Par protein localization during the early development of Mnemiopsis leidyi suggests different modes of epithelial organization in the metazoa
- The Whitney Laboratory for Marine Bioscience, and the Department of Biology, University of Florida, United States
Figures
Figure 1 with 3 supplements
Evolution of cell polarity components during animal evolution.
(A) Three major evolutionary steps (left side) that might have changed the organization of cell polarity in the Metazoa. The diagram (right side) depicts the subcellular asymmetric localization of …
Figure 1—figure supplement 1
Phylogenetic analysis for (A) MlPar-6 and (B) MlPar-1.
Trees were constructed using MrBayes (v3.2.6 × 64) and consisted of 2,000,000 generations using ‘mixed’ models. Maximum-likelihood tree bootstraps were based on 100 replicates. Aq: Amphimedon …
Figure 1—figure supplement 2
Protein sequence alignment for MlPar-6.
Protein domains were predicted by Geneious software using Pfam and SMART databases. Aq: Amphimedon queenslandica; Cel: Caenorhabditis elegans; Ct: Capitella teleta; Dmel: Drosophila melanogaster; …
Figure 1—figure supplement 3
Protein sequence alignment for MlPar-1.
Protein domains were predicted by Geneious software using Pfam and SMART databases. Aq: Amphimedon queenslandica; Cel: Caenorhabditis elegans; Ct: Capitella teleta; Dmel: Drosophila melanogaster; …
Figure 2 with 12 supplements
MlPar-6 protein subcellular localization during the early development of M. leidyi.
Immunostaining against MlPar-6 protein shows that this protein localizes asymmetrically in the cell cortex of the eggs (A) and in the cell-contact-free regions of cleavage stages (B–C; white …
Figure 2—figure supplement 1
Diagram depicting the cortical localization of MlPar-6 (magenta).
(A) Cleavage stages and (B) gastrulation. Animal pole is to the top. Ectoderm is colored in grey. Endoderm and ‘mesoderm’ are colored in yellow and red, respectively. Blue arrows depict gastrulation …
Figure 2—figure supplement 2
Specificity of M. leidyi antibodies as tested by pre-adsorption experiments.
Genome searches of M. leidyi showed that there is only a single copy for both Par-6 (MlPar-6) and Par-1 (MlPar-1) genes and they express through development in the transcriptome of M. leidyi (Babonis…
Figure 2—figure supplement 3
MlPar-6 localization during early developmental stages.
(A–E) Immunostaining against MlPar-6 during cleavage stages of M. leidyi development complimentary to Figure 2. (A–D) MlPar-6 protein localizes to the apical cortex (white arrows) until the 60 …
Figure 2—figure supplement 4
MlPar-6 localization during late gastrulation stages.
Complimentary to Figure 2. MlPar-6 protein localizes to the apical cortex of the ectodermal cells (Ecto) but is absent from endodermal (Endo) and ‘mesodermal’ (‘Meso’) cells. 5 to 7 hpf (A–D): MlPar-…
Figure 2—figure supplement 5
MlPar-6 localization during late developmental stages.
Complimentary to Figure 2. (A–C) Immunostaining against MlPar-6 shows that MlPar-6 protein localizes to the apical cortex (white arrows) until nine hpf. 8–9 hpf images in (A) and (C) are single …
Figure 2—figure supplement 6
Immunofluorescent staining against MlPar-6 after 20 hpf.
The distribution of MlPar-6 in juvenile epithelium is nuclear and cytosolic during later stages. Neither asymmetrical nor cortical localization was observed. a’ and b’ correspond to the …
Figure 2—figure supplement 7
Schematic depiction of fluorescent intensity measurements correspondent to Figure 2.
(A) Depiction of the measurement direction during early stages. 0 is the vegetal pole and one is the animal pole in a’ (Figure 2—figure supplements 8–10). 0 and 1 in b’ are arbitrary along the …
Figure 2—figure supplement 8
Fluorescent intensity measurements of immunofluorescent staining against MlPar-6.
