubule cytoskeleton are observed (Lu et al., 2015; Stone et al., 2010). This is in contrast to in mature neurons where sliding is silenced. In this case, it could be of great interest to exploit our suggested mechanism of Pavarotti phosphorylation. Notably, the kinase Trc may be a promising candidate for chemical inhibition. Would chemical inhibition or silencing of the kinase Trc deplete the pool of phospho-Pav and prolong the time period during which microtubule sliding was upregulated? Could this, in turn, facilitate neurite regeneration after injury? Further work will be required to address any potential for modulating Trc activity in neuronal regeneration.

Materials and methods

Key resources table
Reagent type
(species) or
DesignationSource or
Genetic reagent (D. melanogaster)w; elav-Gal4 (III)C. Doe University of Oregon
Genetic reagent (D. melanogaster)yw; wg(Sp)/CyO;Dr(Mio)/TM3, SbE. Ferguson, University of Chicago
Genetic reagent (D. melanogaster)yw; ppk-CD4-tdtomato (II)Bloomington Drosophila Stock Center (BDSC)Stock number 35844; FBst0035844;
Fly base genotype: w1118; P{ppk-CD4-tdTom}4a
Genetic reagent (D. melanogaster)w; D42-Gal4 (III)BDSCStock number 8816;
Fly base genotype: w*; P{GawB}D42
Genetic reagent (D. melanogaster)y sc v; UAS-Trc-RNAiBDSCStock number 41591; FBst0041591;
Fly base genotype y1 sc*v1 sev21; P{TRiP.GL01127}attP2
Genetic reagent (D. melanogaster)y sc v; UAS-Pav-RNAiBDSCStock number 42573; FBst0042573;
Fly base genotype: y1 v1; P{TRiP.HMJ02232}attP40
Genetic reagent (D. melanogaster)y sc v; UAS-Fry-RNAiBDSCStock number 60103; FBst0060103;
Fly Base Genotype: y1 sc*v1 sev21; P{TRiP.HMC05097}attP40
Genetic reagent (D. melanogaster)w; UASp-tdMaple3-alpha tubulin 84bThis labDescribed in Lu et al. (2016) Generated by injection of pUASp tdMaple3-alpha tubulin 84b. A second chromosome insertion was used in this study.
Genetic reagent (D. melanogaster)yw; UASp-tdMaple3-alpha tubulin 84b; UAS-Trc-RNAiThis labGenerated using an insertion on the second chromosome
Transfected construct (D. melanogaster)pMT EOS tubulinThis labDescribed in Barlan et al. (2013). For S2 cell expression of EOS tubulin.
Transfected construct (D. melanogaster)pMT-BFP Trc WTThis labS2 cell expression of Trc. Generated from pUASt-Trc WT using EcoRI and NotI, a kind gift from P. Adler.
Transfected construct (D. melanogaster)pMT-BFP Trc CA (T253E)This labS2 cell expression of Trc. Generated from pUASt-Trc T253E (a kind gift from P. Adler) and pMT vector using EcoRI and NotI.
Transfected construct (D. melanogaster)pMT-BFP Trc kinase dead (K122A)This labS2 cell expression of Trc. Generated from pUASt-Trc K122A (a kind gift from P. Adler) and pMT vector using EcoRI and NotI.
Transfected construct (D. melanogaster)pMT-GFP PavarottiThis labS2 cell expression. Generated from pMT-BFP Pavarotti (Del Castillo et al., 2015)
Transfected construct (D. melanogaster)pMT-GFP Pavarotti S745AThis labS2 cell expression. Generated by site directed mutagenesis of WT.
transfected construct (D. melanogaster)pEGFP Pavarotti WTThis labMammalian expression. Pavarotti constructs were subcloned into pEGFP-C1 using EcoRI and SalI.
Transfected construct (D. melanogaster)pEGFP Pavarotti S745AThis labMammalian expression. Pavarotti constructs were subcloned into pEGFP-C1 using EcoRI and SalI.
transfected construct (D. melanogaster)pcDNA Trc T253EThis labMammalian expression. Trc T253E was subcloned into pcDNA 3.1+ using HindIII and NotI.
Transfected construct (D. melanogaster)pMT mCherry tubulinThis labFor S2 cell expression. Described in del Castillo et al. (2015)
Cell line (D. melanogaster)S2 cellsDGRCFlyBase Report: FBtc0000006Cell line maintained in this lab.
Cell line (Homo-sapiens)HEK 293 FTATCCRRID:CVCL_0045; ATCC: CRL-1573Cell line maintained in this lab.
AntibodySingle chain anti-GFP, GFP-Trap-MChromotek
AntibodyAnti Pavarotti (Rabbit polyclonal)Scholey labWestern blot 1:1000
AntibodyAnti Trc (Rabbit polyclonal)Emoto labWestern blot 1:1000
AntibodyAnti Tubulin (Rabbit polyclonal)This labAffinity purified from immunized rabbit serum. Western blot 1:1000
AntibodyAnti phospho-Pavarotti S710 (Rabbit polyclonal)Mishima labWestern blot 1:1000
AntibodyAnti GFP (Rabbit polyclonal)This labAffinity purified from immunized rabbit serum. Western blot 1:1000
AntibodyAnti Furry (Rabbit polyclonal)Adler labImmunofluorescence 1:250
AntibodyAnti Hsc 70 (Goat polyclonal)Santa cruzK-19, RRID:AB_2120291Western blot 1:100
AntibodyAnti 14-3-3ζ (Rabbit polyclonal)Proteintech groupcat no. 14503–1-AP; RRID:AB_2218096Western blot 1:250
AntibodyHRP conjugated Anti RabbitJacksonWestern blot 1:10,000
AntibodyHRP conjugated Anti GoatJacksonWestern blot 1:10,000

