Tgfb3 collaborates with PP2A and notch signaling pathways to inhibit retina regeneration
- Michigan Neuroscience Institute and Department of Biological Chemistry, University of Michigan, United States
Figures
Figure 1 with 1 supplement
pSmad3 expression in the uninjured and injured retina.
(A) Retinal section from uninjured gfap:GFP fish retina with GFP (green) and pSmad3 (red) immunofluorescence. Arrowheads point to pSmad3 expressing MG. (B) pSmad3 immunofluorescence in uninjured and …
Figure 1—figure supplement 1
Alk5-dependent pSmad3 expression.
(A) Inhibition of Tgfb receptor kinase activity suppresses pSmad3 expression. Two different Alk5 kinase inhibitors were tested. pSmad3 immunofluorescence is shown on retinal sections from uninjured …
Figure 2 with 1 supplement
Injury-dependent regulation of tgfb gene expression.
(A) RNAseq was used to quantify tgfb gene expression in FACS purified GFP+ MG isolated from uninjured and injured (2 dpi) gfap:GFP and 1016 tuba1a:GFP fish retinas, respectively. Fold change in gene …
Figure 2—figure supplement 1
tgfb gene expression in uninjured and injured retina.
(A) RT-PCR shows time course of tgfb3 and gapdh RNA expression in uninjured and injured retina. (B) tgfb3 RNA expression in retinas isolated at different times post injury using zop:nsfb-EGFP …
Figure 3 with 1 supplement
tgfb3 expression in developing and adult retina.
(A) tgfb3 in situ hybridization identifies tgfb3 expression in lens at 24 hpf (hours post fertilization) and in MG beginning ~10 dpf (days post fertilization). This latter expression continues to …
Figure 3—figure supplement 1
Tgfb3 knockdown and tgfb3 gene editing do not affect MG differentiation.
(A) Effect of Tgfb3 knockdown on expression of MG differentiation at 6 dpf. Single cell zebrafish embryos were injected with the indicated MOs and assayed 6 days later for glutamine sythetase (GS) …
Figure 4 with 1 supplement
Tgfb3 suppresses MG proliferation and reprogramming gene expression.
(A) Top illustration is experimental time line. Bottom panels are BrdU immunofluorescence in injured and heat shock-treated Wt and hsp70:tgfb3 transgenic fish. Asterisk marks injury site. Scale bar …
Figure 4—figure supplement 1
tgfb3 gene expression in hsp70:tgfb3 fish.
(A) Heat shock induction of tgfb3 RNA in hsp70:tgfb3 transgenic fish. Top illustration is experimental time line. Bottom graph is qPCR quantification of tgfb3 gene expression. (B) Tgfb3 knockdown …
Figure 5 with 1 supplement
Tgfb1b and Tgfb3 stimulate pSmad3 expression, but only Tgfb3 inhibits injury-dependent MG proliferation.
(A) Top illustration is experimental time line. Bottom panels show BrdU immunofluorescence on retinal sections from uninjured and injured, heat shock-treated Wt, hsp70:tgfb1b, and hsp70:tgfb3 …
Figure 5—figure supplement 1
Heat shock induced tgfb1b gene expression in hsp70:tgfb1b fish.
(A) Top illustration is experimental time line. Bottom graph is qPCR quantification of tgfb1b gene expression. (B) Top illustration is experimental time line. Bottom graph is qPCR analysis of the …
Figure 6 with 1 supplement
Alk5 and PP2A inhibition rescues Tgfb3-mediated inhibition of MG proliferation in the injured retina.
(A) Experimental time line. (B) Edu click chemistry identifies proliferating MG in retinal sections from injured Wt and hsp70:tgfb3 transgenic fish treated with heat shock, +/- okadaic acid (OKA), …
Figure 6—figure supplement 1
Injury-dependent regulation of PP2A subunit and p38 MAPK RNA expression and effect of okadaic acid on cell death in injured retina.
(A) RNAseq data quantifying expression of RNAs encoding various subunits of PP2A and p38 MAPK isoforms, mapk14a and mapk14b at 0 and 2 dpi. (B) Quantification of TUNEL+ cells in injured retinas …
Figure 7
Tgfb3 acts upstream of Notch signaling to inhibit MG proliferation.
