(a) Coronal sections from neonatal (P0) brains of controls (Ctrl), Pum2 cKO, or Prnp-TARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing Sox5, Bcl11b, or Rorβ or with DAPI to mark …
(a, b) Deleting the targeting cassette with Flp recombinase leaves a ‘floxed allele’ of Pum2 for cKO. Mating directly to mice expressing Cre recombinase in the germline generates a general Pum2-KO …
(a) Bright-field images of controls (Ctrl), Pum2 cKO, and TDP43A315T mice brains at P0. Quantification of the brain anatomy including hemisphere length, width, and area is shown below. Scale bar: 1 …
Nissl staining of coronal (top) and sagittal (bottom) sections of controls (Ctrl), Pum2 cKO, and TDP43A315T mice at P0 (coronal) and P7 (sagittal). To the right and below, higher-magnification …
(a) Schematic representations of a mouse brain are shown. The upper left is a top-down view with different primary areas in neocortex indicated: primary motor area (M1) in green, primary …
(a, b) Quantification of total Sox5-, Rorβ-, and DAPI-positive neurons and layer V Bcl11b+ neurons in controls (Ctrl), Pum2 cKO, or TDP43A315T mice in pS (a) or F/M) (b. The total number of Sox5+ or …
(a, b) Coronal sections at P0 from controls (Ctrl), Pum2 cKO, and TDP43A315T brains immunolabeled for Tbr1 and Cux1 in prospective somatosensory cortex (pS) (a) or frontal/motor area (F/M) (b). To …
(a) Coronal sections of pS at P0 from controls, Pum2 cKO, Pum2 KO, or heterozygous Pum2 cKO (Pum2fl/+; Emx1Cre) animals stained with DAPI or immunostained for Sox5, Bcl11b, or Tbr1. (b) Histograms …
Coronal sections from neonatal (P0) brains of non-transgenic controls (nTg), Prnp-TARDBP (TDP43), and hTARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing either human TDP-43 …
(a) Coronal sections from neonatal (P0) brains of control mice (Ctrl) or mice from a transgenic line expressing, Prnp-TARDBP (TDP43), were stained with antibodies recognizing Sox5, Bcl11b, or Rorβ …
(a) Coronal sections from neonatal (P0) brains of controls (Ctrl), Pum2 cKO, or Prnp-TARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing Sox5, Bcl11b, or with DAPI to mark nuclei …
(a) Schematic representation of cholera toxin subunit B (CTB) injections at the midbrain/hindbrain junction (pons) for retrograde labeling of subcerebral projection neurons (SCPNs), including …
(a) Coronal sections from neonatal (P0) brains of controls (Ctrl), Pum2 cKO, or Prnp-TARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing Sox5 and Bcl11b in the prospective …
(a) Coronal sections of one brain hemisphere from controls (Ctrl), Pum2 cKO, and TDP43A315T brains at P0 co-immunostained for Lmo4 and Bhlhb5. Selected regions are marked by white rectangles in the …
(a–c) Primary neurons harvested from WT cortical lysates enriched for somatosensory cortex at E18.5 were transfected before plating with plasmids encoding either control GFP, TDP43, or TDP43A315T. …
(a, b) Coronal sections from Pum2fl/fl (a) or WT (b) brains at P0 electroporated at E13,5 with pNeuroD-IRES-GFP as control, or with p-NeuroD-IRES-Cre-GFP to ablate Pum2 expression (a) or …
High-magnification coronal sections from Pum2fl/fl (a) or WT (b) brains at P0 electroporated with pNeuroD-IRES-GFP as control, or with p-NeuroD-IRES-Cre-GFP to ablate Pum2 expression (a) or …
