1. Stem Cells and Regenerative Medicine
Download icon

Tgfb3 collaborates with PP2A and notch signaling pathways to inhibit retina regeneration

  1. Mi-Sun Lee
  2. Jin Wan
  3. Daniel Goldman  Is a corresponding author
  1. Michigan Neuroscience Institute and Department of Biological Chemistry, University of Michigan, United States
Research Article
  • Cited 0
  • Views 661
  • Annotations
Cite this article as: eLife 2020;9:e55137 doi: 10.7554/eLife.55137

Abstract

Neuronal degeneration in the zebrafish retina stimulates Müller glia (MG) to proliferate and generate multipotent progenitors for retinal repair. Controlling this proliferation is critical to successful regeneration. Previous studies reported that retinal injury stimulates pSmad3 signaling in injury-responsive MG. Contrary to these findings, we report pSmad3 expression is restricted to quiescent MG and suppressed in injury-responsive MG. Our data indicates that Tgfb3 is the ligand responsible for regulating pSmad3 expression. Remarkably, although overexpression of either Tgfb1b or Tgfb3 can stimulate pSmad3 expression in the injured retina, only Tgfb3 inhibits injury-dependent MG proliferation; suggesting the involvement of a non-canonical Tgfb signaling pathway. Furthermore, inhibition of Alk5, PP2A or Notch signaling rescues MG proliferation in Tgfb3 overexpressing zebrafish. Finally, we report that this Tgfb3 signaling pathway is active in zebrafish MG, but not those in mice, which may contribute to the different regenerative capabilities of MG from fish and mammals.

Introduction

Blinding eye diseases like macular degeneration, glaucoma, and diabetic retinopathy result in retinal neuron death which leads to vision loss. Unlike mammals, zebrafish have a remarkable ability to regenerate neurons that were lost due to injury or disease (Goldman, 2014; Lenkowski and Raymond, 2014; Wan and Goldman, 2016). Key to this regenerative response are Müller glia (MG) the major glial cell type in the retina of both fish and mammals. The normal function of MG is to maintain retinal structure and homeostasis (Bringmann et al., 2009; MacDonald et al., 2015; Reichenbach and Bringmann, 2013). However, in fish, MG respond to retinal injury by dividing and generating multipotent progenitors for neuron regeneration (Bernardos et al., 2007; Fausett and Goldman, 2006; Fimbel et al., 2007; Powell et al., 2016Ramachandran et al., 2010bRaymond et al., 2006).

Although it is not known why MG from fish and mammals respond differently to retinal injury, it likely results from differences in their environment and intrinsic differences that are reflected in their gene expression programs. Unlike mammals, the zebrafish retina continues to grow throughout life and this growth-permissive environment may impact MG’s potential to mount a regenerative response (Hitchcock and Raymond, 2004). Zebrafish MG themselves also appear to contribute to a pro-regenerative environment by releasing growth factors and cytokines after retinal injury (Calinescu et al., 2009; Kaur et al., 2018; Nelson et al., 2013; Ramachandran et al., 2011; Wan et al., 2012; Wan et al., 2014; Zhao et al., 2014). Dying neurons and immune cells may also contribute to the pro-regenerative MG niche in fish. In addition to niche factors, intrinsic differences in gene expression programs in MG from fish and mammals have been noted (Sifuentes et al., 2016). In fish, Ascl1a and Lin28a are critical factors promoting MG reprogramming and proliferation (Elsaeidi et al., 2018; Fausett et al., 2008; Gorsuch et al., 2017; Mitra et al., 2018; Mitra et al., 2019; Ramachandran et al., 2010a; Ramachandran et al., 2011). ascl1a and lin28a RNAs are highly induced in MG following injury to the fish retina, while their homologs remain undetectable in the injured mouse retina (Elsaeidi et al., 2018; Karl et al., 2008). However, forced expression of Ascl1, along with HDAC inhibition or Lin28a expression can stimulate a limited proliferative response by MG in the injured mouse retina (Elsaeidi et al., 2018; Jorstad et al., 2017).

Another intrinsic difference between MG from fish and mammals is Notch signaling. In mice, Notch signaling declines as MG differentiate and mature; while in fish, Notch signaling is maintained into adulthood (Bernardos et al., 2005; Dorsky et al., 1995; Elsaeidi et al., 2018; Furukawa et al., 2000; Nelson et al., 2011; Wan and Goldman, 2017; Wan et al., 2012). The maintenance of Notch signaling in MG of the adult zebrafish retina contributes to MG quiescence and Notch suppression is required for MG proliferation (Conner et al., 2014; Elsaeidi et al., 2018; Taylor et al., 2015; Wan and Goldman, 2017; Wan et al., 2012). Furthermore, the opposing actions of Fgf8a on MG proliferation in juvenile and adult fish is correlated with corresponding changes in Notch signaling activity (Wan and Goldman, 2017). Thus, Notch signaling is a major control point in the decision to proliferate or remain quiescent and understanding how Notch signaling is regulated in the zebrafish retina will help reveal mechanisms underlying MG’s decision to mount a regenerative response.

In addition to Notch signaling, Tgfb signaling has been implicated in regulating injury-dependent MG proliferation in the zebrafish retina (Conedera et al., 2020; Lenkowski et al., 2013; Sharma et al., 2019; Sharma et al., 2020; Tappeiner et al., 2016). However, there are inconsistencies among these reports with some suggesting it is inhibited in proliferating MG (Lenkowski et al., 2013; Sharma et al., 2019) and others suggesting it is activated in these cells (Conedera et al., 2020; Sharma et al., 2020; Tappeiner et al., 2016). Although most of the above studies suggest Tgfb signaling inhibits MG proliferation, one study suggests it is necessary for injury-dependent MG proliferation (Sharma et al., 2020). Besides these inconsistencies, the endogenous ligand responsible for stimulating Tgfb signaling and the downstream signaling components responsible for regulating MG proliferation remain unknown.

In zebrafish, Tgfb ligands are encoded by four genes: tgfb1a, tgfb1b, tgfb2, and tgfb3. Canonical Tgfb signaling occurs when a Tgfb ligand engages a type II receptor that recruits type I (Alk5) receptor to stimulate phosphorylation of Smad2 and Smad3, which stimulates their nuclear import and allows for regulation of target genes (Shi and Massagué, 2003). Non-canonical Tgfb signaling refers to receptors that engage Erk, Jnk, p38, or protein phosphatase 2A (PP2A)-dependent pathways (Derynck and Zhang, 2003; Petritsch et al., 2000). Identification of the specific Tgfb ligands mediating retina regeneration in fish and unravelling their mechanism of action are critical for understanding how the Tgfb signaling pathway regulates MG proliferation and retina regeneration.

Here we provide evidence indicating Tgfb3 controls MG quiescence via a non-canonical Tgfb signaling pathway. Of all Tgfb ligand encoding genes, we find tgfb3 expression is uniquely restricted to quiescent MG in the adult zebrafish retina. Following retinal injury, this expression is suppressed at the injury site. Using transgenic fish that allow for conditional expression of Tgfb3, we show that tgfb3 suppression is necessary for injury-dependent MG proliferation. Interestingly, our studies reveal a specificity in the actions of Tgfb ligands on MG proliferation with Tgfb3, but not Tgfb1b, stimulating MG quiescence. Our studies suggest PP2A and Notch signaling pathways act downstream of Tgfb3. Furthermore, we report that Tgfb3 stimulates pSmad3 expression in the injured retina; however, pSmad3 expression is not sufficient to drive MG quiescence. Finally, we report that the Tgfb3 expression is not detectable in mouse MG, and this may contribute to their poor regenerative potential.

Results

pSmad3 signaling is suppressed in injury-responsive MG

pSmad3 immunofluorescence was used to detect canonical Tgfb signaling in the uninjured retina of gfap:GFP transgenic fish. This analysis revealed that pSmad3 expression was restricted to GFP+ MG (Figure 1A). Importantly, this expression was suppressed when fish were immersed in water containing the Tgfb receptor 1 (Alk5) kinase inhibitors SB431542 or SB505124 (Figure 1—figure supplement 1AVogt et al., 2011).

Figure 1 with 1 supplement see all
pSmad3 expression in the uninjured and injured retina.

(A) Retinal section from uninjured gfap:GFP fish retina with GFP (green) and pSmad3 (red) immunofluorescence. Arrowheads point to pSmad3 expressing MG. (B) pSmad3 immunofluorescence in uninjured and needle poke injured retina. Asterisk marks injury site. (C) Quantification of data shown in (B). (D) Top diagram shows time line for heat shock treatment after injury and when fish were sacrificed. Bottom panels show pSmad3 immunofluorescence in injured and heat shock-treated Wt and hsp70:ca-Alk5 transgenic fish. Asterisk marks the injury site and arrowheads point to recovery of pSmad3 expression at the injury site in heat shock-treated hsp70:ca-alk5 transgenic fish. White dot in lower panel marks non-specific autofluorescence in the photoreceptor layer. (E) Quantification of data shown in (D). (F) Top diagram is time line for experiment illustrating injury, heat shock treatment and BrdU labelling prior to sacrifice. Lower panels show BrdU immunofluorescence in Wt and hsp70:ca-alk5 fish. Asterisk marks the injury site. (G) Quantification of data presented in (F). Error bars are SD. **p<0.01, ***p<0.001. Scale bar is 50 microns.

