1. Cell Biology
  2. Developmental Biology

Recruitment of mRNAs to P granules by condensation with intrinsically-disordered proteins

  1. Chih-Yung S Lee
  2. Andrea Putnam
  3. Tu Lu
  4. ShuaiXin He
  5. John Paul T Ouyang
  6. Geraldine Seydoux  Is a corresponding author
  1. Johns Hopkins University School of Medicine, United States
https://doi.org/10.7554/eLife.52896
Share this article
Cite this article
  1. Chih-Yung S Lee
  2. Andrea Putnam
  3. Tu Lu
  4. ShuaiXin He
  5. John Paul T Ouyang
  6. Geraldine Seydoux
(2020)
Recruitment of mRNAs to P granules by condensation with intrinsically-disordered proteins
eLife 9:e52896.
https://doi.org/10.7554/eLife.52896
  2. Download BibTeX
  3. Download .RIS
6 figures, 1 table and 7 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
mRNAs are recruited into P granules by the MEG phase.

(A) Abbreviated embryonic lineage showing the somatic (AB, EMS, C, and D) and germline (P) blastomeres. Green dots represent P granules. P4 is the founder cell of the germline. Dotted lines refer to …

Figure 1—source data 1

Data used to generate Figure 1D.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Download asset Open asset
mRNAs are recruited into P granules by the MEG phase.

(A) Anti-GFP western blot and autoradiograph of crosslinked anti-GFP immunoprecipitates separated by SDS-PAGE. The immunoprecipitates were 5’ end radiolabeled to visualize cross-linked protein:RNA …

Figure 1—figure supplement 2
Download asset Open asset
In situ hybridization.

Photomicrographs of 4 cell wild-type embryos hybridized with smFISH probes as indicated. Maximum Z projections of photomicrographs from at least 10 embryos were examined per probe set. Numbers in …

Figure 2 with 3 supplements
Download asset Open asset
MEG proteins recruit mRNAs into P granules by a sequence non-specific mechanism that favors ribosome-poor mRNAs.

(A) Metagene analysis of the distribution of MEG-3::GFP iCLIP reads on the 657 MEG-3-bound transcripts (blue line) compared to GFP iCLIP (green line) reads. The peak 3’ to the STOP codon correspond …

Figure 2—source data 1

Data used to generate Figure 2E.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig2-data1-v2.xlsx
Figure 2—source data 2

Data used to generate Figure 2G.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig2-data2-v2.xlsx
Figure 2—figure supplement 1
Download asset Open asset
Characterization of MEG-3 bound transcripts.

(A) First pie chart shows distribution of MEG-3::GFP reads relative to different transcript types (total: 521,189 reads). Second pie chart shows distribution of MEG-3::GFP reads mapping to mRNAs …

Figure 2—figure supplement 2
Download asset Open asset
MEG-3 binds ribosome-poor transcripts.

(A) Box plot showing ribosome occupancy in wild-type embryos for all transcripts (15,345 loci), P-lineage enriched transcripts (1347 loci), P granule transcripts (492 loci), and P granule and …

Figure 2—figure supplement 3
Download asset Open asset
Correlation analyses of sequencing libraries from wild type and meg-3 meg4 embryos.

Sequencing libraries were generated from wild type and meg-3 meg-4 embryonic lysates in triplicates for RNAseq (A) and ribosome profiling (B) experiments. The scatterplots illustrate correlation …

Figure 3 with 1 supplement
Download asset Open asset
P granules enrich maternal mRNAs required for germ cell development in P blastomeres.

(A and B) Photomicrographs of embryos of indicated stages and genotypes and hybridized to fluorescent probes or antibodies to visualize nos-2 and Y51F10.2 transcripts and proteins. Embryos …

Figure 3—figure supplement 1
Download asset Open asset
MEG-3 and MEG-4 are not required for translational repression of 623 mRNAs in P granules.

(A) Photomicrographs of P2 and P4 stage embryos hybridized with smFISH probes as indicated. Unlike nos-2 and Y51F10.2 shown in Figure 3, the transcripts shown here remain associated with P granules …

Figure 4 with 2 supplements
Download asset Open asset
Non-sequence-specific condensation of MEG-3 with RNA.

