A single-cell survey of Drosophila blood
- Department of Genetics, Blavatnik Institute, Harvard Medical School, United States
- Department of Life Science, Hanyang University, Republic of Korea
- Harvard TH Chan Bioinformatics Core, United States
- Howard Hughes Medical Institute, United States
Figures
Figure 1 with 2 supplements
scRNA-seq of Drosophila hemocytes reveals subpopulations of plasmatocytes, crystal cells, and lamellocytes.
(A) Schematic of the microfluidics-based scRNA-seq workflow. (B) t-Distributed Stochastic Neighbor Embedding (t-SNE) plot of Harmony-based batch correction and integration of unwounded (red), …
Figure 1—figure supplement 1
scRNA-seq of Drosophila hemocytes reveals subpopulations of plasmatocytes, crystal cells, and lamellocytes.
(A, B) Number of genes (nGene [A]) and number of unique molecular identifiers (nUMI [B]) detected per cell in unwounded controls (n = 4), wounded (n = 4), wasp infested (wasp inf., 24 hr, n = 3 and …
Figure 1—figure supplement 2
Quality of scRNA-seq data and development of Drosophila blood scRNA-seq portal.
(A) Comparing pseudobulk scRNA-seq data of unwounded samples with published bulk RNA-seq data of control hemocytes from Hml-GAL4 >UAS EGFP larvae (Neves et al., 2016), reveals a strong correlation …
Figure 2 with 1 supplement
Changes in blood cell composition and identification of a novel Mtk-like AMP.
(A-C) t-SNE plots of (A) Unwounded, (B) Wounded, and (C) Wasp inf. 24 hr conditions. (D) Cell fraction changes in clusters based on treatment conditions. (E) Heat map profile of the top expressed …
-
Figure 2—source data 1
Source data pertaining to cell fraction bar graph of Figure 2D.
- https://cdn.elifesciences.org/articles/54818/elife-54818-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Changes in blood cell composition and identification of a novel Mtk-like AMP.
(A-C) Heat maps of differentially expressed gene signatures pertaining to PM3 (A), PM5 (B), and PM6 (C). (D, D’) Screen shots of the Antimicrobial10 domains within the peptide sequences of Mtk (D) …
Figure 3 with 2 supplements
Pseudotemporal ordering of cells using Monocle3 delineates blood cell lineages.
(A) Monocle3 was used to track cells over pseudotime on the 10X-derived unwounded and wounded data sets. (B) Visualization of clusters (from Figure 1C) onto the pseudotime map. (C-E) Three major …
Figure 3—figure supplement 1
Pseudotemporal ordering of cells using Monocle3 delineates blood cell lineages.
(A-B) Confocal imaging reveals that the lymph glands are intact and unruptured in wounded larvae (B) compared to unwounded controls (A). Scale bar = 50 μm. (C-E) Total number of cells, represented …
Figure 3—figure supplement 2
Pseudotemporal ordering of cells using Monocle3 delineates blood cell lineages.
(A-D) Gene expression of blood cell marker genes, such as PPO1 (A), atilla (B), Drs (C), and GstE6 (D) along the pseudotime intervals, reveals that these genes are enriched over pseudotime. (E) Ridge…
Figure 4 with 1 supplement
Crystal cell sub-clustering distinguishes crystal cell intermediates from mature crystal cells.
(A) t-SNE plot of crystal cell sub-clustering depicting two crystal cell sub-clusters, PPO1low and PPO1high. (B) Percentage of PPO1low and PPO1highcrystal cells across the three conditions. (C) Violi…
-
Figure 4—source data 1
Source data pertaining to cell fraction bar graph of Figure 4B.
- https://cdn.elifesciences.org/articles/54818/elife-54818-fig4-data1-v2.xlsx
-
Figure 4—source data 2
Excel file for Figure 4G pertaining to raw intensity values of Lz+ PPO1+ crystal cells.
