Pum2 and TDP-43 refine area-specific cytoarchitecture post-mitotically and modulate translation of Sox5, Bcl11b, and Rorb mRNAs in developing mouse neocortex

  1. Kawssar Harb  Is a corresponding author
  2. Melanie Richter
  3. Nagammal Neelagandan
  4. Elia Magrinelli
  5. Hend Harfoush
  6. Katrin Kuechler
  7. Melad Henis
  8. Irm Hermanns-Borgmeyer
  9. Froylan Calderon de Anda  Is a corresponding author
  10. Kent Duncan  Is a corresponding author
  1. Neuronal Translational Control Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Germany
  2. Institute of Developmental Neurophysiology, Center for Molecular Neurobiology, University Medical Center Hamburg-Eppendorf, Germany
  3. Department of Basic Neuroscience, University of Geneva, Switzerland
  4. Department of Anatomy and Histology, Faculty of Veterinary Medicine, New Valley University, Egypt
  5. Transgenic Service Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Germany

Abstract

In the neocortex, functionally distinct areas process specific types of information. Area identity is established by morphogens and transcriptional master regulators, but downstream mechanisms driving area-specific neuronal specification remain unclear. Here, we reveal a role for RNA-binding proteins in defining area-specific cytoarchitecture. Mice lacking Pum2 or overexpressing human TDP-43 show apparent ‘motorization’ of layers IV and V of primary somatosensory cortex (S1), characterized by dramatic expansion of cells co-expressing Sox5 and Bcl11b/Ctip2, a hallmark of subcerebral projection neurons, at the expense of cells expressing the layer IV neuronal marker Rorβ. Moreover, retrograde labeling experiments with cholera toxin B in Pum2; Emx1-Cre and TDP43A315T mice revealed a corresponding increase in subcerebral connectivity of these neurons in S1. Intriguingly, other key features of somatosensory area identity are largely preserved, suggesting that Pum2 and TDP-43 may function in a downstream program, rather than controlling area identity per se. Transfection of primary neurons and in utero electroporation (IUE) suggest cell-autonomous and post-mitotic modulation of Sox5, Bcl11b/Ctip2, and Rorβ levels. Mechanistically, we find that Pum2 and TDP-43 directly interact with and affect the translation of mRNAs encoding Sox5, Bcl11b/Ctip2, and Rorβ. In contrast, effects on the levels of these mRNAs were not detectable in qRT-PCR or single-molecule fluorescent in situ hybridization assays, and we also did not detect effects on their splicing or polyadenylation patterns. Our results support the notion that post-transcriptional regulatory programs involving translational regulation and mediated by Pum2 and TDP-43 contribute to elaboration of area-specific neuronal identity and connectivity in the neocortex.

Editor's evaluation

All of the reviewers and editors agree that your deep, rigorous, and multidimensional study addresses novel and significant questions, that it will be an important addition to the literature, and that it presents experiments and data that will motivate further study in the field. You have convincingly demonstrated translational modulation of Sox5, Bcl11b, and Rorb by the RNA-binding proteins (RBPs) Pum2 and TDP-43, with thoughtful experiments supporting cell-autonomous effects of the RBPs on the translational regulation of Bcl11b, Sox5, and Rorb. Your in vivo gain and loss-of-function data in a range of genetically manipulated mouse lines, coupled with in vitro neuronal culture experiments, provide strong evidence for the control that Pum2 and TDP43 exert on these key regulators of neuronal diversification during corticogenesis. Thank you for completing such a deeply informative body of work and for discussing the complexities involved so thoughtfully within your paper.

https://doi.org/10.7554/eLife.55199.sa0

Introduction

The neocortex is the largest and the most complex structure in the mammalian brain and plays a crucial role in processing sensory information, controlling movement and higher-level cognition. Two prominent architectural features of the neocortex are its ‘tangential areal’ and ‘radial laminar’ organization. Neocortical areas, defined by Brodmann as the ‘organs of the brain,’ form the basis for sensory perception and mediate our behavior (Rakic, 1988; Zilles and Amunts, 2010). The basic plan of the neocortex comprises four primary areas, spatially organized into six horizontal layers, each containing a heterogeneous population of neurons, distinguished by their morphology, connectivity, molecular code, and function (O’Leary and Nakagawa, 2002; Rash and Grove, 2006; Sur and Rubenstein, 2005). Within each area, the relative number of neuronal subtypes appears to be tuned to correspond with area function. For instance, the primary motor area (M1) has a thick layer V with numerous subcerebral output neurons, but a very thin layer IV for receiving thalamic input. In contrast, the primary somatosensory area (S1) has exactly the opposite organization and is therefore adapted to receive input (Dehay and Kennedy, 2007; Glickfeld et al., 2013; Yamawaki et al., 2014).