Fly stocks

Request a detailed protocol

Flies were maintained at room temperature (24 ~ 25 C) on regular cornmeal food (Nutri-Fly, Bloomington Formulation), supplemented with dry active yeast. dsRNA generation dsRNAs were generated using the sequences described in the supplementary table with the T7 sequence TAATACGACTCACTATAGGG at the 5’ end.

Cell culture

Request a detailed protocol

Drosophila S2 cells were maintained in Insect-Xpress medium (Lonza) at 25°C. These cells came directly from DGRC and their identity was not subsequently confirmed. Transfections were carried out with Effectene (Qiagen) according to the manufacturer’s instructions. dsRNA was added to cells on days 1 and 3 and imaging was carried out on day 5. HEK 293 FT cells were maintained in DMEM (Sigma Aldrich) supplemented with Penicillin Streptomycin and 10% FBS at 37°C and 5% CO2. HEK cells were transfected by Calcium Phosphate precipitation with 5 µg DNA. Cells were confirmed mycoplasma negative by Lonza mycoalert mycoplasma detection kit.

Primary neuronal cultures were prepared by dissection of brains from 3rd instar larvae and dissociation of tissue using liberase (Roche). Cells were plated on ConA coated glass coverslips and maintained in Schneiders medium supplemented with 20% FBS, 5 µg/ml insulin, 100 µg/ml Pen-Strep, 50 µg/ml Gentamycin and 10 µg/ml Tetracycline. For sliding assays, larvae were cultured at 29°C and imaged 1 hr after plating.

Immunoprecipitation and western blotting

Request a detailed protocol

Co-Immunoprecipitation from HEK 293 cells was carried out in coIP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1.5% Triton X-100, 1 mM EDTA, 1 mM PMSF, 20 µg/ml Chymostatin, Leupeptin, Pepstatin, 1 mM NaVO3). Cells were lysed, debris was pelleted by centrifugation, and the soluble fraction was incubated with single chain anti GFP antibody (GFP-binder) (GFP-Trap-M; Chromotek) conjugated to sepharose beads. Samples were washed 3x in lysis buffer and boiled in 5x laemmli buffer prior to loading on 10% acrylamide gels for electrophoresis. For phosphorylation experiments, GFP Pavarotti was enriched by GFP pull down in RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton, 0.5% Na-Deoxycholate, 0.1% SDS, 1.5 mM NaVO3, 1 mM PMSF, 20 µg/ml Chymostatin, Leupeptin, Pepstatin, 1 mM NaVO3) and samples were processed as for co-immunoprecipitation For phosphorylation experiments from brain lysate, around 50 3rd instar larvae brains were dissected per condition and lysed in RIPA buffer. The soluble fraction was subjected to IP with anti-Pavarotti antibody or rabbit IgG. Protein-G Dynabeads (Invitrogen) were blocked in 1% BSA in TBS-T and added to lysates. IPs were washed 3x in RIPA buffer and boiled in 5x laemmli buffer prior to loading on 8% acrylamide gels. To assess efficient knockdown of proteins, S2 cells were lysed directly in sample buffer and boiled. After electrophoresis, transfer onto nitrocellulose membrane was carried out and blocking was performed in 4% milk in PBS-T. For phospho- specific antibody, blocking was carried out with 3% BSA in TBS-T. Western blotting was performed using advansta western bright quantum substrate and Licor Imagequant system. For quantification of western blots, Licor Image Studio software was used. In each case, phosphorylated Pavarotti levels were compared to total Pavarotti levels. Then this ratio was normalized to that of the control condition. In this way, any difference in immunoprecipitated Pavarotti levels is accounted for between the two conditions.