- https://cdn.elifesciences.org/articles/54818/elife-54818-fig4-data2-v2.xlsx
Figure 4—figure supplement 1
Crystal cell sub-clustering distinguishes crystal cell intermediates from mature crystal cells.
(A-B) t-SNE plots represent Harmony-based batch correction per technology (A) and condition (B). (C) Representation of CC1 and CC2 cluster colors (from Figure 1C) onto the crystal cell sub-clusters. …
Figure 5 with 1 supplement
Lamellocyte sub-clustering identifies lamellocyte intermediates and subtypes.
(A) t-SNE plot depicting the lamellocyte sub-clusters. (B) Changes in lamellocyte fractions across the three conditions. (C) Expression of the lamellocyte marker gene atilla was used to annotate the …
-
Figure 5—source data 1
Source data pertaining to cell fraction bar graph of Figure 5B.
- https://cdn.elifesciences.org/articles/54818/elife-54818-fig5-data1-v2.xlsx
-
Figure 5—source data 2
Excel sheet pertaining to the lamellocyte counts used for Figure 5I.
- https://cdn.elifesciences.org/articles/54818/elife-54818-fig5-data2-v2.xlsx
Figure 5—figure supplement 1
Lamellocyte sub-clustering identifies lamellocyte intermediates and subtypes.
(A) t-SNE plot representing the clustering analysis of wasp inf. 48 hr data set reveals 4 distinct clusters. (B) t-SNE plot demonstrating the expression of atilla in the wasp inf. 48 hr data set. (C)…
Figure 6 with 3 supplements
scRNA-seq uncovers a novel role for the FGF pathway in immune response.
(A) Pathway enrichment of the top marker genes across all the clusters from Figure 1C. (B) Expression of bnl (red) and btl (green) in crystal cell and lamellocyte clusters, respectively. (B’) …
Figure 6—figure supplement 1
scRNA-seq uncovers a novel role for the FGF pathway in immune response.
(A) Average bnl expression counts derived from the crystal cell sub-clustering data revealed that bnl is more enriched in PPO1highcrystal cells. Each colored dot represents one cell. Error bars are …
Figure 6—figure supplement 2
scRNA-seq uncovers a novel role for the FGF pathway in immune response.
(A) Validation of bnlRNAi knockdown efficiency by qRT-PCR. UAS-bnlRNAi flies were crossed to Ubiquitin (Ubi)-GAL4 and the resulting RNA from Ubi >control and Ubi >bnlRNAi larvae was subjected to …
Figure 6—figure supplement 3
scRNA-seq uncovers a novel role for the FGF pathway in immune response.
(A) Validation of btlRNAi knockdown efficiency by qRT-PCR. UAS-btlRNAi flies (BL#60013 and #43544) were crossed to Ubiquitin (Ubi)-GAL4 and the resulting RNA from Ubi >control and Ubi >btlRNAi …
Figure 7
Model of the role of FGF signaling pathway in blood cell migration.