Neocortical area patterning is controlled by a regulatory hierarchy: Morphogens establish differentially graded expression of transcription factors, which then determine the area identity of the neurons forming the cortical plate (Alfano and Studer, 2013; O’Leary et al., 2007; O’Leary and Sahara, 2008). This areal commitment of newly born projection neurons is followed by laminar fate determination. Opposing molecular programs direct their differentiation into one of the major neuronal subtype identities (Greig et al., 2013; Jabaudon, 2017; Molyneaux et al., 2007). Most work to date has addressed these two major regulatory schemes separately. Thus, how they interact and how neurons integrate area and subtype identities remains mysterious. Area-specific differences in layer-neuron identity imply exquisite molecular control over cell fate within specific areas. Nevertheless, downstream molecular mechanisms that define area-specific patterns of neuronal identity and connectivity remain poorly understood.

Historically, most analyses of how regulation of gene expression contributes to corticogenesis focused on transcriptional control by nuclear transcription factors, which clearly is a major driving force in control of neuronal fate (Greig et al., 2013; O’Leary and Sahara, 2008). In contrast, the role of post-transcriptional regulation in cortical development is still emerging. RNA-binding proteins (RBPs) are major mediators of post-transcriptional control and can influence different steps of mRNA metabolism, including splicing, stability, translation, and localization (Pilaz and Silver, 2015). Recent studies have revealed roles for RBPs in many aspects of cortical development that affect cortical cytoarchitecture and suggest potential connections between these effects and both neurodevelopmental and neurodegenerative diseases (Jung and Lee, 2021; Kanemitsu et al., 2017; Kiebler et al., 2013; Kraushar et al., 2014; La Fata et al., 2014; Lee et al., 2019; Pilaz and Silver, 2015; Sena et al., 2021; Vessey et al., 2012; Zahr et al., 2018). However, whether RBPs regulate cytoarchitecture area-specifically remains unknown.

Here, we examine the potential contribution of post-transcriptional regulation to area-specific neuronal identity and connectivity by focusing on two RBPs: Pumilio-2 (Pum2) and Tar-DNA binding protein 43 (TDP-43). We chose to focus on these specific proteins based on their known and distinct roles in post-transcriptional regulation in the nervous system and because of TDP-43’s importance in neurodegenerative diseases that affect cortical neurons (Buratti and Baralle, 2014; Goldstrohm et al., 2018; Lagier-Tourenne et al., 2010; Martínez et al., 2019; Vessey et al., 2012; Zahr et al., 2018; Zhang et al., 2017). Pum2, a quintessential RBP enriched in the nervous system, is found exclusively in the cytoplasm and dendrites, where it controls post-transcriptional steps of gene expression that take place in these subcellular compartments (Goldstrohm et al., 2018; Vessey et al., 2012; Vessey et al., 2010). As such, we consider it a particularly interesting neuronal RBP to investigate in control of area-specific cytoarchitecture. Previous work has implicated the combined action of Pum2 and its ortholog Pum1 in many aspects of brain development (Zhang et al., 2017), and Pum2 has recently been implicated in control of cortical axonogenesis (Martínez et al., 2019). However, area-specific phenotypes resulting from selective knockout of Pum2 in developing neocortical neurons have not previously been described.