(A) Representative photomicrographs of condensates of MEG-3 and indicated RNA after incubation in condensation buffer. Reactions contained 500 nM MEG-3 and 20 ng/µL in vitro transcribed RNA. MEG-3 …

Figure 4—source data 1

Data used to generate Figure 4B.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig4-data1-v2.xlsx
Figure 4—source data 2

Data used to generate Figure 4C.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig4-data2-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
MEG-3 Purification and RNA only condensation.

(A) Gel showing purified recombinant 6Xhis-tagged MEG-3 protein stained with SimplyBlue SafeStain. (B) Representative fluorescence (left panels) or DIC (right panels) photomicrographs of control …

Figure 4—figure supplement 2
Download asset Open asset
RNA modulates MEG condensation dependent on salt concentration.

(A) Representative photomicrograph of condensates of MEG-3 and nos-2 RNA after incubation in condensation buffer and imaged with a 100X objective. Scale bar is 5 µm. Reactions contained 500 nM MEG-3 …

Figure 5 with 1 supplement
Download asset Open asset
Long RNAs stably associate with the MEG gel phase.

(A) Representative photomicrographs of MEG-3 condensation reactions with indicated RNAs. 100–600 nt RNAs are fragments of nos-2 (Materials and methods). Reactions contained 500 nM MEG-3 and 20 ng/µL …

Figure 5—source data 1

Data used to generate Figure 5B.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig5-data1-v2.xlsx
Figure 5—source data 2

Data used to generate Figure 5D.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig5-data2-v2.xlsx
Figure 5—source data 3

Data used to generate Figure 5F.

https://cdn.elifesciences.org/articles/52896/elife-52896-fig5-data3-v2.xlsx
Figure 5—figure supplement 1
Download asset Open asset
RNA modulates MEG condensation dependent on RNA length.

(A) Histograms of MEG-3 intensity (log10 scale) normalized to the total number of condensates/aggregates in each reaction assembled as in Figure 5A. Each histogram includes data from 12 images …