(A) Proposed model depicting inter-hemocyte crosstalk between Bnl+crystal cells and Btl+ lamellocytes. Based on our in vivo data, we propose that crystal cells expressing Bnl are important for the …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information | |||
|---|---|---|---|---|---|---|---|
| Gene (D. melanogaster) | CG43236 | NA | FLYB: FBgn0262881 | NA | |||
| Gene (D. melanogaster) | E(spl)m3-HLH | NA | FLYB: FBgn0002609 | NA | |||
| Gene (D. melanogaster) | Drip | NA | FLYB: FBgn0015872 | NA | |||
| Gene (D. melanogaster) | bnl | NA | FLYB: FBgn0014135 | NA | |||
| Gene (D. melanogaster) | btl | NA | FLYB: FBgn0285896 | NA | |||
| Strain, strain background (D. melanogaster) | Oregon R | BloomingtonDrosophilaStock Center | BDSC: 5 | NA | |||
| Strain, strain background (L. boulardi) | Leptopilina boulardi | BloomingtonDrosophilaStock Center | PMID:17967061 | Strain G486 | |||
| Genetic reagent (D. melanogaster) | HmlΔ-GAL4; UAS-2XEGFP | BloomingtonDrosophilaStock Center | BDSC: 30140; FLYB: FBst0030140 | FLYB genotype: w1118; P{Hml-GAL4.Δ}2, P{UAS-2xEGFP}AH2 | |||
| Genetic reagent (D. melanogaster) | Hml-GAL4-Lineage Trace (HLT)-GAL4 | Dr. Utpal Banerjee | PMID:22134547 | Hml-Gal4 UAS-FLP, ubi-FRT-STOP-FRT-Gal4 | |||
| Genetic reagent (D. melanogaster) | lz-GAL4; UAS-GFP | BloomingtonDrosophilaStock Center | BDSC: 6314; FLYB: FBst0006314 | FLYB genotype: y1 w* P{UAS-mCD8::GFP.L}Ptp4ELL4 P{GawB}lzgal4 | |||
| Genetic reagent (D. melanogaster) | E(spl)m3-HLH-GAL4 | BloomingtonDrosophilaStock Center | BDSC: 46517; FLYB: FBst0046517 | FLYB genotype: w1118; P{GMR10E12-GAL4}attP2 | |||
| Genetic reagent (D. melanogaster) | Drip-GAL4 | BloomingtonDrosophilaStock Center | BDSC: 66782; FLYB: FBst0066782 | FLYB genotype: y1 w*; Mi{Trojan-GAL4.0}DripMI00887-TG4.0/SM6a | |||
| Genetic reagent (D. melanogaster) | btl-GAL4 | Perrimon Lab stock | NA | Genotype: yw; UAS-GFPN-lacZ(2-1)/CyO; btl-Gal4(3-1)/TM3 Sb Ser | |||
| Genetic reagent (D. melanogaster) | bnl-LexA | Dr. Sougata Roy | PMID:28502613 | bnl-LexA/TM6 | |||
| Genetic reagent (D. melanogaster) | Ubi-GAL4 | Dr. Utpal Banerjee | PMID:24267893 | Ubiquitin-GAL4 | |||
| Genetic reagent (D. melanogaster) | BcF6-mCherry | Dr. Robert Schulz | PMID:27913635 | BcF6-mCherry (III) | |||
| Genetic reagent (D. melanogaster) | msn-mCherry | Dr. Robert Schulz | PMID:27913635 | MSNF9mo-mCherry (III) | |||
| Genetic reagent (D. melanogaster) | srp-GAL4 | Dr. Lucas Waltzer | PMID:14657024 | NA | |||
| Genetic reagent (D. melanogaster) | LexAOp-myr-GFP | BloomingtonDrosophilaStock Center | BDSC:32210; FLYB: FBst0032210 | FLYB genotype: P{13XLexAop2-IVS-myr::GFP}attP40 | |||
| Genetic reagent (D. melanogaster) | LexAOp-mCherry | BloomingtonDrosophilaStock Center | BDSC:52271; FLYB: FBst0052271 | FLYB genotype: y1 w*; wgSp-1/CyO, P{Wee-P.ph0}BaccWee-P20; P{13XLexAop2-6XmCherry-HA}attP2 | |||
| Genetic reagent (D. melanogaster) | UAS-mCD8- GFP | BloomingtonDrosophilaStock Center | BDSC: 5137; FLYB: FBst0005137 | FLYB genotype: y1 w*; P{UAS-mCD8::GFP.L}LL5, P{UAS-mCD8::GFP.L}2 | |||
