ARID1A loss in adult hepatocytes activates β-catenin-mediated erythropoietin transcription

  1. Rozenn Riou
  2. Meriem Ladli
  3. Sabine Gerbal-Chaloin
  4. Pascale Bossard
  5. Angélique Gougelet
  6. Cécile Godard
  7. Robin Loesch
  8. Isabelle Lagoutte
  9. Franck Lager
  10. Julien Calderaro
  11. Alexandre Dos Santos
  12. Zhong Wang
  13. Frédérique Verdier
  14. Sabine Colnot  Is a corresponding author
  1. INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), France
  2. Equipe labellisée Ligue Nationale Contre le Cancer, France
  3. INSERM, CNRS, Institut COCHIN, France
  4. INSERM U1183, Université Montpellier, Institute for Regenerative Medicine & Biotherapy (IRMB), France
  5. Plateforme d’Imageries du Vivant de l’Université de Paris, France
  6. INSERM, Université Paris-Est UPEC, France
  7. Department of Pathology, Henri Mondor Hospital, France
  8. INSERM, Paul-Brousse University Hospital, Hepatobiliary Centre, France
  9. Department of Cardiac Surgery Cardiovascular Research Center, University of Michigan, United States


Erythropoietin (EPO) is a key regulator of erythropoiesis. The embryonic liver is the main site of erythropoietin synthesis, after which the kidney takes over. The adult liver retains the ability to express EPO, and we discovered here new players of this transcription, distinct from the classical hypoxia-inducible factor pathway. In mice, genetically invalidated in hepatocytes for the chromatin remodeler Arid1a, and for Apc, the major silencer of Wnt pathway, chromatin was more accessible and histone marks turned into active ones at the Epo downstream enhancer. Activating β-catenin signaling increased binding of Tcf4/β-catenin complex and upregulated its enhancer function. The loss of Arid1a together with β-catenin signaling, resulted in cell-autonomous EPO transcription in mouse and human hepatocytes. In mice with Apc-Arid1a gene invalidations in single hepatocytes, Epo de novo synthesis led to its secretion, to splenic erythropoiesis and to dramatic erythrocytosis. Thus, we identified new hepatic EPO regulation mechanism stimulating erythropoiesis.


Chromatin dynamics strongly modulates gene expression, and the liver is a prominent tissue in which chromatin opening is a pre-pattern for cell fate programming (Zaret, 2016). ARID1A, ‘AT-rich interacting domain containing protein 1A’, is a BAF (BRG1-associated factors) subunit of the highly evolutionarily conserved SWI/SNF chromatin remodeling complexes. These complexes use the energy of ATP hydroxylation to reposition, eject, or exchange nucleosomes and thus modulate DNA accessibility (de la Serna et al., 2006). They are essential for the regulation of gene expression and are involved in several cellular functions, such as differentiation, development, proliferation, DNA repair, and adaptation to the extracellular environment (Kadoch et al., 2016). Recently, mutations in chromatin modifying factors have been identified in several types of cancer (Kadoch et al., 2016).

In the adult mouse liver, Arid1a has been shown to play a role in liver regeneration and in tumorigenesis (Sun et al., 2018; Sun et al., 2016). In human hepatocellular carcinoma (HCC), the most common primary liver cancer (Torre et al., 2016), ARID1A is the chromatin modifier gene the most frequently inactivated (>13% of HCCs). These mutations are preferentially found in HCC with activating mutations of the CTNNB1 gene encoding β-catenin, accounting for one third of HCC (Guichard et al., 2012; Rebouissou et al., 2016). This suggested a potential link between Wnt/β-catenin pathway and ARID1A for the regulation of hepato-specific gene expression programs involved in liver pathophysiology.

In the adult liver, the Wnt/β-catenin pathway can induce both physiological and oncogenic effects (Cavard et al., 2008; Colnot, 2016; Monga, 2015). Such signaling is restricted to the hepatocytes surrounding the central vein, the so-called pericentral hepatocytes, where it is activated by nearby endothelial Wnt and R-Spondin ligands (Planas-Paz et al., 2016; Benhamouche et al., 2006). β-catenin transcriptionnally patterns the liver to ensure its pericentral metabolic functions (Gougelet et al., 2014; Torre et al., 2011). A genetically engineered panlobular activation of the Wnt/β-catenin pathway quickly induced a pericentral-like liver phenotype and hepatomegaly, resulting in mouse death (Benhamouche et al., 2006). Additionally, the focal activation of β-catenin in vivo in single murine hepatocytes is oncogenic, leading to the development of β-catenin-activated liver tumors (Colnot et al., 2004). We used transcriptomic and metabolomic approaches and showed that the genetic program expressed in β-catenin-activated liver is similar to the oncogenic signature found in human HCC harboring activating β-catenin mutations (Gougelet et al., 2014; Gougelet et al., 2019; Senni et al., 2019).

When activated, β-catenin translocates into the nucleus and interacts with its co-factor Tcf4 to bind Wnt-responsive elements (WRE) located in the vicinity of target genes (Gougelet et al., 2014). Chromatin remodeling processes have been shown to unlock chromatin over WREs, allowing β-catenin to dictate specific transcriptomic programs (Mosimann et al., 2009). Given the frequent inactivation of ARID1A in CTNNB1-mutated liver tumors, our aim was to determine in mice whether and how the loss of the chromatin remodeler Arid1a cooperates with β-catenin to impact on mouse liver pathophysiology. We used transgenic murine models in which the main brake of the Wnt/β-catenin pathway, the tumor suppressor Adenomatous polyposis coli (Apc) (Colnot et al., 2004) and/or Arid1a (Gao et al., 2008) are lost in adult hepatocytes. We unexpectedly revealed a novel major function of ARID1A and the Wnt/β-catenin pathway in regulating EPO expression and adult erythropoiesis.


Emergence of peliosis-like regions in the liver of [Apc-Arid1a]ko-focal mice

We investigated the effects of the loss of the chromatin remodeler Arid1a in a context of focal and aberrant β-catenin activation. To do so, we injected transgenic mice carrying Apc and/or Arid1a floxed genes with a low dose of Cre-expressing Adenovirus (AdCre) known to mainly target the liver (Colnot et al., 2004). In Apc-floxed mice, we previously showed that this dose was sufficient to induce β-catenin activation in single hepatocytes and promote tumorigenesis without killing the mice (Colnot et al., 2004). Accordingly, this injection in compound Apc/Arid1a-floxed mice inactivated both Apc and Arid1a genes in approximately 20% of hepatocytes ([Apc-Arid1a]ko-focal mice, Figure 1a, Figure 1—figure supplements 1).

Figure 1 with 4 supplements see all
Development of peliosis-like regions after hepato-specific and focal Arid1a and Apc inactivation.

(a) Cre-loxP-generated hepatocyte-specific and inducible inactivation of Apc and/or Arid1a in 20% of hepatocytes after retro-orbital injection of infectious viral particles (ivp) of adenovirus encoding Cre recombinase (AdCre). The resulting mice are referred to as [Apc-Arid1a]ko-focal, [Apc]ko-focal, and [Arid1a]ko-focal. (b) Gross examination of mouse livers, 7 months after AdCre injection. Livers from [Apc-Arid1a]ko-focal mice had an irregular shape and a rough surface, with multiple dark red zones (indicated by arrows). (c) Incidence of hepatic lesions detected in WT (n = 10) and [Apc-Arid1a]ko-focal (n = 24) mice by ultrasonography. (d) Kaplan-Meier estimated survival curves of WT and [Apc-Arid1a]ko-focal mice over 15 months. n = 6 for each group. Inset: Liver of one mouse at necropsy (13 months after AdCre injection, representative of the three analyzed mice). (e) Hematoxylin Eosin (HE)-stained sections of mouse livers at 7 months post-injection. Large vascular spaces filled with blood cells were observed only in [Apc-Arid1a]ko-focal livers. Related data are found in Figure 1—figure supplements 14, and source data in ‘Figure 1—source data 1; Figure 1—figure supplement 1—source data 1; Figure 1—figure supplement 3—source data 1’.

Surprisingly, an ultrasound follow-up showed the development of striking echogenic features in [Apc-Arid1a]ko-focal mouse livers from 5 months after AdCre injection (Figure 1c, Figure 1—figure supplements 2a). We revealed after dissection that these livers harbored numerous and irregular dark red to black vascular lesions (Figure 1b). After 10 months, all [Apc-Arid1a]ko-focal mice (n = 24) exhibited blood-filled lacunar spaces (Figure 1c), as well as hepatomegaly (Figure 1—figure supplements 1a). We did not however observe such phenotypic abnormalities in the [Apc]ko-focal (n = 13), 18 [Arid1a]ko-focal (n = 18), or control (n = 10) mice studied. [Apc-Arid1a]ko-focal mice exhibited 50% and 100% mortality at 10 and 14 months, respectively (Figure 1d). In dying mice, we discovered that the whole liver was diseased and dark red in color. Indeed, the liver was filled with blood, harboring large necrotic areas with no remaining healthy zones (Figure 1d, inset).

Histologically, the diseased [Apc-Arid1a]ko-focal liver showed abnormal blood vessels that were partially or completely full of red blood cells (RBCs) (Figure 1e, Figure 1—figure supplements 3a), associated with sinusoidal dilatation and liver cell dropout. Additionally, using microbubble-assisted ultrasound, we showed a decrease in hepatic vascular perfusion within echogenic areas, illustrating hence a vascular liver disease (Figure 1—figure supplements 2a). We thus characterized these areas with dramatic histological features as peliosis-like areas, similar to the human vascular disease, peliosis.

In accordance with previous results (Colnot et al., 2004), β-catenin-activated liver tumors developed in 92% of [Apc]ko-focal mice (Figure 1—figure supplements 4a). Here, only 8% of [Apc-Arid1a]ko-focal mice developed liver tumors which were both β-catenin-activated and Arid1a-invalidated (Figure 1—figure supplements 4a-c), suggesting that Arid1a loss suppresses the tumorigenic effect of activated Wnt/β-catenin signaling in the liver. However, this model was not appropriate for assessing the effects of Arid1a loss on Wnt/β-catenin-dependent hepatocarcinogenesis in these mice, given the emergence of peliosis and lethality at a stage preceding or overlapping the expected tumor initiation phase (Figure 1c, Figure 1—figure supplements 4a-c).

We reveal here that β-catenin activation and Arid1a loss cooperate to induce a dramatic hepatic peliosis and lethality in the mouse.

Hepatic loss of both Arid1a and Apc results in erythrocytosis linked to de novo transcription of Epo

We performed transcriptomic microarray analysis of micro-dissected [Apc-Arid1a]ko-focal livers (Figure 2a). Firstly, gene set enrichment analysis (GSEA) revealed transcriptional signatures linked to angiogenesis and the Erythropoietin (EPO) pathway in peliosis-like areas relative to adjacent regions (Figure 2b,c and Figure 2—figure supplements 1). Additionally, these peliosis-like regions showed a Wnt/β-catenin transcriptional signature, revealing enrichment of β-catenin-activated cells within these areas.

Figure 2 with 1 supplement see all
Hepatic peliosis has ‘angiogenic’ and ‘erythropoietin’ transcriptional signatures, linked to a systemic erythrocytosis and to de novo hepatic Epo expression in [Apc-Arid1a]ko-focal mice.