Unlike Pum2, TDP-43 is a ‘shuttling’ RBP that moves back and forth between the nucleus and cytoplasm to regulate gene expression primarily at the post-transcriptional level in both compartments (reviewed in Lee et al., 2011). Strong overexpression of TDP-43 in developing neuronal progenitors leads to apoptosis with concomitant pleiotropic effects on cortical development (Vogt et al., 2018). However, the impact of lower-level, post-mitotic overexpression of TDP-43 on area-specific cytoarchitecture has not previously been examined. TDP-43 is heavily implicated as a key causal factor in the neurodegenerative diseases (amyotrophic lateral sclerosis [ALS]) and frontotemporal dementia (FTD), both of which show some degree of area-selective pathology in the neocortex of both patients and animal models (Taylor et al., 2016). While diseases are typically classified into either neurodevelopmental or neurodegenerative, there is long-standing interest in the idea that altered neuronal specification and wiring during development might ultimately contribute to degenerative disease later in life (Greig et al., 2013). Thus, one goal of our study was to see whether we could find evidence for area-specific effects on layer neuron identity in an established mouse model of ALS driven by a patient mutation in TDP-43.

By combining genetics with molecular imaging and in vivo biochemical approaches, we uncovered evidence for a role for RBPs in shaping the specialized layering pattern of S1. Our work highlights an apparent contribution of post-transcriptional repression of Sox5 and Bcl11b (Ctip2) mRNAs and activation of Rorβ mRNA as a downstream mechanism in area-specific control of neuronal identity and connectivity. Moreover, our data provide evidence that Pum2 and TDP-43 regulate neuronal identity post-mitotically in S1, and may do so at least partly through competing effects on translation of key regulators of neuronal identity.

Results

Contribution of RBPs Pum2 and TDP-43 to area-specific neuronal cytoarchitecture in the neocortex

We used a reverse-genetic approach to investigate whether RBPs might contribute to the establishment of neuronal identity in an area-specific manner. Specifically, we compared the expression of proteins that determine layer-specific neuronal subtypes in different cortical areas of mutant mice for the two RBPs, Pum2 and TDP-43. To this end, we generated Pum2 mice with loxP sites flanking exons 6 and 7. Crossing these mice to a line expressing Cre recombinase under the control of the Emx1 promoter (Iwasato et al., 2000) enabled selective inactivation of Pum2 expression in the forebrain (Gorski et al., 2002; Figure 1—figure supplement 1). To examine a potential contribution of TDP-43 and a possible link to human disease, we used a previously described transgenic mouse line containing a mutant allele that causes the neurodegenerative disease, ALS, in human patients Prnp-TARDBP A315T (TDP43A315T) (Wegorzewska et al., 2009).

We analyzed the overall brain architecture in Emx1Cre; Pum2fl/fl (Pum2 cKO) and TDP43A315T (TDP43A315T) mice compared to their littermate controls (Figure 1—figure supplements 2 and 3). At postnatal day 0 (P0), brain size and cortical thickness were similar to littermate controls in both mutants (Figure 1—figure supplement 2a and b). Our Nissl staining showed no strong cortical morphological differences in coronal (P0) and sagittal (P7) sections of both mutants compared to their littermate controls (Figure 1—figure supplement 3). On a cellular level, nuclear size in S1 layer II–VI neurons was slightly larger in Pum2 cKO compared to controls, while it was not significantly affected in TDP43A315T mutants (Figure 1—figure supplement 2c). Moreover, we did not observe any significant changes in the total number of DAPI cells in both mutants compared to their littermate controls (Figures 1 and 2, Figure 1—figure supplement 5). To check whether the neurogenesis to gliogenesis ratio might be affected in our mutants at P0, we performed staining for NeuN as a neuronal marker and GFAP as a glial marker (Figure 1—figure supplement 2d). Our staining showed that most cortical neurons co-expressed NeuN and DAPI, but GFAP was essentially absent from cortices of both mutants and controls. This is consistent with gliogenesis starting at E18.5-P0 in WT animals (Miller and Gauthier, 2007; Sarnat, 1992) and shows that this is not affected in either mutant. The same experiment showed significant hippocampal staining with both NeuN and GFAP, in accordance with earlier gliogenesis in the hippocampus (Figure 1—figure supplement 2d). Overall, these findings support use of DAPI as a normalization factor in our following analysis.

Figure 1 with 9 supplements see all
Neocortical neuronal identity of somatosensory cortex is altered in Pum2 cKO and TDP43A315T mice.