We next investigated if pSmad3 expression was regulated by retinal injury. A needle poke was used to cause a focal injury (Fausett and Goldman, 2006). This manipulation stimulated a rapid depletion in pSmad3 expression at the injury site (Figure 1B–C), which was rescued after heat shock of hsp70:ca-Alk5 transgenic fish that express a constitutively active Tgfb receptor 1 (ca-Alk5, T204D) under the control of a hsp70 heat shock promoter (Figure 1D–EWieser et al., 1995; Zhou et al., 2011). Furthermore, forced expression of ca-Alk5 inhibited injury-dependent MG proliferation (Figure 1F–G). However, when TUNEL stain was used to identify apoptotic cells, very few TUNEL+ cells were identified (Figure 1—figure supplement 1B). Thus, the reduced injury-dependent MG proliferation noted with ca-Alk5 overexpression may reflect increased pSmad signaling and/or reduced cell death. Regardless, these data indicate that Tgfb signaling via pSmad3 expression correlates with MG proliferation in the injured retina.

tgfb3 expression correlates with injury-dependent pSmad3 expression

To identify injury-responsive Tgfb ligands that might regulate pSmad3 signaling in the retina, we interrogated RNAseq data sets from MG and MG-derived progenitors that were isolated from uninjured gfap:GFP and injured 1016 tuba1a:GFP transgenic fish retinas, respectively (Fausett and Goldman, 2006; Kassen et al., 2007). This analysis indicated constitutive and low expression of tgfb1a; injury-dependent induction of tgfb1b and tgfb2; and injury-dependent suppression of tgfb3 (Figure 2A). qPCR was used to validate the RNAseq data (Figure 2B–C; Figure 2—figure supplement 1A). Injury-dependent reduction in tgfb3 RNA was also evident following NMDA-mediated amacrine and ganglion cell death or genetic ablation of photoreceptors using metronidazole-treated zop:nsfb-EGFP transgenic fish that harbor a zebrafish rod opsin promoter driving expression of bacterial nitroreductase that converts metronidazole into a cytotoxic product (Figure 2—figure supplement 1BMontgomery et al., 2010; Powell et al., 2016).

Figure 2 with 1 supplement see all
Injury-dependent regulation of tgfb gene expression.

(A) RNAseq was used to quantify tgfb gene expression in FACS purified GFP+ MG isolated from uninjured and injured (2 dpi) gfap:GFP and 1016 tuba1a:GFP fish retinas, respectively. Fold change in gene expression following retinal injury is indicated above the bars. (B) qPCR quantification of tgfb gene expression in GFP+ MG FACS purified from uninjured gfap:GFP fish retina (normalized to tgfb1b). (C) qPCR quantification of tgfb gene expression following retinal injury normalized to uninjured levels. Total retinal RNA was used for qPCR. Error bars are SD. *p<0.05. (D) tgfb3 in situ hybridization and GS (glutamine synthetase) immunofluorescence in adult fish retina shows tgfb3 RNA is expressed in MG. Top panel is tgfb3 in situ hybridization; bottom panel is overlay of in situ hybridization and GS immunofluorescence. Arrowheads point to tgfb3-expressing MG. Scale bar is 50 microns. *p<0.05, ***p<0.001.

We also compared the relative expression of tgfb ligand encoding RNAs in the retinal neuron (GFP-) and MG (GFP+) cell populations that were separated by FACS using dissociated cells from uninjured gfap:GFP fish retinas. This analysis showed tgfb3 is highly enriched in MG, whereas tgfb1b and tgfb2 are more equally distributed between these different cell populations (Figure 2—figure supplement 1C). In situ hybridization assays for tgfb3 combined with glutamine synthetase (GS) immunofluorescence on retinal sections confirmed tgfb3 gene expression is restricted to GS+ MG in the uninjured retina (Figure 2D).

We next used in situ hybridization assays to investigate when during development this MG-specific tgfb3 expression profile emerges. Consistent with a previous report (Cheah et al., 2005), we found transient expression of tgfb3 RNA in the lens at 24 hpf (hours post fertilization) (Figure 3A). At 96 hpf when MG are differentiating (Bernardos et al., 2005), we do not detect significant levels of tgfb3 RNA in the retina, nor do we observe significant tgfb3 expression at 7 dpf (days post fertilization). By 10 dpf, tgfb3 RNA is detected in the central region of the retina where more mature MG reside (Figure 3A). This expression continues to increase with age and the adult expression pattern is established by 3 mpf (months post fertilization) (Figure 3A). Consistent with our RNAseq and qPCR data indicating very low tgfb1b levels in the retina (Figure 1A–B), we were unable to detect zebrafish tgfb1b gene expression by in situ hybridization at any of the time points examined (Figure 3A).

Figure 3 with 1 supplement see all
tgfb3 expression in developing and adult retina.

(A) tgfb3 in situ hybridization identifies tgfb3 expression in lens at 24 hpf (hours post fertilization) and in MG beginning ~10 dpf (days post fertilization). This latter expression continues to increase throughout the first 3 months of development. Note tgfb1b expression remains undetectable by in situ hybridization at all the time points examined (14 dpf and 3 mpf). Size marker is 20 microns. In the 10 and 20 dpf panels, black arrowheads point to tgfb3 expressing MG in the central retina, while white arrowheads point to reduced tgfb3 expression in the retinal periphery. (B) In situ hybridization (blue/purple product) and Sox9 immunofluorescence (green fluorescence) identifies tgfb3 expression in GCL and INL, but not in MG of the mouse retina. Size marker is 25 microns. (C) Retinal injury suppresses tgfb3 expression at the injury site in 3 month old fish. In situ hybridization detects tgfb3 RNA (blue/purple product) and BrdU immunofluorescence (red/orange fluorescence) identifies proliferating cells. Size marker is 40 microns.

We next examined Tgfb3 expression in the 1 month old mouse retina. This analysis showed Tgfb3 expression was confined to cells in the GCL and INL (Figure 3B). Co-staining retinal sections for Tgfb3 RNA and Sox9 immunofluorescence (MG marker) showed no overlap, indicating Tgfb3+ cells in the INL are not MG (Figure 3B).

Although the lack of detectable Tgfb3 expression in the developing (1–7 dpf) fish retina suggests Tgfb3 expression is not necessary for MG differentiation, low levels of expression may go undetected by in situ hybridization. Therefore, we investigated if knocking down Tgfb3 expression with a translation-blocking morpholino-modified antisense oligonucleotide (MO) would affect MG differentiation. Control or tgfb3-MOs were delivered into single cell zebrafish embryos and at 6 dpf, fish were sacrificed and retinal sections assayed for glutamine synthetase (GS) immunofluorescence which serves as a marker of differentiated MG. This analysis revealed normal GS reactivity in the developing retina regardless of Tgfb3 knockdown (Figure 3—figure supplement 1A). We confirmed the tgfb3-MO’s effectiveness by observing reduced GFP in embryos injected with a tgfb3-EGFP fusion RNA and the tgfb3-MO, but not with control MO (Figure 3—figure supplement 1B).

Because of concerns that MO-mediated Tgfb3 knockdown may not be effective at 6 dpf due to MO dilution during cell division, we generated tgfb3-/- fish using a CRISPR/Cas9 strategy (Figure 3—figure supplement 1C–E). In these fish, an insertion mutation changes the tgfb3 reading frame so a premature stop codon is introduced in exon 1 (Figure 3—figure supplement 1E). We found that tgfb3-/- fish die around 2 weeks post fertilization. Therefore, we selected tgfb3+/+, tgfb3+/- and tgfb3-/- fish at 12 dpf to assay for retinal GS expression. Normal GS immunofluorescence was observed in both tgfb3+/- and tgfb3-/- fish retinas suggesting Tgfb3 does not impact MG differentiation (Figure 3—figure supplement 1F). However, we do note that retinas were smaller in tgfb3-/- fish.

We next used in situ hybridization assays to investigate the spatial pattern of tgfb3 expression in the injured adult retina. This analysis revealed that tgfb3 RNA is specifically suppressed at the injury site and that this suppression preceded MG proliferation that begins ~2 dpi (Figure 3C).

Together, the above results indicate that tgfb3 expression in the zebrafish retina correlates with MG maturation, pSmad3 expression, and MG quiescence.

Injury-dependent Tgfb3 suppression is required for MG proliferation

To investigate if Tgfb3 suppression was required for injury-dependent MG proliferation, we generated hsp70:tgfb3 transgenic fish that allow conditional expression of Tgfb3 with heat shock. A 1 hr heat shock at 37°C resulted in over a 100-fold induction of tgfb3 RNA that persisted for over 3 hr and then returned to basal levels around 24 hr post heat shock (Figure 4—figure supplement 1A). To examine the effect Tgfb3 had on MG proliferation in the injured retina, hsp70:tgfb3 transgenic fish received a needle poke injury and then a 1 hr heat shock every 6 hr for 4 days. Three hours before sacrifice at 4 dpi, fish received an IP (intraperitoneal) injection of BrdU to label proliferating cells. This analysis showed that forced expression of Tgfb3 suppressed MG proliferation in the injured retina (Figure 4A–B), without any significant effect on injury-dependent cell death (Figure 6—figure supplement 1B).

Figure 4 with 1 supplement see all
Tgfb3 suppresses MG proliferation and reprogramming gene expression.

(A) Top illustration is experimental time line. Bottom panels are BrdU immunofluorescence in injured and heat shock-treated Wt and hsp70:tgfb3 transgenic fish. Asterisk marks injury site. Scale bar is 50 microns. (B) Quantification of data in (A). (C) Top illustration is experimental time line. Fish received a needle poke injury and a 1 hr heat shock and then sacrificed at 6 hpi for RNA analysis by qPCR. Bottom graph is qPCR quantification of select reprogramming gene expression levels in the indicated fish lines at 6 hpi. (D) Experimental time line is as in (C) and tgfb3 levels were assayed in the indicated fish lines at 6 hpi. (E) Top illustration is experimental time line. Bottom panel is qPCR analysis of ascl1a and tgfb3 gene expression with and without the indicated MO treatment. MO, is morpholino-modified antisense oligonucleotide used to knockdown expression from the indicated gene. Error bars are SD. *p<0.05, **p<0.01, ***p<0.001.