(a) Experimental strategy; (b) Transcriptomic gene-set enrichment analysis (GSEA) of hepatic peliosis (n = 4) relative to adjacent regions (n = 4) of [Apc-Arid1a]ko-focal mice. (c) Quantitative RT-PCR showing relative expression of mRNAs for positive targets of hepatic Wnt/β-catenin pathway and angiogenic factors in hepatic peliosis (n = 10) compared to adjacent regions (n = 10) of [Apc-Arid1a]ko-focal mice (unpaired t test analysis); (d) Hematological parameters from WT (n = 7), [Apc]ko-focal (n = 12), [Arid1a]ko-focal (n = 19), and [Apc-Arid1a]ko-focal (n = 20) mice (One-way ANOVA analysis). (e) Evaluation of erythropoietin (Epo) mRNAs by quantitative RT-PCR in the livers analyzed by the ΔCt technique and expressed relative to those for 18S RNA for the liver, and as relative levels in the kidney (One-way ANOVA analysis). (f) Plasma EPO concentrations at sacrifice (WT (n = 6), [Apc]ko-focal (n = 5), [Arid1a]ko-focal (n = 2), and [Apc-Arid1a]ko-focal (n = 10)). Exact p-values are mentioned, ****p<0.0001. Related data are found in Figure 2—figure supplements 1 and source data in ‘Figure 2—source data 1'.

We then analyzed the hematological parameters and complete blood cell counts from peripheral blood. RBC counts, as well as hematocrit and hemoglobin levels, were significantly higher in [Apc-Arid1a]ko-focal mice than in control or single knockout mice (Figure 2d). This confirmed that blood erythrocytosis corresponded to erythrocyte overload.

The production of RBCs, known as erythropoiesis, is a dynamic process requiring the orchestration of specific molecular mechanisms (Nogueira-Pedro et al., 2016). These include for example the key EPO cytokine, a circulating glycoprotein hormone (Jelkmann, 2007). In mouse embryos, hepatoblasts are the primary source of Epo. In adults, the site of production switches from the liver to the kidney (Weidemann and Johnson, 2009), but the adult liver can still produce Epo (Suzuki, 2015). To determine whether erythrocytosis in [Apc-Arid1a]ko-focal mice could be due to dysregulation of this key hematological regulator, we examined Epo transcript and protein levels within the entire liver and the plasma fraction, respectively. We detected a marked reactivation of Epo expression in [Apc-Arid1a]ko-focal livers, whereas no Epo expression was detected in either single knockout or control livers (Figure 2e). This was associated with distinctly higher Epo protein levels in the plasma of [Apc-Arid1a]ko-focal mice (Figure 2f). We confirmed that plasma Epo derived from the liver as we observed no change in Epo transcription in the kidneys of [Apc-Arid1a]ko-focal mice (Figure 2e). Interestingly, we saw no changes in Epo mRNA levels in human HCC harboring the compound CTNNB1/ARID1A mutations (Figure 1—figure supplements 4d).

Overall, our findings demonstrate that simultaneous Arid1a loss and β-catenin activation in single hepatocytes, occurring in a physiological but non-cancerous context, are responsible for a major hematological disorder that is linked to de novo expression and subsequent secretion of hepatic Epo.

Erythropoiesis is induced in the spleens of [Apc-Arid1a] ko-focal mice

To determine the site of pathological production of the RBCs observed in [Apc-Arid1a]ko-focal mice, we examined the liver, bone marrow (BM), and spleen; these are the three major organs responsible for erythropoiesis during embryogenesis (Suzuki et al., 2011), adult life (Suzuki, 2015), and stress responses in mice (Perry et al., 2009), respectively. Firstly, gross dissection of [Apc-Arid1a]ko-focal mice revealed a marked splenomegaly (Figure 3a,b). Histological sections from [Apc-Arid1a]ko-focal spleens showed prominent expansion of the red pulp with a predominance of erythroblasts relative to control spleens (Figure 3c).

Figure 3 with 1 supplement see all
Erythropoiesis occurs in the spleen of [Apc-Arid1a]ko-focal mice.

(a) Gross morphology of spleens from representative control (WT) and [Apc-Arid1a]ko-focal mice; (b) Spleen/body weight ratio of WT (n = 7), [Apc]ko-focal (n = 11), [Arid1a]ko-focal (n = 11), and [Apc-Arid1a]ko-focal (n = 17) mice (one-way ANOVA). (c) Hematoxylin and Eosin staining of splenic sections. Scale bar is 200 µm. (d,e) FACS analysis of liver NPC, bone marrow, and spleens from control (WT) or [Apc-Arid1a]ko-focal mice using the erythroid markers CD71 and Ter119. (e) FACS quantification from WT (n = 4) and [Apc-Arid1a]ko-focal (n = 4) mice (multiple t-test). (f) Quantification of erythroid progenitors as erythroid colony-forming units (CFU-E) in the presence of EPO, using 2 × 105 cells from bone marrow or 2 × 106 cells from the liver and spleen of WT or [Apc-Arid1a]ko-focal mice (2-way ANOVA). (g) Q-PCR showing relative expression of several factors, known to be involved in stress-induced erythropoiesis, in the spleens of WT (n = 9), [Apc]ko-focal (n = 5), [Arid1a]ko-focal (n = 8), and [Apc-Arid1a]ko-focal (n = 8) mice (one-way ANOVA). ****p<0.0001. Related data are found in Figure 3—figure supplements 1 and source data in ‘Figure 3—source data 1'.

Figure 3—source data 1

Spleen to body weight (Figure 3b), FACS analyses (Figure 3e), CFU-E counts (Figure 3f) and gene expression (Figure 3g).

We additionally quantified erythroid precursors in the liver, BM, and spleen by flow cytometry (corresponding to the TER119+/CD71+ cell population). In [Apc-Arid1a]ko-focal liver non-parenchymal cells (NPCs) relative to controls, there was no difference in TER119+/CD71+ progenitors revealing no intra-hepatic erythropoiesis (Figure 3d,e). However, there was a striking increase in the RBC population (TER119+/CD71-). This liver erythrocytosis was confirmed by immunostaining of the hemoglobin subunit beta (HBB) in liver tissue sections, showing that RBCs, but not erythroblasts, accumulated in these livers (Figure 3—figure supplements 1). In addition, TER119+/CD71+ cell populations were similar in the BM of [Apc-Arid1a]ko-focal and control mice, whereas we found threefold more erythroid precursors in [Apc-Arid1a]ko-focal spleens than in control spleens (Figure 3d,e). This suggested that RBC overproduction came from splenic and not from medullary or hepatic erythroblasts. We then analyzed the ability of erythroid progenitors to expand by in vitro quantification of erythroid colony-forming units (CFU-E) from spleen cells, BM cells, and liver NPCs. We confirmed the presence of erythroid progenitors in the BM and spleens of control mice after 3 days of culture in the presence of EPO, and their absence in control liver NPCs (Figure 3f). After EPO treatment, the spleens of [Apc-Arid1a]ko-focal mice contained 13-fold more CFU-E than control spleens (Figure 3f). This was not the case for the liver or BM. Finally, there were higher mRNA levels of erythropoiesis-related signaling components (Nogueira-Pedro et al., 2016) in the spleens of [Apc-Arid1a]ko-focal mice than those of control or single knockout mice (Figure 3g), including that of the Epo receptor.

Overall, these data show a strong increase in erythropoiesis and erythrocyte progenitors in the spleens of [Apc-Arid1a]ko-focal mice.

Blocking Epo signaling reverses erythrocytosis and splenic erythropoiesis, but maintains liver angiogenesis

We analyzed the role of Epo in the dramatic phenotype of [Apc-Arid1a]ko-focal mice. We used an anti-EPO blocking serum which neutralizes soluble erythropoietin in mice (Mastrogiannaki et al., 2012). Anti-Epo treatment restored the hematocrit level of [Apc-Arid1a]ko-focal mice to that of untreated controls (Figure 4a, Figure 2d), showing a reversal of blood erythrocytosis. We quantified 10-fold less erythroid precursors and a lower mRNA expression of erythropoiesis factors in the spleen of anti-Epo treated [Apc-Arid1a]ko-focal mice compared to untreated mice (Figure 4b–d).

Figure 4 with 1 supplement see all
Blockade of Epo signaling with anti-EPO serum in [Apc-Arid1a]ko-focal mice eliminates aberrant erythropoiesis in the spleen, but maintains angiogenesis in the liver.

(a) Hematocrit before (n = 4) and after (n = 4) anti-EPO treatment (t-test). (b,c) FACS analysis (b) and quantification (c) of spleens with/without anti-EPO (n = 4 for each group) (t-test). (d) RT-qPCR showing relative expression of erythropoiesis factors in the spleens of WT (n = 9), treated [Apc-Arid1a]ko-focal (n = 4), untreated [Apc-Arid1a]ko-focal (n = 8) mice (one-way ANOVA). (e) Hematoxylin Eosin (HE)-stained sections of livers from representative 7-month-old mice. (f,g) FACS analysis (f) and quantification (g) of liver NPC with/without anti-EPO. (h) RT-qPCR showing relative expression of angiogenic factors in the livers with (n = 4) and without (n = 10) anti-EPO (t-test). ****p<0.0001. Related data are found in Figure 4—figure supplements 1 and source data in ‘Figure 4—source data 1'.

Figure 4—source data 1

Hematocrit (Figure 4a), FACS quantifications (Figure 4c, g) and gene expression (Figure 4d, h) after anti-EPO treatment.

EPO is a pleiotropic growth factor which can stimulate vessel growth through an autocrine and/or paracrine loop (Kimáková et al., 2017). We tested the attractive possibility that hepatocyte-secreted Epo in [Apc-Arid1a]ko-focal mouse livers regulates RBC homing to the liver through increased angiogenesis. Liver tissue sections showed that blood vessels contained less RBCs in anti-EPO treated [Apc-Arid1a]ko-focal mice compared to untreated mice (Figure 4e, Figure 4—figure supplements 1), and these livers harbored less TER119+/CD71- mature RBCs (Figure 4f–g). Despite this decrease in intrahepatic RBCs, we did not observe any change in the disruption of the liver vascular architecture as shown by both histological (Figure 4e, Figure 4—figure supplements 1) and gene expression analyses (Figure 4h).

We demonstrate here that high plasma Epo concentration is directly responsible for splenic erythropoiesis and erythrocytosis in [Apc-Arid1a]ko-focal mice. However, this cytokine alone is not responsible for alterations in liver angiogenesis.

Epo is cell-autonomously expressed by β-catenin-activated Arid1a-null hepatocytes in both the mouse and in humans

We investigated whether Epo is expressed by hepatocytes after Apc and/or Arid1a hepato-specific inactivations. We generated Tamoxifen-induced mouse models (Figure 5a) with short-term panlobular gene inactivations (Figure 5b) and Apc loss-induced hepatomegaly (Figure 5—figure supplements 1a) as previously shown (Buenrostro et al., 2015). After diet-based Tamoxifen administration, the Apc and/or Arid1a genes were invalidated in approximately 90% of hepatocytes (Figure 5—figure supplements 1b). There was no gene invalidation in liver NPCs, thus highlighting the high purity of the NPC fraction (Figure 5—figure supplements 2a). We detected Epo mRNA expression only in the hepatocyte compartment and not in NPCs of [Apc-Arid1a]ko-TOTAL livers, whereas a slight decrease of Epo expression was seen in the kidney of [Apc-Arid1a]ko-TOTAL mice (Figure 5c,d).

Figure 5 with 2 supplements see all
Cell-autonomous Epo expression after Arid1a inactivation and Wnt/β-catenin activation in murine and human hepatocytes.

(a) In vivo and ex vivo strategy. WT (n = 8), [Apc]ko-TOTAL (n = 7), [Arid1a]ko-TOTAL (n = 8), and [Apc-Arid1a]ko-TOTAL (n = 10) mice. (b) Inactivation efficiency of Apc and Arid1a genes in isolated hepatocytes. (c,d) RT-qPCR assessment of erythropoietin (Epo) transcription (c) in the hepatocyte and NPC compartments of the livers, (d) in the kidney (1-way ANOVA). (e) In vitro analysis of Axin2, Arid1a (Arid1a floxed-exon detection), and Epo expression by RT-qPCR of mouse hepatocytes after Wnt3a and R-Spondin3 stimulation, and si-Arid1a/si-Control treatments, showing Arid1a knockdown efficiency and Wnt/β-catenin pathway activation, as the mRNA levels of Axin2, a canonical target gene of Wnt signaling, significantly increased (2-way ANOVA). (f) In vitro analysis of Apc, Arid1a, and Epo by RT-qPCR of cryopreserved human hepatocytes after siRNA transfection (one-way ANOVA analysis). Data are presented as the mean ± SEM. ****p<0.0001. Cell culture data are representative of three independent experiments. Related data are found in Figure 5—figure supplements 12, and source data in ‘Figure 5—source data 1; Figure 5—figure supplement 1—source data 1; Figure 5—figure supplement 2—source data 1’.