(a, b) Coronal sections from Pum2fl/fl (a) or WT (b) brains at P0 electroporated at E14.5 with pNeuroD-IRES-GFP as control, or with p-NeuroD-IRES-Cre-GFP to ablate Pum2 expression (a) or …
qRT-PCR of RNA derived from P0 somatosensory area-enriched cortical lysates for Pum2 cKO (a) or TDP43A315T (b). The fold change for Sox5, Bcl11b, Rorb, and Fezf2 mRNAs normalized to GAPDH mRNA is …
(a) Schematic overview of polysome profiling for developing neocortices. Lysates from dissected E14.5 cortices were separated on polysome gradients, and RNA was prepared from fractions (F1–6) …
(a, b) Expression of Sox5, Bcl11b, and Rorb splicing mRNA isoforms normalized to GAPDH mRNA is shown in P0 somatosensory area-enriched cortical lysates of Pum2 cKO (a) and TDP43 A315T (b) mutants …
(a) 3′UTR regions for mouse Sox5, Bcl11b/Bcl11b, and Rorb mRNAs from Ensembl are shown to scale. Alternative polyadenylation sites that give rise to the different 3′UTR isoforms are indicated, as …
(a) Representative polysome profiles from E14.5 neocortices are shown for controls (Ctrl), Pum2 cKO (top), and TDP43A315T (bottom). Quantification of polysome/monosome (P/M) ratio for n = 3 of each …
(a, b) Single-molecule fluorescent in situ hybridization (smFISH) for Sox5, Bcl11b, and Rorb mRNAs coupled with immunofluorescence for Pum2 (a) or TDP-43 (b) on coronal sections from the prospective …
(a) Wild-type coronal sections from frontal motor (F/M) and prospective somatosensory (pS) areas at P0 immunostained for endogenous mouse Pum2 or TDP-43. White boxes indicate the selected cortical …
mRNA | Forward primer (5′–3′) | Reverse primer (5′–3′) |
---|---|---|
Sox5 | CCAGGACTTGTCTTTCCAG | CCCTGAAGCAGAGGAAGATG |
Bcl11b | AAGCCATGTGTGTTCTGTGC | AAAGGCATCTGTCCAAGCAG |
Rorb | ATGCCAGCTGATGGAGTTCT | TAGCTCCCGGGATAACAATG |
Fezf2 | GTGGCTCCCACCTTTGTACATTCA | TCACGGTGACAGGCTGGGATTAAA |
Cux1 | CCTGCAGAGTGAGCTGGAC | GCTTGCTGAAGGAGGAGAAC |
Gapdh | TTGATGGCAACAATCTCCAC | CGTCCCGTAGACAAAATGGT |
Pum2 | CCCCGAGATTCTAATGCAAG | CTGGAAGAAGCACGGTGAAT |
Pum2 exons 6&7 | ATTGGGCCCTCTTCCTAATC | CCAACTTGGTCCATTGCAT |
Tardbp | CGTGTCTCAGTGTATGAGAGGAGTC | CTGCAGAGGAAGCATCTGTCTCATCC |
Emx1 | ACCATAGAGTCCTTGGTGGC | TGGGGTGAGGATAGTTGAGC |
Sox6 | GCATAAGTGACCGTTTTGGCAGG | GGCATCTTTGCTCCAGGTGACA |
Unc5C | ACTCAATGGCGGCTTTCAGCCT | GGTCCAGAATTGGAGAGTTGGTC |
18s rRNA | CTTAGAGGGACAAGTGGCG | ACGCTGAGCCAGTCAGTGTA |
Rluc | TGGTAACGCGGCCTCTTCT | GCCTGATTTGCCCATACCAA |
mRNA | Forward primer (5′–3′) | Reverse primer (5′–3′) |
---|---|---|
Sox5 204 | CGTACATGATACGTCCTCCC | CCAGCCCCACTGTTTATTC |
Sox5 206 | CTTGAGGTTTGTTCTCCTCTG | GCCATAGTGGTTGGGATCAG |
Sox5 211 | GTACATGATACGTCCTCCCC | TCTTGTCTGTGTGAATGCTG |
Sox5 diff | ATGCTTACTGACCCTGATTTAC | TCTCACTCTCCTCCTCTTCC |
Bcl11b 201 | CAGTGTGAGTTGTCAGGTAAAG | GCTCCAGGTAGATTCGGAAG |
Bcl11b 202 | TCCCAGAGGGAACTCATCAC | GCTCCAGGTAGATTCGGAAG |
Bcl11b 203 | CCTACTGTCACCCACGAAAG | GCTCCAGGTAGATTCGGAAG |
Rorb 201 | CTGCACAAATTGAAGTGATACC | AAACAGTTTCTCTGCCTTGG |
Rorb 202 | AAGCATAGCACGCAGCACTC | ATCCCGGAGGATTTATCGCCAC |
Rorb 203 | AGCGGAATTTTTGGGTTCTC | ACGTGATGACTCCGTAGTG |
Each forward primer has its reverse primer below. F: forward; R: reverse.
