ARID1A loss in adult hepatocytes activates β-catenin-mediated erythropoietin transcription
- INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), France
- Equipe labellisée Ligue Nationale Contre le Cancer, France
- INSERM, CNRS, Institut COCHIN, France
- INSERM U1183, Université Montpellier, Institute for Regenerative Medicine & Biotherapy (IRMB), France
- Plateforme d’Imageries du Vivant de l’Université de Paris, France
- INSERM, Université Paris-Est UPEC, France
- Department of Pathology, Henri Mondor Hospital, France
- INSERM, Paul-Brousse University Hospital, Hepatobiliary Centre, France
- Department of Cardiac Surgery Cardiovascular Research Center, University of Michigan, United States
Figures
Figure 1 with 4 supplements
Development of peliosis-like regions after hepato-specific and focal Arid1a and Apc inactivation.
(a) Cre-loxP-generated hepatocyte-specific and inducible inactivation of Apc and/or Arid1a in 20% of hepatocytes after retro-orbital injection of infectious viral particles (ivp) of adenovirus …
-
Figure 1—source data 1
Emergence of peliosis (Figure 1c) and survival curve (Figure 1d).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Focal inactivation of Apc and/or Arid1a genes in mouse liver.
(a) Liver to Body weight (%) in mice; WT (n = 8), [Apc]ko-focal (n = 10), [Arid1a]ko-focal (n = 18), and [Apc-Arid1a]ko-focal (n = 19) mice. (b) RT-qPCR analysis of β-catenin-positive target genes …
-
Figure 1—figure supplement 1—source data 1
Liver to body weight ratios (Figure 1—figure supplements 1a) and expression of Glul and Axin2 mRNAs (Figure 1—figure supplements 1b).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Ultrasound features of livers from seven-month-old [Apc-Arid1a]ko-focal mice.
(a) Echogenicity of peliotic areas within the [Apc-Arid1a]ko-focal liver (arrow), showing striking tissue modification. Scale bars = 2 cm. (b) Dynamic contrast-enhanced ultrasound using microbubble …
Figure 1—figure supplement 3
Blood vessel enrichment and angiogenesis in [Apc-Arid1a]ko-focal livers.
(a) Peliotic areas appeared as abnormal tangles of irregularly shaped, leaky, small and large blood vessels filled with red blood cells, with multiple, mottled cyst-like spaces associated with …
-
Figure 1—figure supplement 3—source data 1
qPCR expression of angiogenic mRNAs (Figure 1—figure supplements 3c).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig1-figsupp3-data1-v2.xlsx
Figure 1—figure supplement 4
Hepatocarcinogenesis in β-catenin-activated and Arid1a-null context.
(a–c) HCC incidence decrease in [Apc-Arid1a]ko-focal compared to [Apc]ko-focal mice. (a) Incidence of HCC was detected by ultrasound in [Apc]ko-focal (n = 13) and [Apc-Arid1a]ko-focal (n = 24) mice. …
Figure 2 with 1 supplement
Hepatic peliosis has ‘angiogenic’ and ‘erythropoietin’ transcriptional signatures, linked to a systemic erythrocytosis and to de novo hepatic Epo expression in [Apc-Arid1a]ko-focal mice.
(a) Experimental strategy; (b) Transcriptomic gene-set enrichment analysis (GSEA) of hepatic peliosis (n = 4) relative to adjacent regions (n = 4) of [Apc-Arid1a]ko-focal mice. (c) Quantitative …
-
Figure 2—source data 1
Gene expression (Figure 2c, e) and hematological parameters (Figure 2d).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Peliosis-like regions from [Apc-Arid1a]ko-focal livers are enriched for ‘Endothelium development’ and ‘Erythrocyte homeostasis’ transcriptional signatures.
Gene-set enrichment analysis (GSEA) was performed with the Java tool application available at the Broad Institute (Cambridge, MA, USA) in which FFPE micro-dissected RBC regions were compared with …
Figure 3 with 1 supplement
Erythropoiesis occurs in the spleen of [Apc-Arid1a]ko-focal mice.