Figure 5—source data 1

Efficiency of gene invalidation (Figure 5b), and gene expression in vivo and ex vivo (Figure 5c-f) in mice and humans.

To confirm the cell-autonomous expression of Epo in β-catenin-activated Arid1a-null hepatocytes, we performed RNA in situ hybridization for Epo with Axin2 as a marker of β-catenin activation (Figure 6). Epo transcripts were not expressed in the livers, yet were abundant in rare interstitial renal cells of control mice (Figure 6—figure supplements 1a); this localization of Epo in the kidney has already been described (Lacombe et al., 1988). Conversely but as expected, we found Axin2 mRNA transcripts in pericentral hepatocytes (Benhamouche et al., 2006). After Apc and Arid1a gene invalidation, we found a de novo expression of Epo in a subset of Axin2-expressing hepatocytes. In the long-term focal model, this expression was restricted to the areas of peliosis (Figure 6a). In the short-term panlobular model, rare Axin2-expressing hepatocytes also expressed single Epo mRNA transcripts (Figure 6b). In both models, Epo expression was not found elsewhere in the liver.

Figure 6 with 1 supplement see all
In situ hybridization of mRNAs showing a de novo expression of Epo in a subset of β-catenin-activated hepatocytes.

(a) Seven months after Apc/Arid1a gene invalidation in single hepatocytes from two livers (#1 and #2); (b) 7 days after gene invalidation in more than 90% hepatocytes (two livers: #a and #b). Axin2 RNAScope probe stains β-catenin-activated hepatocytes (blue dots), and Epo RNAScope probe stains single Epo mRNAs as red dots. Related data are found in Figure 6—figure supplement 1.

We examined whether Epo expression is specific to the loss of Apc or can be initiated regardless of how Wnt/β-catenin signaling is activated. We successfully activated β-catenin via its Wnt/Spondin ligand in murine primary hepatocytes (Figure 5—figure supplements 2e). We consecutively performed in vivo Arid1a knockout followed by in vitro Wnt/Spondin stimulation, or in vivo Apc loss followed by efficient in vitro siRNA-mediated Arid1a knockdown (si-Arid1a) (Figure 5—figure supplements 2f). Epo expression significantly increased in these conditions (Figure 5e, Figure 5—figure supplements 2b, c). Mutational activation of β-catenin coupled with si-Arid1a also led to the induction of Epo expression in the β-catenin-mutated HEPA1.6 murine hepatoma-derived cell line (Figure 5—figure supplements 2d).

We assessed the conservation of EPO regulation from mouse to humans. We found that EPO mRNA expression was also regulated by both the chromatin remodeler ARID1A and the Wnt/β-catenin signaling pathway in primary human hepatocytes after siRNA-mediated ARID1A and APC downregulation (Figure 5f).

Overall, these in vivo and in vitro findings strongly demonstrate a conserved and cell-autonomous role of Wnt/β-catenin activation and Arid1a loss in hepatic Epo expression. This occurs as a stochastic transcriptional event in β-catenin-activated Arid1a-null hepatocytes.

Wnt/β-catenin pathway control of 3’ Epo enhancer activity is hypoxia- and HIF-independent

We questioned if β-catenin directly controls Epo transcription through cis-regulatory sequences. We previously performed ChIP-Seq experiments to assess Tcf4/β-catenin occupancy in the chromatin of hepatocytes isolated from [Apc]ko-TOTALversus [β-catenin]ko-TOTAL murine models (Gougelet et al., 2014). The only DNA region bound by Tcf4 in the vicinity of the Epo gene was its 3’enhancer (Epo-3’E), known to be involved in Epo transcription in the embryonic liver, as well as the known Hif- (HIF-REs) and Hnf4-containing responses elements (HREs) (Suzuki et al., 2011; Semenza et al., 1991; Figure 7a). This Tcf4 binding was at the same location as HRE binding, and was stronger in activated β-catenin than in β-catenin-null hepatocytes (Figure 7a). We demonstrated from ENCODE data that H3K27Ac, a histone mark indicating active promoters or enhancers, also bound to this region; this binding was present in mouse liver chromatin at E14.5, an embryonic stage in which the Epo gene is actively transcribed (Figure 7a). However, Epo was only partially present in the livers of eight-week-old mice, with no Epo transcription, and completely absent in the adult small intestine, a tissue known not to transcribe the Epo gene (Figure 7a).

Figure 7 with 2 supplements see all
Wnt/β-catenin directly controls EPO expression through 3’ Epo enhancer, in a HIF-independent manner.

(a) Genomic environment of the Epo gene (UCSC Genome Browser, mm9 database) and ChIP-seq peaks at the 3’ Epo enhancer. In blue/red: the crude reads of ChIP-Seq data performed in adult livers against HNF-4a (54). In black: ChIP-Seq under Apcko or βcatko conditions with an antibody against TCF4 (16). In yellow: ENCODE data of H3K27Ac marks in eight-week-old and E14.5 embryonic livers (Histone Mods by ChIP-Seq from ENCODE/LICR). (b) Schematic representation of the EpoE-Luc erythropoietin luciferase reporter, driven by the 3’ enhancer. (c–e) Luciferase reporter assays in mouse primary hepatocytes: (c) after in vitro overactivation of Wnt/β-catenin signaling and Arid1a knockdown (d) after in vivo Cre-loxP-mediated gene inactivation; (e) Effect of hypoxic-mimic conditions using desferrioxamine (DFO), and effect of knockdown of HIF factors (two separate experiments carried out in triplicate). Results are in relative light units, and analyzed using 1-way (d) or 2-way ANOVA (c,e). ****p<0.0001. Related data are found in Figure 7—figure supplements 12, and source data in ‘Figure 7—source data 1; Figure 7—figure supplement 1—source data 1; Figure 7—figure supplement 2—source data 1’.

We thus tested whether Wnt/β-catenin signaling directly activates hepatic Epo transcription through the Epo-3’E. We transfected a luciferase reporter (pEpoE-luc) containing the HIF and HNF4-binding sites into primary mouse hepatocytes (Figure 7b). After Wnt/Spondin stimulation, and regardless of si-Arid1a treatment, Epo enhancer activity was five- to eight-fold higher (Figure 7c,d). Hence, in this in vitro reporter assay context, β-catenin signaling increases Epo-3’E activity and it is independent of the chromatin landscape.

Hypoxia-inducible factor (HIF) signaling is the master pathway regulating EPO transcription and Hif2α has a prominent role in hepatic Epo transcription (Mastrogiannaki et al., 2012). We investigated Hif2α involvement in β-catenin/Arid1a-dependent Epo expression. In vivo, we did not detect hypoxia or Hif1α/Hif2α accumulation in the absence of Apc and/or Arid1a in mouse livers (Figure 7—figure supplements 1a-c). A small subset of Hif1α/Hif2α targets, such as Eno2, Car9, and Rab42, was slightly overexpressed in both [Apc]ko and [Apc-Arid1a]ko livers, confirming that β-catenin and HIF signaling share some transcriptional targets (Figure 7—figure supplements 1d-e; Benhamouche et al., 2006). As expected, the hypoxia-mimetic agent desferrioxamine (DFO) markedly potentiated luciferase activity in pEpoE-luc-transfected hepatocytes, whereas efficient knockdown of both Hif1α or Hif2α (Figure 7—figure supplements 2) resulted in a significant decrease (Figure 7e). Interestingly, knockdown of HIFs, either alone or combined, did not reduce Epo-3’E induction by β-catenin signaling in hepatocytes, whether Apc be inactivated alone or in combination with Arid1a (Figure 7e).

In all, the Wnt/β-catenin pathway controls erythropoietin expression in hepatocytes through the 3’ Epo enhancer in a hypoxia- and HIF-independent manner.

Both β-catenin signaling and Arid1a are key players in chromatin remodeling, histone recruitment, and Tcf4 binding on the hepatic Epo enhancer

We previously showed similarities between HREs and WREs, and that Tcf4 can bind HREs and thereby participate in β-catenin-dependent transcription (Gougelet et al., 2014). Here, we found that Tcf4 bound DNA on the HRE region of the Epo-3’E in which there is no classical WRE. Indeed, by electrophoretic mobility shift assay (EMSA), we showed that Tcf4 weakly bound the Epo-3’E HRE (thereafter called DR2) in control liver nuclear extracts (Figure 8a). In [Apc]ko-TOTAL liver extracts, the nuclear translocation of β-catenin led to a stronger binding represented by a supershift (Figure 8a,b). This indicates that the Tcf4/β-catenin complex binds this DR2 motif, as well as a classical WRE shown by competitive EMSA (Figure 8b,c). These findings highlighted that Tcf4 binds to the HRE of the Epo enhancer and that activation of β-catenin increases this interaction.

Figure 8 with 2 supplements see all
β-catenin/Tcf4 complex binds to the HNF4-responsive element of Epo enhancer (Epo-HRE) after modifications of histone marks and chromatin accessibility.

(a) EMSA using nuclear proteic extracts from WT or [Apc]ko-TOTAL livers and 32P-labeled probes containing Epo-HRE (DR2). (b, c) Competitive EMSA using 32P-labeled DR2 (b) and 32P-labeled WRE (c) probes and increasing concentrations of cold probes containing HNF4, WRE or control-responsive element. WRE cold probes compete with radiolabeled DR2 motif for the Tcf4/β-catenin binding and vice versa. (d, e) Chromatin ImmunoPrecipitation (ChIP) assays of hepatocytes from WT, [Apc]ko-TOTAL, [Arid1a]ko-TOTAL, and [Apc-Arid1a]ko-TOTAL livers. ChIP-qPCR against IgG, Tcf4, Acetylation of Histone3 in Lysine27 (H3K27Ac), and Tri-methylation of Histone3 in Lysine27 (H3K27me3) for Axin2 (d) and Epo (e) enhancer regions. WT (n = 3), [Apc]ko-TOTAL (n = 2), [Arid1a]ko-TOTAL (n = 2), and [Apc-Arid1a]ko-TOTAL (n = 3) mice. Enrichment by ChIP was assessed relative to the input DNA and normalized to the level of negative controls. (f) ATAC-qPCR using frozen livers from WT (n = 7), [Apc]ko-TOTAL (n = 7), [Arid1a]ko-TOTAL (n = 6), and [Apc-Arid1a]ko-TOTAL (n = 7) mice. Data are analyzed with one-way ANOVA. ****p<0.0001. Related data are found in Figure 8—figure supplements 12, and source data in ‘Figure 8—source data 1; Figure 8—figure supplement 2—source data 1; Figure 8—figure supplement 2—source data 1’.

Endogenous hepatic Epo was expressed de novo after both Wnt/β-catenin activation and Arid1a knockout, but gene expression of classical β-catenin target genes (Glul, Axin2) was not affected by Arid1a status (Figure 8—figure supplements 1). We thus characterized Tcf4 binding, chromatin accessibility, and histone active (H3K27Ac) or repressive (H3K27Me3) marks of the Epo enhancer, the Axin2 intronic enhancer, and the Glul promoter in hepatocytes isolated from transgenic mouse livers.