We next investigated if Tgfb3 depletion affected spontaneous or injury-dependent MG proliferation. Because tgfb3-/- fish do not survive to adults, we knocked down Tgfb3 with a tgfb3-targeting MO and determined if there was an effect on MG proliferation. Control or tgfb3-MO was delivered intravitreally and cellular uptake facilitated by electroporation as previously described (Thummel et al., 2011). Retinas were injured and at 3 dpi fish received an IP injection of EdU 3 hr prior to sacrifice. Quantification of EdU+ and TUNEL+ cells revealed Tgfb3 knockdown had no effect on MG proliferation or cell death at either the injury site or in undamaged regions of the retina (Figure 4—figure supplement 1B–C).

Together, the above data indicate Tgfb3 suppression is necessary for injury-dependent MG proliferation, but this suppression is not sufficient to drive MG proliferation in the uninjured retina.

Tgfb3 regulates MG reprogramming

Reprogramming MG for retinal repair requires the regulation of gene expression programs that stimulate MG proliferation and the expansion of a MG-derived progenitor population. Essential components of these programs are genes encoding growth factors, cytokines, and transcription factors that are rapidly induced following a retinal injury (Gorsuch et al., 2017; Nagashima et al., 2020; Nelson et al., 2013; Nelson et al., 2012; Ramachandran et al., 2010a; Ramachandran et al., 2011; Ramachandran et al., 2012; Thummel et al., 2010; Wan and Goldman, 2017; Wan et al., 2012; Wan et al., 2014; Zhao et al., 2014). Because tgfb3 expression is suppressed within a few hours post injury, we suspected it might regulate these gene expression programs. To investigate this, we injured Wt or hsp70:tgfb3 fish retinas and immediately treated fish with a single 1 hr heat shock before sacrificing fish at 6 hpi and isolating retinal RNA for gene expression analysis using qPCR. Interestingly, we found that many reprogramming genes that are normally induced after retinal injury, like ascl1a, hbegfa, lepb, crlf1a, and socs3a, were suppressed by Tgfb3 expression, while genes normally repressed soon after injury, like fgf8a and dll4 were unaffected (Figure 4C). Furthermore, forced Fgf8a expression, which we previously showed suppressed injury-dependent MG proliferation in the adult retina (Wan and Goldman, 2017), had no effect on tgfb3 expression (Figure 4D). Thus, Tgfb3 and Fgf8a appear to act independent of each other to regulate MG proliferation.

The observation that ascl1a gene expression is suppressed in a Tgfb3-dependent manner was intriguing since it is a critical reprogramming gene that along with Lin28a and Notch inhibition is sufficient to stimulate spontaneous MG proliferation in the uninjured retina (Elsaeidi et al., 2018). We previously reported that injury-dependent induction of cytokines, like Crlf1a and Lepb, acting via gp130-coupled receptors, also act upstream of ascl1a to drive MG proliferation (Zhao et al., 2014). Therefore, we wondered if Tgfb3 was part of this early cytokine response system. For this analysis we took advantage of previously characterized MOs to knockdown cytokine signaling in the injured retina and assayed ascl1a and tgfb3 gene expression (Figure 4EZhao et al., 2014). This analysis confirmed that injury-dependent ascl1a gene induction is regulated by a cytokine signaling system, and that this signaling system also contributes to injury-dependent tgfb3 suppression (Figure 4E). Thus, Tgfb3 and cytokine-related gene products seem to contribute to a feedback loop regulating each other’s expression and also regulating MG proliferation.

Together, these data suggest Tgfb3 drives MG quiescence in the injured retina, at least in part, by inhibiting the expression of pro-regenerative gene expression programs.

Tgfb1b overexpression stimulates pSmad3 expression without affecting MG proliferation

qPCR and RNAseq analysis of tgfb gene expression in the injured retina revealed that although tgfb1b and tgfb2 were induced in the injured retina, their levels remained below the suppressed levels of tgfb3 (Figure 2A). Furthermore, injury-dependent regulation of pSmad3 expression followed that of tgfb3, but not tgfb1a, tgfb1b, or tgfb2 (Figures 1B, 2A and 3C). These observations suggest that Tgfb3 expression largely accounts for pSmad3 expression in the uninjured and injured retina. Whether other Tgfb ligands could also inhibit MG proliferation via a pSmad3 signaling mechanism remained unknown, but seemed likely if we boosted their levels to at least that of Tgfb3 in the uninjured retina. To investigate this, we generated hsp70:tgfb1b transgenic fish.

hsp70:tgfb1b fish treated with a 1 hr heat shock exhibited over a 100-fold induction of tgfb1b RNA that returned to basal levels ~ 24 hr later (Figure 5—figure supplement 1A). Overexpression of Tgfb1b had no significant effect on endogenous tgfb2b expression, but did decrease tgfb3 expression by ~50% at 6 hr post heat shock (Figure 5—figure supplement 1B). Interestingly, when comparing the consequence of Tgfb1b and Tgfb3 overexpression on MG proliferation and pSmad3 expression, only Tgfb3 suppressed injury-dependent MG proliferation (Figure 5A–B), but both Tgfb1b and Tgfb3 reestablished pSmad3 expression at the injury site (Figure 5C).

Figure 5 with 1 supplement see all
Tgfb1b and Tgfb3 stimulate pSmad3 expression, but only Tgfb3 inhibits injury-dependent MG proliferation.

(A) Top illustration is experimental time line. Bottom panels show BrdU immunofluorescence on retinal sections from uninjured and injured, heat shock-treated Wt, hsp70:tgfb1b, and hsp70:tgfb3 transgenic fish. (B) Quantification of data in (A). (C) pSmad3 immunofluorescence on retinal sections from uninjured and injured, heat shock-treated Wt, hsp70:tgfb1b, and hsp70:tgfb3 transgenic fish. Arrowheads point to the INL at the injury site. Asterisk marks the injury site. White dot in two right-hand panels marks non-specific autofluorescence in the photoreceptor layer. Scale bar is 50 microns. Error bars are SD. **p<0.01.

Although Tgfb1b overexpression did not regulate MG proliferation, tgfb1b RNA is induced in the injured retina (Figure 2A and C), and we wondered if this induction had any consequence on regeneration. Therefore, we knocked down Tgfb1b expression with a previously validated splice-blocking tgfb1b-targeting MO (Figure 5—figure supplement 1CMonteiro et al., 2016). MOs were delivered to retinas at the time of injury and cellular uptake facilitated by electroporation. Four days later, fish received an IP injection of EdU and 3 hr later some fish were sacrificed to assay MG proliferation (Figure 5—figure supplement 1D), while others were allowed to survive until 14 dpi to lineage trace EdU+ MG (Figure 5—figure supplement 1E). These analyses revealed that Tgfb1b knockdown had no significant effect on injury-dependent MG proliferation or the fate of MG-derived progenitors (Figure 5—figure supplement 1D–E).

Together, the above data indicate specificity in the action of Tgfb ligands on MG proliferation and suggest that pSmad3 expression does not drive MG quiescence in the injured retina.

Alk5 and PP2A inhibition rescue MG proliferation in injured retinas with Tgfb3 overexpression

The above data suggested that Tgfb3-dependent activation of Alk5 may engage a non-canonical Tgfb signaling pathway to regulate MG proliferation. To investigate this, we first determined the effect Alk5 suppression had on MG proliferation in heat shock-treated hsp70:tgfb3 fish immersed in either DMSO or the Alk5 inhibitor, SB431542 (Figure 6A). As expected, Alk5 inhibition rescued MG proliferation in injured retinas from heat shock-treated hsp70:tgfb3 fish (Figure 6B–C).

Figure 6 with 1 supplement see all
Alk5 and PP2A inhibition rescues Tgfb3-mediated inhibition of MG proliferation in the injured retina.

(A) Experimental time line. (B) Edu click chemistry identifies proliferating MG in retinal sections from injured Wt and hsp70:tgfb3 transgenic fish treated with heat shock, +/- okadaic acid (OKA), PD169316 (PD), or SB431542 (SB) treatment. Scale bar is 50 microns. (C) Quantification of the effects of OKA, PD, and SB on Tgfb3-mediated suppression of MG proliferation that is shown in (B). Edu values are normalized to MG proliferation in Tgfb3 overexpressing transgenic fish. Error bars are SD. **p<0.01.

We next investigated if Tgfb3-dependent activation of Alk5 engaged a non-canonical Tgfb signaling pathway, like ERK, PI3K, p38, and PP2A (Derynck and Zhang, 2003; Petritsch et al., 2000; Yu, 2002; Zhang, 2017). Previous studies indicated that ERK and PI3K signaling are necessary for injury-dependent MG proliferation and therefore, are not candidates for conveying the quiescence-promoting effects of Tgfb3 (Wan et al., 2012; Wan et al., 2014). Therefore, we focused our analysis on PP2A and p38.

PP2A functions as a trimer with a dimeric core consisting of a catalytic (zebrafish genes ppp2ca, ppp2cb) and structural subunit (zebrafish genes ppp2r1a, ppp2r1b) and one of 7 regulatory subunits (zebrafish genes ppp2r2aa, ppp2r2ab, ppp2r2ba, ppp2r2bb, ppp2r2ca, ppp2r2cb, ppp2r2d) that confers subcellular targeting, substrate specificity, and regulation of holoenzyme phosphatase activity. Importantly, the PP2A Bα subunit (zebrafish Ppp2r2aa and Ppp2r2ab) can associate with and be phosphorylated by Alk5, and this association/phosphorylation is necessary to transduce the anti-proliferative effects of Tgfb receptor signaling (Griswold-Prenner et al., 1998; Petritsch et al., 2000; Wlodarchak and Xing, 2016). Interrogation of RNAseq data sets indicates that genes encoding PP2A components and p38 isoforms (mapk14a, mapk14b) are expressed in quiescent and injury-responsive MG (Figure 6—figure supplement 1A).