(a) Gross morphology of spleens from representative control (WT) and [Apc-Arid1a]ko-focal mice; (b) Spleen/body weight ratio of WT (n = 7), [Apc]ko-focal (n = 11), [Arid1a]ko-focal (n = 11), and [Apc…
-
Figure 3—source data 1
Spleen to body weight (Figure 3b), FACS analyses (Figure 3e), CFU-E counts (Figure 3f) and gene expression (Figure 3g).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Hepato-specific and focal inactivation of Apc and Arid1a genes leads to sequestration of enucleated beta-globin-positive red blood cells.
Western blot (a) and immunostaining (b, c) of hemoglobin subunit beta (Hbb) showing that Hbb-positive erythroid cells accumulated in [Apc-Arid1a]ko-focal livers are not nucleated, so do not …
Figure 4 with 1 supplement
Blockade of Epo signaling with anti-EPO serum in [Apc-Arid1a]ko-focal mice eliminates aberrant erythropoiesis in the spleen, but maintains angiogenesis in the liver.
(a) Hematocrit before (n = 4) and after (n = 4) anti-EPO treatment (t-test). (b,c) FACS analysis (b) and quantification (c) of spleens with/without anti-EPO (n = 4 for each group) (t-test). (d) …
-
Figure 4—source data 1
Hematocrit (Figure 4a), FACS quantifications (Figure 4c, g) and gene expression (Figure 4d, h) after anti-EPO treatment.
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Anti-EPO blocking serum treatment in [Apc-Arid1a]ko-focal mice leads to decrease of intra-hepatic red blood cells accumulation.
Hematoxylin Eosin (HE)-stained sections of livers from untreated and treated 7-month-old [Apc-Arid1a]ko-focal mice with anti-EPO blocking serum. Scale bars = 200 μm. The dotted outlines correspond …
Figure 5 with 2 supplements
Cell-autonomous Epo expression after Arid1a inactivation and Wnt/β-catenin activation in murine and human hepatocytes.
(a) In vivo and ex vivo strategy. WT (n = 8), [Apc]ko-TOTAL (n = 7), [Arid1a]ko-TOTAL (n = 8), and [Apc-Arid1a]ko-TOTAL (n = 10) mice. (b) Inactivation efficiency of Apc and Arid1a genes in isolated …
-
Figure 5—source data 1
Efficiency of gene invalidation (Figure 5b), and gene expression in vivo and ex vivo (Figure 5c-f) in mice and humans.
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Panlobular inactivation of Apc and/or Arid1a in hepatocytes.
(a) Hepatomegaly in mice after panlobular inactivations. WT (n = 30), [Apc]ko-TOTAL (n = 9), [Arid1a]ko-TOTAL (n = 9), and [Apc-Arid1a]ko-TOTAL (n = 14) mice. Data are presented as the mean + SEM …
-
Figure 5—figure supplement 1—source data 1
Liver to body weight ratio (Figure 5—figure supplements 1a).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig5-figsupp1-data1-v2.xlsx
Figure 5—figure supplement 2
Cell-autonomous Epo expression after Arid1a invalidation and Wnt/β-catenin activation in hepatocytes.
(a) No invalidation of Apc and Arid1a genes was found in NPC from [Apc-Arid1a]ko-TOTAL mice (Student t-test). (b) In vitro analysis of Axin2, Arid1a, and Epo transcription by RT-qPCR in primary …
-
Figure 5—figure supplement 2—source data 1
Efficiency of gene invalidation (Figure 5—figure supplements 2a), mRNA expression (Figure 5—figure supplements 2b-d), western blots (Figure 5—figure supplements 2e).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig5-figsupp2-data1-v2.xlsx
Figure 6 with 1 supplement
In situ hybridization of mRNAs showing a de novo expression of Epo in a subset of β-catenin-activated hepatocytes.