As previously described (Gougelet et al., 2014), Tcf4 efficiently bound to the Axin2 intronic enhancer in vivo and this increased when β-catenin signaling was activated (Figure 8d). This was correlated with a partial removal of the repressive H3K27Me3 mark (Figure 8d) and an increase in chromatin accessibility revealed by ATAC-qPCR analysis (Figure 8f). Co-inactivation of Arid1a and Apc decreased chromatin accessibility on this enhancer and induced a H3K27me3 repressive histone mark. A similar chromatin accessibility profile was seen for the Glul promoter. Tcf4 bound in vivo to the Epo enhancer, and this binding was slightly higher in [Apc]ko-TOTAL and much higher in [Apc-Arid1a]ko-TOTAL hepatocytes versus controls (Figure 8e). After Apc loss, the H3K27me3 repressive mark slightly decreased on Epo enhancer and chromatin was more accessible (Figure 8f, Figure 8—figure supplements 1b). In contrast, the loss of Arid1a strongly decreased the H3K27Me3 repressive mark without modifying chromatin access. In [Apc-Arid1a]ko-TOTAL hepatocytes, the H3K27Ac active histone mark was induced while chromatin accessibility was lower compared to single knockout hepatocytes.

These data show that nuclear β-catenin favors Tcf4 binding on the Epo enhancer, increasing its chromatin accessibility, whereas Arid1a loss rather disrupts the H3K27me3 histone repressive mark. Both these changes increase the H3K27Ac enhancer mark and promote hepatic Epo transcription (Figure 9).

Schematic model of the role of Arid1a in hepatic Epo expression linked to overactivation of the Wnt/β-catenin pathway.

Under physiological conditions, the presence of Arid1a is associated with histone repressive marks at the Epo enhancer and β-catenin is constantly degraded; thus, Epo is not produced. In the absence of Apc, β-catenin/Tcf4 complex binds the Epo enhancer, and enhances chromatin accessibility, but the histone marks remain repressive. The loss of Arid1a increases active histone marks, which is insufficient to induce Epo transcription. After both Wnt/β-catenin activation and Arid1a inactivation, active histone marks and binding of β-catenin/Tcf4 to the Epo enhancer drive Epo liver transcription, and subsequent secretion of Epo into the bloodstream, resulting in splenic erythropoiesis and in substantial blood and liver erythrocytosis.


Our study shows that the Arid1a-dependent epigenetic landscape in the adult liver is a potent brake for transcription of EPO, a new key β-catenin target (Figure 9). Consequently, Arid1a loss in the context of β-catenin activation leads to Epo-dependent erythropoiesis in the spleen, erythrocytosis in the blood and liver, and to increased but defective angiogenesis, generating ‘peliosis’.

Liver peliosis is a misunderstood human vascular disease, with non-specific features of impaired blood inflow and/or systemic inflammatory response (Valla and Cazals-Hatem, 2018). The dramatic phenotype we observed here is distinct from other existing murine models of liver-induced hypoxia with equivalent non-lethal erythrocytosis (Minamishima and Kaelin, 2010; Ruschitzka et al., 2000; Takeda et al., 2008). Using an anti-Epo blocking strategy, we could explain this discrepancy: our phenotypic observations were attributable to not only Epo-dependent erythrocytosis, as restricting plasma Epo rescued the erythrocytosis phenotype, but also to Epo-independent aberrant angiogenesis, a hallmark of liver peliosis (Valla and Cazals-Hatem, 2018).

We describe emerging roles for ARID1A and β-catenin signalings in Epo transcription. Until now, the major known regulator of both renal and hepatic Epo transcription was hypoxia-inducible factor signaling, acting via EPO’s 3’ enhancer (Epo-3’E) in the embryonic liver or anemic/hypoxic adult liver. We demonstrated that Tcf4/β-catenin bound the Hnf4-Responsive Element (Hnf4-RE) in the Epo-3’E and that the enhancer activity is independent of HIF in this context, contrary to what is reported in colorectal cancer cell lines, in which transcriptional cooperation between HIF and β-catenin occurs in hypoxia adaptation (Kaidi et al., 2007).

The consequences of this HIF signaling-independent Epo regulation is significant for the genetic engineering of EPO for therapeutic purposes. In anemia, a major complication of chronic kidney disease, HIF stabilizers are currently used to restore circulating EPO levels. The long-term safety of this strategy is hindered by the lack of targeting specificity (Kular and Macdougall, 2019). The use of cell transcriptional machinery to produce therapeutic levels of EPO has been put forward to overcome the side effects associated with HIF stabilizers. The EPO-producing cells of the adult kidney are potential candidates, but anemic patients have damaged kidneys. Based on our results, here we can propose an alternative involving the restoration of the ability of hepatocytes to synthetize EPO, independently of hypoxia, by targeting Wnt/β-catenin and ARID1A signaling in the liver.

Our demonstration that Arid1a inactivation is required in Epo transcription opposes previously described roles of chromatin remodeling complexes in hepatic regulation of Epo (Wang et al., 2004; Sena et al., 2013). However, firstly these studies analyzed hypoxia-dependent Epo regulation which is distinct from our study; we firmly established that the β-catenin-dependent control of Epo transcription depends on Arid1a loss, is Hif-independent, and occurs in a normoxic adult liver. Secondly, these studies focused on BRG1/BRM ATPases, essential core subunits of both the BAF and pBAF complexes. The loss of Arid1a, a facultative component of the BAF complex, does not disrupt BAF complex functionality as Arid1b is known to compensate for Arid1a loss. This highlights a specific role for Arid1a in transcriptional repression through the modulation of chromatin accessibility to transcription factors at their target DNA sequences (Sun et al., 2016; Nagl et al., 2005). We show increased binding of the Tcf4/β-catenin complex to Epo-3’E Hnf4-RE is Arid1a-dependent and Arid1a loss decreases the H3K27me3 repressive mark. That could be due to the intricate balance existing between the Polycomb complex PRC2 and the SWI/SNF complex (Kadoch et al., 2016). Accordingly, the inhibition of the Polycomb EZH2 subunit is synthetically lethal in ARID1A-mutated tumors (Bitler et al., 2015; Alldredge and Eskander, 2017). Therefore, Arid1a and the Polycomb complex could act in concert to modulate Epo gene expression in the liver.

We illustrate that Arid1a loss renders the liver Epo-inducible element more accessible to Tcf4, and even more so to β-catenin. Contrary to the paradigm that Tcf4 binds its DNA targets regardless of β-catenin activation status, we previously reported that Tcf4 DNA-binding was stronger in the presence of nuclear β-catenin in the liver (Gougelet et al., 2014). More broadly, numerous interactions between chromatin remodeling and Wnt/β-catenin signaling have already been described (Barker et al., 2001; Eckey et al., 2012; Mathur et al., 2017; Song et al., 2009; Yan et al., 2014; Zhai et al., 2016) and can explain the impact of β-catenin signaling on chromatin accessibility at the Epo enhancer. Single-RNA in situ hybridization revealed that Epo gene expression only occurs in rare hepatocytes, emphasizing the complexity of Epo liver transcription in the liver. This contributes to previous studies using single-RNA in situ hybridization, showing that transcription in the liver is gene-dependent, and is either bursty and dynamic or stable (Bahar Halpern et al., 2015).

We found here that the loss of Arid1a does not change the transcription of hepatic canonical Wnt/β-catenin target genes. As for Epo, it could potentially unmask new chromatin-dependent β-catenin target genes. Among these new Arid1a/β-catenin target genes are those involved in liver angiogenesis. In the near future, genome-wide studies will be required to firmly identify these genes, combining the analysis of transcriptome, chromatin accessibility (ATAC-Seq), histone mark, β-catenin and Arid1a cistromes (ChIP-Seq) in liver chromatin from Arid1a-null and β-catenin-activated hepatocytes.

The initial aim of our study was to better elucidate oncogenic cooperation in liver carcinogenesis. In our in vivo experimental models reported here, the loss of Arid1a protects against β-catenin-dependent carcinogenesis. However, these results were not fully exploitable due to the deleterious effect of the dramatic hematological disorder developed by the mice. New mouse models are therefore required for further investigation of the oncogenic role of Arid1a in liver carcinogenesis. In turn, confirmation of such a role would corroborate a recent study showing that hepatic Arid1a can harbor either a tumor suppressor or oncogenic role depending on the cellular context (Sun et al., 2018). An additional study also demonstrated that Arid1a is protumoral rather than a tumor suppressor in colorectal cancer with Apc mutations (Mathur et al., 2017).

Lastly, some liver cancer studies have identified pathological erythrocytosis and/or hepatic vascular lesions, potentially with EPO production and peliosis. However, the molecular mechanisms underlying these pathological observations are still poorly understood (Matsuyama et al., 2000; Bunn, 2013; Ke et al., 2017; Hoshimoto et al., 2009; Tsuchiya et al., 2009; Vik et al., 2009). Our study contributes molecular clues by indicating that this is not linked to CTNNB1/ARID1A mutations, but more likely attributed to the hypoxia frequently found in cancers. Future studies should use mouse models and data from patients with HCC to address the specific transcriptional output of CTNNB1/ARID1A-mutated liver tumors.