(a) Coronal sections from neonatal (P0) brains of controls (Ctrl), Pum2 cKO, or Prnp-TARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing Sox5, Bcl11b, or Rorβ or with DAPI to mark nuclei in the prospective somatosensory cortex (pS). (b) Quantification of results from n = 3 mice of each genotype is shown to the right of the relevant marker. Distribution of cells across six equal-sized bins is shown. For Bcl11b, only high-expressing neurons were counted. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; II–IV, V, VI: layers II–IV, V, and VI. Scale bar: 100 μm.

Neocortical neuronal identity remains unaffected in the motor cortex of Pum2 and TDP-43 mutants.

(a) Coronal sections from neonatal (P0) brains of controls (Ctrl), Pum2 cKO, or Prnp-TARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing Sox5, Bcl11b, or with DAPI to mark nuclei in the frontal/motor area (F/M). (b) Quantification of results from n = 3 mice of each genotype is shown to the right of the relevant marker. Distribution of cells across six equal-sized bins is shown. For Bcl11b, only high-expressing neurons were counted. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; II–IV, V, VI: layers II–IV, V, and VI. Scale bar: 100 μm.

We focused our analysis on the frontal/motor (F/M) and somatosensory cortices, which show characteristic differences in neuronal subtype ratios related to their specialized functions. The frontal motor area F/M is characterized by a thick layer V (Dehay and Kennedy, 2007; Polleux et al., 2001), in which many cells co-express the molecular determinants of subcerebral projection neurons (SCPNs): Sox5 and Bcl11b (Chen et al., 2008; Kwan et al., 2008; Lai et al., 2008). In contrast, the primary somatosensory area (S1) has a thick layer IV, in which most cells express Rorβ,a bona fide marker of layer IV stellate cells (Jabaudon et al., 2012; Nakagawa and O’Leary, 2003 Figure 1—figure supplement 4a and b). In P0 WT coronal sections, we observed dramatic differences in the prospective somatosensory area (pS) compared to the frontal motor area (F/M) when we analyzed key molecular identity determinants that define specific neuronal subtypes (Figure 1—figure supplement 4b; Arlotta et al., 2005; Bedogni et al., 2010; Chen et al., 2008; Jabaudon et al., 2012; Kwan et al., 2008; Lai et al., 2008; McKenna et al., 2011). In both mutants, the number of Sox5+ and Bcl11b+ neurons in the upper region of layer V was significantly increased and radially expanded in pS, accompanied by a corresponding decrease in the number of Rorβ+ neurons in layer IV (Figure 1, Figure 1—figure supplements 4a and 5a). DAPI staining revealed no significant differences (Figure 1, Figure 1—figure supplement 5a), consistent with a potential switch in neuronal identity specification, rather than effects on cell number or migration. Similar effects were not observed in F/M cortex, where neither the number nor the radial distribution of Sox5+, Bcl11b+, or Tbr1+ neurons in the mutant lines differed from controls and Rorβ was not expressed, as expected (Figure 2, Figure 1—figure supplements 5b and 6b). Unlike the dramatic effects on layer IV/V in pS, we detected no significant changes in the layer VI neuronal marker Tbr1 or the upper layer marker Cux1 (Nieto et al., 2004), implying normal neuronal specification in these layers (Figure 1—figure supplement 6a).

Importantly, we observed similar phenotypes in pS with a constitutive Pum2 KO line, but not in Emx1Cre; Pum2fl/+ heterozygotes, confirming that the phenotype is due to loss of Pum2 function, rather than the Cre line used or Cre expression per se (Figure 1—figure supplement 7a and b). Taken together, our results suggest that Pum2 functions within the forebrain to influence layer IV/V specification in the pS.