(a) Seven months after Apc/Arid1a gene invalidation in single hepatocytes from two livers (#1 and #2); (b) 7 days after gene invalidation in more than 90% hepatocytes (two livers: #a and #b). Axin2 …
Figure 6—figure supplement 1
Implementation of in situ Hybridization for Axin2 and Epo mRNAs using RNAScope, showing expressing mRNA as dots.
(a,b) Ppib (blue) and Polr2a (red) were successfully found expressed in liver and kidney FFPE sections of control mice. No expression of bacterial dapB was found. (c) In control livers, Axin2 mRNAs …
Figure 7 with 2 supplements
Wnt/β-catenin directly controls EPO expression through 3’ Epo enhancer, in a HIF-independent manner.
(a) Genomic environment of the Epo gene (UCSC Genome Browser, mm9 database) and ChIP-seq peaks at the 3’ Epo enhancer. In blue/red: the crude reads of ChIP-Seq data performed in adult livers against …
-
Figure 7—source data 1
EpoE-luc luciferase relative activity (Figure 7c-e).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Lack of hypoxia and HIF signaling in [Apc-Arid1a]ko-TOTAL livers.
(a) Immunodetection of hepatic hypoxia seven days after Apc and/or Arid1a loss in all hepatocytes in mouse liver. For hypoxia detection in tissues, mice were injected with Hypoxyprobe (NPI Inc) …
-
Figure 7—figure supplement 1—source data 1
Quantification of western blots (Figure 7—figure supplements 1c) and mRNA expression (Figure 7—figure supplements 1d-e).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig7-figsupp1-data1-v2.xlsx
Figure 7—figure supplement 2
Effect of HIF1α and HIF2α knock-downs in mouse primary and transgenic hepatocytes.
(a) RT-qPCR analysis of Hif1α and Hif2α expression in primary culture hepatocytes treated or not with desferrioxamine (DFO) and after siRNA mediated knockdown of Hif1α (20 nM) and/or Hif2α (20 nM). …
-
Figure 7—figure supplement 2—source data 1
mRNA expressions (Figure 7—figure supplements 2a, c, d) and western blots (Figure 7—figure supplements 2b, e).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig7-figsupp2-data1-v2.xlsx
Figure 8 with 2 supplements
β-catenin/Tcf4 complex binds to the HNF4-responsive element of Epo enhancer (Epo-HRE) after modifications of histone marks and chromatin accessibility.
(a) EMSA using nuclear proteic extracts from WT or [Apc]ko-TOTAL livers and 32P-labeled probes containing Epo-HRE (DR2). (b, c) Competitive EMSA using 32P-labeled DR2 (b) and 32P-labeled WRE (c) …
-
Figure 8—source data 1
EMSA (Figure 8a-c), ChIP-qPCR (Figure 8d, e) and ATAC-qPCR (Figure 8f) data.
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig8-data1-v2.xlsx
Figure 8—figure supplement 1
The expression of β-catenin-positive target genes is not modulated by Arid1a status.
RT-qPCR analysis of GS and Axin2 expression in hepatocytes from the livers of two-month-old mice, one week after panlobular Apc and Arid1a invalidation. WT (n = 3), [Apc]ko-TOTAL (n = 2), [Arid1a]ko-…
-
Figure 8—figure supplement 1—source data 1
mRNA expression (Figure 8—figure supplements 1a).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig8-figsupp1-data1-v2.xlsx
Figure 8—figure supplement 2
Chromatin accessibility assessed all along the hepatic 3’Epo enhancer by ATAC-qPCR.
(a) The hepatic 3’ Epo enhancer with the 4 PCR products analyzed: the whole hepatic 3’ Epo enhancer (222nt); (1) the EPO-enh-5’ located upstream the HIF- and Hnf4- responsive elements; (2) the …
-
Figure 8—figure supplement 2—source data 1
ATAC-qPCR data (Figure 8—figure supplements 2b).
- https://cdn.elifesciences.org/articles/53550/elife-53550-fig8-figsupp2-data1-v2.xlsx
Figure 9
Schematic model of the role of Arid1a in hepatic Epo expression linked to overactivation of the Wnt/β-catenin pathway.