Allele | Primer (5′–3′) | Predicted size (bp) |
---|---|---|
mSox5-346F | CCT TTC ACC TTC CCT TAC ATG | 833 |
mSox5-1178R | AGC AGC TGC CAT AGT GGT TG | |
mSox5-512F | CAA CTC ATC TAC CTC ACC TCA G | 457 |
mSox5-968R | CAG AAG CTG CTG CTG TTG | |
mSox5-899F | ACA GCG TCA GCA GAT GGA G | 637 |
mSox5-1535R | GCT AAC TCT TGC AGA AGG AC | |
mSox5-1426F | CTG CAT CAC CCA CCT CTC | 535 |
mSox5-1960R | CTG ATG TTG GAA TTG TGC ATG |
mRNA | Forward primer (5′–3′) | Reverse primer (5′–3′) |
---|---|---|
Sox5 S1 | GCCGTTCTCAGGTGAAAAGA | GCCTGACATTATTCCCCAAT |
Sox5 S2 | CAGACAACTGCAGCCACTTC | TTGGCAACATGAGAGGACTG |
Sox5 S3 | TAGGTCACTTGGGGGAAAGC | GCAAGGGCATTGTGTTGTTA |
Sox5 S4 | TGCAAACTACCATCTCACTTG AA | TGGCATGAATGATAACATAAAA CC |
Bcl11b B1 | GGACGGGAAAATGCCATAAG | AAGTCACCTCCACTCCATATC |
Bcl11b B2 | TACCCTGCCCTTTTGACACC | TTGACAGAGACACACAAGTCC |
Rorb R1 | GGAAAACAGGGTAATGGAAGG | GGGAACATCAAGTAGACACAG |
Rorb R2 | AAATATGTACTCGCTCCCTTTC | AGCCCTGTCCCTTTCTTAG |
Allele | Forward primer (5′–3′) | Reverse primer (5′–3′) |
---|---|---|
Pum2 KO | GCTGCTACTCCCTTTCTTGC | GAGCACATGTGGAGGTCAGA |
Pum2 WT and floxed | GCTGCTACTCCCTTTCTTGC | CCAAGGCGCTCAACTACTTC |
Cre | TAACATTCTCCCACCGCTAGTACG | AAACGTTGATGCCGGTGAACGTGC |
Actin | CAATAGTGATGACCTGGCCGT | AGAGGGAAATCGTGCGTGAC |
TDP43A315T | GGATGAGCTGCGGGAGTTCT | TGCCCATCATACCCCAACTG |
TDP43 | GGATGAGCTGCGGGAGTTCT | TGCCCATCATACCCCAACTG |
Control for TDP43 | CAAATGTTGCTTGTCTGGTG | GTCAGTCGAGTGCACAGTTT |
Quantification of layer II–VI molecular determinants in Pum2 cKO mutants.
Quantification of results from n = 3 mice of controls and Pum2 mutants in the prospective somatosensory cortex (pS) for Sox5, Bcl11b, Rorβ, and DAPI in single bins (Figure 1a) and total (Figure 1—figure supplement 5a) and Tbr1, Cux1 in single bins (Figure 1—figure supplement 6a). All markers are normalized to DAPI cells. Distribution of cells across six equal-sized bins is shown. For Bcl11b, only high-expressing neurons were counted. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; II–IV, V, VI: layers II–IV, V, and VI.
Quantification of layer II–VI molecular determinants in TDP43A315T mutants.