Fixed imaging

Request a detailed protocol

For subcellular localization analysis of Pavarotti, S2 cells were plated on ConA coated coverslips and allowed to attach. Cells were then extracted in 30% glycerol, 1%triton, 1 uM taxol in BRB80 for 3 min and imaged directly.

Microscopy and photoconversion

Request a detailed protocol

To image dissociated neuronal cultures by phase contrast we used an inverted microscope (Eclipse U2000; Nikon Instruments) equipped with 60x/1.40 N.A objective and a CoolSnap ES CCD camera (Roper Scientific) and driven by Nikon Elements software.

To image Drosophila S2 cells and primary neurons, a Nikon Eclipse U200 or Ti2 inverted microscope with a Yokogawa CSU10 or Yokogawa W1 spinning disk confocal head, Nikon Perfect Focus system, and 100×/1.45 N.A. objective was used. Images were acquired with an Evolve EMCCD or Prime 95B (Photometrics) using Nikon NIS-Elements software (AR 4.00.07 64-bit). S2 cells expressing tdEOS-tagged Tubulin were plated in Xpress with 2.5 µM cytoD and 40 nM taxol. For photoconversion of tdEOS-tagged Tubulin in sliding assays, we applied 405 nm light from a light-emitting diode light source (89 North Heliophor) for 5 s. The 405 nm light was constrained to a small circle with an adjustable diaphragm, therefore only a region of interest within the cell was photoconverted. After photoconversion, images were collected every minute for > 10 min.

To image Drosophila DA neurons, larvae were immobilized between a slide and a coverslip. A Nikon Eclipse U200 inverted microscope with a Yokogawa CSU10 spinning disk confocal head, 20×/0.75 N.A. objective was used. Images were acquired with an Evolve EMCCD (Photometrics) using Nikon NIS-Elements software (AR 4.00.07 64-bit). Images were analyzed in FIJI using the ‘tubeness’ and ‘skeletonize’ plugins. Branch point analysis was carried out in Nikon NIS-Elements software (AR 5.200 64-bit) using the detect branches function in the general analysis three module.

Microtubule sliding analysis

Request a detailed protocol

Analysis was carried out as previously described. Briefly, time-lapse movies of photoconverted microtubules were bleach-corrected and thresholded and the initial photoconverted zone was identified. The number of pixels corresponding to MTs was measured in total or outside the initial zone for each frame. The motile fraction (defined as MTsoutside_initial_zone/MTstotal) was plotted against time and the slope of the linear portion was calculated to represent microtubule sliding rate. For analysis of microtubule sliding in neurons, images were bleach corrected and denoised using despeckle in FIJI. Movies were then processed using the WEKA trainable segmenter in Fiji to generate probability maps of photoconverted microtubules (Arganda-Carreras et al., 2017). Probability maps were thresholded and analyzed in the same way as S2 cells.

Statistical analysis and data presentation

Request a detailed protocol

Data are presented as mean ± standard error. Statistical analysis was carried out in GraphPad. Data were analyzed using student’s T-test or one-way ANOVA with Sidak’s post-hoc correction for multiple comparisons. Data are collected from at least three replicates. Statistical significance is presented as *p<0.05, **p<0.01, ***p<0.001. Data in Figure legends are presented as mean ± standard error, Upper 95% Confidence Interval, Lower 95% Confidence interval.


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
    Genes required for axon pathfinding and extension in the C. elegansnerve ring
    1. JA Zallen
    2. SA Kirch
    3. CI Bargmann
    Development 126:3679–3692.

Decision letter

  1. Suzanne R Pfeffer
    Senior Editor; Stanford University School of Medicine, United States
  2. Jennifer G DeLuca
    Reviewing Editor; Colorado State University, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Neuronal process formation must be precisely regulated such that neurite outgrowth is robust in developing neurons in order to form proper communication networks and limited in mature neurons once neurites have reached their appropriate targets. The study here uses a combination of cell-based systems including Drosophila S2 cells, primary neuronal cultures, and sensory neurons to investigate microtubule-based mechanisms for neurite outgrowth. In doing so, they uncover a new mechanism for how neuronal processes are limited to ensure proper development of the nervous system.