We next investigated if PP2A or p38 signaling participated in Tgfb3-dependent regulation of MG proliferation in the injured retina. For this analysis, Wt and hsp70:tgfb3 transgenic fish retinas were injured and fish were either left untreated or received a 1 hr heat shock every 6 hr for 4 days along with daily intravitreal injections of either DMSO, the PP2A inhibitor okadaic acid (10 μM, OKA), or the p38 MAPK inhibitor PD169316 (3 μM, PD) (Bialojan and Takai, 1988; Wilson et al., 1997). Fish received an IP injection of EdU 3 hr prior to sacrifice to label proliferating cells. Quantification of EdU+ cells revealed that inhibition of PP2A, but not p38 MAPK, rescued MG proliferation in retinas with Tgfb3 overexpression (Figure 6C). Neither forced expression of Tgfb3 or intravitreal injection of OKA affected injury-dependent apoptosis (Figure 6—figure supplement 1B).

Together, the above data suggests Alk5 and PP2A act downstream of Tgfb3 to regulate MG quiescence.

Notch inhibition rescues MG proliferation in Tgfb3-expressing injured retinas

Previous studies revealed that Notch signaling inhibition is required for injury-dependent MG proliferation (Conner et al., 2014; Elsaeidi et al., 2018; Wan and Goldman, 2017; Wan et al., 2012). Therefore, we wondered if Tgfb3 signaling acted through Notch signaling to inhibit MG proliferation. To investigate this, we bred hsp70:tgfb3 fish with tp1:mCherry Notch reporter fish that harbor 12 RBP-Jk binding sites upstream of a minimal promoter that drives nuclear localized mCherry expression (Parsons et al., 2009). Normally, Notch signaling is suppressed in injury-responsive MG spanning the injury site (Figure 7A, tp1:mCherry panel) (Elsaeidi et al., 2018; Wan and Goldman, 2017). However, forced Tgfb3 expression in hsp70:tgfb3;tp1:mCherry double transgenic fish prevented this injury-dependent suppression in Notch signaling (Figure 7A–B) and this correlated with reduced MG proliferation (Figure 4A–B). Furthermore, we found that Tgfb3-dependent inhibition of MG proliferation can be rescued by pharmacological suppression of Notch signaling using the γ-secretase inhibitor RO4929097 (Figure 7C–D). Consistent with these data, Tgfb3 overexpression in the uninjured retina increased expression of the Notch reporter gene hey1, and the ligand encoding gene, dll4. However, dll4 induction did not reach statistical significance (Figure 7E) and further studies are needed to determine if Tgfb3 regulates Notch signaling via dll4 expression. Nonetheless, the above studies suggest Tgfb3 acts, at least in part, via the Notch signaling pathway to regulate MG quiescence.

Tgfb3 acts upstream of Notch signaling to inhibit MG proliferation.

(A) Top illustration is experimental time line. Bottom panels show mCherry immunofluorescence on retinal sections from either injured tp1:mCherry or hsp70:tgfb3;tp1:mCherry transgenic fish. Asterisk and box region shows the injury site. Note forced Tgfb3 expression stimulate mCherry expression. (B) Quantification of data mCherry+ cells shown in (A). (C) Top is experimental time line. Bottom panels show BrdU immunofluorescence on retinal sections from injured and heat shock-treated Wt and hsp70:tgfb3 fish treated +/- RO4929097. (D) Quantification of data in (C). (E) qPCR analysis of dll4 and hey1 RNA expression using total retinal RNA from Wt and hsp70:tgfb3 fish that were given a 1 hr heat shock (HS) treatment before sacrifice. Values are normalized to Wt control. Error bars are SD. *p<0.05, ***p<0.001. Scale bar is 50 microns.

Discussion

Here we report that Tgfb3 signaling regulates MG quiescence in the zebrafish retina. Although both Tgfb1b and Tgfb3 can induce pSmad3 expression, only Tgfb3 stimulates MG quiescence, suggesting the involvement of a non-canonical Tgfb signaling pathway. We found that PP2A or Notch inhibition partially rescued MG proliferation in injured retinas overexpressing Tgfb3 and that Tgfb3 acts, at least in part, by stimulating Notch signaling. We also found that Tgfb3-driven MG quiescence is associated with suppression of regeneration-associated genes. Finally, our study reveals that tgfb3 is highly expressed by pro-regenerative MG of the zebrafish retina, but remains undetectable in non-regenerative MG of the mouse retina.

Tgfb ligands are expressed as latent pre-pro-polypeptides that must be released from latency for their action (Shi et al., 2011). Prior to secretion, the immature polypeptide is cleaved between the prodomain and mature peptide domain, but they remain associated. The prodomain is required for proper folding, dimerization, and binding to integrin in the extracellular matrix. In order for Tgfb ligands to signal through their receptors they must be released from the prodomain, which is accomplished via integrin interaction. Among the four different Tgfb ligand encoding genes expressed in the uninjured retina, our data suggests that Tgfb3 predominates. Tgfb3 expression is restricted to quiescent MG and its suppression is required for MG proliferation. Our data suggest that Tgfb3 is constitutively released from integrin in the extracellular matrix and that tgfb3 gene expression is a major control point in regulating Tgfb signaling in MG.

The mechanism by which tgfb3 expression is suppressed in the injured retina remains unknown, but diffusible factors emanating from either dying neurons and/or immune cells that accumulate at the injury site are good candidates. The observation that both the ligand (Tgfb3) and the response (pSmad3) are restricted to MG suggests that Tgfb3 acts in an autocrine or paracrine fashion; however, we cannot rule out the involvement of an intervening neuronal or immune cell. An autocrine/paracrine type of regulation may be a common theme in the injured zebrafish retina since most of the reported secreted factors regulating MG proliferation emanate from MG themselves (Nelson et al., 2013; Wan and Goldman, 2017; Wan et al., 2012; Zhao et al., 2014).

In the adult mammalian retina, Tgfb signaling is low and Tgfb expression does not correlate with MG quiescence or proliferation (Anderson et al., 1995; Kugler et al., 2015; Lutty et al., 1993; Tosi et al., 2018). However, similar to what we observed in adult fish retina, Tgfb signaling has been associated with reduced MG proliferation in young chicks and postnatal rats (Close et al., 2005; Todd et al., 2017), and with reduced stem cell proliferation in certain regions of the mouse brain (Falk et al., 2008). The high basal level of tgfb3 in mature MG from zebrafish, but not mice, is intriguing and one cannot help but speculate that it may contribute to their stemness. Interestingly, Notch signaling has been reported to contribute to neural stem cell stemness in the adult zebrafish brain (Than-Trong et al., 2018), and in the retina, our data indicates Tgfb3 stimulates Notch signaling. Thus, Tgfb3 expression in the zebrafish retina provides a mechanism for maintaining Notch signaling into adulthood, which is absent in mammals.

Our conclusion that Tgfb3-pSmad3 signaling is active in quiescent MG and suppressed following retinal injury differs from previous reports (Conedera et al., 2020; Lenkowski et al., 2013; Sharma et al., 2020; Tappeiner et al., 2016). However, even among these previous studies, inconsistencies emerge, reinforcing the importance of carefully controlled experiments. Lenkowski et al., 2013 assayed the expression of putative Tgfb responsive genes, like tgif1 and tgfbi to concluded Tgfb signaling was transiently induced prior to injury-dependent MG proliferation and then repressed when MG proliferate. In contrast, Tappeiner et al., 2016 used pSmad3 immunofluorescence to conclude Tgfb signaling was increased in proliferating MG. Further disparities emerge when examining the effect of the Tgfb signaling inhibitor SB431542 on MG proliferation in the INL where Tappeiner et al., 2016 reported no effect, and Sharma et al., 2020 reported inhibition. Remarkably, even in work coming from the same group, inconsistencies emerge. For example, when assaying tgfb gene expression, one report suggests increased injury-dependent tgfb1a expression, while another indicated reduced tgfb1a expression (Conedera et al., 2020; Tappeiner et al., 2016); and another group reported Tgfb signaling is inhibited in an Oct4-dependent fashion in injury-responsive MG, while a later report indicates enhanced Tgfb signaling in these reprogrammed MG (Sharma et al., 2019; Sharma et al., 2020). The reason for these disparities is not known, but reinforces the idea that manipulating and assaying Tgfb signaling in the zebrafish retina is not trivial. We also note that many of these studies relied solely on SB431542 to inhibit Tgfb signaling; however, this drug is a more potent inhibitor of CK1 and RIPK2 (Vogt et al., 2011), which further clouds the interpretation of results.

In the work reported here, we not only suppressed Tgfb signaling with SB431542 and the more specific Alk5 inhibitor, SB505124 (Vogt et al., 2011), but also stimulated Tgfb signaling with conditional expression of Tgfb1b, Tgfb3, and ca-Alk5 using transgenic fish. All these manipulations resulted in the expected change in pSmad3 immunofluorescence in MG, supporting our contention that pSmad3 immunofluorescence reflects Tgfb signaling. Importantly, we found that Tgfb signaling is active in quiescent MG and rapidly suppressed in injury-responsive MG, and that this suppression correlates with tgfb3 gene expression that was visualized by in situ hybridization and quantified by RNAseq and qPCR. Furthermore, unlike previous studies, we determined the relative proportion of RNAs encoding different tgfb isoforms, revealing tgfb3 is expressed at least 80-fold higher than the other isoforms in quiescent MG, and the only isoform to be repressed after retinal injury. These data suggest that Tgfb3 is largely responsible Tgfb signaling in quiescent MG. Remarkably, Conedera et al., 2020 reported a ~ 2 fold increase in tgfb3 expression at 1–14 dpi, which is inconsistent with their previous study (Tappeiner et al., 2016), and hard to reconcile with our data.