Materials and methods

Key resources table
(species) or
DesignationSource or
Gene (Mus musculus)EpoGenBankNM_007942.2Erythropoietin
Gene (Mus musculus)Arid1aGenBankNM_001080819.2Arid1a
Gene (Mus musculus)Ctnnb1GenBankNM_007614.3Beta-catenin
Gene (Mus musculus)ApcGenBankNM_001360980.1Adenomatous polyposis coli
Strain, strain background (Mus musculus)Arid1a-loxFrom Z. Wang’s labArid1atm1.1Zhwa/J
Strain, strain background (Mus musculus)Apc-loxFrom Perret-Colnot’s labApctm2.1Cip
Strain, strain background (Mus musculus)Ttr-Cre-TamFrom Perret-Colnot’s labTg(Ttr-cre/Esr1*)1Vco
Genetic reagent (Adenovirus 5)Ad-CreUniversité de Nantes, FranceAd5-CAG-Cre
Cell line (Mus musculus)Mouse hepatomaFrom Christine Perret’s labHepa 1-6 [Hepa1-6] (ATCC CRL-1830)For transfection experiments
Antibodyanti-Arid1a (Rabbit monoclonal)AbcamCat# 182560
IHC(1:1000), WB (1:2000)
Antibodyanti-Glul (GS) (Mouse monoclonal)BD BiosciencesCat# 610518, RRID:AB_397880IHC(1:400), WB (1:5000)
Antibodyanti-HBB (Mouse monoclonal)ProteintechCat# 16216–1-AP, RRID:AB_10598329IHC(1:200), WB (1:2000)
Antibodyanti-HIF1α (Rabbit polyclonal)NovusCat# NB100-449, RRID:AB_10001045WB nuclear extract (1:500)
Antibodyanti-HIF2α (Rabbit polyclonal)NovusCat# NB100-122, RRID:AB_10002593WB nuclear extract (1:500)
AntibodyAnti-Tcf4 (Tcf7l2) (Mouse monoclonal)MilliporeCat# 05–511, RRID:AB_309772ChIP: 3 μg
AntibodyAnti-H3K27Ac (Rabbit polyclonal)Active MotifCat# 39133, RRID:AB_2561016ChIP: 3 μg
AntibodyAnti-H3K27me3 (Rabbit polyclonal)Active MotifCat# 39155, RRID:AB_2561020ChIP: 3 μg
AntibodyIgG (Mouse)Thermo Fisher ScientificCat# 10400C, RRID:AB_2532980ChIP: 3 μg
AntibodyAnti-CD71-FITC (Rat monoclonal)BD BiosciencesCat# 553266, RRID:AB_394743FACS (1:100)
AntibodyAnti-Ter119-PE (rat monoclonal)BD BiosciencesCat# 553673, RRID:AB_394986FACS (1:100)
AntibodyAnti-β-actin (mouse monoclonal)Sigma-AldrichCat# A5441, RRID:AB_476744WB (1:10000)
AntibodyAnti-lamin A/C (rabbit polyclonal)Cell Signaling TechnologyCat# 2032, RRID:AB_2136278WB nuclear extract (1:500)
AntibodyIgG, HRP-conjugated (horse, anti-mouse)Cell Signaling TechnologyCat# 7076, RRID:AB_330924WB (1:2000)
AntibodyIgG, HRP-conjugated (goat, anti-rabbit)Cell Signaling TechnologyCat# 7074, RRID:AB_2099233WB (1:2000)
AntibodyIgG, biotinylated (goat, anti-rabbit)Vector labCat# BA-1000, RRID:AB_2313606IHC (1:200)
Commercial assay or kitMOM mouse on mouseVector LaboratoriesCat# BMK-2202, RRID:AB_2336833Kit
Sequence-based reagent18SThermo Fisher ScientificTaqman Assay 4308329qPCR primers
Sequence-based reagentGlulThermo Fisher ScientificTaqman Assay Mm00725701_siqPCR primers
Mus musculus
Sequence-based reagentAxin2Thermo Fisher ScientificTaqman Assay Mm00443610_m1qPCR primers Mus musculus
Sequence-based reagentArid1a (total)Thermo Fisher ScientificTaqman Assay Mm00473838_m1qPCR primers Mus musculus
Sequence-based reagentArid1a (not excised by Cre)Thermo Fisher ScientificTaqman Assay Mm00473841_m1qPCR primers Mus musculus
Sequence-based reagentApc (total)Thermo Fisher ScientificTaqman Assay Mm00545877_m1qPCR primers Mus musculus
Sequence-based reagentApc (not excised by Cre)Thermo Fisher ScientificTaqman Assay Mm01130462_m1qPCR primers Mus musculus
Sequence-based reagentEpoThermo Fisher ScientificTaqman Assay Mm01202755_m1qPCR primers Mus musculus
based reagent
SybrGreen qPCR primers
Sequence-based reagentAngiopoietin-like 2 (Angptl2)EurogentecF_CCGCAACATGAACTCGAGAG
SybrGreen qPCR primers Mus musculus
Sequence-based reagentCarbonic anhydrase 9 (Car9)EurogentecF_GACCTCGTGATTCTCGGCTA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentCyclin D1 (Ccnd1)EurogentecF_AGAAGTGCGAAGAGGAGGTC
SybrGreen qPCR primers Mus musculus
Sequence-based reagentEnolase 2, gamma neuronal (Eno2)EurogentecF_TGGATTTCAAGTCTCCCGCT
SybrGreen qPCR primers Mus musculus
Sequence-based reagentErythropoietin receptor (Epo-r)EurogentecF_ATGACTTTCGTGACTCACCCT
SybrGreen qPCR primers Mus musculus
Sequence-based reagentFMS-like tyrosine kinase 1 (Flt1)EurogentecF_AGAGGAGGATGAGGGTGTCT
SybrGreen qPCR primers Mus musculus
Sequence-based reagentGATA binding protein 1 (Gata1)EurogentecF_TTCCCACTACTGCTGCTACC
SybrGreen qPCR primers Mus musculus
Sequence-based reagentGATA binding protein 2 (Gata2)EurogentecF_GCCGGTTCTGTCCATTCATC
SybrGreen qPCR primers Mus musculus
Sequence-based reagentInhibin beta-B (Inhbb)EurogentecF_GTACCTGAAACTGCTCCCCT
SybrGreen qPCR primers Mus musculus
Sequence-based reagentPotassium channel tetramer domain contain. 11 (Kctd11)EurogentecF_TGACTTCTACCAGATCCGGC
SybrGreen qPCR primers Mus musculus
based reagent
Kinase insert domain protein receptor (Kdr)EurogentecF_AGAAGATGCCCATGACCCAA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentNuclear factor, erythroid derived 2 (Nfe2)EurogentecF_GATGTCCCGAACTAGAGCCA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentPlatelet derived growth factor receptor, alpha polypeptide (Pdgfra)EurogentecF_ACAGCTCACAGACTTCGGAA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentPhosphoglycerate kinase 1 (Pgk1)EurogentecF_TGGCACCAGGAACCCTTAAA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentPlacenta-specific 8 (Plac8)EurogentecF_TGATTGCTTCAGTGACTGCG
SybrGreen qPCR primers Mus musculus
Sequence-based reagentProtein tyrosine phosphatase, receptor type, B (Ptprb)EurogentecF_TGGACCCTGGGATCTAAGGA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentMember RAS oncogene family (Rab42)EurogentecF_GGCGTTCTGTTGGTCTTTGA
SybrGreen qPCR primers Mus musculus
Sequence-based reagentVascular endothelial growth factor A (Vegfa)EurogentecF_GCTGTAACGATGAAGCCCTG
SybrGreen qPCR primers Mus musculus
Sequence-based reagentZinc finger protein, multitype 1 (Zfpm1)EurogentecF_CCTTGAGATGGCGTTCACAG
SybrGreen qPCR primers Mus musculus
Sequence-based reagentAT-rich interaction domain 1A (ARID1A)EurogentecF_AAGCCACCAACTCCAGCATCCA
SybrGreen qPCR primers (Homo sapiens)
Sequence-based reagentAdenomatous polyposis coli (APC)EurogentecF_CACACTTCCAACTTCTCGCAACG
SybrGreen qPCR primers (Homo sapiens)
Sequence-based reagentErythropoietin (EPO)EurogentecF_GCATGTGGATAAAGCCGTCAGTG
SybrGreen qPCR primers (Homo sapiens)
Sequence-based reagentDOS7-binding site (Control)EurogentecF_GGGGTAGGAACCAATGAAA
EMSA probe Mus musculus
Sequence-based reagentHNF4-responsive element (DR2)EurogentecF_GCCCGGCTGACCTCTTGACCCCTCTGGGCTTGAG
EMSA probe Mus musculus
Sequence-based reagentWnt-reponsive elementEurogentecF_CATCCCCCTTTGATCTTACC
EMSA probe
based reagent
Negative control regionEurogentecF_ACACACCTTGAATCCCGT
qPCR primers for ChIP and ATAC
Sequence-based reagentHepatic Epo 3’ enhancerEurogentecF_CTGTACCTCACCCCATCTGGTC
qPCR primers for ChIP and ATAC
Sequence-based reagentEPO-enh-5’ (1)EurogentecF_GGCAACAGCTGAAATCACCAA
qPCR primers for ATAC
Sequence-based reagentEPO-enhHIF (2)EurogentecF_CTGTACCTCACCCCATCTGG
qPCR primers for ChIP and ATAC
Sequence-based reagentEPO-enhHnf4 (3)EurogentecF_GCAAGGCATCAGATCTGGGA
qPCR primers for ChIP and ATAC


Mice carrying two floxed alleles in the 14th exon of the Apc gene (generated in our laboratory [Colnot et al., 2004]) or the 8th exon of the Arid1a gene (created by the Zhong Wang laboratory [Gao et al., 2008]),were interbred with TTR-CreTam mice (Tannour-Louet et al., 2002), resulting in Apcflox/+/TTR-CreTam or Arid1aflox/+/TTR-CreTam mice. For focal genetic inactivation, 8-week-old Apcflox/flox and Arid1aflox/flox male mice were injected intravenously with 0.5 × 109 infectious particles of Ad5-CAG-cre (AdCre) adenovirus as described (Colnot et al., 2004). Mice with hepato-specific and AdCre-mediated inactivation of Apc and/or Arid1a in single hepatocytes are referred to as [Apc-Arid1a]ko-focal, [Apc]ko-focal, and [Arid1a]ko-focal mice. The development of tumors and peliosis were followed monthly by 2D-ultrasound (Vevo 770, Visualsonics). For panlobular genetic inactivation, 8-week-old Apcflox/flox/Ttr-CreTam and Arid1aflox/flox/Ttr-CreTammale mice were given a tamoxifen diet (M-Z, low phytoestrogen +1000 mg/kg TAM citrate, SSNIFF, Soest, Germany) for 4 days. These mice are referred to as [Apc-Arid1a]ko-TOTAL, [Apc]ko-TOTAL, and [Arid1a]ko-TOTAL mice.

Mice were housed under conventional conditions and all reported animal procedures were carried out according to French government regulations (Ethics Committee of Descartes University, Paris). The animal welfare assurance number is APAFIS#14472.

Immunohistochemistry and in situ hybridization experiments

Request a detailed protocol

After sacrifice, livers were harvested, fixed overnight in 4% formalin buffer, and embedded in paraffin. FFPE liver sections were treated as previously described for immunocytochemistry and HE stainings (de La Coste et al., 1998). Antibodies used are listed in the Key Resources Table.

RNA in situ hybridization was done on freshly cut 7 μm FFPE liver or kidney sections using the RNAScope 2.5 HD Duplex Kit, with HybEZ II hybridization system, following the manufacturer’s instructions (Advanced Cell Diagnostics). The following RNAscope probes were used: Epo (Mm-Epo-C2, Cat. 315501-C2, NM_007942.2, region 39–685), Axin2 (Mm-Axin2, Cat. 400331, NM_015732.4, region 330–1287), DapB (negative control, Cat. 320751, CP015375.1, region 2252107–2252555), Polr2a (positive control, Mm-Polr2a, Cat. 320761, NM_001291068.1, region 3212–4088).

Hematological analysis and red blood cell counts

Request a detailed protocol

Hematological parameters were measured using a CoulterMAXM automatic analyzer (Beckman Coulter) as previously described (Mastrogiannaki et al., 2009).

Plasma collection and ELISA for erythropoietin

Request a detailed protocol

At sacrifice, peripheral blood was collected from the inferior vena cava with a heparinized needle (Sigma Aldrich – H3393-50KU). Plasma samples were stored at −80°C. Plasma EPO protein levels were determined using a Quantikine mouse EPO enzyme-linked immunosorbent assay kit (R and D systems – MEP00B), according to the manufacturer’s instructions.

Treatment with anti-erythropoietin blocking serum

Request a detailed protocol

One-year-old [Apc-Arid1a]ko-focal and control mice were injected with anti-erythropoietin rabbit serum, as previously described (Mastrogiannaki et al., 2012), with minor modifications: injections were performed for 7 consecutive days and mice were sacrificed 18 hr after the last injection. The dose injected was described as able to neutralize a 10-fold excess of circulating erythropoietin (Mastrogiannaki et al., 2012). At sacrifice, liver and spleen were collected for immunochemistry and cytometry analysis.

Hepatocyte isolation and cell culture

Request a detailed protocol

Livers from 3-month-old mice were perfused 7 days after the beginning of the tamoxifen diet (1000 mg/kg) with collagenase. The liver cell suspension was collected, and hepatocytes were separated from NPCs by centrifugation for 2 min at 48 g as previously described (Anson et al., 2012). The supernatant containing the NPCs was collected and centrifuged for 10 min at 440 g. Hepatocytes were plated as previously described (Gougelet et al., 2014; Torre et al., 2011; Guidotti et al., 2003). Hepa1-6 hepatoma cell line was a gift from C. Perret's lab, authenticated by its CTNNB1 mutation, assessed by Sanger sequencing. It was tested negative for mycoplasma contamination. Cells were plated at 3 × 105 cells per well, in six-well plates, in DMEM solution supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin and fungizone.

Cryopreserved human hepatocytes were obtained from Triangle Research Laboratory (Lonza). They were seeded at confluency (2.1 105 cell/cm²) and cultured in a humidified 5% CO2 atmosphere at 37°C in hepatocyte growth medium (HGM: WME medium supplemented with 5 µg/ml insulin, 0.1 µM hydrocortisone, 10 µg/ml transferrin, 250 µg/ml ascorbic acid, 3.75 mg/ml fatty-acid-free bovine serum albumin, 2 mM glutamine, penicillin and streptomycin).