Author response image 1
Download asset Open asset

Tables

Key resources table
Reagent type
(species) or resource		DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background C. elegansJH3503Smith et al., 2016meg-3(ax3054[meg-3::meGFP]) X.
Strain, strain background C. elegansJH3269Putnam et al., 2019pgl-1(ax3122[pgl-1::GFP]) IV.
Strain, strain background C. elegansJH3193Paix et al., 2014nos-2(ax2049[3xFLAG::nos-2]) II.
Strain, strain background C. elegansJH3605This studyY51F10.2(ax4319[Y51F10.2::OLLAS]) I
Strain, strain background C. elegansEGD364Wu et al., 2019meg-3(egx4[meg-3::Halo]) X.
Strain, strain background C. elegansJH3475Smith et al., 2016meg-3(ax3055) meg-4(ax3052) X
Strain, strain background C. elegansWM527Shen et al., 2018prg-1(ne4523 [gfp::tev::flag::prg-1]) I
Strain, strain background C. elegansJH3357Lee et al., 2017nos-2(ax3103[nos-2△]) II
Strain, strain background C. elegansSS608Kawasaki et al., 2004pgl-3(bn103[pgl-3△]) V
Strain, strain background C. elegansSX922Caenorhabditis Genetics Centerprg-1(n4357[prg-1△])I
Strain, strain background C. elegansJH3229Wang et al., 2014meg-1(vr10) meg-3(tm4259)X
Strain, strain background C. elegansJH3740This studymeg-3(ax3055) meg-4(ax3052) X; Y51F10.2(ok1610) I
Strain, strain background C. elegansJH3743This studynos-2(ax3130) II; Y51F10.2(ok1610) I
Strain, strain background C. elegansJH3746This studymeg-3(ax3055) meg-4(ax3052) X; nos-2(ax3130) II. 100% sterile, no clone was maintained.
Strain, strain background C. elegansJH1904This studyUnc-119(ed3) III; axls1374[Ppie1::GFP]
Strain, strain background C. elegansJH2878Leacock and Reinke, 2008meg-1(vr10) X
Strain, strain background C. elegansJH3562This studymeg-3(ax3054[MEG-3::meGFP]) X; K08F4.2 (ax5000[gtbp-1::tagRFP]) IV
Strain, strain background C. elegansRB1413Caenorhabditis Genetics CenterY51F10.2(ok161) I
AntibodyK76DSHB,PMID: 28787592RRID:AB_531836(1:15)
AntibodyAnti-FLAG M2Sigma-Aldrich Cat# F3165RRID:AB_259529(1:200)
AntibodyDonky-anti-mouse
IgM 647		Jackson ImmunoResearch LabsRRID:AB_2340861(1:400)
AntibodyGoat anti-Rabit IgG (H+L) 568Molecular probes cat# A-11011RRID:AB_143157(1:400)
AntibodyAnti-OLLAS-L2Novus cat# NBP1-06713RRID:AB_1625979(1:200)
AntibodyAnti-OLLASothergift from Dr. Jeremy Nathans
AntibodyAnti-GFPRoheRRID:AB_390913For conjugation
Sequence-based reagentoCYL1089: crRNA to cut Y51F10.2 at 3' endThis studyGTGCTCAAAATAGTAGGCGA
Sequence-based reagentoCYL1143: repair oligo of Y51F10.2 C-ter Ollas tag (+)This studyTCCAGCGCCAGCACCACCATTCGAC AACTCCGTCGCCTACTATTTTGGAGGAT CCGGAtccggattcgccaacGAGCTCggac cacgtctcatgggaaagGGAGGATCCGG AGAGCACCAATTTTGA gcttttatatttttttttctc
Sequence-based reagentoCYL1144: repair oligo of Y51F10.2 C-ter Ollas tag (-)This studygagaaaaaaaaatataaaagc TCAAAATTGGTGCTCTCCGGATCCTC CctttcccatgagacgtggtccGAGCTCgtt ggcgaatccggaTCCGG ATCCTCCAAAAT AGTAGGCGACGGAGTTGTCGA ATGGTGGTGCTGGCGCTGGA
Sequence-based reagentoCYL1096:5' PCR primer 333 bp up of Y51F10.2 TGA stopThis studyGTTTCCAGCCGCTTGACAAG
Sequence-based reagentGTTTCCAGCCGCTTGACAAGThis studyCTGATCCTCCCCCTTCTTCG
Sequence-based reagentoCYL1259:5' PCR primer contains T7 promoter for in vitro transcription of T19H12.2 mRNA.This studyCATGATTACTAATACG ACTCACTATA GGGaccagctcacga aactaacaatg
Sequence-based reagentoCYL1260:3' PCR primer at the end of T19H12.2 3UTR for T7 in vitro transcriptionThis studygaaagcgaaagaaatttt attttacaggagg
Sequence-based reagentoCYL1261:5' PCR primer contains T7 promoter for in vitro transcription of dao-5 mRNA including utr.This studycatgattacTAATACGACT CACTATAGGG ggtacccctgatcgctATGAG
Sequence-based reagentoCYL1262:3' PCR primer at the end of dao-5 3UTR for T7 in vitro transcriptionThis studyggaccaaacattttatggat gagacaag
Sequence-based reagentoCYL1263:5' PCR primer contains T7 promoter forin vitro transcription of hil-5 mRNA.This studycatgattacTAATACGACT CACTATAGGG actatcacttttcaagtgtttgttcatcg
Sequence-based reagentoCYL1264:3' PCR primer at the end of hil-5 3UTR for T7 in vitro transcriptionThis studyagaatctattaatggtttattggaa ggtatatttgttaaaatg