Using transgenic fish, we found that forced expression of Tgfb3, but not Tgfb1b, suppressed injury-dependent MG proliferation. This result contrasts with Sharma et al., 2020 who reported intravitreal injection of recombinant human Tgfb1 enhanced MG reprogramming and proliferation in the injured. Zebrafish Tgfb1b shares 42% amino acid identity with human TGFb1, and it is not clear if the human ligand will engage zebrafish Tgfb receptors and stimulate pSmad3 expression in the zebrafish retina. Although transgenic approaches used to conditionally express zebrafish ligands are generally preferable to intravitreal injection of human factors, these transgenic approaches do have their limitations since heat shock causes cell stress, and the hsp70 promoter is induced in all retinal cell types. Our studies suggest that heat shock-induced cell stress had no effect on MG proliferation in wild type and hsp70:tgfb1b fish; however, we were unable to achieve conditional, cell-type specific expression of Tgfb3, so it remains possible that some of its actions are indirectly related to its expression in retinal neurons.

One of the more remarkable observations we made during this study is that bothTgfb3 and Tgfb1b can stimulate pSmad3 expression, but only Tgfb3 can drive MG quiescence. This suggested that Tgfb3 must be mediating if effects on MG proliferation via a non-canonical Tgfb signaling pathway. Although the mechanism coupling Tgfb3-dependent activation of Alk5 to MG quiescence remains unknown, our data indicates that it impacts Notch signaling as indicated by increased tp1:mcherry transgene and endogenous hey1 expression.

Experiments designed to rescue MG proliferation in Tgfb3 overexpressing retinas revealed a role for Alk5 and PP2A in regulating MG quiescence. Although it is not surprising that inhibition of Tgfb3’s Alk5 receptor would relieve its effects on MG proliferation, the observation that this phenotype is recapitulated by PP2A inhibition was unexpected. Interestingly, PP2A can be recruited to Alk5 to stimulate G1 arrest (Griswold-Prenner et al., 1998; Petritsch et al., 2000; Wlodarchak and Xing, 2016), and PP2A is a major regulator of cell cycle check points and signaling pathways that impinge on the cell cycle, like Wnt, MAPK, PI3K, and mTor (Wlodarchak and Xing, 2016). Importantly, these PP2A-regulated signaling pathways have been previously shown to contribute to injury-dependent MG proliferation (Ramachandran et al., 2011; Wan et al., 2012; Wan et al., 2014; Zelinka et al., 2016). However, additional studies are needed to determine the mechanism of action of PP2A in regulating MG quiescence and in particular, whether it directly interacts with Alk5.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background (Danio rerio)1016 tuba1a:GFPFausett and Goldman, 2006
Strain, strain background (Danio rerio)gfap:GFPKassen et al., 2007
Strain, strain background (Danio rerio)tp1:mCherryParsons et al., 2009
Strain, strain background (Danio rerio)zop:nsfb-EGFPMontgomery et al., 2010
Strain, strain background (Danio rerio)hsp70:ca-Alk5Zhou et al., 2011
Strain, strain background (Danio rerio)hsp70:tgfb1bThis paper; Figure 5tgfb1b expressed under the hsp70 promoter; generated using Tol2-mediated transgenesis -Goldman lab
Strain, strain background (Danio rerio)hsp70:tgfb3This paper; Figure 4tgfb3 expressed under the hsp70 promoter; generated using Tol2-mediated transgenesis – Goldman lab
Sequence-based reagentTgfb3-MOGene Tools, LLCLissamine-tagged, tgfb3-targeting Morpholino 5’TGCATGGTTAA TATCTGCACACTAT
Sequence-based reagentTgfb1b-MOGene Tools, LLCLissamine-tagged, tgfb1b-targeting Morpholino 5’AAGGATAGTG CCACTCACTCATTGT
Sequence-based reagentT7 universal gRNA primerSigma-AldrichT7 universal gRNA primer 5’-AAAAGCACCGACTCGGTG CCACTTTTTCAAGTTGATAAC GGACTAGCCTTATTTTAACTT GCTATTTCTAGCTCTAAAAC-3’
Sequence-based reagenttgfb3 gRNA one primerSigma-Aldrichtgfb3 gRNA one primer: 5’-TAATACGACTCACTAT AGGGCACCTGACTAGGG CCCAGTTTTAGAGCTAGAA
Sequence-based reagenttgfb3 gRNA two primerSigma-Aldrichtgfb3 gRNA two primer: 5’-TAATACGACTCACTAT AGGCCCTCTACAACAGC ACCAGTTTTAGAGCTAGAA
Sequence-based reagentPCR primersSee Materials and Methods - Primers and Morpholinos section below
Recombinant DNA reagentpCS2+ tgfb3-EGFPThis paper; Figure 3—figure supplement 1BVector for generating RNA that has tgfb3 MO target sequence appended to the 5’ end of the EGFP mRNA coding sequence - Goldman lab.
Recombinant DNA reagentpCS2-nCas9n-nanos3’UTRAddgene, Plasmid #62542Plasmid #62542
Antibodyanti-pSmad3, rabbit monoclonalAbcamCat. # ab52903
RRID:AB_882596
1/200 dilution
AntibodyZpr-1, mouse monoclonalZebrafish International Resource CenterCat. # zpr-1
RRID:AB_10013803
1/500 dilution
AntibodyZn-5, mouse monoclonalZebrafish International Resource CenterCat. # zn-5
RRID:AB_10013770
1/1000 dilution
Antibodyanti-HuC/D, rabbit polyclonalAbcamCat. # ab210554
RRID:AB_210554
1/500 dilution
Antibodyanti-PKCβ1, mouse monoclonalSanta Cruz BiotechnologyCat. # SC-8049
RRID:AB_628143
1/200 dilution
Antibodyanti-glutamine synthetase (GS), mouse monoclonalSigma-AldrichCat. # MAB302
RRID:AB_2110656
1/500 dilution
Antibodyanti-SOX9, rabbit polyclonalMillipore SigmaCat. # AB5535
RRID:AB_2239761
1/500 dilution
Antibodyanti-BrdU, rat monoclonalThermo FisherCat. #
MA 182088
RRID:AB_927214
1/500 dilution
Antibodyanti-BrdU, mouse monoclonalThermo FisherCat. # B35128
RRID:AB_2536432
Clone MoBu-1 for co-staining with EdU Click-it Chemistry, 1/500 dilution
Chemical compound, drugSB431542Fisher ScientificCat # 16–141Tgfb signaling inhibitor
Chemical compound, drugSB505124Fisher ScientificCat # 32-631-0Tgfb signaling inhibitor
Chemical compound, drugRO4929097Cayman ChemicalCat # 19996Notch signaling inhibitor
Chemical compound, drugokadaic acidCell Signaling TechnologyCat # 5934PP2A inhibitor
Chemical compound, drugPD169316Cayman ChemicalCat # 10006727P38 MAPK inhibitor
Commercial assay or kitmMESSAGE mMACHINESP6 Transcription KitInvitrogenCat # AM1340mRNA synthesis
Commercial assay or kitMegascript T7 Transcription KitInvitrogenCat # AM1334mRNA synthesis
Commercial assay or kitIn situ cell death, fluoresceinSigma AldrichCat # 11684795910TUNEL assay

Animals, injury models, and cell proliferation assays

Request a detailed protocol

Animal studies were approved by the University of Michigan’s Institutional Animal Care and Use Committee. Zebrafish were kept at 26–28°C with a 10/14 hr light/dark cycle. Adult male and female fish from 6 to 12 months of age were used in these studies. 1016 tuba1a:GFP, gfap:GFP, tp1:mCherry, zop:nsfb-EGFP, and hsp70:ca-Alk5 fish were previously described (Fausett and Goldman, 2006; Kassen et al., 2007; Montgomery et al., 2010; Parsons et al., 2009; Zhou et al., 2011). We generated hsp70:tgfb1b and hsp70:tgfb3 transgenic fish using standard recombinant DNA techniques using Tol2 vector backbone. Expression constructs were injected into single cell zebrafish embryos as previously described (Fausett and Goldman, 2006). Fish were anesthetized in tricaine and retinas were injured with a needle poke injury (2–4 injuries/retina for analysis of proliferation and protein expression on retinal sections and 8–10 injuries/retina when harvesting total RNA for qPCR), NMDA, or genetically as previously described (Fausett and Goldman, 2006; Montgomery et al., 2010; Powell et al., 2016). To investigate cell proliferation, fish received an IP injection of BrdU or EdU (10 μl of 10 mg/ml stock) as indicated in the text and detected by immunofluorescence or Click-It chemistry as previously described (Wan and Goldman, 2017). Wild-type FVB/N mice were obtained from our breeding colony.

RNA isolation, PCR, and RNAseq

Request a detailed protocol

Total RNA was isolated using Trizol (Invitrogen). cDNA synthesis and PCR reactions were performed as previously described (Fausett et al., 2008; Ramachandran et al., 2010a). Real-time qPCR reactions were carried out in triplicate with ABsolute SYBR Green Fluorescein Master Mix (Thermo Scientific) on an iCycler real-time PCR detection system (BioRad). The ΔΔCt method was used to determine relative expression of mRNAs in control and injured retinas and normalized to either gapdh or gapdhs mRNA levels. Individual comparisons were done using unpaired 2-tailed Student t-test. ANOVA with Fisher's PLSD post hoc analysis was used for multiple parameter comparison. Error bars are standard deviation (SD).