Under physiological conditions, the presence of Arid1a is associated with histone repressive marks at the Epo enhancer and β-catenin is constantly degraded; thus, Epo is not produced. In the absence …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Epo | GenBank | NM_007942.2 | Erythropoietin |
| Gene (Mus musculus) | Arid1a | GenBank | NM_001080819.2 | Arid1a |
| Gene (Mus musculus) | Ctnnb1 | GenBank | NM_007614.3 | Beta-catenin |
| Gene (Mus musculus) | Apc | GenBank | NM_001360980.1 | Adenomatous polyposis coli |
| Strain, strain background (Mus musculus) | Arid1a-lox | From Z. Wang’s lab | Arid1atm1.1Zhwa/J | https://www.jax.org/strain/027717 |
| Strain, strain background (Mus musculus) | Apc-lox | From Perret-Colnot’s lab | Apctm2.1Cip | https://www.infrafrontier.eu/search?keyword=EM:05566 |
| Strain, strain background (Mus musculus) | Ttr-Cre-Tam | From Perret-Colnot’s lab | Tg(Ttr-cre/Esr1*)1Vco | https://www.infrafrontier.eu/search?keyword=EM:01713 |
| Genetic reagent (Adenovirus 5) | Ad-Cre | Université de Nantes, France | Ad5-CAG-Cre | https://umr1089.univ-nantes.fr/facilities-cores/cpv/translational-vector-core-2201753.kjsp?RH=1519296751975 |
| Cell line (Mus musculus) | Mouse hepatoma | From Christine Perret’s lab | Hepa 1-6 [Hepa1-6] (ATCC CRL-1830) | For transfection experiments |
| Antibody | anti-Arid1a (Rabbit monoclonal) | Abcam | Cat# 182560 [EPR13501] | IHC(1:1000), WB (1:2000) |
| Antibody | anti-Glul (GS) (Mouse monoclonal) | BD Biosciences | Cat# 610518, RRID:AB_397880 | IHC(1:400), WB (1:5000) |
| Antibody | anti-HBB (Mouse monoclonal) | Proteintech | Cat# 16216–1-AP, RRID:AB_10598329 | IHC(1:200), WB (1:2000) |
| Antibody | anti-HIF1α (Rabbit polyclonal) | Novus | Cat# NB100-449, RRID:AB_10001045 | WB nuclear extract (1:500) |
| Antibody | anti-HIF2α (Rabbit polyclonal) | Novus | Cat# NB100-122, RRID:AB_10002593 | WB nuclear extract (1:500) |
| Antibody | Anti-Tcf4 (Tcf7l2) (Mouse monoclonal) | Millipore | Cat# 05–511, RRID:AB_309772 | ChIP: 3 μg |
| Antibody | Anti-H3K27Ac (Rabbit polyclonal) | Active Motif | Cat# 39133, RRID:AB_2561016 | ChIP: 3 μg |
| Antibody | Anti-H3K27me3 (Rabbit polyclonal) | Active Motif | Cat# 39155, RRID:AB_2561020 | ChIP: 3 μg |
| Antibody | IgG (Mouse) | Thermo Fisher Scientific | Cat# 10400C, RRID:AB_2532980 | ChIP: 3 μg |
| Antibody | Anti-CD71-FITC (Rat monoclonal) | BD Biosciences | Cat# 553266, RRID:AB_394743 | FACS (1:100) |
| Antibody | Anti-Ter119-PE (rat monoclonal) | BD Biosciences | Cat# 553673, RRID:AB_394986 | FACS (1:100) |
| Antibody | Anti-β-actin (mouse monoclonal) | Sigma-Aldrich | Cat# A5441, RRID:AB_476744 | WB (1:10000) |
| Antibody | Anti-lamin A/C (rabbit polyclonal) | Cell Signaling Technology | Cat# 2032, RRID:AB_2136278 | WB nuclear extract (1:500) |
| Antibody | IgG, HRP-conjugated (horse, anti-mouse) | Cell Signaling Technology | Cat# 7076, RRID:AB_330924 | WB (1:2000) |
| Antibody | IgG, HRP-conjugated (goat, anti-rabbit) | Cell Signaling Technology | Cat# 7074, RRID:AB_2099233 | WB (1:2000) |