Quantification of results from n = 3 mice of controls and TDP43A315T in the prospective somatosensory cortex (pS) for Sox5, Bcl11b, Rorβ, and DAPI in single bins (Figure 1b) and total (or layer V for Bcl11b) (Figure 1—figure supplement 5b) and Tbr1, Cux1 in single bins (Figure 1—figure supplement 6b). All markers are normalized to DAPI cells. Distribution of cells across six equal-sized bins is shown. For Bcl11b, only high-expressing neurons were counted. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; II–IV, V, VI: layers II–IV, V, and VI.
Quantification of layer V and VI molecular determinants in the frontal/motor (F/M) cortex of Pum2 and TDP-43 mutants.
Quantification of results from n = 3 mice of Pum2 and TDP-43 mutants and their control littermates in the F/M for Sox5, Bcl11b, and DAPI in single bins (Figure 2b) and total (Figure 1—figure supplement 5b) and Tbr1 in single bins (Figure 1—figure supplement 6b). All markers are normalized to DAPI cells. Distribution of cells across six equal-sized bins is shown. For Bcl11b, only high-expressing neurons were counted. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; II–IV, V, VI: layers II–IV, V, and VI.
Validation of Pum2 cKO mutants by qRT-PCR.
qRT-PCR of E14.5 cortical RNA from controls (Ctrl) vs. Pum2 cKO using primers to the floxed exons. The fold change in expression levels of Pum2 mRNA normalized to GAPDH mRNA in the Pum2 cKO is shown relative to the Cre- control (Ctrl) in Figure 1—figure supplement 1c. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. * p≤0.05, two-tailed t-test.
Quantification of general cortical developmental features in Pum2 and TDP-43 mutants.
Quantification of the brain anatomy including hemisphere length, width, and area (Figure 1—figure supplement 2a), cortical thickness (Figure 1—figure supplement 2b), and nuclei size (Figure 1—figure supplement 2c) in Pum2 and TDP-43 mutants. n = 3–6 samples of each genotype. *p≤0.05, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.
Quantification of Sox5 expression in the prospective somatosensory cortex (pS) of Pum2 KO mice.
Quantification of results from n = 3 mice of controls and Pum2 KO mice in the pS for Sox5 normalized to DAPI in single bins and total (Figure 1—figure supplement 7). Data are represented as means ± standard error of the mean (SEM). *p≤0.05, **p≤0.01 by two-tailed t-test. Ctrl: controls; Pum2 KO: Pum2 constitutive knockout.
Quantification of TDP-43 overexpression.
Quantification of fold changes in protein levels of human TDP-43 (hTDP-43) or both mouse and human (m+h) TDP-43 normalized to total protein in nuclear or cytoplasmic fractions from three mice (n1–3) of each genotype (Ctrl, TDP43, or TDP43A315T) (Figure 1—figure supplement 8c). Data are shown as means ± SEM, n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001 by one-tailed t-test.
Quantification of layer IV/V molecular determinants in hTDP-43 mice.
Quantification of results from n = 3 animals of controls mice (Ctrl) or mice from a transgenic line expressing Prnp-TARDBP (TDP43) shown in six equal-sized bins and the total number of Sox5- or Rorβ- or Bcl11b or DAPI-positive cells (Figure 1—figure supplement 9b). Only high-expressing Bcl11b+ neurons were counted. Data are shown as means ± SEM, n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001 by two-tailed t-test. IV, V, VI: layers IV, V, and VI.
Quantification of subcerebral projection neuron (SCPN) in Pum2 and TDP-43 mutants.
Quantification of retrogradely labeled SCPNs in equal-sized bins for the three genotypes. Analysis of bins 3 and 4 is shown separately and combined (Figure 3c). Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.
Quantification of Sox5/Bcl11b colocalization in Pum2 and TDP-43 mutants.
Quantification of results from n = 3 brains of controls (Ctrl), Pum2 cKO, or hTARDBPA315T (TDP43A315T) in the prospective somatosensory area (pS) for Sox5 and Bcl11b colocalization across six equal-sized bins (Figure 4a). Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.
Analysis of frontal motor (F/M) and prospective somatosensory (pS) areas identities.