For RNAseq, retinas from 1016 tuba1a:GFP and gfap:GFP fish were dissociated and GFP+ MG were purified using FACS using the University of Michigan’s Cell Sorting Core as previously described (Powell et al., 2013; Ramachandran et al., 2010a). RNA from GFP+ cells was used to generate libraries and DNA was sequenced on an Illumina HiSeq2000 instrument. Sequencing reads were analyzed by the University of Michigan’s Bioinformatics Core. The number of reads for each expressed gene was determined and differentially expressed genes were restricted to those exhibiting at least a 2-fold difference in expression with threshold abundance greater than 5 Fragments Per Kilobase of transcript per Million mapped reads to eliminate very low abundant transcripts whose estimates of fold-change are unreliable. GEO accession for RNAseq data is GSE145330.

Generation of tgfb3 mutant fish

Request a detailed protocol

Gene editing was performed as previously described (Hwang et al., 2013; Vejnar et al., 2016). Briefly, CRISPRscan (https://www.crisprscan.org/) was used to identify gRNA target sequences in exon 1 of the tgfb3 gene. gRNAs were transcribed using PCR products as a templates and the MEGAscript T7 transcription kit (Thermo Fisher Scientific #AM1334). Cas9-nanos mRNA was transcribed using NotI-digested Cas9-nanos pCS2 expression vector and the mMESSAGE mMACHINE SP6 kit (Invitrogen, #AM1340). Cas9-nanos mRNA and two gRNAs targeting tgfb3 exon1 were co-injected into one cell stage zebrafish embryos. Primers for making tgfb3 mutant fish: T7 universal gRNA primer: 5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’; gRNA one primer: 5’-TAATACGACTCACTATAGGGCACCTGACTAGGGCCCAGTTTTAGAGCTAGAA; gRNA two primer: 5’-TAATACGACTCACTATAGGCCCTCTACAACAGCACCAGTTTTAGAGCTAGAA.

Primers and morpholinos (MO) used in this study

Request a detailed protocol

The following PCR primers are 5’ to 3’. tgfb3: forward GATTGGAGGGACGGATGA, reverse GTGACAGGGGCAGTGAAC; tgfb2: forward CAGCATGAGAGCCACAGAC, reverse CTCCACAGATACGGACAGG; tgfb1a: forward GTACAAACACCACAACCCTGG, reverse GGCTTACTTATCAATCCCGAC; tgfb1b: forward ACTGGCTCTTGCTCCTAT, reverse AACTGTTCCACCTTATGC; ascl1a: forward TTGAGCGTTCGTAAA, reverse GCTGAAGGACTGGATT; fgf8a: forward CAGTGTGGATACAAACGCAGG, reverse TAGCAAAACGCAAAGAGGTGA; lepb: forward CATTGCTCGAACCACCATCAGC, reverse TCTTTATGCACCGGGGTCTCG; crlf1a: forward GGGATTCTGGGATCTAGGAAAGC, reverse TCCTTGAAGAACCTGGTTGCG; socs3a: forward CACTAACTTCTCTAAAGCAGGG, reverse GGTCTTGAAGTGGTAAAACG; il-11b: forward GCTAACAGTGTCGCCTGACTCC, reverse CTGTAGTTCAGTGAGGGCAGGG; dll4: forward GGAAATTTGACGTGCTCCAT, reverse GAGAAAGGTGAGCCAAGCTG; hbegf: forward CGATGGATGGCGAGGATGTAGA, reverse GCATTAGGGCAGGACGAAGTTG; hey1: forward GTTTGCATTTTCACGCCCCT, reverse CGCCCTCTAGTGCTCACATT; tgfb3 gRNA mutation forward GGCAAAGGACTGCTGTTTGT, reverse GAGATCCCTGGATCATGTTGA; tgfb1b MO mis-splicing forward GCACACCATAGAAGATCCAACA, reverse AGGCATCTGCAACCAGTCTT.

Lissamine-tagged, tgfb3-targeting MO: 5’TGCATGGTTAATATCTGCACACTAT; Lissamine-tagged, tgfb1b-targeting MO: 5’AAGGATAGTGCCACTCACTCATTGT; Gene Tools standard control MO: 5’ CCTCTTACCTCAGTTACAATTTATA.

Morpholino (MO) functional assays

Request a detailed protocol

For testing tgfb3-targeting MO, we generated pCS2+tgfb3 EGFP construct that contained tgfb3 cDNA MO target site upstream and in-frame with the EGFP initiator AUG. Primers for generating tgfb3 MO targeting sequence are: forward primer (BamHI): 5’-GCAGGATCCGGAGCCGCTTCATTCATCTG-3’ and reverse primer (Nco1): 5’-TCACCATGGTGGACAGAGACAAGCTCATG-3’. The pCS2+tgfb3 EGFP plasmid was linearized with Not1 restriction enzyme and capped sense tgfb3-EGFP RNA was synthesized using SP6 RNA polymerase using Invitrogen’s mMESSAGE mMACHINE SP6 Transcription Kit (Invitrogen, #AM1340) according to manufactures directions. Following purification, the capped tgfb3-EGFP RNA was dissolved in nuclease free water containing 0.2% phenol red and injected with experimental or control MO into single cell zebrafish embryos. Each embryo received approximately 50 pg of RNA and 250 pg of control or experimental MO. For testing splice blocking tgfb1b-targeting MO, we injected either control MO (2.4 ng) or tgfb1b-targeting MO (0.3 ng and 2.4 ng) into single cell zebrafish embryos. RNA was extracted from embryos at 24–48 hr post injection and assayed for tgfb1b mRNA by PCR.

Heat shock and pharmacological inhibitors

Request a detailed protocol

For heat shock, fish were immersed in a water bath at 37°C for 1 hr before returning to system water at 28°C. For extended periods of heat shock, this was repeated every 6 hr. For inhibition of Tgfb signaling we used two different Tgfb receptor 1 (Alk 5) inhibitors, SB431542 and SB505124 (Fisher Scientific) and to inhibit Notch signaling we used RO4929097 (Cayman). PP2A was inhibited with okadaic acid (Cell Signaling Technology) and p38 MAPK was inhibited with PD169316 (Cayman Chemical). Pharmacological reagents were prepared in DMSO as a 10 mM stock and diluted 1/200 in fish water for immersion or PBS for intravitreal injections. Control fish were treated with vehicle.

Immunofluorescence and in situ hybridization

Request a detailed protocol

Zebrafish samples were prepared for immunofluorescence as previously described (Fausett and Goldman, 2006; Ramachandran et al., 2010a; Ramachandran et al., 2010a). Primary antibodies used in this study: anti-pSmad3, Abcam Cat. # ab52903 (1/200); Zpr-1 and Zn-5, Zebrafish International Resource Center (1/500 and 1/1000, respectively); anti-HuC/D, Abcam, Cat. #ab210554 (1/500); anti-PKCβ1, Santa Cruz Biotechnology, Cat. #SC-8049 (1/200); anti-glutamine synthetase (GS), Sigma-Aldrich, Cat. #MAB302 (1/500); anti-SOX9, EMD Millipore, Cat. #AB5535 (1/500); anti-BrdU, Thermo Fisher, Cat. # MA 1–82088 (1/500) and Cat. # B35128 (1/500, clone MoBu-1 for co-staining with EdU Click-It chemistry). Secondary antibodies: Alexa Flour 555 Donkey anti Mouse-IgG (H+L), Thermo Fisher Cat. # A31570 (1:500); Alexa flour 555 Donkey anti Rabbit IgG (H+L), Thermo Fisher, Cat # A31572 (1:500); Alexa flour 555 Donkey anti Sheep IgG (H+L) Thermo Fisher Cat #A21436. Cy3, Jakson Immuno research labs, Cat #712-166-150 (1:500); Alexa Flour 488 donkey anti mouse Thermo Fisher Cat. # A21202 (1:500); Alexa Flour 488 goat anti rabbit Thermo Fisher Cat. # A11008 (1:500); Cy5 goat anti mouse, Thermo Fisher Cat. # A10524 (1:500); and Alexa Flour 647 goat anti rabbit Thermo Fisher Cat # A21244 (1:500). In situ hybridization was performed as described previously (Barthel and Raymond, 2000).

Microscopy, TUNEL, cell quantification, and statistical analysis

Request a detailed protocol

BrdU and EdU labelling were used to identify and quantify proliferating cells in retinal sections as previously described (Fausett and Goldman, 2006; Ramachandran et al., 2010a; Wan and Goldman, 2017; Wan et al., 2012; Wan et al., 2014). TUNEL assays were performed on retinal sections using the in situ cell death, fluorescein kit (Sigma Aldrich, Cat # 11684795910). Images were captured by a Zeiss Axiophot fluorescence microscope or a Leica DM2500 microscope. Autofluorescence is defined as variable, background fluorescence that can be detected in multiple channels. All experiments were done in triplicate (three trials) with three animals per trial unless otherwise indicated. We routinely quantify the total number of proliferating cells around the injury site in all nuclear layers and also the number of proliferating cells restricted to the INL in order to be sure proliferative changes represent MG proliferation and are not solely due to rod progenitor proliferation. Unless specifically stated, quantification shown in graphs is proliferation in all nuclear layers at the injury site. Quantification of pSmad3 immunofluorescence was restricted to the area surrounding the injury site and represents the field of view. Error bars are standard deviation (SD). ANOVA with Fisher's PLSD post hoc analysis was used for multiple parameter comparison; two-tailed Student's t test was used for single parameter comparison.