| Antibody | IgG, biotinylated (goat, anti-rabbit) | Vector lab | Cat# BA-1000, RRID:AB_2313606 | IHC (1:200) |
| Commercial assay or kit | MOM mouse on mouse | Vector Laboratories | Cat# BMK-2202, RRID:AB_2336833 | Kit |
| Sequence-based reagent | 18S | Thermo Fisher Scientific | Taqman Assay 4308329 | qPCR primers |
| Sequence-based reagent | Glul | Thermo Fisher Scientific | Taqman Assay Mm00725701_si | qPCR primers Mus musculus |
| Sequence-based reagent | Axin2 | Thermo Fisher Scientific | Taqman Assay Mm00443610_m1 | qPCR primers Mus musculus |
| Sequence-based reagent | Arid1a (total) | Thermo Fisher Scientific | Taqman Assay Mm00473838_m1 | qPCR primers Mus musculus |
| Sequence-based reagent | Arid1a (not excised by Cre) | Thermo Fisher Scientific | Taqman Assay Mm00473841_m1 | qPCR primers Mus musculus |
| Sequence-based reagent | Apc (total) | Thermo Fisher Scientific | Taqman Assay Mm00545877_m1 | qPCR primers Mus musculus |
| Sequence-based reagent | Apc (not excised by Cre) | Thermo Fisher Scientific | Taqman Assay Mm01130462_m1 | qPCR primers Mus musculus |
| Sequence-based reagent | Epo | Thermo Fisher Scientific | Taqman Assay Mm01202755_m1 | qPCR primers Mus musculus |
| Sequence- based reagent | 18 s | Eurogentec | F_GTAACCCGTTGAACCCCATT R_CCATCCAATCGGTAGCG | SybrGreen qPCR primers |
| Sequence-based reagent | Angiopoietin-like 2 (Angptl2) | Eurogentec | F_CCGCAACATGAACTCGAGAG R_GTGCTCCAGGTCCTTGTACT | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Carbonic anhydrase 9 (Car9) | Eurogentec | F_GACCTCGTGATTCTCGGCTA R_GAGAAGGCCAAACACCAAGG | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Cyclin D1 (Ccnd1) | Eurogentec | F_AGAAGTGCGAAGAGGAGGTC R_TTCTCGGCAGTCAAGGGAAT | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Enolase 2, gamma neuronal (Eno2) | Eurogentec | F_TGGATTTCAAGTCTCCCGCT R_TCAGGTCATCGCCCACTATC | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Erythropoietin receptor (Epo-r) | Eurogentec | F_ATGACTTTCGTGACTCACCCT R_GGGCTCCGAAGAACTTCTGTG | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | FMS-like tyrosine kinase 1 (Flt1) | Eurogentec | F_AGAGGAGGATGAGGGTGTCT R_GGGAACTTCATCTGGGTCCA | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | GATA binding protein 1 (Gata1) | Eurogentec | F_TTCCCACTACTGCTGCTACC R_GCGGCCTCTATTTCAAGCTC | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | GATA binding protein 2 (Gata2) | Eurogentec | F_GCCGGTTCTGTCCATTCATC R_ATGGCAGCAGTCTCTTCCAT | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Inhibin beta-B (Inhbb) | Eurogentec | F_GTACCTGAAACTGCTCCCCT R_ATGGCCTCTGTGATGGGAAA | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Potassium channel tetramer domain contain. 11 (Kctd11) | Eurogentec | F_TGACTTCTACCAGATCCGGC R_TCAGGGTCAGTGCAGAAGAG | SybrGreen qPCR primers Mus musculus |