Fluorescent intensity (Y axis) was measured along the vegetal/animal and basal/apical axes (X axis) for the developmental stages reported in Figure 2 and Figure 2—figure supplements 1–6. All …
-
Figure 2—figure supplement 8—source data 1
Numerical data that are represented as a graph in Figure 2—figure supplement 8.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig2-figsupp8-data1-v3.xlsx
Figure 2—figure supplement 9
Fluorescent intensity distribution of immunofluorescent staining against MlPar-6.
The distribution of the MlPar-6 antibody signal was obtained by plotting Fluorescent intensity data from Figure 2—figure supplement 8 (Y axis) in intervals along the vegetal/animal and basal/apical …
-
Figure 2—figure supplement 9—source data 1
Numerical data that are represented as a graph in Figure 2—figure supplement 9.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig2-figsupp9-data1-v3.pzfx
Figure 2—figure supplement 10
Graphical depiction of fluorescence intensity measurements between basal and apical cortex.
Different MlPar-6 localization between basal and apical cortex for each stage represented in Figure 2 and Figure 2—figure supplement 8. Median, 95% CI, and P values are depicted in the figure. …
-
Figure 2—figure supplement 10—source data 1
Numerical and statistical data that are represented as graphs in Figure 2—figure supplement 10.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig2-figsupp10-data1-v3.pzfx
Figure 2—figure supplement 11
Fluorescent intensity measurements of immunofluorescent staining against MlPar-6 during cell cycle.
-
Figure 2—figure supplement 11—source data 1
Numerical data that are represented as a graph in Figure 2—figure supplement 11.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig2-figsupp11-data1-v3.xlsx
Figure 2—figure supplement 12
Western blot analyses for the tested antibodies.
(A) Coomassie stained gel of the full input lysate. (B) Full Western blot lanes for the MlPar-6 and MlPar-1 antibodies sections shown in Figure 2—figure supplement 2.
Figure 3 with 6 supplements
MlPar-1 protein subcellular localization during the early development of M. leidyi.
Immunostaining against MlPar-1 protein shows that this protein remains cytoplasmic during early cleavage stages (A–D). MlPar-1 protein appears as punctate aggregations distributed uniformly in the …
Figure 3—figure supplement 1
Diagram depicting the cortical localization of MlPar-1 (magenta).
(A) Cleavage stages and (B) gastrulation. (B) Ectoderm is colored in grey. Endoderm and ‘mesoderm’ are colored in yellow and red, respectively. Animal pole is to the top. For simplicity, most of the …
Figure 3—figure supplement 2
MlPar-1 localization during developmental stages complementary to Figure 3.
(A–D) Immunostaining against MlPar-1 during cleavage stages of M. leidyi development shows that MlPar-1 protein appears as punctate aggregations distributed uniformly in the cytosol (white arrows). …
Figure 3—figure supplement 3
MlPar-1 protein remains cytoplasmic during M. leidyi development between 8 hpf and 11 hpf.
(A–C) MlPar-1 protein remains as punctate aggregations distributed uniformly in the cytosol (white arrows). Images are maximum projections from a z-stack confocal series. a’ and b’ correspond to the …
Figure 3—figure supplement 4
Immunofluorescent staining against MlPar-1 after 20 hpf.
The distribution of MlPar-1 in juvenile epithelium is cytosolic during later stages, similar to Figure 3—figure supplement 3F–G. Neither asymmetrical nor cortical localization was observed. a’ and …
Figure 3—figure supplement 5
Fluorescent intensity measurements correspondent to Figure 3.
Fluorescent intensity (Y axis) was measured along the basal/apical axes (X axis) for the developmental stages reported in Figure 3. Numerical data can be found in Figure 3—figure supplement 5—source …
-
Figure 3—figure supplement 5—source data 1
Numerical data that are represented as graphs in Figure 3—figure supplement 5.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig3-figsupp5-data1-v3.xlsx
-
Figure 3—figure supplement 5—source data 2
Numerical and statistical data that are represented as graphs in Figure 3—figure supplement 5.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig3-figsupp5-data2-v3.pzfx
Figure 3—figure supplement 6
Schematic depiction of fluorescent intensity measurements correspondent to Figure 3.