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
    Heterogeneity in localization of isoforms of TGF-beta in human retina, vitreous, and choroid
    1. GA Lutty
    2. C Merges
    3. AB Threlkeld
    4. S Crone
    5. DS McLeod
    (1993)
    Investigative Ophthalmol & Visual Science 34:477–487.
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77

Decision letter

  1. Jeffrey Gross
    Reviewing Editor; University of Pittsburgh School of Medicine, United States
  2. Kathryn Song Eng Cheah
    Senior Editor; The University of Hong Kong, Hong Kong
  3. Jeffrey Gross
    Reviewer; University of Pittsburgh School of Medicine, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This study nicelydemonstrates that Tgfb3 controls Müller glia quiescence in zebrafish via non-canonical Tgfb signaling. Data also suggest that Notch signaling, and possibly PP2A, act downstream of Tgfb3 which provides additional mechanistic insight into the regenerative process. There is substantial interest in how/why zebrafish possess the capacity to regenerate retinal neurons from Müller glia after injury in comparison to mammals, which cannot. Interestingly, analyses of mouse retinae suggest that Tgfb3 expression is not detectable in mouse Müller glia, which might contribute to their inability to stimulate a regenerative response after retinal injury.

Decision letter after peer review:

Thank you for submitting your article "Tgfb3 inhibits retina regeneration via a PP2A-Notch signaling pathway" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Jeffrey Gross as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Kathryn Cheah as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

The paper by Goldman and colleague investigates how Tgfb-signaling influences the formation of Müller glia-derived progenitor cells in the fish retina. The authors utilize a variety of experimental manipulations that include state of the art genetic tools, including a constitutively active Alk5, heat-shock-induced Tgfb3, RBP-j/Notch reporter line, and generate a CRISPR-Cas9 deleted tgfb3-/- fish. Collectively, their data support a model in which resting Müller glia express elevated levels of Tgfb3 and that forced expression of Tgfb3 suppresses the proliferation of progenitors. Furthermore, their data suggest that the Tgfb3-signaling that suppresses proliferation is mediated, in part, through PPP2CA, and possibly also by promoting Notch-signaling.Overall, this is a generally well done study and one that will be of broad interest to the field.

Essential revisions:

1) The link between Tgfb3/pSmad3, PP2A signaling, and the Notch pathway is potentially the most novel aspect of the paper but is not fully developed or characterized. The authors state that Tgfb3-PP2A signaling "impinges" on Notch signaling, but the lack of mechanistic insight into the relationship between these pathways and retina regeneration is disappointing and needs to be experimentally clarified.

2) The findings regarding ppp2ca are interesting. However, it seems likely (and is suggested by existing scRNA-seq databases) that ppp2ca and all associated catalytic, structural and regulatory subunits are widely expressed in retinal neurons and glia. Thus, intravitreal delivery of okadaic acid is likely to broadly inhibit ppp2c in many different retinal cells (and perhaps also have off-target effects). Without targeted inhibition to MG or better descriptions of patterns of expression, the authors should use caution when asserting that ppp2ca-mediates non-canonical Tgfb3-signaling to suppress the formation of progenitor cells in damaged fish retinas. Interpretations and conclusions regarding ppp2ca should be softened, unless addition targeted experiments are performed that better support this pathway.

3) The findings of current paper have not been adequately discussed in the context of another recent paper from the Ramachandran lab. (Sharma et al., 2020) or Raymond lab (Lenkowski et al., 2013). Many of the findings from the current study are entirely contradictory, despite investigation of similar pathways and use of similar reagents. Particular with respect to patterns of expression of Tgfb isoforms and increases in proliferation of progenitors with the addition of Tgfb1 (Sharma et al., 2020). Additional discussion and explicit comparison of results here is needed.

4) The authors report effective suppression of pSmad3 in resting MG by systemic exposure to Alk5 inhibitors. SB431542 was also used in the study from Sharma and colleagues. It is not clear why the current study did not apply intravitreal SB431542 (similar to okadiac acid or p38 inhibitor) to test whether proliferating of progenitors is influenced by inhibition of Alk5 and, presumptively, failure to up-regulate pSmad3.

5) Normally Tgfbs are secreted as latent factors and require activation by gelatinases. Is it assumed that the hsp-driven Tgfb3 is produced as a latent form and then instantly activated by extracellular gelatinases?

6) Only once (for treatment with okadaic acid) are dying cells assessed. Since levels of damage are linked to numbers of proliferating progenitors, it seems prudent to assess levels of cell death with different manipulations to determine whether treatments impact neuronal damage, which in turn might impact numbers of proliferating cells. For example, is there more or less cell death in damaged retinas with loss of tgfb3 or ca-Alk5?

7) For Figure 1D, how were the BrdU cells quantified? It looks like the number of BrdU cells in the INL is similar or even increased, but the number of BrdU cells in the ONL are decreased. Are the cells in the ONL derived from MG? Please clarify.

8) It is surprising that gene expression changes are detectable among Tgfb ligands when using whole retina RNA and the needle poke model. Why was whole retina RNA used in Figure 2? Related, why are Tgfb levels sometimes normalized to Tgfb1 and sometimes to GAPDH?

9) Figure 1—figure supplement 1 – the labeling for pSmad3 in DMSO-treated retinas is strong. However, in inhibitor-treated retinas not only is the nuclear pSmad3 missing from the nuclei of Müller glia, but all of the background labeling is gone, as is autofluorescence in photoreceptor outer segments. This suggests the images were taken at different exposures or post-hoc processing was different. More generally, by what criterion is the fluorescence detected in some of the images referred to as autofluorescence?

10) From a scholarly perspective, the authors are undoubtedly aware that there are many labs doing retina regeneration, yet far too many of the citations only cite work from the Goldman lab. As one simple example, numerous papers have demonstrated a role for Ascl1 (MASH-1) in retina regeneration. A full scholarly account should cite the full breadth of papers across both the fish and mouse models, especially since those findings work together to validate a key role for Ascl1.

11) A few of the analyses lack quantification and statistical analyses (e.g. Figure 1B, C; Figure 7A).

12) All bar graphs should be remade to show individual data points.

https://doi.org/10.7554/eLife.55137.sa1

Author response

Essential revisions:

1) The link between Tgfb3/pSmad3, PP2A signaling, and the Notch pathway is potentially the most novel aspect of the paper but is not fully developed or characterized. The authors state that Tgfb3-PP2A signaling "impinges" on Notch signaling, but the lack of mechanistic insight into the relationship between these pathways and retina regeneration is disappointing and needs to be experimentally clarified.

We have provided additional data (Figure 7E) showing Tgfb3 stimulated hey1 expression which is a Notch-reporter gene in the zebrafish retina (Cell Reports 19: 849-62, 2017). Our data also suggest Tgfb3 may be regulating Notch signaling through its actions on dll4. These data, along with the stimulatory effect Tgfb3 has on Notch reporter fish that harbor multiple RBP-Jk binding sites (tp1:mCherry) strongly supports the idea that Tgfb3 acts, at least partly, through Notch signaling to regulate MG quiescence. The Results and Discussion section were revised to include our new data and clearly state that additional studies are needed to reveal PP2A mechanism of action (see end of Results and Discussion sections). We also edited the title of the paper for clarity.

We feel that requesting additional experiments to reveal mechanistic details of how Tgfb3 and PP2A mediate their effects on Müller glia proliferation would unreasonably delay publication beyond a year. For example, mechanistic insight into PP2A’s action will require the generation of new transgenic fish that allow for pulldown of Alk5 and PP2A so we can investigate if there is a direct interaction (there are no antibodies that work in fish for this analysis). Production of new transgenic lines and their analysis would take over a year to complete. Because PP2A data is a minor component of the paper (only Figure 6) and because it would take a large amount of time to further investigate its mechanism of action, we prefer to relegate additional mechanistic analysis to a future study.

2) The findings regarding ppp2ca are interesting. However, it seems likely (and is suggested by existing scRNA-seq databases) that ppp2ca and all associated catalytic, structural and regulatory subunits are widely expressed in retinal neurons and glia. Thus, intravitreal delivery of okadaic acid is likely to broadly inhibit ppp2c in many different retinal cells (and perhaps also have off-target effects). Without targeted inhibition to MG or better descriptions of patterns of expression, the authors should use caution when asserting that ppp2ca-mediates non-canonical Tgfb3-signaling to suppress the formation of progenitor cells in damaged fish retinas. Interpretations and conclusions regarding ppp2ca should be softened, unless addition targeted experiments are performed that better support this pathway.

We have softened our statements throughout the paper, including title and Abstract.

3) The findings of current paper have not been adequately discussed in the context of another recent paper from the Ramachandran lab. (Sharma et al., 2020) or Raymond lab (Lenkowski et al., 2013). Many of the findings from the current study are entirely contradictory, despite investigation of similar pathways and use of similar reagents. Particular with respect to patterns of expression of Tgfb isoforms and increases in proliferation of progenitors with the addition of Tgfb1 (Sharma et al., 2020). Additional discussion and explicit comparison of results here is needed.

We address this in the Discussion and also added a little more context on this subject to the Introduction. It is important to realize that even among the published papers and between multiple papers coming from the same group – inconsistencies emerge; we have included this information in the Discussion.

4) The authors report effective suppression of pSmad3 in resting MG by systemic exposure to Alk5 inhibitors. SB431542 was also used in the study from Sharma and colleagues. It is not clear why the current study did not apply intravitreal SB431542 (similar to okadiac acid or p38 inhibitor) to test whether proliferating of progenitors is influenced by inhibition of Alk5 and, presumptively, failure to up-regulate pSmad3.