Quantification of results from n = 3 animals from controls (Ctrl), Pum2 cKO, and TDP43A315T for Lmo4 and Bhlhb5 in F/M and pS areas in single bins and total. Results of F/M and pS for both markers are compared between mutants and their controls and between F/M and pS of each genotype. A summary of total cells only is shown independently comparing F/M and pS in each genotype (Figure 5a). Quantification of the number of barrels per section (Figure 5b) from n = 3 brains of controls (Ctrl), Pum2 cKO, or hTARDBPA315T (TDP43A315T). Data are shown as means ± standard error of the mean (SEM). *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.
Analysis of TDP-43 gain-of-function effect in vitro on layer IV/V molecular determinants.
Quantification of the fraction of Sox5+, Bcl11b+, or Rorβ+ neurons among all transfected neurons with plasmids encoding either control GFP, TDP43, or TDP43A315T. At least 50 cells were counted for each replicate of every transfection. Data are shown as means ± standard error of the mean (SEM), n = 3 for each transfection. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test.
Analysis of post-mitotic effect of Pum2 loss-of-function and TDP-43 gain-of-function in vivo on layer IV/V molecular determinants.
Quantification of results from Pum2fl/flor WT brains at P0 electroporated at E13,5 with pNeuroD-IRES-GFP as control, or with p-NeuroD-IRES-Cre-GFP to ablate Pum2 expression (Figure 7a) or p-NeuroD-TDP43-IRES-GFP or p-NeuroD-TDP43A315T-IRES-GFP to overexpress hTDP-43 alleles (Figure 7b) only in post-mitotic neurons. The fraction of Sox5+, Bcl11b+, or Rorβ+ neurons among all electroporated cells was quantified. Data are shown as means ± standard error of the mean (SEM), n = 3 for each electroporation. Both p-NeuroD-IRES-Cre-GFP and hTDP-43 alleles were co-electroporated with T-dimer (red) to distinguish them from littermate control brains electroporated only with pNeuroD-IRES-GFP. For both hTDP-43 alleles, the respective control littermates for each variant were combined to a total of n = 6 for pNeuroD-IRES-GFP electroporations. **p≤0.01, ***p≤0.001, two-tailed t-test.
Quantification of mRNA levels of layer IV/V neuronal identity determinants in Pum2 cKO or TDP43A315T mutants.
qRT-PCR of RNA derived from P0 somatosensory area-enriched cortical lysates for Pum2 cKO (Figure 8a) or TDP43A315T (Figure 8b). The fold change for Sox5, Bcl11b, Rorb, and Fezf2 mRNAs normalized to GAPDH mRNA is shown for mutants relative to respective control samples (Ctrl). Data are displayed as means ± standard error of the mean (SEM) for at least n = 4 of each genotype.
Quantification of mRNA levels of layer IV/V neuronal identity determinants in Pum2 cKO or TDP43A315T mutants.
Quantification of results from single-molecule fluorescent in situ hybridization (smFISH) for Sox5, Bcl11b, Rorb, and Fezf2 mRNAs on coronal sections from the prospective somatosensory area (pS) of controls (Ctrl), Pum2 cKO, and TDP43A315T mice at P0. Distribution of cells across six equal-sized bins (Figure 8d). The number of RNA dots in the bins where they are mostly expressed is normalized to the total number of cell nuclei (DAPI) within that bin. Data are shown as means ± standard error of the mean (SEM), at least n = 3 for each genotype. *p≤0.05 by two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.
Translational control of layer IV/V neuronal identity determinants by TDP-43 in developing neocortex.
Quantification of results from n = 3 experiments of polysome profiling on TDP43A315T cortices at E14.5 (Figure 8c). Histograms depict the distribution of the Sox5, Bcl11b, Rorb, and Fezf2 mRNAs across the gradient fractions for TDP43A315T relative to corresponding controls (Ctrl). Samples in heavier gradient fractions were virtually pooled at analysis to simplify visualization in the case of the Bcl11b B1 primer. Levels of specific mRNAs in each fraction were analyzed by qRT-PCR with normalization to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, one-tailed t-test.
Translational control of layer IV/V neuronal identity determinants by Pum2 in developing neocortex.