Sequence-based reagentoCYL1265:5' PCR primer contains T7 promoter forin vitro transcription of pbs-7 mRNA including utr.This studycatgattacTAATACGACT CACTATAGGG gcatttcattgtcgaaattcacttcctttc
Sequence-based reagentoCYL1266:3' PCR primer at the end of pbs-7 3UTR for T7in vitro transcriptionThis studyagaaggattaaatggaag tttatttatcgacttc
Sequence-based reagentoCYL1267:5' PCR primer contains T7 promoter for in vitro transcription of T07C4.3a mRNA including utr.This studycatgattacTAATACGACT CACTATAGGG gtttgtgcactcactacgaaatctc
Sequence-based reagentoCYL1268:3' PCR primer at the end of T07C4.3a 3UTR for T7 in vitro transcriptionThis studycatcaaaatattctttcatt taacaaaaacagaaacaac
Recombinant DNA reagentplasmid: 6XHis-MEG-3Smith et al., 2016
Recombinant DNA reagentplasmid: MBP-HIS-TEV-PGL-3Putnam et al., 2019
Chemical compound, drugSYTO 14ThermoFisher Cat#S7572In vivo RNA labeling
Chemical compound, drugAlexa Fluor 647 NHS EsterThermoFisher Cat#A37573protein labeling
Chemical compound, drugDyLight 488 NHS EsterThermoFisher Cat#46403protein labeling
Chemical compound, drugChromaTide Alexa Fluor 488–5-UTPThermoFisher Cat#C11403RNA labeling
Chemical compound, drugChromaTide Alexa Fluor 546–14-UTPThermoFisher Cat#C11404RNA labeling
Recombinant DNA reagentplasmid: cDNA of pbs-7this paperpbs-7 cDNA, pUC19 vector
Recombinant DNA reagentplasmid: cDNA of dao-5this paperdao-5 cDNA, pUC19 vector
Recombinant DNA reagentplasmid: cDNA of T19H12.2this paperT19H12.2 cDNA, pUC19 vector
Recombinant DNA reagentplasmid: cDNA of hil-5this paperhil-5, pUC19 vector
Recombinant DNA reagentplasmid: cDNA of Y51F10.2this paperY51F10.2 cDNA, PCR blunt II topo vector
Recombinant DNA reagentplasmid: cDNA of nos-2this papernos-2 cDNA, PCR blunt II topo vector
Recombinant DNA reagentplasmid: cDNA of skr-2this paperskr-2 cDNA, PCR blunt II topo vector
Recombinant DNA reagentplasmid: cDNA of R04D3.2this paperR04D3.2 cDNA, PCR blunt II topo vector
Recombinant DNA reagentplasmid: cDNA of C46A5.6this paperC46A5.6 cDNA, PCR blunt II topo vector
Software, algorithmDESeq2https://bioconductor.org/packages/release/bioc/html/DESeq2.htmlRRID:SCR_015687
Software, algorithmhisat2DOI:10.1038/nprot.2016.095RRID:SCR_015530
Software, algorithmhtseq-countDOI:10.1093/bioinformatics/btu638RRID:SCR_011867
Software, algorithmcuffdiffhttp://cole-trapnell-lab.github.io/cufflinks/RRID:SCR_001647
Software, algorithmSlidebook 6https://www.intelligent-imaging.com/slidebookRRID:SCR_014300
Software, algorithmDeeptoolshttps://deeptools.readthedocs.io/en/develop/RRID:SCR_016366
Software, algorithmicounthttps://github.com/tomazc/iCountRRID:SCR_016712
Software, algorithmsmatoolshttp://samtools.sourceforge.net/RRID:SCR_002105
Software, algorithmBEDToolshttps://github.com/arq5x/bedtools2RRID:SCR_006646
Software, algorithmGalaxyhttps://usegalaxy.eu/RRID:SCR_006281
Software, algorithmRstusiohttp://www.rstudio.com/RRID:SCR_000432
Software, algorithmSTARhttps://github.com/alexdobin/STARRRID:SCR_015899

Additional files

Supplementary file 1

Gene list of MEG-3 bound transcripts, P granule transcripts and PGL-1 bound transcripts.

https://cdn.elifesciences.org/articles/52896/elife-52896-supp1-v2.csv
Supplementary file 2

Ribosome footprint for P-blastomere enriched genes.

https://cdn.elifesciences.org/articles/52896/elife-52896-supp2-v2.csv
Supplementary file 3

Differential gene expression analysis of wild type and meg-3meg-4 embryos.

https://cdn.elifesciences.org/articles/52896/elife-52896-supp3-v2.xlsx
Supplementary file 4

Differential Translation analysis of wild type and meg-3meg-4 embryos.

https://cdn.elifesciences.org/articles/52896/elife-52896-supp4-v2.xlsx
Supplementary file 5

Sequencing library information.

https://cdn.elifesciences.org/articles/52896/elife-52896-supp5-v2.xlsx
Supplementary file 6

Read counts for iCLIP experiments.

https://cdn.elifesciences.org/articles/52896/elife-52896-supp6-v2.csv
Transparent reporting form
https://cdn.elifesciences.org/articles/52896/elife-52896-transrepform-v2.docx

Download links