Figure 4 with 2 supplements
Expression of ctenophore MlPar6-mVenus and MlPar1-mCherry in embryos of the cnidarian N. vectensis.
The translated exogenous proteins display the same pattern than the previously described for endogenous N. vectensis proteins (A–D). White arrowheads indicate MlPar6-mVenus and MlPar1-mCherry …
Figure 4—figure supplement 1
Evolution of cell polarity in Metazoa.
Diagram depicting the evolution of different interactions between known signaling pathways that organize cell polarity in animal cells (see references), including the new information obtained by …
Figure 4—figure supplement 2
Fluorescent intensity measurements correspondent to Figure 4.
Fluorescent intensity (Y axis) was measured along the basal/apical axes (X axis) for the developmental stages reported in Figure 4. All measured cells display asymmetric localization of MlPar-6-mVenu…
-
Figure 4—figure supplement 2—source data 1
Numerical data that are represented as graphs in Figure 4—figure supplement 2.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig4-figsupp2-data1-v3.xlsx
-
Figure 4—figure supplement 2—source data 2
Numerical and statistical data that are represented as graphs in Figure 4—figure supplement 2.
- https://cdn.elifesciences.org/articles/54927/elife-54927-fig4-figsupp2-data2-v3.pzfx
Author response image 1
Author response image 2
Videos
Video 1
Punctuate aggregates of MlPar-1-mCherry are highly dynamic.
2.5 min in vivo recording of a gastrula embryo at 40x.
Video 2
Z-stack of MlPar-1-mCherry expression at 24 hpf at 40X.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Mouse Anti-alpha-Tubulin Monoclonal Antibody, Unconjugated, Clone DM1A | Sigma-Aldrich | T9026; RRID:AB_477593 | (1:500) |
| Antibody | anti-MlPar-6 custom peptide antibody produced in rabbit | Bethyl labs; This study | Stored at MQ Martindale's lab; (1:100) | |
| Antibody | anti-MlPar-1 custom peptide antibody produced in rabbit | Bethyl labs; This study | Stored at MQ Martindale's lab; (1:100) | |
| Antibody | Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | A-11004; RRID:AB_2534072 | (1:250) |
| Antibody | Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 647 | Thermo Fisher Scientific | A-21245; RRID:AB_2535813 | (1:250) |
| Other | DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride) | Thermo Fisher Scientific | D1306; RRID:AB_2629482 | (0.1 µg/µl) |
| Chemical compound, drug | Dextran, Alexa Fluor 488; 10,000 MW, Anionic, Fixable | Thermo Fisher Scientific | D22910 | |
| Chemical compound, drug | Dextran, Alexa Fluor 555; 10,000 MW, Anionic, Fixable | Thermo Fisher Scientific | D34679 | |
| Chemical compound, drug | Dextran, Alexa Fluor 647; 10,000 MW, Anionic, Fixable | Thermo Fisher Scientific | D22914 | |
| Chemical compound, drug | Dextran, Cascade Blue, 10,000 MW, Anionic, Lysine Fixable | Thermo Fisher Scientific | D1976 | |
| Sequence-based reagent | Mlpar-6: F-GTACTGTGCTGTGTGTTTGGA; R- GTACTGTGCTGTGTGTTTGGA | Mnemiopsis Genome Project - NIH-NHGRI | MLRB351777 | |
| Sequence-based reagent | Mlpar-1: F- ATGTCAAATTCTCAACACCAC; R- CAGTCTTAATTCATTAGCTATGTTA | Mnemiopsis Genome Project - NIH-NHGRI | MLRB182569 | |
| Recombinant DNA reagent | pSPE3-mVenus | Roure et al., 2007 | Gateway vector | |
| Recombinant DNA reagent | pSPE3-mCherry | Roure et al., 2007 | Gateway vector | |
| Software, algorithm | Fiji (ImageJ) | NIH | http://fiji.sc | |
| Software, algorithm | Imaris 7.6.4 | Bitplane Inc |