Cell transfection, stimulation, and luciferase assays

Request a detailed protocol

Primary murine hepatocytes were transfected with 20 nM small-interfering RNA (siRNA) directed against Arid1a (Qiagen SI00230405) or control siRNA (Dharmacon D-001210-01-05) in the presence of Lipofectamine 2000 (Thermo Fisher Scientific). The next day, cells were stimulated, or not, with 100 ng/ml recombinant mouse Wnt3a (1324-WN) and 100 ng/ml recombinant mouse R-Spondin 3 Protein (4120-RS) (R and D Systems). Molecular analyses were performed 48 hr after transfection or stimulation.

HEPA 1.6 cells were transfected for 24 and 48 hr with 20 nM siRNA directed against Arid1a or β-catenin (QiagenSI00942039) or control siRNA. Molecular analyses were performed 72 hr after the first transfection.

Adherent primary human hepatocytes were transfected with 20 nM non-targeting siRNA or siRNAs specific for APC (Dharmacon, Lafayette, CO) or ARID1A (Qiagen 1027416) at day 1 and day 3 after seeding, using Lipofectamine RNAiMAX (Life Technologies, Carlsbad, CA).

For luciferase assay, primary mouse hepatocytes were transfected using Lipofectamine 2000 (ThermoFisher Scientific) with 1 μg of a luciferase reporter driven by erythropoietin 3’ enhancer region (Epo-3’E, 50 nucleotides) (Huang et al., 1996), and/or 500 ng of a Renilla vector (Promega, Madison, WI). Luciferase activity was measured 48 hr after transfection with the Dual-Luc kit, according to manufacturer’s protocols (Promega).

Isolation of peliosis-like areas from paraffin-embedded (FFPE) tissue sections and Affymetrix microarrays

Request a detailed protocol

Healthy and peliosis-like areas were isolated from 15 to 20 paraffin sections (10 µm) using a small needle under a binocular magnifying glass. After deparaffinization, FFPE tissues were lysed for 24 hr in tissue lysis with proteinase K (Qiagen) at 60°C. Microarray transcriptomic analysis from paraffin-embedded (FFPE) tissue sections was performed on the MTA-31461 chip. Gene set enrichment analysis (GSEA) was performed using the Java tool application available at the Broad Institute (Cambridge, MA, USA). The analysis was performed using Hallmark gene data sets.

RNA extraction and quantitative RT-PCR

Request a detailed protocol

Total RNA was extracted with Trizol reagent (Thermo Fisher Scientific) as previously described (Gougelet et al., 2016). Reverse transcription was performed from 100 ng RNA with a cDNA synthesis kit from Thermo Scientific (K1642). The Taqman assays (Thermo Fisher Scientific) and the sequences of PCR primers (Eurogentec) for SybrGreen assays are described in the Key Resources Table. qPCR was performed in duplicate on a LightCycler480 apparatus and the results, analyzed by the ΔΔCt technique, expressed relative to those for 18S RNA.

Calculation of gene inactivation efficiencies

Request a detailed protocol

Arid1a and Apc mRNAs were analyzed by RT-qPCR. For each gene, we used two distinct Taqman assays: (1) One contained two primers both located in undeleted regions. It allowed to detect both wild type and inactivated genes, so the relative mRNA expression of ‘TOTAL’ gene; (2) In the other, one primer was located in the deleted region. Thus, this Taqman assay allowed to detect and amplify only the ‘non excised’ gene. We quantified the percentage of inactivation as follows: % of gene inactivation = (1- (mRNA expression of TOTAL gene expression/mRNA expression of undeleted gene expression)) x 100.

Protein extracts and western blotting

Request a detailed protocol

Livers were lysed mechanically in RIPA buffer (Sigma Aldrich – R0278-50ml) with protease inhibitors (Roche - 11697498001), and boiled in Laemmli sample buffer (Sigma Aldrich – S3401-1VL). 50 µg of protein per lane were run on 8% polyacrylamide gels. The resulting protein bands were electrotransferred onto a 0.2 µm nitrocellulose membrane (Biorad 162–0112), which was then blocked with 5% blocking reagent (Biorad 170–6404) in TBS/Tween 0.1% for 1 hr at RT, probed overnight with the primary antibody, and then incubated with IgG HRP-conjugated secondary antibody for detection with the Clarity ECL substrate (Biorad 70–5061).

To analyze nuclear protein extracts, livers were lysed in Hepes 10 mM pH7.9, KCl 10 mM, EDTA 0.1 mM, EGTA 0.1 mM, DTT 1 mM, AEBSF 0.5 mM. Then, after addition of 12,5 µl of NP40 20% and centrifugation, the pellet was resuspended in Hepes 20 mM pH7.9, NaCl400 mM, EDTA 1 mM, EGTA 1 mM, DTT 1 mM, AEBSF 1 mM, PIC1X, Glycerol 5%, and the supernatants boiled in Laemmli. We next ran 70 µg of protein per lane on Bolt 4–12% Bis-TrisPlus Gels (Thermo Fisher, NW04125BOX). Detection was performed by using Super Signal West Dura ECL system (Thermo Fisher, 34076).

Electrophoretic mobility shift assay (EMSA)

Request a detailed protocol

Nuclear proteins preparation and LXR electromobility shift assay (EMSA) were performed as previously described (Bobard et al., 2005). The probes are listed in the Key Resources Table. The HRE element from the Epo-3’E is constituted from two direct repeats of GG/AGTCA sequences with a spacing of two nucleotides (thereafter called DR2).

Flow cytometry and c-forming unit-erythroid (CFU-E) assays

Request a detailed protocol

Primary mouse bone marrow, spleen cells, and NPC liver cells were harvested from [Apc-Arid1a]ko-focal mice and their wild-type littermates and erythroid cell populations were identified and analysed using CD71/TER119 flow-cytometric assay. Staining was performed in a 96-well plate and samples (5.104 cells) were washed once in PBS, 0.4% BSA, 0.1% Sodium Azide, sample staining volume was 50 µl of mix primary-antibody solution, to a final concentration 1.0 × 106 cells/ml. Primary antibody staining mix were prepared for CD71-FITC and Ter119-PE. Unstained cells, Isotype Ig and single stained cells were used as control and to define boundaries between negative and positive cell labelling. After incubation in the primary antibody stain, two washes were performed by adding 200 µl of staining buffer to each sample.

For CFU-E formation, we plated in duplicate 2 × 105 bone marrow cells or 2 × 106 splenic/NPC liver cells in MethoCult M3234 (StemCell Technologies), supplemented, or not, with 2 U EPO. The number of CFU-E colonies was counted after 3 days.

Chromatin immunoprecipitation (ChIP) and ATAC-qPCR assays

Request a detailed protocol

ChIP assay was previously described for hepatocytes isolated after collagenase perfusion in Gougelet et al., 2014. Chromatin was immunoprecipitated using 3 µg antibody preabsorbed onto 60 µl protein G agarose (Thermo Fisher Scientific – 10004D). Bindings were assessed on the Axin2 intronic enhancer and hepatic Epo enhancer, relative to that of the immunoglobulin isotype control, by Taqman assay and SYBR green technology, respectively with the following oligonucleotides (Eurogentec): negative control region and hepatic Epo enhancer. Enrichment by ChIP was assessed relative to the input DNA and normalized to the level of the negative controls.

ATAC-qPCR assays were done using omni-ATAC as described in Corces et al., 2017, on frozen liver samples after isolation of nuclei. Then, 50,000 nuclei were used for transposition for 30 min in 50 μl reaction mix containing 2.5 μl transposase (Illumina kit #FC-121–103), digitonin and tween 20 at 0.1%. After transposition, the following steps were done according to the initial protocol (Buenrostro et al., 2015). The qPCR step was similar to ChIP experiments.


We assessed statistical significances with GraphPad Prism six software. The data represent the mean ± SEM and p values were calculated by two-tailed unpaired Student’s t-test, one-way ANOVA, or two-way ANOVA as specified in the figure legends. p<0.05 was considered statistically significant and exact p-values are mentioned unless ****p<0.0001. Each quantitative experiment was repeated at least three times. We considered biological replicates as those animals or tissues subjected to the same experimental test, and technical replicates as individual samples or tissues subjected to the same analysis.

Data availability

Microarrays have been deposited in GEO database (GSE134553) and are publicly available. All data generated or analysed during this study are included in the manuscript and supporting files. Source data excel files have been provided for Figures 1, 2, 3, 4, 5, 7, 8, 1S1,1S3,3S1,5S1,5S2,7S1.

The following data sets were generated
    1. Colnot S
    2. Riou R
    (2020) NCBI Gene Expression Omnibus
    ID GSE134553. Expression data from isolated areas from [Apc-Arid1a]ko-focal liver tissues after FFPE treatment.


    1. Bunn HF
    (2013) Erythropoietin
    Cold Spring Harbor Perspectives in Medicine 3:a011619.
    1. Nogueira-Pedro A
    2. dos Santos GG
    3. Oliveira DC
    4. Hastreiter AA
    5. Fock RA
    Erythropoiesis in vertebrates: from ontogeny to clinical relevance
    Frontiers in Bioscience : A Journal and Virtual Library 8:100–112.

Decision letter

  1. Didier YR Stainier
    Senior Editor; Max Planck Institute for Heart and Lung Research, Germany
  2. Irwin Davidson
    Reviewing Editor; Institut de Génétique et de Biologie Moléculaire et Cellulaire, France
  3. Irwin Davidson
    Reviewer; Institut de Génétique et de Biologie Moléculaire et Cellulaire, France
  4. Tom Bird

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Riou et al. describe how the Arid1a subunit of the SWI/SNF chromatin remodelling complex cooperates with activated Wnt signalling to induce re-expression of the erythropoeitin (EPO) hormone in liver hepatocytes. The overexpressed EPO induces increased red blood cell production in the spleen leading to erythrocytosis and local angiogenesis in the liver. Arid1a regulates binding of the TCF4-β catenin complex to an Hnf4a response element in the 3' enhancer of the EPO gene that to promote its expression upon activation of Wnt signalling.

Decision letter after peer review:

Thank you for submitting your article "ARID1A loss in adult hepatocytes unleashes β-catenin-mediated erythropoietin transcription" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Irwin Davidson as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Didier Stainier as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Tom Bird (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


This paper describes a potential mechanism by which the SWI/SNF subunit Arid1a cooperates with activated Wnt signaling to induce re-expression of the EPO hormone in liver hepatocytes. This study provides new data on how Wnt signaling can regulate EPO expression and on an interplay between Arid1a, chromatin accessibility and Wnt signaling. While the reviewers found this study to be of significant interest, a number of major issues should be addressed in a revised version of the paper.

Essential revisions:

1) In Figure 9, the authors summarize their data and proposes a model for how Arid1A regulates TCF4-b-cat activation of the EPO gene. It would be essential to perform ATAC-seq or at least ATAC-qPCR to demonstrate changes in accessibility of the EPO regulatory element under the different conditions. The model proposes that in wild-type conditions and in APC-mutant conditions the SWI/SNF complex is bound at the regulatory element and that it is released under conditions where Arid1a is deleted. This model can be easily tested using antibodies that ChIP components of the SWI/SNF complex. The best would be Arid1a in combination with other subunits, but if there are no ChIP-grade Arid1a antibodies, the authors could at least determine whether SWI/SNF is present under these conditions and released upon Arid1a inactivation. One could also imagine other models where SWI/SNF without Arid1a is also bound when the element is activated, but with different functional outcome in the presence or absence of Ardi1a. Additional ATAC or ChIP experiments could easily discriminate these possibilities. It is essential that the authors address these issues.

2) The data for physiologically relevant production of Epo by hepatocytes in the model must be more convincingly shown. The absence of systemic/hepatic and renal hypoxia should be more robustly demonstrated. The production of physiologically meaningful Epo by hepatocytes should be shown. It is proposed that the 2-4-fold increase in transcript/reporter observed in cell lines is responsible for the 2-3-fold increase in systemic Epo; most of which is derived from kidney physiologically. Comparing kidney as positive control at transcript level would be helpful as well as measurement at protein level in liver and kidney. The authors should quantify and compare hepatic and kidney EPO expression in the different genetic backgrounds. This could be done by both qRT-PCR and by RNA-fish/RNAscope on sections from both kidney and liver. It is essential the authors quantify relative EPO expression in both organs.