We next wanted to resolve the nature of regulation of layer neuron fate markers in pS by TDP43A315T. In particular, we wanted to determine whether regulation was due to a specific property of the mutant protein or reflected a gain of function due to overexpression. To this aim, we examined a transgenic line reported to overexpress human Prnp-TARDBP (TDP43) at relatively low levels in the brain, which does not develop symptoms (Arnold et al., 2013). We first compared expression of the respective transgenic proteins in the two lines. Both hTDP-43 and hTDP-43A315T were broadly expressed in neocortical areas and layers, including layers IV and V of the pS, in a pattern qualitatively like endogenous TDP-43 (Figure 1—figure supplement 8a). Although the distribution of cells expressing transgenic hTDP-43 or hTDP-43A315T was qualitatively similar across layers in both F/M and pS, the intensity of the expression of the protein variants was different in developing neocortex. Interestingly, layer V neurons expressed higher levels of hTDP-43A315T, which was confirmed using hTDP-43 and Flag antibodies (Figure 1—figure supplement 8a and b). In addition, using quantitative immunoblotting, we confirmed overexpression of TDP-43 in the cytoplasmic fraction of neocortical lysates of the TDP43 line and in both nuclear and cytoplasmic fractions of the TDP43A315T line (Figure 1—figure supplement 8c). Consistent with higher intensity for mutant hTDP-43 in immunostaining, quantitative immunoblotting indicated that hTDP-43A315T protein levels were significantly higher than the hTDP-43 protein levels in cytoplasmic-enriched fractions of neocortex (Figure 1—figure supplement 8c).

Analyzing effects on neuronal identity due to WT TDP43 overexpression in this line revealed clear effects like those seen with the TDP43A315T line, with significant increases in the number of cells expressing Sox5 and Bcl11b protein and fewer cells expressing Rorβ protein (Figure 1—figure supplement 9a and b). Although the magnitude of these phenotypic effects with TDP43 was not as strong as those observed with hTDP-43A315T, finding them with the TDP43 line demonstrates that they are not line- or mutation-specific. Moreover, since this line does not develop ALS-like symptoms, our observations further suggest that the underlying effect on altered neuronal fate marker expression in the pS is likely due to gain of WT TDP-43 function and that altered cortical architecture in S1 during development per se is not sufficient to result in ALS-like symptoms (see ‘Discussion’). To simplify the experimental workflow and analysis for TDP-43, we focused in our following analyses on the TDP43A315T line since it showed qualitatively identical, but quantitatively stronger, phenotypes relative to WT TDP43 in multiple assays.

In sum, our phenotypic analyses in the pS and F/M areas support a role for the RBPs Pum2 and TDP-43 in area-specific regulation of neuronal identity marker expression in layers IV and V of the developing somatosensory cortex. Moreover, they suggest that Pum2 promotes the normal pattern of S1 neuronal identity marker expression, whereas gain of TDP-43 function can act in an apparently opposite manner to repress it.

Increased subcerebral connectivity for S1 neurons in Pum2 cKO and TDP43A315T mice

Co-expression of Bcl11b and Sox5 is a hallmark of SCPNs (Chen et al., 2008; Kwan et al., 2008; Lai et al., 2008), and ectopic Bcl11b overexpression in upper-layer progenitors is sufficient to redirect their axons from corticocortical projections into projections to subcerebral targets (Chen et al., 2008). We therefore wondered whether the increase and radial expansion of neurons expressing molecular determinants of SCPNs (Bcl11b and Sox5) would be accompanied by increased SCPN connectivity (Arlotta et al., 2005; Chen et al., 2008; Kwan et al., 2008; Lai et al., 2008). To examine this directly in Pum2 cKO and TDP43A315T mice, we injected fluorophore-labeled cholera toxin B (CTB) into the pons for retrograde labeling of SCPNs (Conte et al., 2009; Figure 3a). This revealed significantly increased labeling in layer V and a striking radial expansion in both Pum2 cKO and TDP43A315T vs. their respective littermate controls (Figure 3b and c).

Increased subcerebral connectivity in somatosensory cortex of Pum2 cKO and TDP43A315T mice.

