(a) Crystal structure of a single subunit of E. coli Tn5 Transposase (PDB code 1MM8) complexed with ME DNA duplex, and zoom-in views of the conserved catalytic core of Tn5 transposase, HIV-1 …
qPCR Ct values of tagmentation products of samples under different conditions in Figure 1d and e.
(a) Denaturing (8 M urea) polyacrylamide gel analysis of reverse transcription products of an in vitro transcribed mRNA (IRF9). Lane 1: ssRNA marker. Lane 2: in vitro transcribed mRNA (IRF9). Lane 3 …
(a) Workflow of TRACE-seq. (b) Gene expression, measured by three technical replicates of TRACE-seq with 200 ng total RNA as input, are shown as scatter plots in the upper right half. Pearson's …
Distribution of reads across known genome features for NEBNext Ultra II RNA kit, Smart-seq2 and TRACE-seq with different amount of RNA as input.
(a) Gene expression measured by two technical replicates of TRACE-seq with 20 ng total RNA as input are shown as scatter plots. Pearson's product-moment correlations are displayed in the upper left …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Cell line (Homo-sapiens) | HEK293T | American Type Culture Collection | Cat#: CRL-11268, RRID:CVCL_1926 | |
Antibody | Mouse anti-DNA-RNA Hybrid [S9.6] Antibody | Kerafast | Cat#: ENH001, RRID:AB_2687463 | 1:2000 |
Antibody | Antibody Anti-mouse-IgG-HRP | CWBiotech | Cat#: CW0102, RRID:AB_2736997 | 1:3000 |
Recombinant DNA reagent | CLuc Control Template | NEB | Cat#: E2060S | |
Sequence-based reagent | CLuc Control_F | This paper | PCR primers | TAATACGACTCACTATAGGG |
Sequence-based reagent | CLuc Control_R | This paper | PCR primers | TTAGCTTCACAGGAAGTTGG |
Sequence-based reagent | GAPDH-qFWD | This paper | PCR primers | GCATCCTGGGCTACACTGAG |
Sequence-based reagent | GAPDH-qRVS | This paper | PCR primers | AAAGTGGTCGTTGAGGGCAA |
Sequence-based reagent | ACTB-qFWD | This paper | PCR primers | AGTCATTCCAAATATGAGATGCGTT |
Sequence-based reagent | ACTB-qRVS | This paper | PCR primers | TGCTATCACCTCCCCTGTGT |
Sequence-based reagent | CYC1-qFWD | This paper | PCR primers | CACCATAAAGCGGCACAAGT |
Sequence-based reagent | CYC1-qRVS | This paper | PCR primers | CAGGATGGCAAGCAGACACT |
Sequence-based reagent | Tn5ME-A | doi: 10.1186/gb-2010-11-12-r119 | Transposon adaptor oligonucleotides | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
Sequence-based reagent | Tn5ME-B | doi: 10.1186/gb-2010-11-12-r119 | Transposon adaptor oligonucleotides | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG |
Sequence-based reagent | Tn5MErev | doi: 10.1186/gb-2010-11-12-r119 | Transposon adaptor oligonucleotides | CTGTCTCTTATACACATCT |
Sequence-based reagent | Tn5_qFWD | This paper | PCR primers | AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC |
Sequence-based reagent | Tn5_qRVS | This paper | PCR primers | CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG |
Sequence-based reagent | TSO | doi:10.1038/nprot.2014.006 | Template switch primer | AAGCAGTGGTATCAACGCAGAGTACATrGrG+G |
Sequence-based reagent | ISPCR oligo | doi:10.1038/nprot.2014.006 | PCR primers | AAGCAGTGGTATCAACGCAGAGT |
Sequence-based reagent | oligo dT(23)VN primer | NEB | Cat#: S1327S | |
Sequence-based reagent | Random primer mix | NEB | Cat#: S1330S | |
Sequence-based reagent | N501 primer | Illumina | PCR primers for sequencing | |
Sequence-based reagent | N701-N712 primers | Illumina | PCR primers for sequencing | |
Commercial assay or kit | TRIzol | Invitrogen | Cat#: 15596018 | |