3) The authors should address if the observed peliosis is related to sinusoidal obstruction related to the polycythaemia. If this is the case then this would be consistent with the splenomegaly – due to portal hypertension. Is there flow in the peliotic regions on ultrasound? An alternative explanation for the results in this paper would be that a combination of Arid1/APC deletion results in sinusoidal constriction/obstruction with pooling/extravasation of blood. This constriction would then lead to portal hypertension and increased Epo release by the kidney resulting in polycythaemia and peliosis. This seems a potential explanation and is not refuted by the data presented.

4) Peliosis and HCC have been described together in HCC but this is not referenced e.g. doi: 10.1007/s00534-008-0035-9. Furthermore, interrogation of publicly available datasets (e.g. TCGA) may add strength to the proposition that Wnt pathway mutations in combination with Arid1A give rise to Epo production within the liver tumour.

5) A statement regarding the cause of death in APC/Arid1 animals should be provided to support the authors claim that this is secondary to peliosis. This is not normally itself a fatal disorder, so why do the authors propose it is in this model? Similarly, is there correlation between the ultrasound findings and endpoint liver examination at post mortem?

6) In line with general recommendations in mouse work it would be important to show that the key findings are present in both male and female model systems.

7) Additional replicates are necessary to show absence of effects of HIF targets. There do appear to be differences in at least some of these and it is likely that n=4 will be insufficient to demonstrate equivalence.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "ARID1A loss in adult hepatocytes activates β-catenin-mediated erythropoietin transcription" for further consideration by eLife. Your revised article has been evaluated by Didier Stainier (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:

The manuscript of Riou et al. has been substantially modified and reorganised. The authors have performed the majority of the essential revisions, in particular the RNAscope analyses of EPO expression in the wild-type and mutant livers and kidneys. The only experiment that could not be performed was the analyses of the phenotype of the female mice that is likely to take a much longer time due to the COVID crisis that restricted access and breeding in the animal facility.

While the manuscript is very much improved, several issues still require attention and should be addressed before final acceptance.

1) In the rebuttal letter and in the revised text, the authors describe the EPO expression seen by RNAscope experiments as “bursty” or “stochastic”. While this may be the case, it is not fully justified, nor necessary to explain the phenotype to describe EPO expression in this way. The text should be modified.

2) The ATAC-qPCR experiments did not reveal increased chromatin accessibility upon Arid1a inactivation, in fact, chromatin accessibility appeared to decrease compared to Apc inactivation alone. It appears that only a single primer set was used that overlaps with the TCF binding site. From this limited analysis, it is difficult to assess exact nucleosome positioning and how it may be affected by Arid1a loss. It would have been more appropriate to test several amplicons spanning the enhancer. This would have perhaps better revealed how Arid1a loss affects nucleosome positioning and accessibility.

3) Last but not least, the quality of the English in the revised version is very poor leading to lack of precision and making the text difficult to follow. A thorough revision of the text by a native speaker is essential.

Author response

Essential revisions:

1) In Figure 9, the authors summarize their data and proposes a model for how Arid1A regulates TCF4-b-cat activation of the EPO gene. It would be essential to perform ATAC-seq or at least ATAC-qPCR to demonstrate changes in accessibility of the EPO regulatory element under the different conditions. The model proposes that in wild-type conditions and in APC-mutant conditions the SWI/SNF complex is bound at the regulatory element and that it is released under conditions where Arid1a is deleted. This model can be easily tested using antibodies that ChIP components of the SWI/SNF complex. The best would be Arid1a in combination with other subunits, but if there are no ChIP-grade Arid1a antibodies, the authors could at least determine whether SWI/SNF is present under these conditions and released upon Arid1a inactivation. One could also imagine other models where SWI/SNF without Arid1a is also bound when the element is activated, but with different functional outcome in the presence or absence of Ardi1a. Additional ATAC or ChIP experiments could easily discriminate these possibilities. It is essential that the authors address these issues.

We agreed with this essential requirement. We had tried ChIP-qPCR experiments using antibodies against Arid1a or against Brg1. But primary mouse hepatocytes are difficult to study by ChIP and this previously took us time to implement ChIP against Tcf4 and/or β-catenin (see Gougelet et al., 2014). Consequently, we got no convincing data using these antibodies. We thus undertook ATAC-qPCR experiments using OMNI-ATAC recently described technique, which works on frozen liver tissue. We clearly found that chromatin accessibility increased after β-catenin activation on GS, Axin2 and Epo enhancer. But surprisingly, this was not the case when Arid1a gene is inactivated. This goes well with the fact that Arid1a is a facultative component of BAF SWI/SNF chromatin complex, which can be replaced by Arid1b. This has been added in Figure 8F, leading to a modified model of transcription of Epo shown in Figure 9. This is described in the text: “Tcf4 bound in vivo to the Epo enhancer and such binding was slightly higher in [Apc]ko-TOTAL and much higher in [Apc-Arid1a]ko-TOTAL hepatocytes than in controls (Figure 8E). After a single β-catenin activation process, the H3K27me3 repressive mark slightly decreased and chromatin was more accessible (Figure 8F). In contrast, the loss of Arid1a strongly decreased H3K27Me3 repressive mark without modifying chromatin access. In [Apc-Arid1a]ko-TOTAL hepatocytes, a H3K27Ac active histone mark was induced while chromatin accessibility was lower.” This is also discussed: “For Epo enhancer, the increased binding of Tcf4/β-catenin complex to the Hnf4-RE is dependent on Arid1a, whose loss decreases H3K27me3 repressive mark. That could be due to the complex existing balance between the Polycomb complex PRC2 (catalyzing the addition of methyl groups to histone H3 at lysine 27) and the SWI/SNF complex (Kadoch, Copeland and Keilhack, 2016). Accordingly, the inhibition of the Polycomb EZH2 subunit is synthetically lethal in ARID1A-mutated tumors (Bitler et al., 2015; Allredge and Eskander, 2017). Therefore, Arid1a and Polycomb complex could act in concert to modulate liver expression of the Epo gene”.

2) The data for physiologically relevant production of Epo by hepatocytes in the model must be more convincingly shown. The absence of systemic/hepatic and renal hypoxia should be more robustly demonstrated. The production of physiologically meaningful Epo by hepatocytes should be shown. It is proposed that the 2-4-fold increase in transcript/reporter observed in cell lines is responsible for the 2-3-fold increase in systemic Epo; most of which is derived from kidney physiologically. Comparing kidney as positive control at transcript level would be helpful as well as measurement at protein level in liver and kidney. The authors should quantify and compare hepatic and kidney EPO expression in the different genetic backgrounds. This could be done by both qRT-PCR and by RNA-fish/RNAscope on sections from both kidney and liver. It is essential the authors quantify relative EPO expression in both organs.

Here again, the reviewers indicated some useful experiments to perform. We first assessed Epo mRNA expression by qPCR in the transgenic kidneys, and showed that there is no increase in renal Epo expression after either focal (new Figure 2E) or panlobular (new Figure 5D) Apc/Arid inactivations. In this latter case, there is rather a slight decrease of renal Epo after hepatic Apc/Arid knock-out. This clearly showed that the systemic impact of Epo is due to hepatic de novo transcription. We also performed. In this context, measuring renal hypoxia was not of interest. We focused on hepatic localization of Epo transcripts. After some attempts to perform classical in situ hybridizations, even if we are expert in mRNA ISH in the liver (Benhamouche et al., 2006), they failed when assessing Epo transcripts. We thus performed highly sensitive RNAScope experiments, and as expected we showed: (1) that Epo mRNA are only detectable in rare renal interstitial cells of normal kidney; (2) that no Epo is detected in normal livers (Figure 6—figure supplement 1). In transgenic livers, we were able to detect Epo transcripts only in rare Axin2-expressing (and thus β-catenin-activated) hepatocytes of Apc/Arid knock-out livers. This exciting experiment clearly underlines a stochastic and bursty transcription of Epo as described previously for several hepatic mRNAs by Itzkovitz’ team using single-RNA ISH (Halpern, Nature 2015).

3) The authors should address if the observed peliosis is related to sinusoidal obstruction related to the polycythaemia. If this is the case then this would be consistent with the splenomegaly – due to portal hypertension. Is there flow in the peliotic regions on ultrasound? An alternative explanation for the results in this paper would be that a combination of Arid1/APC deletion results in sinusoidal constriction/obstruction with pooling/extravasation of blood. This constriction would then lead to portal hypertension and increased Epo release by the kidney resulting in polycythaemia and peliosis. This seems a potential explanation and is not refuted by the data presented.

In keeping with this hypothesis, we performed dynamic ultrasound using microbubble administration and an example is shown in Figure 1—figure supplement 2. It clearly showed that there is a decrease in hepatic vascular perfusion within echogenic areas enriched in Apc/Arid inactivated hepatocytes. However, no modification in kidney Epo expression was seen, showing that the primary defect resulting in polycythaemia and peliosis is a hepatic one.

4) Peliosis and HCC have been described together in HCC but this is not referenced e.g. doi: 10.1007/s00534-008-0035-9. Furthermore, interrogation of publicly available datasets (e.g. TCGA) may add strength to the proposition that Wnt pathway mutations in combination with Arid1A give rise to Epo production within the liver tumour.

Thank you for the reference about peliosis and HCC, added in the Discussion paragraph eight. We have interrogated TCGA dataset as legitimately proposed. We could not find Epo overexpression in CTNNB1/ARID1A mutated HCCs. However, the frequent hypoxia found in cancers rendered this observation not so surprising. This has been added as a supplemental figure (Figure 1—figure supplement 4) and in the text (subsection “Emergence of peliosis-like regions in the liver of [Apc-Arid1a]ko-focal mice”) and commented in the Discussion.

5) A statement regarding the cause of death in APC/Arid1 animals should be provided to support the authors claim that this is secondary to peliosis. This is not normally itself a fatal disorder, so why do the authors propose it is in this model? Similarly, is there correlation between the ultrasound findings and endpoint liver examination at post mortem?

To clarify this issue, we have added in Figure 1D a picture of a necropsy from a Apc/Arid 13-month old mouse whose entire liver was diseased with a dramatic erythrocytosis and no healthy area in its liver. This is representative of the 3 mice necropsied before dying, as they were reaching the endpoints: “At necropsy of dying mice, the whole liver was diseased, appearing dark red, filled with blood, with large necrotic areas, and no remaining healthy zones (Figure 1D, inset)”.

6) In line with general recommendations in mouse work it would be important to show that the key findings are present in both male and female model systems.

We agree with this comment. We did all the analyses in males because the initial question was to analyze liver carcinogenesis for which an important delay in females is described. We tried to generate new female mice with the different genotypes. We got no enough female mice with the 4 genotypes expected in March. Unfortunately, we could not continue the breedings due to the COVID19 crisis as the access to the animal facility has been severely restricted.

7) Additional replicates are necessary to show absence of effects of HIF targets. There do appear to be differences in at least some of these and it is likely that n=4 will be insufficient to demonstrate equivalence.

We agree with this comment and have expanded this analysis to n=8 (n=7 for Arid ko livers). There are some differences in the expression of Eno2, Car9 and Rab42 mRNA expressions, which were seen in Apcko and Apc/Aridko livers (Figure 7—figure supplement 1D-E). This underlines an overexpression of some HIF targets after β-catenin activation, and does not emphasize that Apc/Arid-ko livers are specifically HIF-activated. This is written in the text: “A small subset of Hif1α/Hif2α targets was slightly overexpressed in both Apcko and Apc-Arid1ako livers, such as Eno2, Car9 and Rab42, confirming that β-catenin and HIF signaling share some transcriptional targets (Figure 7—figure supplement 1D,E) ( Benhamouche et al., 2006).”