(a) Schematic representation of cholera toxin subunit B (CTB) injections at the midbrain/hindbrain junction (pons) for retrograde labeling of subcerebral projection neurons (SCPNs), including corticospinal PNs (CSMN) and corticopontine PNs (CPoPN). (b) Coronal sections from primary somatosensory cortex (S1) of controls, Pum2 cKO, and TDP43A315T mice at P7 traced for SCPNs without (top) or with DAPI (bottom) staining. S1 columns merged with DAPI are divided into eight equal bins. White rectangles indicate bins 3 and 4. (c) Quantification of retrogradely labeled SCPNs in equal-sized bins for the three genotypes. Analysis of bins 3 and 4 is shown separately in the left panel and combined in the right panel. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; II–IV, V, VI: layers II–IV, V and VI, respectively. Scale bars: 100 μm.

To understand whether the increase in Sox5 corresponds with the increase in Bcl11b, we co-immunostained Sox5 and Bcl11b in coronal sections of Pum2 cKO and TDP43A315T and their control littermates. Our analysis showed an increase in the number of Sox5+/Bcl11b+ neurons in both mutants, suggesting that ectopic expression of Sox5 corresponds with that of Bcl11b (Figure 4a). We next combined retrograde labeling of SCPN with staining for either Sox5 or Bcl11b 2 to test whether the increased number of SCPN in S1 directly corresponds with the increased number of Sox5+/Bcl11b+ neurons. Our co-immunostaining showed that all retrogradely labeled neurons in controls and mutants co-expressed both Sox5 and Bcl11b (Figure 4b and c). Thus, the typical area-specific neuronal connectivity of S1 is dramatically altered in both Pum2 cKO and TDP43A315T, with more SCPNs in layer V and ectopic SCPNs in the position normally occupied by layer IV in S1. This pattern is reminiscent of motor cortex (Armentano et al., 2007; Harb et al., 2016; Tomassy et al., 2010), and thus, reflects apparent “motorization” of layer IV/V in S1.

Subcerebral projection neurons’ (SCPNs’) increase colocalizes with Sox5 and Bcl11b in Pum2 and TDP-43 mutants.

(a) Coronal sections from neonatal (P0) brains of controls (Ctrl), Pum2 cKO, or Prnp-TARDBPA315T (TDP43A315T) mice were stained with antibodies recognizing Sox5 and Bcl11b in the prospective somatosensory area (pS). Quantification of Sox5 and Bcl11b colocalization from n = 3 mice of each genotype is shown to the right across six equal-sized bins. (b, c) Coronal sections from primary somatosensory cortex (S1) of controls, Pum2 cKO, and TDP43A315T mice at P7 traced for SCPNs combined with Sox5 (b) or Bcl11b (c) staining. White arrows in (a–c) indicate colocalization. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; V, VI: layers V and VI. Scale bars: 100 μm.

Most aspects of somatosensory area identity appear to be properly determined in Pum2 cKO and TDP43A315T mice, despite layers IV and V being ‘motorized’

Previously described mutants with a motorized layer IV/V in S1 affect multiple aspects of pS area identity (Armentano et al., 2007; Harb et al., 2016; Tomassy et al., 2010). Thus, we envisaged two hypotheses to explain apparent motorization of layer IV/V in Pum2 cKO and TDP43A315T mutant mice. On the one hand, Pum2 and TDP-43 might control area identity, like previously described transcriptional regulators mentioned above. Alternatively, they could control layer IV/V specification and connectivity without affecting area identity per se. To test these hypotheses, we examined two hallmarks of area identity in S1 of Pum2 cKO and TDP43A315T mice. We first checked the expression pattern of two standard molecular markers of neocortical area identity: Lmo4 (motor) (Huang et al., 2009) and Bhlhb5 (sensory) (Joshi et al., 2008). Both Pum2 cKO and TDP43A315T mice showed overall a wild-type pattern of Lmo4 and Bhlhb5 expression (Figure 5a). Quantitative analysis of the total number of Lmo4 and Bhlhb5 cells normalized to DAPI showed major differences between motor and somatosensory cortex in all genotypes, as expected, suggesting that the pS maintains its areal identity and does not show an F/M identity. On a laminar level, comparison of Lmo4 and Bhlhb5 analysis between controls and mutants (source data related to Figure 5a) showed no significant changes in Lmo4 and Bhlhb5 in the pS of Pum2 cKO compared to controls, but a significant increase in Lmo4 in bin1 and decrease in Bhlhb5 in bins 3 and 4 in TDP43A315T. In the case of the motor cortex, an increase in Bhlhb5 was observed in bin 6 of TDP43A315T while Lmo4 was unaltered in all bins. Pum2 cKO did not show any change for Bhlhb5, but Lmo4 expression was decreased in bins 1 and 4. These differences are not surprising since both Lmo4 and Bhlhb5 regulate area-specific laminar identity (Cederquist et al., 2013; Greig et al., 2013; Harb et al., 2016; Joshi et al., 2008) and do not affect our conclusion regarding the unchanged areal identity of pS or F/M. Next, we examined another major hallmark of area identity in S1: the specialized ‘barrels’ in layer IV. These clusters of glutamatergic interneurons receive somatosensory input from the whiskers via the thalamus and can be visualized by serotonin (5HT) staining of the thalamic presynaptic terminals. In contrast to previously described mutants with motorized somatosensory areas (Armentano et al., 2007; Tomassy et al., 2010), barrels formed efficiently at the same tangential position and their numbers are not significantly different from controls in S1 of either Pum2 cKO and TDP43A315T mice (Figure 5b), supporting a lack of major changes to thalamocortical axonal targeting and patterning in S1. Taken together, these experiments suggest that Pum2 and TDP-43 contribute to elaboration of area-specific cytoarchitecture of layers IV and V without strongly affecting area identity per se.