| Genetic reagent (D. melanogaster) | UAS-poloRNAi | BloomingtonDrosophilaStock Center | BDSC: 33042; FLYB: FBst0033042 | FLYB genotype: y1 sc* v1 sev21; P{TRiP.HMS00530}attP2 | |||
| Genetic reagent (D. melanogaster) | UAS-btlRNAi-1 | BloomingtonDrosophilaStock Center | BDSC: 43544; FLYB: FBst0043544 | FLYB genotype: y1 sc* v1 sev21; P{TRiP.HMS02656}attP40 | |||
| Genetic reagent (D. melanogaster) | UAS-btlRNAi-2 | BloomingtonDrosophilaStock Center | BDSC: 60013; FLYB: FBst0060013 | FLYB genotype: y1 v1; P{TRiP.HMS05005}attP40 | |||
| Genetic reagent (D. melanogaster) | UAS-empty | Dr. Hugo Bellen | PMID:27640307 | UAS-empty (III) | |||
| Transfected construct (D. melanogaster) | NA | NA | NA | NA | |||
| Biological sample (D. melanogaster) | larval hemolymph (blood) | NA | NA | Hemocytes from hemolymph of third instar (96 and 120 hr AEL) larvae | |||
| Antibody | L1abc (mouse monoclonal) | Prof. Istvan Andó | PMID:18297797 | 1:100 dilution | |||
| Antibody | anti-PPO2 (mouse monoclonal) | Prof. Istvan Andó | PMID:18297797 | 1:1000 dilution | |||
| Antibody | anti-Hindsight (mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# 1G9 | 1:10 dilution | |||
| Antibody | anti-Mys (mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# CF-6G11 | 1:10 dilution | |||
| Recombinant DNA reagent | NA | NA | NA | NA | |||
| Sequence-based reagent | CecC (primer) | FlyPrimerBank | PD41779 | For: GCATTGGACAATCGGAAGCC Rev: TTGCGCAATTCCCAGTCCTT | |||
| Sequence-based reagent | Drs (primer) | FlyPrimerBank | PD40133 | For: CTGGGACAACGAGACCTGTC Rev: ATCCTTCGCACCAGCACTTC | |||
| Sequence-based reagent | Mtk (primer) | FlyPrimerBank | PD41985 | For: GCTACATCAGTGCTGGCAGA Rev: TTAGGATTGAAGGGCGACGG | |||
| Sequence-based reagent | CG43236 (primer) | FlyPrimerBank | PD41670 | For: GCAAGAGTTTGGATGCCACC Rev: GCCTCATATCGAAAGGATTGCG | |||
| Sequence-based reagent | stg (primer) | FlyPrimerBank | PB60117 | For: GAAAACAACTGCAGCATGGAT Rev: CGACAGCTCCTCCTGGTC | |||
| Sequence-based reagent | polo (primer) | FlyPrimerBank | PP7029 | For: CCCGAGGATAAGAGCACGGA Rev: GTCGTCGGTTTCCACATCG | |||
| Sequence-based reagent | MMP1 (primer) | FlyPrimerBank | PP18419 | For: CCAGTTCGGCTATCTACCCG Rev: CTCGATGGCACTCACCCAG | |||
| Sequence-based reagent | Ance (primer) | FlyPrimerBank | PP22471 | For: GTGATACCACCAAGTTCCAATGG Rev: GGCATAGTCGTCTTCAGGTAGAG | |||
| Sequence-based reagent | GstE6 (primer) | FlyPrimerBank | PP10905 | For: TACGGTTTGGACCCCAGTC Rev: ATATTCCGGTGAAAGTTGGGC | |||
| Sequence-based reagent | Arc1 (primer) | FlyPrimerBank | PP10071 | For: ATGGCCCAGCTTACACAGATG Rev: GGAGAAGTTGCCTTTGCCTC | |||
| Sequence-based reagent | Prx2540-1 (primer) | FlyPrimerBank | PD40349 | For: ATGATCCTGCCCACTGTCAC Rev: CAGTGGTGCGGACGTAGTTT | |||
| Sequence-based reagent | Ubx (primer) | FlyPrimerBank | PP12922 | For: ATGAACTCGTACTTTGAACAGGC Rev: CCAGCGAGAGAGGGAATCC | |||
| Sequence-based reagent | Cpx (primer) | FlyPrimerBank | PD40622 | For: CGCGAGAAGATGAGGCAAGA Rev: CATCAGGGGATTGGGCTCTT | |||
| Sequence-based reagent | mthl7 (primer) | FlyPrimerBank | PP15001 | For: AGTTTGGGGACGGTTCGATTA Rev: TGAGACCATCATCGCATTTTCC | |||