This experiment was added to Figure 6. Consistent with Alk5 kinase activity being necessary for Tgfb3 effects on MG proliferation, we find SB431542 rescues MG proliferation in the Tgfb3 treated retina. Text was added to Results to describe this result.

5) Normally Tgfbs are secreted as latent factors and require activation by gelatinases. Is it assumed that the hsp-driven Tgfb3 is produced as a latent form and then instantly activated by extracellular gelatinases?

We added to the second paragraph of the Discussion the mechanism underlying Tgfb activation. Prodomain cleavage takes place in golgi prior to secretion and the non-covalent complex of latency domain and mature peptide bind integrin in the extracellular matrix which stimulates release of the mature protein so it can interact with its receptor. These proteins don’t require extracellular gelatinases for their activity.

6) Only once (for treatment with okadaic acid) are dying cells assessed. Since levels of damage are linked to numbers of proliferating progenitors, it seems prudent to assess levels of cell death with different manipulations to determine whether treatments impact neuronal damage, which in turn might impact numbers of proliferating cells. For example, is there more or less cell death in damaged retinas with loss of tgfb3 or ca-Alk5?

We include the TUNEL data for ca-Alk5 overexpression and Tgfb3 loss in Figure 1—figure supplement 1B and Figure 4—figure supplement 1C, respectively. We found ca-Alk5 suppressed TUNEL+ cell number in the injured retina, while Tgfb3 loss had no effect. We comment on the ca-Alk5 effect on TUNEL+ cells at the end of the first section of the Results under the heading “pSmad3 signaling is suppressed…” Our original data, presented in Figure 6—figure supplement 1B, showed Tgfb3 overexpression and okadaic acid treatment had no effect on TUNEL+ cells in the injured retina.

7) For Figure 1D, how were the BrdU cells quantified? It looks like the number of BrdU cells in the INL is similar or even increased, but the number of BrdU cells in the ONL are decreased. Are the cells in the ONL derived from MG? Please clarify.

Although MG nuclei migrate towards the ONL and divide at the base of the ONL, MG-derived progenitors divide in the INL. Thus, counting all proliferating cells is appropriate. Because we use a needle poke injury, proliferating cells at the site of injury are often displaced towards the GCL, while proliferating cells flanking the injury site are not displaced. This is what is observed in this picture. The reviewer is only looking at the displaced cells in the top Wt panel not the cells restricted to the INL. To help clarify this we labelled the various layers in the top panel. We added a couple of sentences to the Materials and methods subsection “Microscopy, cell quantification and statistical analysis”, to clarify how we do our counts and what is reported.

8) It is surprising that gene expression changes are detectable among Tgfb ligands when using whole retina RNA and the needle poke model. Why was whole retina RNA used in Figure 2? Related, why are Tgfb levels sometimes normalized to Tgfb1 and sometimes to GAPDH?

Figure 2A and B use RNA from FACS purified GFP+ MG from gfap:GFP and 1016 tuba1a:GFP fish and we added this to the figure legend (it is also in the Materials and methods section). We used total RNA from retinas for the time course experiments since it would be too costly and complex to FACS purify MG for every time point. However, the reason we can detect gene expression changes is that we give the fish 8-10 needle pokes when we analyze total retinal RNA by qPCR, which activates a regenerative response in most MG. This information was added to the Materials and methods subsection – “Animals, injury models, and cell proliferation assays”. All samples are corrected for variations in RNA amount using gapdh as a normalizer; however, to illustrate the magnitude of tgfb3 RNA abundance relative to the other injury-regulated tgfb genes, we normalized to tgfb1b which is the least abundant tgfb ligand encoding gene in MG.

9) Figure 1—figure supplement 1 – the labeling for pSmad3 in DMSO-treated retinas is strong. However, in inhibitor-treated retinas not only is the nuclear pSmad3 missing from the nuclei of Müller glia, but all of the background labeling is gone, as is autofluorescence in photoreceptor outer segments. This suggests the images were taken at different exposures or post-hoc processing was different. More generally, by what criterion is the fluorescence detected in some of the images referred to as autofluorescence?

We reimaged the sections and provide a new figure. Autofluorescence is defined as variable, background fluorescence that can be detected in multiple channels. This statement was added to the Materials and methods section.

10) From a scholarly perspective, the authors are undoubtedly aware that there are many labs doing retina regeneration, yet far too many of the citations only cite work from the Goldman lab. As one simple example, numerous papers have demonstrated a role for Ascl1 (MASH-1) in retina regeneration. A full scholarly account should cite the full breadth of papers across both the fish and mouse models, especially since those findings work together to validate a key role for Ascl1.

We added references as suggested.

11) A few of the analyses lack quantification and statistical analyses (e.g. Figure 1B, C; Figure 7A).

Quantification has been added to these figures.

12) All bar graphs should be remade to show individual data points.

Graphs were remade as requested with individual data points shown.

https://doi.org/10.7554/eLife.55137.sa2

Article and author information

Author details

  1. Mi-Sun Lee

    Michigan Neuroscience Institute and Department of Biological Chemistry, University of Michigan, Ann Arbor, United States
    Contribution
    Formal analysis, Validation, Investigation, Methodology, Writing - review and editing
    Contributed equally with
    Jin Wan
    Competing interests
    No competing interests declared
  2. Jin Wan

    Michigan Neuroscience Institute and Department of Biological Chemistry, University of Michigan, Ann Arbor, United States
    Contribution
    Formal analysis, Validation, Investigation, Methodology, Writing - review and editing
    Contributed equally with
    Mi-Sun Lee
    Competing interests
    No competing interests declared
  3. Daniel Goldman

    Michigan Neuroscience Institute and Department of Biological Chemistry, University of Michigan, Ann Arbor, United States
    Contribution
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    neuroman@umich.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0013-1188

Funding

Gilbert Family Foundation (Vision Restoration Initiative; AWD011459)

  • Daniel Goldman

National Institutes of Health (NEI RO1 EY018132)

  • Daniel Goldman

National Institutes of Health (NEI RO1 EY027310)

  • Daniel Goldman

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work was supported by grants from the NIH (NEI RO1 EY018132 and NEI RO1 EY027310) and the Gilbert Family Foundation Vision Restoration Initiative. We thank Caroline Burns, Harvard, for hsp70:ca-alk5 transgenic fish; David Hyde, Notre Dame, for zop:nsfb-EGFP and gfap:GFP transgenic fish, Michael Parsons, University California, Irvine, for tp1:mCherry transgenic fish, Doyun (George) Kim for help in genotyping fish; Curtis Powell for RNAseq; Flora Rajaei for preliminary in situ hybridization assays, Jonathan Jui for help with mouse retinal dissection, Aresh Sahu for suggesting Tgfb3 may regulate notch signaling component expression, Muchu Zhou and Zachary Rekowski for maintaining our zebrafish colony, and all members of the Goldman lab for their comments on this work. We also acknowledge and thank the University of Michigan’s Cell Sorting Core, Advanced Genomics Core, and Bioinformatics Core.

Ethics

Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Animal studies were approved by the University of Michigan's Institutional Animal Care and Use Committee.

Senior Editor

  1. Kathryn Song Eng Cheah, The University of Hong Kong, Hong Kong

Reviewing Editor

  1. Jeffrey Gross, University of Pittsburgh School of Medicine, United States

Reviewer

  1. Jeffrey Gross, University of Pittsburgh School of Medicine, United States

Publication history

  1. Received: January 14, 2020
  2. Accepted: May 12, 2020
  3. Accepted Manuscript published: May 12, 2020 (version 1)
  4. Version of Record published: May 26, 2020 (version 2)

Copyright

© 2020, Lee et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 661
    Page views
  • 153
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Developmental Biology
    2. Stem Cells and Regenerative Medicine
    Kacy L Gordon et al.
    Research Article

    Stem cells reside in and rely upon their niche to maintain stemness but must balance self-renewal with the production of daughters that leave the niche to differentiate. We discovered a mechanism of stem cell niche exit in the canonical C. elegans distal tip cell (DTC) germ stem cell niche mediated by previously unobserved, thin, membranous protrusions of the adjacent somatic gonad cell pair (Sh1). A disproportionate number of germ cell divisions were observed at the DTC-Sh1 interface. Stem-like and differentiating cell fates segregated across this boundary. Spindles polarized, pairs of daughter cells oriented between the DTC and Sh1, and Sh1 grew over the Sh1-facing daughter. Impeding Sh1 growth by RNAi to cofilin and Arp2/3 perturbed the DTC-Sh1 interface, reduced germ cell proliferation, and shifted a differentiation marker. Because Sh1 membrane protrusions eluded detection for decades, it is possible that similar structures actively regulate niche exit in other systems.

    1. Developmental Biology
    2. Stem Cells and Regenerative Medicine
    Louise Menendez et al.
    Research Article

    The mechanoreceptive sensory hair cells in the inner ear are selectively vulnerable to numerous genetic and environmental insults. In mammals, hair cells lack regenerative capacity, and their death leads to permanent hearing loss and vestibular dysfunction. Their paucity and inaccessibility has limited the search for otoprotective and regenerative strategies. Growing hair cells in vitro would provide a route to overcome this experimental bottleneck. We report a combination of four transcription factors (Six1, Atoh1, Pou4f3, and Gfi1) that can convert mouse embryonic fibroblasts, adult tail-tip fibroblasts and postnatal supporting cells into induced hair cell-like cells (iHCs). iHCs exhibit hair cell-like morphology, transcriptomic and epigenetic profiles, electrophysiological properties, mechanosensory channel expression, and vulnerability to ototoxin in a high-content phenotypic screening system. Thus, direct reprogramming provides a platform to identify causes and treatments for hair cell loss, and may help identify future gene therapy approaches for restoring hearing.