Decision letter after peer review:

Thank you for submitting your article "Ser/Thr kinase Trc controls neurite outgrowth by modulating microtubule-microtubule sliding" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Suzanne Pfeffer as the Senior Editor. The reviewers have opted to remain anonymous. The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


Previous work from the Gelfand group has shown that microtubule sliding, driven by kinesin-1, promotes neurite formation and extension, and the kinesin-6 motor Pavarotti inhibits these processes in Drosophila neurons. In the present study, the authors describe a regulatory pathway that leads to inhibition of kinesin-1-dependent microtubule sliding, thereby limiting the extension of neuronal processes. The principle finding is that the Ser/Thr kinase Trc blocks microtubule sliding by promoting the activity of Pavarotti. The authors demonstrate that Trc phosphorylates Pavarotti on S745, and this in turn promotes a biochemical interaction between Pavarotti and 14-3-3 proteins. They conclude that this complex formation leads to microtubule binding and inhibition of microtubule sliding. The authors make use of a microtubule sliding assay in cultured cells, biochemistry, and an in vivo dendrite morphology assay to support their findings. The evidence that Trc regulates microtubule sliding and neurite outgrowth in cultured neurons is strong, and the authors show that loss of either Pav or Trc results in an increase in dendrite length in Class IV sensory neurons. However, much of the study, including the experiments arguing that the phosphorylation state of Pav is important, that Trc is the relevant kinase, and that 14-3-3 is important for this pathway, is done in cultured S2 cells. It is not clear if microtubule dynamics in these cells are regulated comparably to those in developing neurons, thus it will be important for the authors to demonstrate that the results obtained in S2 cells regarding Trc phosphorylation of Pav and the role of 14-3-3 in the regulatory pathway are recapitulated in an appropriate neuronal cell type.

Essential revisions:

1) The data that Trc phosphorylates Pav and promotes its ability to limit sliding in S2 cells are convincing. However, there is little evidence that this phosphorylation is relevant in neurons. To address the proposed role of Trc as a neuronal regulator of Pav-mediated microtubule braking, the authors should carry out the same experiments presented in Figures 2 and 3 in neurons to show that Pav is phosphorylated on S745, that the kinase activity of Trc is important for its function, and that the Pav S745A mutant does not block sliding. In del Castillo et al., 2015, the authors addressed Pav function in third instar motor axons, which may be a good option for addressing the role of Trc in Pav regulation in a relevant cell type.

2) Contrary to the authors' claim that 14-3-3 is a key regulator of Pav's ability to regulate sliding, 14-3-3 knockdown in S2 cells has no sliding phenotype on its own. The authors only show that knockdown of 14-3-3 impedes the ability of Pav overexpression to inhibit sliding. In light of this, they may consider revising their model of 14-3-3 function.

3) Related to the above point, is Pavarotti phosphorylated and bound to 14-3-3 in neurons? In the paper, the authors demonstrate that Pavarotti is phosphorylated on S745 in HEK293T cells (and more so when Trc is co-expressed). Similarly, evidence to support a functional interaction between Pavarotti and 14-3-3 comes from experiments performed in non-neuronal cells. The authors should demonstrate that Pavarotti is phosphorylated and interacts with 14-3-3 in neurons.

4) The authors propose in their model that 14-3-3 binding to the phospho-epitope promotes the association of Pavarotti with microtubules and its crosslinking and braking activity. However, Douglas et al., 2010, published that 14-3-3 binding to the S710 residue in human kinesin-6 reduced the MT binding and bundling activity of centralspindlin. The authors should account for this discrepancy in the text.

5) Figure 5: The authors show that Pav or Trc knockdown leads to an increase in the total length of dendrites of Class IV neurons. It has been previously reported that Trc knockdown increases branching (Emoto et al., 2004). It is unclear why increased MT sliding would cause an increase in branching as opposed to dendrite growth. Do the authors observe an increase in branching after Pav knockdown? In the images presented, the effect of Pav depletion looks qualitatively different than the effect of Trc depletion; Pavarotti depletion does appear by eye to produce more secondary and tertiary branches than Trc depletion. Is this the case? These parameters should be quantified and discussed.

6) Figure 5: If possible, these analyses should be carried out at an earlier time point to demonstrate that this phenotype is the result of a defect in initial dendrite outgrowth.

7) In Figure 1G (and Video 2), there does not appear to be a clear difference in sliding between the two conditions from the images/video. This should be addressed.

8) There are a number of instances (listed below) throughout the manuscript where knockdown efficiencies and expression levels should be assessed: a) Furry knockdown in Figure 2; b) Pav depletion and expression experiments in Figure 3C, D; c) PavGFP over-expression in Figure 4; d) Knockdown efficiencies of Trc and Pav in the DA neurons in Figure 5. This is a beautiful cell type and assay but it needs to be accompanied by some assessment (IF, WB, RT-qPCR) that the RNAi is working in these cells.

9) The measurements of the% microtubule area shown in Figures 3 and 4 are unclear, especially as presented as a single merged image. Please show each individual channel and highlight the area that you designate as "Pav positive". Pav is nuclear in interphase and, while the images are difficult to assess, it appears that the nuclear signal is evident in some of them. How is this taken into account when evaluating the area that is measured?