Quantification of results from n = 3 experiments of polysome profiling on Pum2 cKO prospective somatosensory area (pS)-enriched cortices at P0 (Figure 8d). Histograms depict the distribution of the Sox5, Bcl11b, Rorb, and Fezf2 mRNAs across the gradient fractions for Pum2 cKO relative to corresponding controls (Ctrl). Samples in heavier gradient fractions were virtually pooled at analysis to simplify visualization. Levels of specific mRNAs in each fraction were analyzed by qRT-PCR with normalization to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, one-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.
Expression of Sox5 splicing isoforms in Pum2 and TDP-43 mutant neocortices.
Quantification of expression of Sox5 splicing mRNA isoforms normalized to GAPDH mRNA in P0 somatosensory area-enriched cortical lysates of Pum2 cKO (Figure 9—figure supplement 1a) and TDP43A315T (Figure 9—figure supplement 1b) mutants and their respective control samples (Ctrl). For Sox5, 7 protein-coding isoforms were annotated. We designed primers recognizing three of them, and it was not possible to design specific qPCR primers to distinguish the other four isoforms for which we used a primer called Sox5 diff to detect the four of them simultaneously. Data are shown as means ± standard error of the mean (SEM) for at least n = 4 of each genotype. Pum2 cKO: Pum2fl/fl; Emx1Cre. Two-tailed t-test.
Expression of Bcl11b and Rorb splicing isoforms in Pum2 and TDP-43 mutant neocortices.
Quantification of expression of Bcl11b and Rorb splicing mRNA isoforms normalized to GAPDH mRNA is shown in P0 somatosensory area enriched cortical lysates of Pum2 cKO (Figure 9—figure supplement 1a) and TDP43 A315T (Figure 9—figure supplement 1b) mutants and their respective control samples (Ctrl). Data are shown as means ± standard error of the mean (SEM) for at least n = 4 of each genotype. Pum2 cKO: Pum2fl/fl; Emx1Cre. Two-tailed t-test.
Expression of Sox5 3′UTR isoforms in Pum2 and TDP-43 mutant neocortices.
Quantification of expression of Sox5 3′UTR mRNA isoforms normalized to GAPDH mRNA in P0 somatosensory area-enriched cortical lysates of Pum2 cKO (Figure 9—figure supplement 2a) and TDP43 A315T (Figure 9—figure supplement 2b) mutants and their respective control samples (Ctrl). Data are shown as means ± standard error of the mean (SEM) for at least n = 4 of each genotype. Pum2 cKO: Pum2fl/fl; Emx1Cre. Two-tailed t-test.
Expression of Bcl11b and Rorb 3′UTR isoforms in Pum2 and TDP-43 mutant neocortices.
Quantification of expression of Bcl11b and Rorb 3′UTR mRNA isoforms normalized to GAPDH mRNA is shown in P0 somatosensory area-enriched cortical lysates of Pum2 cKO (Figure 9—figure supplement 2a) and TDP43A315T (Figure 9—figure supplement 2b) mutants and their respective control samples (Ctrl). Data are shown as means ± standard error of the mean (SEM) for at least n = 4 of each genotype. Pum2 cKO: Pum2fl/fl; Emx1Cre. Two-tailed t-test.
Analysis of general translation in Pum2 and TDP-43 mutant cortices.
Quantification of polysome/monosome (P/M) ratio from polysome profiles of E14.5 neocortices for controls (Ctrl), Pum2 cKO, and TDP43A315T for n = 3 of each genotype (Figure 9—figure supplement 3a). Two-tailed t-test.
Translational control of layer V neuronal identity determinants by Pum2 in developing E13.5 neocortex.
Quantification of polysome profiling from E13.5 neocortices of Pum2 cKO (Figure 9—figure supplement 3b). Histograms showing the distribution of the Sox5 and Bcl11b mRNAs at E13.5 across polysome gradient fractions for Pum2 cKO relative to controls. E13.5 is the peak time of birth for layer V neurons when no layer IV Rorβ+ neurons are born yet. Values were normalized to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are represented as means ± standard error of the mean (SEM). *p≤0.05 by two-tailed t-test.
Translational control of layer V neuronal identity determinants by Pum2 in developing E14.5 neocortex.