Commercial assay or kit | Blood & Cell Culture DNA Midi Kit | Qiagen | Cat#: 13343 | |
Commercial assay or kit | MAXIscript T7 Transcription Kit | Invitrogen | Cat#: AM1314M | |
Commercial assay or kit | SUPERase-In RNase Inhibitor | Invitrogen | Cat#: AM2696 | |
Commercial assay or kit | Quant-iT PicoGreen dsDNA Assay Kit | Invitrogen | Cat#: P11496 | |
Commercial assay or kit | AceQ Universal SYBR qPCR Master Mix | Vazyme | Cat#: Q511-02 | |
Commercial assay or kit | pEASY-Blunt Zero Cloning Kit | TransGen | Cat#: CB501-01 | |
Commercial assay or kit | NEBNext Q5 Hot Start HiFi PCR Master Mix | NEB | Cat#: M0544 | |
Commercial assay or kit | Agencourt AMPure XP beads | Beckman Coulter | Cat#: A63882 | |
Commercial assay or kit | RNAClean XP beads | Beckman Coulter | Cat#: A63987 | |
Commercial assay or kit | Qubit dsDNA HS Assay kit | Invitrogen | Cat#: Q33230 | |
Commercial assay or kit | DNF-474 High Sensitivity NGS Fragment Analysis Kit | Agilent | Cat#: DNF-473-1000 | |
Commercial assay or kit | NEBNext Ultra II RNA Library Prep Kit for Illumina | NEB | Cat#: E7770S | |
Commercial assay or kit | Dynabeads Oligo(dT)25 | Invitrogen | Cat#: 61005 | |
Commercial assay or kit | KAPA HiFi HotStart ReadyMix | KAPA Biosystems | Cat#: KK2601 | |
Commercial assay or kit | TransDetect PCR Mycoplasma Detection Kit | TransGen | Cat#: FM311-01 | |
Commercial assay or kit | RNA 6000 Pico kits (Agilent Technologies | Agilent | Cat#: 5067-1513 | |
Peptide, recombinant protein | DNase I | NEB | Cat#: M0303S | |
Peptide, recombinant protein | SuperScript IV reverse transcriptase | Invitrogen | Cat#: 12594100 | |
Peptide, recombinant protein | SuperScript II reverse transcriptase | Invitrogen | Cat#: 18064022 | |
Peptide, recombinant protein | RNase H | NEB | Cat#: M0297 | |
Peptide, recombinant protein | TruePrep Tagment Enzyme | Vazyme | Cat#: S601-01 | |
Peptide, recombinant protein | Bst 3.0 DNA Polymerase | NEB | Cat#: M0374S | |
Chemical compound, drug | PEG200 | Sigma | Cat#: 88440 | |
Chemical compound, drug | PEG8000 | Sigma | Cat#: 89510 | |
Software, algorithm | Trim Galore | http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | RRID:SCR_011847 | v0.6.4_dev |
Software, algorithm | STAR | PMID:23104886 | RRID:SCR_015899 | v2.7.1a |
Software, algorithm | bowtie2 | https://doi.org/10.1038/nmeth.1923 | RRID:SCR_005476 | v2.2.9 |
Software, algorithm | Samtools | http://samtools.sourceforge.net/ | RRID:SCR_002105 | v1.9 |
Software, algorithm | cuffnorm | PMID:20436464 | RRID:SCR_014597 | v2.2.1 |
Software, algorithm | QoRTs | https://doi.org/10.1186/s12859-015-0670-5 | RRID:SCR_018665 | v1.1.6 |
Software, algorithm | RseQC | PMID:22743226 | RRID:SCR_005275 | v2.6.4 |
Software, algorithm | Picard Tools | http://broadinstitute.github.io/picard/ | RRID:SCR_006525 | v2.20.6 |
Software, algorithm | Preseq | PMID:23435259 | RRID:SCR_018664 | v2.0.0 |
Software, algorithm | RStudio | https://rstudio.com/ | RRID:SCR_000432 | 1.2.5033 |
Software, algorithm | Integrative Genomics Viewer | http://software.broadinstitute.org/software/igv/ | RRID:SCR_011793 | v2.4.16 |
Quality control of the sequencing results using different enzymes for strand extension and PCR in TRACE-seq library construction procedure.
Quality control of the sequencing results using NEBNext kit and TRACE-seq.
Quality control of the sequencing results using Smart-seq2 and TRACE-seq.
Costs of RNA-seq constructed by NEBNext Ultra II RNA kit, TRACE-seq and Smart-seq2.
List of housekeeping genes.