| Sequence- based reagent | Kinase insert domain protein receptor (Kdr) | Eurogentec | F_AGAAGATGCCCATGACCCAA R_TCACCCATCCTCAACACACA | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Nuclear factor, erythroid derived 2 (Nfe2) | Eurogentec | F_GATGTCCCGAACTAGAGCCA R_ACACCCTTGGCCTTAGAGTC | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Platelet derived growth factor receptor, alpha polypeptide (Pdgfra) | Eurogentec | F_ACAGCTCACAGACTTCGGAA R_AGAAGATGATACCCGGAGCG | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Phosphoglycerate kinase 1 (Pgk1) | Eurogentec | F_TGGCACCAGGAACCCTTAAA R_AGCTCAGCCTTTACAGCTCA | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Placenta-specific 8 (Plac8) | Eurogentec | F_TGATTGCTTCAGTGACTGCG R_GTTCATGGCTCTCCTCCTGT | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Protein tyrosine phosphatase, receptor type, B (Ptprb) | Eurogentec | F_TGGACCCTGGGATCTAAGGA R_GTGGTCACTGCAAGCTTCAA | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Member RAS oncogene family (Rab42) | Eurogentec | F_GGCGTTCTGTTGGTCTTTGA R_GCAAGTTCCTCTGCTTCCTG | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Vascular endothelial growth factor A (Vegfa) | Eurogentec | F_GCTGTAACGATGAAGCCCTG R_CGCTCCAGGATTTAAACCGG | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | Zinc finger protein, multitype 1 (Zfpm1) | Eurogentec | F_CCTTGAGATGGCGTTCACAG R_CCTGCTCTACTACTGTGCCA | SybrGreen qPCR primers Mus musculus |
| Sequence-based reagent | AT-rich interaction domain 1A (ARID1A) | Eurogentec | F_AAGCCACCAACTCCAGCATCCA R_CGCTTCTGGAATGTGGAGTCAC | SybrGreen qPCR primers (Homo sapiens) |
| Sequence-based reagent | Adenomatous polyposis coli (APC) | Eurogentec | F_CACACTTCCAACTTCTCGCAACG R_AGGCTGCATGAGAGCACTTGTG | SybrGreen qPCR primers (Homo sapiens) |
| Sequence-based reagent | Erythropoietin (EPO) | Eurogentec | F_GCATGTGGATAAAGCCGTCAGTG R_GAGTTTGCGGAAAGTGTCAGCAG | SybrGreen qPCR primers (Homo sapiens) |
| Sequence-based reagent | DOS7-binding site (Control) | Eurogentec | F_GGGGTAGGAACCAATGAAA R_TTTCATTGGTTCCTACCCC | EMSA probe Mus musculus |
| Sequence-based reagent | HNF4-responsive element (DR2) | Eurogentec | F_GCCCGGCTGACCTCTTGACCCCTCTGGGCTTGAG R_CTCAAGCCCAGAGGGGTCAAGAGGTCAGCCGGGC | EMSA probe Mus musculus |
| Sequence-based reagent | Wnt-reponsive element | Eurogentec | F_CATCCCCCTTTGATCTTACC R_GGTAAGATCAAAGGGGGATG | EMSA probe |
| Sequence- based reagent | Negative control region | Eurogentec | F_ACACACCTTGAATCCCGT R_CCCAGCTAGAATGAACAAG | qPCR primers for ChIP and ATAC |
| Sequence-based reagent | Hepatic Epo 3’ enhancer | Eurogentec | F_CTGTACCTCACCCCATCTGGTC R_CCCAGCTCACTCAGCACTTGTCC | qPCR primers for ChIP and ATAC |
| Sequence-based reagent | EPO-enh-5’ (1) | Eurogentec | F_GGCAACAGCTGAAATCACCAA R_TCCCAGATCTGATGCCTTGC | qPCR primers for ATAC |
| Sequence-based reagent | EPO-enhHIF (2) | Eurogentec | F_CTGTACCTCACCCCATCTGG R_CAGAGGGGTCAAGAGGTCAG | qPCR primers for ChIP and ATAC |
| Sequence-based reagent | EPO-enhHnf4 (3) | Eurogentec | F_GCAAGGCATCAGATCTGGGA R_AGACAGCCTTGAATGGAGCC | qPCR primers for ChIP and ATAC |