10) The authors reference a constitutively-active Trc in the subsection “Trc kinase activity is necessary to control microtubule sliding”, and refer in to data showing that this construct reduces sliding comparably to WT Trc; however, these data are not presented in Figure 2.

11) The co-IPs in Figure 4A should be quantified. In addition, the experiment shown in 4A is not currently described in sufficient detail so that readers can understand exactly what was done. Please provide a more detailed explanation.

12) Very little is mentioned in the manuscript about the other component of centralspindlin – MgcRacGAP. The authors should clarify if they believe this mechanism is being mediated by the centralspindlin complex. Part of the source of the confusion also stems from the model figure that appears to show a tetramer of Pavarotti – is that the intention or is this supposed to be a Pavarotti dimer and a Tumbleweed dimer? If it is centralspindlin then the complex should be labeled appropriately and the schematic should be changed accordingly (at least different colors for the constituents).

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Ser/Thr kinase Trc controls neurite outgrowth by modulating microtubule-microtubule sliding" for further consideration by eLife. Your revised article has been evaluated by Suzanne Pfeffer as the Senior Editor, and a Reviewing Editor.

The manuscript has been significantly improved, but there are a few remaining issues that need to be addressed before acceptance, as outlined below:

1) Much of the new data relates to extending the findings from Drosophila S2 cells further into neurons. To do so the authors have added additional sliding data from cultured neurons to Figure 2 (and Figure 2—figure supplement 1) and Figure 5 that agree with the results from S2 cells. They also show that there is a reduction of Pavarotti phosphorylation on S745 following depletion of Trc in fly brains in Figure 3. While the levels of pS745-Pav are quantified, the total Pav levels are not. The authors need to quantify the bands in the lower blot of Figure 3J and report the ratio of pS745 to total Pavarotti.

2) The author's claim that 14-3-3 is required for regulation of microtubule sliding is still not explicitly supported by the data presented. Figure 4B and 4C clearly show that there is no effect on sliding when 14-3-3 is inhibited. In light of this, the language in the Abstract should be modified.

3) "In vitro we show that these two proteins act together to regulate sliding in developing cultured neurons." This sentence needs to be re-written to more clearly indicate that the in vitro studies support a model in which the two proteins act together to regulate sliding in developing cultured neurons.


Author response


Previous work from the Gelfand group has shown that microtubule sliding, driven by kinesin-1, promotes neurite formation and extension, and the kinesin-6 motor Pavarotti inhibits these processes in Drosophila neurons. In the present study, the authors describe a regulatory pathway that leads to inhibition of kinesin-1-dependent microtubule sliding, thereby limiting the extension of neuronal processes. The principle finding is that the Ser/Thr kinase Trc blocks microtubule sliding by promoting the activity of Pavarotti. The authors demonstrate that Trc phosphorylates Pavarotti on S745, and this in turn promotes a biochemical interaction between Pavarotti and 14-3-3 proteins. They conclude that this complex formation leads to microtubule binding and inhibition of microtubule sliding. The authors make use of a microtubule sliding assay in cultured cells, biochemistry, and an in vivo dendrite morphology assay to support their findings. The evidence that Trc regulates microtubule sliding and neurite outgrowth in cultured neurons is strong, and the authors show that loss of either Pav or Trc results in an increase in dendrite length in Class IV sensory neurons. However, much of the study, including the experiments arguing that the phosphorylation state of Pav is important, that Trc is the relevant kinase, and that 14-3-3 is important for this pathway, is done in cultured S2 cells. It is not clear if microtubule dynamics in these cells are regulated comparably to those in developing neurons, thus it will be important for the authors to demonstrate that the results obtained in S2 cells regarding Trc phosphorylation of Pav and the role of 14-3-3 in the regulatory pathway are recapitulated in an appropriate neuronal cell type.

We thank the reviewers for their careful consideration of our work. We agree with the reviewers’ overall assessment that our work relied heavily on data from cultured S2 cells. Therefore, as suggested by the reviewers, we have expanded our data to include the role of Trc in neurons. We show that it is not just the Trc kinase expression level that regulates sliding, but more specifically, Trc kinase activity is required to regulate microtubule sliding (Figure 2E, F). We also show that, related to the development of Class IV sensory neuron dendrites (Figure 5C, D), microtubule sliding is regulated by Pavarotti and Trc together (Figure 5A, B). These data support our hypothesis that microtubule sliding is in S2 cells and developing neurons are regulated by similar mechanisms. Significantly, we now include biochemistry from Drosophila larvae brain to demonstrate Trc dependent Pavarotti phosphorylation (Figure 3J). In addition, we greatly expand on our demonstration of relevant knockdown throughout the manuscript. For an itemized description of our revisions, please see below.