(A) Top illustration is experimental time line. Bottom panels show mCherry immunofluorescence on retinal sections from either injured tp1:mCherry or hsp70:tgfb3;tp1:mCherry transgenic fish. Asterisk …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Danio rerio) | 1016 tuba1a:GFP | Fausett and Goldman, 2006 | ||
| Strain, strain background (Danio rerio) | gfap:GFP | Kassen et al., 2007 | ||
| Strain, strain background (Danio rerio) | tp1:mCherry | Parsons et al., 2009 | ||
| Strain, strain background (Danio rerio) | zop:nsfb-EGFP | Montgomery et al., 2010 | ||
| Strain, strain background (Danio rerio) | hsp70:ca-Alk5 | Zhou et al., 2011 | ||
| Strain, strain background (Danio rerio) | hsp70:tgfb1b | This paper; Figure 5 | tgfb1b expressed under the hsp70 promoter; generated using Tol2-mediated transgenesis -Goldman lab | |
| Strain, strain background (Danio rerio) | hsp70:tgfb3 | This paper; Figure 4 | tgfb3 expressed under the hsp70 promoter; generated using Tol2-mediated transgenesis – Goldman lab | |
| Sequence-based reagent | Tgfb3-MO | Gene Tools, LLC | Lissamine-tagged, tgfb3-targeting Morpholino 5’TGCATGGTTAA TATCTGCACACTAT | |
| Sequence-based reagent | Tgfb1b-MO | Gene Tools, LLC | Lissamine-tagged, tgfb1b-targeting Morpholino 5’AAGGATAGTG CCACTCACTCATTGT | |
| Sequence-based reagent | T7 universal gRNA primer | Sigma-Aldrich | T7 universal gRNA primer 5’-AAAAGCACCGACTCGGTG CCACTTTTTCAAGTTGATAAC GGACTAGCCTTATTTTAACTT GCTATTTCTAGCTCTAAAAC-3’ | |
| Sequence-based reagent | tgfb3 gRNA one primer | Sigma-Aldrich | tgfb3 gRNA one primer: 5’-TAATACGACTCACTAT AGGGCACCTGACTAGGG CCCAGTTTTAGAGCTAGAA | |
| Sequence-based reagent | tgfb3 gRNA two primer | Sigma-Aldrich | tgfb3 gRNA two primer: 5’-TAATACGACTCACTAT AGGCCCTCTACAACAGC ACCAGTTTTAGAGCTAGAA | |
| Sequence-based reagent | PCR primers | See Materials and Methods - Primers and Morpholinos section below | ||
| Recombinant DNA reagent | pCS2+ tgfb3-EGFP | This paper; Figure 3—figure supplement 1B | Vector for generating RNA that has tgfb3 MO target sequence appended to the 5’ end of the EGFP mRNA coding sequence - Goldman lab. | |
| Recombinant DNA reagent | pCS2-nCas9n-nanos3’UTR | Addgene, Plasmid #62542 | Plasmid #62542 | |
| Antibody | anti-pSmad3, rabbit monoclonal | Abcam | Cat. # ab52903 RRID:AB_882596 | 1/200 dilution |
| Antibody | Zpr-1, mouse monoclonal | Zebrafish International Resource Center | Cat. # zpr-1 RRID:AB_10013803 | 1/500 dilution |
| Antibody | Zn-5, mouse monoclonal | Zebrafish International Resource Center | Cat. # zn-5 RRID:AB_10013770 | 1/1000 dilution |
| Antibody | anti-HuC/D, rabbit polyclonal | Abcam | Cat. # ab210554 RRID:AB_210554 | 1/500 dilution |
| Antibody | anti-PKCβ1, mouse monoclonal | Santa Cruz Biotechnology | Cat. # SC-8049 RRID:AB_628143 | 1/200 dilution |
| Antibody | anti-glutamine synthetase (GS), mouse monoclonal | Sigma-Aldrich | Cat. # MAB302 RRID:AB_2110656 | 1/500 dilution |
| Antibody | anti-SOX9, rabbit polyclonal | Millipore Sigma | Cat. # AB5535 RRID:AB_2239761 | 1/500 dilution |
| Antibody | anti-BrdU, rat monoclonal | Thermo Fisher | Cat. # MA 182088 RRID:AB_927214 | 1/500 dilution |
| Antibody | anti-BrdU, mouse monoclonal | Thermo Fisher | Cat. # B35128 RRID:AB_2536432 | Clone MoBu-1 for co-staining with EdU Click-it Chemistry, 1/500 dilution |
| Chemical compound, drug | SB431542 | Fisher Scientific | Cat # 16–141 | Tgfb signaling inhibitor |
| Chemical compound, drug | SB505124 | Fisher Scientific | Cat # 32-631-0 | Tgfb signaling inhibitor |
| Chemical compound, drug | RO4929097 | Cayman Chemical | Cat # 19996 | Notch signaling inhibitor |
| Chemical compound, drug | okadaic acid | Cell Signaling Technology | Cat # 5934 | PP2A inhibitor |
| Chemical compound, drug | PD169316 | Cayman Chemical | Cat # 10006727 | P38 MAPK inhibitor |
| Commercial assay or kit | mMESSAGE mMACHINESP6 Transcription Kit | Invitrogen | Cat # AM1340 | mRNA synthesis |
| Commercial assay or kit | Megascript T7 Transcription Kit | Invitrogen | Cat # AM1334 | mRNA synthesis |
| Commercial assay or kit | In situ cell death, fluorescein | Sigma Aldrich | Cat # 11684795910 | TUNEL assay |