Quantification of polysome profiling from E14.5 neocortices of Pum2 cKO (Figure 9—figure supplement 3b). Histograms showing the distribution of the Sox5, Bcl11b, and Rorb mRNAs at E14.5 across polysome gradient fractions for Pum2 cKO relative to controls. Values were normalized to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are represented as means ± standard error of the mean (SEM). **p≤0.01 by two-tailed t-test.
Translational control of layer V neuronal identity determinants by Pum2 in developing E18.5 neocortex.
Quantification of polysome profiling from E18.5 neocortices of Pum2 cKO (Figure 9—figure supplement 3b). Histograms showing the distribution of the Sox5, Bcl11b, and Rorb mRNAs at E18.5 across polysome gradient fractions for Pum2 cKO relative to controls. Values were normalized to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are represented as means ± standard error of the mean (SEM). Two-tailed t-test.
Analysis of Pum2 and TDP-43 interaction with mRNAs encoding key regulators of layer IV/V neuronal identity in developing neocortex.
Quantification of results from UV cross-linking immunoprecipitation (UV-CLIP) from E18.5 cortices (Figure 10c). Dissociated cells were either cross-linked with UV light or left untreated as a control. Lysates were used for immunoprecipitations with antibodies against TDP-43, Pum2, or control nonspecific IgG. RNA in the input and IP eluate were analyzed by qRT-PCR for Sox5, Bcl11b, Rorb, Fezf2, Cux1, Pum2, Tdp43, and 18S mRNAs. After verifying enrichment relative to IgG controls for UV-treated samples, histograms were generated that represent the fraction of input mRNA co-immunoprecipitated with either Pum2 or TDP-43 in the presence or absence of UV cross-linking. Statistically significant enrichment was evaluated relative to 18S rRNA, which is not known to interact significantly with either protein. Reduced signal in the absence of UV-cross-linking implies an interaction is cross-linking-dependent, that is, direct. Data are represented as means ± standard error of the mean (SEM) from n = 3–6 samples. Raw values and data normalized to 18S of each replicate are shown independently in different sheets, and a summary of consolidated results from six replicates is in the last Excel sheet. *p≤0.05, ** p≤0.01, Mann–Whitney U test.
mRNA expression pattern of Emx1, Sox6, and Unc5C.
Quantification of the fold change for Emx1 mRNA normalized to GAPDH mRNA is shown for P0 somatosensory area-enriched cortical lysates of Pum2 cKO relative to respective control samples (reviewers Figure 1a). Quantification of the fold change for Sox6 and Unc5C mRNA normalized to GAPDH mRNA is shown for P0 somatosensory area-enriched cortical lysates of Pum2 cKO and TDP43A315T (reviewers Figure 2a and b) relative to respective control samples (Ctrl). Data are shown as means ± standard error of the mean (SEM) for n = 4-6 animals of each genotype. *p≤0.05 by two-tailed t-test.
Emx1 protein expression in Pum2 mutants.
Analysis of results of Western blot performed on nuclear fractions from three mice (N1–3) of Ctrl and Pum2 cKO for Emx1 protein. Quantification of corresponding fold changes in Emx1 protein levels normalized to total protein is shown below. Data are shown as means ± standard error of the mean (SEM), n = 3 of each genotype. two-tailed t-test.
Analysis of Sox5, Bcl11b, and Rorb mRNAs across polysome gradient fractions after puromycin treatment.
Quantification of results of polysome profiling from P0 WT somatosensory area-enriched cortices neocortices for controls (Ctrl) and puromycin-treated samples (reviewers Figure 3). Histograms showing the distribution of the Sox5, Bcl11b, Rorb, Fezf2, GAPDH, and 18S mRNAs across polysome gradient fractions for puromycin-treated samples relative to controls. Values were normalized to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are represented as means ± standard error of the mean (SEM). *p≤0.05 by two-tailed t-test.
Source data for Western blots.
A zipped folder containing original and labeled bands photos for Western blots of Pum2 and tubulin as control (Figure 1—figure supplement 1e), human and mouse TDP-43 and total protein stain as control (Figure 1—figure supplement 8c), and Emx1 and total protein stain as control (reviewers Figure 1b).