Essential revisions:

1) The data that Trc phosphorylates Pav and promotes its ability to limit sliding in S2 cells are convincing. However, there is little evidence that this phosphorylation is relevant in neurons. To address the proposed role of Trc as a neuronal regulator of Pav-mediated microtubule braking, the authors should carry out the same experiments presented in Figures 2 and 3 in neurons to show that Pav is phosphorylated on S745, that the kinase activity of Trc is important for its function, and that the Pav S745A mutant does not block sliding. In del Castillo et al., 2015, the authors addressed Pav function in third instar motor axons, which may be a good option for addressing the role of Trc in Pav regulation in a relevant cell type.

We agree with the reviewers’ assessments. We have now expanded our experiments in neurons beyond demonstrating that Trc protein level regulates sliding in these cells. To address the requirement for Trc kinase activity to inhibit microtubule sliding (as in Figure 2), we have taken advantage of the fact that Trc kinase activity requires the presence of another protein – Furry (Fry). We have carried out sliding experiments in cultured neurons upon knockdown of Furry/Fry, as well as S2 cells. The results of these experiments are now shown in Figure 2E and F. We demonstrated that Fry knockdown in both S2 cells and in neurons increases microtubule sliding. The control experiments demonstrate that knock-down of Fry does not change Trc protein level. Taken together, these data demonstrate that the kinase activity of Trc is required to regulate sliding in both S2 cells and in neurons.

We have now also demonstrated that Trc and Pavarotti act together to regulate microtubule sliding in neurons, extending our experiments in Figure 3A. Unfortunately, the experiment that the reviewer suggested in 3rd instar motor axons did not give us an obvious phenotype, most likely because Trc is a kinase, so a much higher level of knock-down is required for observing an effect. Instead, we used a different approach. We show in the updated Figure 5A that knockdown of both of these proteins in neurons increases microtubule sliding to similar degree to each RNAi individually. Together with in vivoneurite outgrowth data in Figure 5C and D, these data support the conclusion that Trc and Pavarotti tailor neurite outgrowth together, by controlling microtubule sliding.

2) Contrary to the authors' claim that 14-3-3 is a key regulator of Pav's ability to regulate sliding, 14-3-3 knockdown in S2 cells has no sliding phenotype on its own. The authors only show that knockdown of 14-3-3 impedes the ability of Pav overexpression to inhibit sliding. In light of this, they may consider revising their model of 14-3-3 function.

We fully agree with the reviewers’ suggestion. Therefore, we have amended our model to reflect the fact 14-3-3 RNAi only has a phenotype upon Pavarotti overexpression. Please see the revised summary figure in the Discussion section. We also expand our Discussion with regards to these data and now postulate that, while 14-3-3 appears to be a regulator of microtubule sliding, there appears to be some divergence between mitotic mechanisms and interphase mechanisms. Please see the first paragraph of the subsection “Pavarotti requires 14-3-3 proteins to brake microtubule sliding in S2 cells”, in the Discussion.

3) Related to the above point, is Pavarotti phosphorylated and bound to 14-3-3 in neurons? In the paper, the authors demonstrate that Pavarotti is phosphorylated on S745 in HEK293T cells (and more so when Trc is co-expressed). Similarly, evidence to support a functional interaction between Pavarotti and 14-3-3 comes from experiments performed in non-neuronal cells. The authors should demonstrate that Pavarotti is phosphorylated and interacts with 14-3-3 in neurons.

We now show that Pavarotti is phosphorylated in neurons at S745 and that this is dependent upon Trc. Please see Figure 3J. To address this, we Immunoprecipitated Pavarotti from control brains of Drosophila 3rd instar larvae or brains expressing Trc RNAi in neurons. We carried out western blotting and showed that the phospho signal at S745 is decreased when Trc is depleted.

4) The authors propose in their model that 14-3-3 binding to the phospho-epitope promotes the association of Pavarotti with microtubules and its crosslinking and braking activity. However, Douglas et al., 2010, published that 14-3-3 binding to the S710 residue in human kinesin-6 reduced the MT binding and bundling activity of centralspindlin. The authors should account for this discrepancy in the text.

This discrepancy is now further discussed. Please see the first paragraph of the subsection “Pavarotti requires 14-3-3 proteins to brake microtubule sliding in S2 cells”.