| Sequence-based reagent | Cys (primer) | FlyPrimerBank | PP22082 | For: GGATGCCACTCTCGCACAG Rev: GGTGTTAAGACTTCCAGCTACG | |||
| Sequence-based reagent | bnl (primer) | NA | NA | For: AACCCAAATCCAATCCCAAT Rev: GATGCTGTTGCTGTTGCTGT | |||
| Sequence-based reagent | btl (primer) | NA | NA | For: GAGTCGATCCCTGAAGTTGC Rev: GCAGTTGCCCCACTGTTAAT | |||
| Sequence-based reagent | RpL32/rp49 (primer) | FlyPrimerBank | PD41810 | For: AGCATACAGGCCCAAGATCG Rev: TGTTGTCGATACCCTTGGGC | |||
| Peptide, recombinant protein | NA | NA | NA | NA | |||
| Commercial assay or kit | Chromium Single Cell 3’ Library and Gel Bead Kit v2 | 10x Genomics | PN-120267 | NA | |||
| Commercial assay or kit | Chromium i7 Multiplex Kit | 10x Genomics | PN-120262 | NA | |||
| Commercial assay or kit | Chromium Single Cell A Chip Kit | 10x Genomics | PN-1000009 | NA | |||
| Chemical compound, drug | NA | NA | NA | NA | |||
| Software, algorithm | Seurat | Stuart et al., 2019 | PMID:31178118 | NA | |||
| Software, algorithm | Harmony | Korsunsky et al., 2019 | PMID:31740819 | NA | |||
| Software, algorithm | Monocle 3 | Cao et al., 2019 | PMID:30787437 | NA | |||
| Software, algorithm | Jalview | Waterhouse et al., 2009 | PMID:19151095 | NA | |||
| oftware, algorithm | Biorender | https://biorender.com/ | NA | Biorender was utilized to make the schematic diagrams used in this study. | |||
| Other | DAPI (nuclear stain) | Vector Laboratories | Cat# H-1200 | Ready to use | |||
| Other | Phalloidin | ThermoFischer | Cat# A34055 | 1:100 dilution | |||
| Other | Optiprep | AxisShield | AXS-1114542 | Working concentration: 1.09 g/ml | |||
| Other | SyBr Green | Bio-Rad iQ SYBR Green Supermix | Cat# 1708880 | Working concentration: 1X | |||
Additional files
-
Supplementary file 1
Table representing number of cells, genes, reads, and unique molecular identifiers (UMIs) recovered per cell per sample.
- https://cdn.elifesciences.org/articles/54818/elife-54818-supp1-v2.xlsx
-
Supplementary file 2
Table representing the top marker genes per cluster pertaining to Figure 1C and D. One cluster per sheet.
- https://cdn.elifesciences.org/articles/54818/elife-54818-supp2-v2.xlsx
-
Supplementary file 3
Table representing the Differentially Expressed Genes per cluster across all conditions pertaining to Figure 2 and its supplement.
- https://cdn.elifesciences.org/articles/54818/elife-54818-supp3-v2.xlsx
-
Supplementary file 4
Table representing differentially expressed genes across all conditions in PPO1low and PPO1highcrystal cells.
- https://cdn.elifesciences.org/articles/54818/elife-54818-supp4-v2.xlsx
-
Supplementary file 5
Table representing differentially expressed genes across all conditions in lamellocyte clusters.
- https://cdn.elifesciences.org/articles/54818/elife-54818-supp5-v2.xlsx
-
Supplementary file 6
Table representing the gene enrichment analysis pertaining to Figure 6A and Figure 3—figure supplement 2F.
- https://cdn.elifesciences.org/articles/54818/elife-54818-supp6-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/54818/elife-54818-transrepform-v2.docx