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

The manuscript of Riou et al. has been substantially modified and reorganised. The authors have performed the majority of the essential revisions, in particular the RNAscope analyses of EPO expression in the wild-type and mutant livers and kidneys. The only experiment that could not be performed was the analyses of the phenotype of the female mice that is likely to take a much longer time due to the COVID crisis that restricted access and breeding in the animal facility.

While the manuscript is very much improved, several issues still require attention and should be addressed before final acceptance.

1) In the rebuttal letter and in the revised text, the authors describe the EPO expression seen by RNAscope experiments as “bursty” or “stochastic”. While this may be the case, it is not fully justified, nor necessary to explain the phenotype to describe EPO expression in this way. The text should be modified.

We agree that our interpretation of RNAscope experiments was hypothetic. We have suppressed these words, and have only discussed the interest of single-RNA in situ hybridization approach to better describe gene expression in the liver, as it was done by Itzkovitz’ lab.

2) The ATAC-qPCR experiments did not reveal increased chromatin accessibility upon Arid1a inactivation, in fact, chromatin accessibility appeared to decrease compared to Apc inactivation alone. It appears that only a single primer set was used that overlaps with the TCF binding site. From this limited analysis, it is difficult to assess exact nucleosome positioning and how it may be affected by Arid1a loss. It would have been more appropriate to test several amplicons spanning the enhancer. This would have perhaps better revealed how Arid1a loss affects nucleosome positioning and accessibility.

We limited the chromatin accessibility analysis due to the difficulty to design accurate PCR primers in the region of the enhancer. For this revision, we finally designed three additional primer pairs which work for qPCR (added in the key resources table), but we could not technically try amplicons in the flanking regions, nor get an amplicon specific for the Hnf4/Wnt responsive element (see Figure 8—figure supplement 2A). We revealed an increased chromatin accessibility when the amplicon is centered on the Hnf4/Wnt responsive element. These data are added as Figure 8—figure supplement 2 and commented in the legend.

3) Last but not least, the quality of the English in the revised version is very poor leading to lack of precision and making the text difficult to follow. A thorough revision of the text by a native speaker is essential.

The text of the Results and the Discussion has been thoroughly revised by a professional scientific proofreader and editor.

Article and author information

Author details

  1. Rozenn Riou

    1. INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), Paris, France
    2. Equipe labellisée Ligue Nationale Contre le Cancer, Paris, France
    3. INSERM, CNRS, Institut COCHIN, Paris, France
    Conceptualization, Formal analysis, Validation, Investigation, Visualization
    Competing interests
    No competing interests declared
  2. Meriem Ladli

    INSERM, CNRS, Institut COCHIN, Paris, France
    Validation, Investigation, Visualization
    Competing interests
    No competing interests declared
  3. Sabine Gerbal-Chaloin

    INSERM U1183, Université Montpellier, Institute for Regenerative Medicine & Biotherapy (IRMB), Montpellier, France
    Formal analysis, Supervision, Validation, Visualization
    Competing interests
    No competing interests declared
  4. Pascale Bossard

    1. Equipe labellisée Ligue Nationale Contre le Cancer, Paris, France
    2. INSERM, CNRS, Institut COCHIN, Paris, France
    Formal analysis, Supervision, Validation, Investigation, Visualization
    Competing interests
    No competing interests declared
  5. Angélique Gougelet

    1. INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), Paris, France
    2. Equipe labellisée Ligue Nationale Contre le Cancer, Paris, France
    3. INSERM, CNRS, Institut COCHIN, Paris, France
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
  6. Cécile Godard

    1. INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), Paris, France
    2. Equipe labellisée Ligue Nationale Contre le Cancer, Paris, France
    3. INSERM, CNRS, Institut COCHIN, Paris, France
    Competing interests
    No competing interests declared
  7. Robin Loesch

    1. INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), Paris, France
    2. Equipe labellisée Ligue Nationale Contre le Cancer, Paris, France
    3. INSERM, CNRS, Institut COCHIN, Paris, France
    Investigation, Involved in the revision process
    Competing interests
    No competing interests declared
  8. Isabelle Lagoutte

    1. INSERM, CNRS, Institut COCHIN, Paris, France
    2. Plateforme d’Imageries du Vivant de l’Université de Paris, Paris, France
    Competing interests
    No competing interests declared
  9. Franck Lager

    1. INSERM, CNRS, Institut COCHIN, Paris, France
    2. Plateforme d’Imageries du Vivant de l’Université de Paris, Paris, France
    Competing interests
    No competing interests declared
  10. Julien Calderaro

    1. INSERM, Université Paris-Est UPEC, Créteil, France
    2. Department of Pathology, Henri Mondor Hospital, Créteil, France
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
  11. Alexandre Dos Santos

    INSERM, Paul-Brousse University Hospital, Hepatobiliary Centre, Villejuif, France
    Investigation, Involved in the revision process
    Competing interests
    No competing interests declared
  12. Zhong Wang

    Department of Cardiac Surgery Cardiovascular Research Center, University of Michigan, Ann Arbor, United States
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8720-4609
  13. Frédérique Verdier

    INSERM, CNRS, Institut COCHIN, Paris, France
    Formal analysis, Supervision, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
  14. Sabine Colnot

    1. INSERM, Sorbonne Université, Université de Paris, Centre de Recherche des Cordeliers (CRC), Paris, France
    2. Equipe labellisée Ligue Nationale Contre le Cancer, Paris, France
    3. INSERM, CNRS, Institut COCHIN, Paris, France
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3949-9107


Institut National Du Cancer (Epigenetics and Liver Cancer)

  • Rozenn Riou
  • Angélique Gougelet
  • Cécile Godard
  • Julien Calderaro
  • Sabine Colnot

Ligue Contre le Cancer (Equipe Labellisée)

  • Rozenn Riou
  • Angélique Gougelet
  • Cécile Godard
  • Sabine Colnot

Agence Nationale de la Recherche (Labex "Who Am I")

  • Rozenn Riou
  • Angélique Gougelet
  • Cécile Godard
  • Sabine Colnot

Institut National Du Cancer (Chromaliv)

  • Rozenn Riou
  • Angélique Gougelet
  • Cécile Godard
  • Sabine Colnot

Agence Nationale de la Recherche (Idex "EpilivCan")

  • Rozenn Riou
  • Angélique Gougelet
  • Cécile Godard
  • Sabine Colnot

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


This work was supported by the French National League against Cancer (LNCC), by the IDEX ‘Epilivcan’, by the Institut National du Cancer ‘Epigenetics and Liver Cancer’, and by the Plan-Cancer Programme « CHROMA-LIV ». RR got fellowships from the French Laboratory of Excellence program ‘Who am I ?” (no ANR-11-LABX-0071 included in the Investments for the Future program n° ANR-11-IDEX-0005–01), and the French Foundation for Cancer Research (ARC). We are thankful to Dr C Peyssonnaux team for discussions on erythropoietin expression, and help to measure hematological blood parameters. We are thankful to Dr P Mayeux, JC Deschemin and Dr E Huang for the gift of anti-EPO blocking serum, DFO and EpoE-LUC plasmid, respectively. We wish to thank the animal housing facility at Cochin Institute, and the ‘GENOM’IC’ facility for transcriptomic data generation and analysis. We are very grateful to Dr C Desbois-Mouthon, Dr S Vaulont and Pr J Weitzman for critical reading of the manuscript, and to Pr J Weitzman, Pr J Zucman-Rossi and Dr C Desdouets for helpful discussions.


Animal experimentation: This study was performed in strict accordance with the French government regulations. All of the animals were handled according to approved institutional animal care and use committee (Ethics Committee of Descartes University, Paris). The protocol was approved by the Ethics Committee of Descartes University, Paris (permit number APAFIS#14472). Every effort was made to minimize suffering.

Senior Editor

  1. Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany

Reviewing Editor

  1. Irwin Davidson, Institut de Génétique et de Biologie Moléculaire et Cellulaire, France


  1. Irwin Davidson, Institut de Génétique et de Biologie Moléculaire et Cellulaire, France
  2. Tom Bird

Publication history

  1. Received: November 12, 2019
  2. Accepted: October 20, 2020
  3. Accepted Manuscript published: October 21, 2020 (version 1)
  4. Version of Record published: November 4, 2020 (version 2)


© 2020, Riou et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,187
    Page views
  • 174
  • 2

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Rozenn Riou
  2. Meriem Ladli
  3. Sabine Gerbal-Chaloin
  4. Pascale Bossard
  5. Angélique Gougelet
  6. Cécile Godard
  7. Robin Loesch
  8. Isabelle Lagoutte
  9. Franck Lager
  10. Julien Calderaro
  11. Alexandre Dos Santos
  12. Zhong Wang
  13. Frédérique Verdier
  14. Sabine Colnot
ARID1A loss in adult hepatocytes activates β-catenin-mediated erythropoietin transcription
eLife 9:e53550.
  1. Further reading

Further reading

    1. Chromosomes and Gene Expression
    2. Plant Biology
    Myeongjune Jeon, Goowon Jeong ... Ilha Lee
    Research Article

    To synchronize flowering time with spring, many plants undergo vernalization, a floral-promotion process triggered by exposure to long-term winter cold. In Arabidopsis thaliana, this is achieved through cold-mediated epigenetic silencing of the floral repressor, FLOWERING LOCUS C (FLC). COOLAIR, a cold-induced antisense RNA transcribed from the FLC locus, has been proposed to facilitate FLC silencing. Here, we show that C-repeat (CRT)/dehydration-responsive elements (DREs) at the 3′-end of FLC and CRT/DRE-binding factors (CBFs) are required for cold-mediated expression of COOLAIR. CBFs bind to CRT/DREs at the 3′-end of FLC, both in vitro and in vivo, and CBF levels increase gradually during vernalization. Cold-induced COOLAIR expression is severely impaired in cbfs mutants in which all CBF genes are knocked-out. Conversely, CBF-overexpressing plants show increased COOLAIR levels even at warm temperatures. We show that COOLAIR is induced by CBFs during early stages of vernalization but COOLAIR levels decrease in later phases as FLC chromatin transitions to an inactive state to which CBFs can no longer bind. We also demonstrate that cbfs and FLCΔCOOLAIR mutants exhibit a normal vernalization response despite their inability to activate COOLAIR expression during cold, revealing that COOLAIR is not required for the vernalization process.

    1. Chromosomes and Gene Expression
    2. Genetics and Genomics
    Fernanda M Bosada, Karel van Duijvenboden ... Vincent M Christoffels
    Research Article

    Heart development and rhythm control are highly Tbx5 dosage-sensitive. TBX5 haploinsufficiency causes congenital conduction disorders, whereas increased expression levels of TBX5 in human heart samples has been associated with atrial fibrillation (AF). We deleted the conserved mouse orthologues of two independent AF-associated genomic regions in the Tbx5 locus, one intronic (RE(int)) and one downstream (RE(down)) of Tbx5. In both lines we observed a modest (30%) increase of Tbx5 in the postnatal atria. To gain insight into the effects of slight dosage increase in vivo, we investigated the atrial transcriptional, epigenetic and electrophysiological properties of both lines. Increased atrial Tbx5 expression was associated with induction of genes involved in development, ion transport and conduction, with increased susceptibility to atrial arrhythmias, and increased action potential duration of atrial cardiomyocytes. We identified an AF-associated variant in the human RE(int) that increases its transcriptional activity. Expression of the AF-associated transcription factor Prrx1 was induced in Tbx5RE(int)KO cardiomyocytes. We found that some of the transcriptional and functional changes in the atria caused by increased Tbx5 expression were normalized when reducing cardiac Prrx1 expression in Tbx5RE(int)KO mice, indicating an interaction between these two AF genes. We conclude that modest increases in expression of dose-dependent transcription factors, caused by common regulatory variants, significantly impact on the cardiac gene regulatory network and disease susceptibility.