5) Figure 5: The authors show that Pav or Trc knockdown leads to an increase in the total length of dendrites of Class IV neurons. It has been previously reported that Trc knockdown increases branching (Emoto et al., 2004). It is unclear why increased MT sliding would cause an increase in branching as opposed to dendrite growth. Do the authors observe an increase in branching after Pav knockdown? In the images presented, the effect of Pav depletion looks qualitatively different than the effect of Trc depletion; Pavarotti depletion does appear by eye to produce more secondary and tertiary branches than Trc depletion. Is this the case? These parameters should be quantified and discussed.

As the reviewers suggested, we have now quantified number of branch points per neuron in the class IV DA neurons analysed in Figure 5. These data are now presented in Figure 5—figure supplement 1. Interestingly, we find that Trc depletion either alone or in combination with Pav depletion increases number of dendritic branch points (consistent with previous reports). However, depletion of Pavarotti alone gives values similar to those for control cells. These data suggest that branching of the dendritic arbor is independent of microtubule sliding and also suggest that another substrate of Trc might be in charge of controlling the branching process. Therefore, we hypothesize from these data that Trc regulates dendrite outgrowth and dendrite branching via different mechanisms.

6) Figure 5: If possible, these analyses should be carried out at an earlier time point to demonstrate that this phenotype is the result of a defect in initial dendrite outgrowth.

We attempted this analysis at a late embryonic stage when DA neurons can be observed but their development has not progressed very far. Unfortunately, we found that syncing the embryo collection was unreliable and, despite a short time frame for embryo collection (30mins), embryos were clearly in different developmental stages. Thus, the comparison of DA neuron dendrite length would not be accurate between conditions.

7) In Figure 1G (and Video 2), there does not appear to be a clear difference in sliding between the two conditions from the images/video. This should be addressed.

We have now chosen more representative examples. Please refer to Figure 1E and Video 2.

8) There are a number of instances (listed below) throughout the manuscript where knockdown efficiencies and expression levels should be assessed: a) Furry knockdown in Figure 2;

Please see Figure 2—figure supplement 1B and C.

b) Pav depletion and expression experiments in Figure 3C, D;

Please see Figure 3—figure supplement 1. Here we show Pavarotti depletion by non-coding dsRNA by western blot. We also confirm equivalent expression of WT and S745A GFP Pavarotti by immunofluorescence.

c) PavGFP over-expression in Figure 4;

Please Figure 4—figure supplement 1 for demonstration of GFP Pavarotti signal.

d) Knockdown efficiencies of Trc and Pav in the DA neurons in Figure 5. This is a beautiful cell type and assay but it needs to be accompanied by some assessment (IF, WB, RT-qPCR) that the RNAi is working in these cells.

Trc knockdown in neurons is confirmed by western blotting of Trc in control brain lysate and lysate from larvae expressing Trc RNAi under control of the neuron specific driver elav Gal4. Elav gal4 is active in all neurons of the peripheral nervous system from stage 12 of embryo development, therefore will be driving the relevant RNAis in the analysed class IV DA neurons (Luo et al., 1994). Please see Figure 1—figure supplement 1. We also confirm double knockdown of Pavarotti and Trc by elav Gal4 in brain lysate related to Figure 5.

Unfortunately, it has not been possible to confirm knockdown exclusively in class IV DA neurons as these cells represent a very small, and not easily isolatable population, therefore western blotting is not possible. Further, immunofluorescence experiments would include signal from all surrounding cells, occluding any effect seen in these neurons.

9) The measurements of the% microtubule area shown in Figures 3 and 4 are unclear, especially as presented as a single merged image. Please show each individual channel and highlight the area that you designate as "Pav positive". Pav is nuclear in interphase and, while the images are difficult to assess, it appears that the nuclear signal is evident in some of them. How is this taken into account when evaluating the area that is measured?

We now include Figure 3—figure supplement 2 detailing how this analysis was carried out and how the nuclear Pavarotti signal is excluded in this analysis. Each individual channel for the example images is now presented in Figure 4B to clearly demonstrate the Pav positive microtubule area.

10) The authors reference a constitutively-active Trc in the subsection “Trc kinase activity is necessary to control microtubule sliding”, and refer in to data showing that this construct reduces sliding comparably to WT Trc; however, these data are not presented in Figure 2.

We have now expanded Figure 2A and B to include all relevant conditions.

11) The co-IPs in Figure 4A should be quantified. In addition, the experiment shown in 4A is not currently described in sufficient detail so that readers can understand exactly what was done. Please provide a more detailed explanation.

The coIPs in Figure 4A are now quantified as in Figure 3. The experiment is now described in better detail in the Materials and methods section. Please refer to ‘Immunoprecipitation and western blotting’ in this section.

12) Very little is mentioned in the manuscript about the other component of centralspindlin – MgcRacGAP. The authors should clarify if they believe this mechanism is being mediated by the centralspindlin complex. Part of the source of the confusion also stems from the model figure that appears to show a tetramer of Pavarotti – is that the intention or is this supposed to be a Pavarotti dimer and a Tumbleweed dimer? If it is centralspindlin then the complex should be labeled appropriately and the schematic should be changed accordingly (at least different colors for the constituents).

We have now expanded our discussion of MgcRacGAP and included it in the summary figure to show that, while we are focussing on Pavarotti phosphorylation, we believe this mechanism to be carried out by the centralspindlin complex. Please refer to the second paragraph of the subsection “Pavarotti requires 14-3-3 proteins to brake microtubule sliding in S2 cells”, in the Discussion.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

The manuscript has been significantly improved, but there are a few remaining issues that need to be addressed before acceptance, as outlined below:

1) Much of the new data relates to extending the findings from Drosophila S2 cells further into neurons. To do so the authors have added additional sliding data from cultured neurons to Figure 2 (Figure 2—figure supplement 1) and Figure 5 that agree with the results from S2 cells. They also show that there is a reduction of Pavarotti phosphorylation on S745 following depletion of Trc in fly brains in Figure 3. While the levels of pS745-Pav are quantified, the total Pav levels are not. The authors need to quantify the bands in the lower blot of Figure 3J and report the ratio of pS745 to total Pavarotti.

This is how the western blots have already been quantified throughout all experiments. We apologise for the confusion and have added the following in the Materials and methods section to clarify:

“For quantification of western blots, Licor Image Studio software was used. In each case, phosphorylated Pavarotti levels were compared to total Pavarotti levels. Then this ratio was normalized to that of the control condition. In this way, any difference in immunoprecipitated total Pavarotti levels is accounted for between the two conditions.”

2) The author's claim that 14-3-3 is required for regulation of microtubule sliding is still not explicitly supported by the data presented. Figure 4B and 4C clearly show that there is no effect on sliding when 14-3-3 is inhibited. In light of this, the language in the Abstract should be modified.

The Abstract now reads “Loss of 14-3-3 prevents Pavarotti from associating with microtubules”.

3) "In vitro we show that these two proteins act together to regulate sliding in developing cultured neurons." This sentence needs to be re-written to more clearly indicate that the in vitro studies support a model in which the two proteins act together to regulate sliding in developing cultured neurons.

This line now reads “Our in vitrodata suggest that these two proteins act together to regulate sliding in developing cultured neurons.”


Article and author information

Author details

  1. Rosalind Norkett

    Department of Cell and Developmental Biology, Feinberg School of Medicine, Northwestern University, Chicago, United States
    Conceptualization, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared
  2. Urko del Castillo

    Department of Cell and Developmental Biology, Feinberg School of Medicine, Northwestern University, Chicago, United States
    Resources, Data analysis data interpretation, manuscript editing
    Competing interests
    No competing interests declared
  3. Wen Lu

    Department of Cell and Developmental Biology, Feinberg School of Medicine, Northwestern University, Chicago, United States
    Resources, Generation of flies used in the study, manuscript editing
    Competing interests
    No competing interests declared
  4. Vladimir I Gelfand

    Department of Cell and Developmental Biology, Feinberg School of Medicine, Northwestern University, Chicago, United States
    Conceptualization, Supervision, Funding acquisition
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6361-2798


National Institutes of Health (R01 GM052111)

  • Vladimir I Gelfand

National Institutes of Health (R35 GM131752)

  • Vladimir I Gelfand

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


This work was supported by NIH grants R01 GM052111 and R35 GM131752 to V Gelfand. We thank members of the Gelfand lab and M Glotzer for helpful discussion. We thank the Bloomington Stock Center (supported by NIH P40OD018537) for fly stocks. We thank M Mishima for phospho-specific Pavarotti antibodies, K Emoto for Trc antibody and we thank P Adler for Trc DNA constructs. We thank D Kirchenbuechler of the Northwestern University Center for Advanced Microscopy for help with analysis in Figure 5—figure supplement 1B.

Senior Editor

  1. Suzanne R Pfeffer, Stanford University School of Medicine, United States

Reviewing Editor

  1. Jennifer G DeLuca, Colorado State University, United States

Publication history

  1. Received: September 19, 2019
  2. Accepted: February 5, 2020
  3. Accepted Manuscript published: February 5, 2020 (version 1)
  4. Version of Record published: February 14, 2020 (version 2)


© 2020, Norkett et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 778
    Page views
  • 159
  • 1

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    2. Developmental Biology
    Moran Cohen-Berkman et al.
    Research Article
    1. Cell Biology
    2. Neuroscience
    Eduardo Javier López Soto, Diane Lipscombe
    Research Article