Somatosensory area identity is properly determined in Pum2 cKO and TDP43A315T mutants despite layers IV and V being ‘motorized.’.

(a) Coronal sections of one brain hemisphere from controls (Ctrl), Pum2 cKO, and TDP43A315T brains at P0 co-immunostained for Lmo4 and Bhlhb5. Selected regions are marked by white rectangles in the upper panel, and high-magnification views of frontal motor (F/M) and prospective somatosensory (pS) areas are shown below. Scale bars: 400 μm and 100 μm, respectively. Quantification of results is shown to the right. (b) Sagittal sections from controls, Pum2 cKO (top), and TDP43A315T (bottom) at P7 immunolabeled for serotonin (5HT). Quantification of the number of barrels per section is shown to the right. Scale bar: 100 μm. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; Ctx: cortex; Hip: hippocampus; Str: striatum; S1BF: barrel field region of S1. Scale bar: 100 μm.

Cell-autonomous and post-mitotic effects of TDP-43 gain of function and Pum2 loss of function on regulation of Sox5, Bcl11b, and Rorβ in pS neurons

We next asked whether ectopic expression of hTDP-43 or the patient mutant hTDP-43A315T would be sufficient cell-autonomously to drive a switch in expression of Sox5, Bcl11b, and Rorβ. For these experiments, we prepared primary neuronal cultures from pS-enriched neocortices at E18.5 and transfected them with plasmids containing either WT TDP43, TDP43A315T, or EGFP as a control via electroporation before plating. After 2 days in culture, we fixed and stained the cells for both the transfected protein and for endogenous Sox5, Bcl11b, or Rorβ protein. We identified transfected cells by immunostaining for one of the epitope tags on hTDP-43 or EGFP for control transfections (Figure 6a–c). Subsequently, we quantified the number of transfected neurons that were also positive for Sox5, Bcl11b, or Rorβ protein in the three different transfections. This revealed that expression of either WT hTDP-43 or the hTDP-43A315T mutant in transfected cortical neurons could strongly induce Sox5 and Bcl11b proteins to a similar extent (Figure 6a and b). Expression of either protein also significantly reduced Rorβ protein expression (Figure 6c). These results are consistent with our observations with transgenic lines and suggest that increased levels of TDP-43, rather than a mutant-specific activity, contribute to altered layer neuron identity determinant expression through a gain-of-function mechanism. In addition, they further imply that TDP-43 overexpression can act cell-autonomously to control layer IV/V identity determinant expression in developing cortical neurons in the pS.

TDP-43 gain of function cell-autonomously regulates layer IV and V molecular determinants in vitro.

(a–c) Primary neurons harvested from WT cortical lysates enriched for somatosensory cortex at E18.5 were transfected before plating with plasmids encoding either control GFP, TDP43, or TDP43A315T. After 48 hr in culture, neurons were fixed and stained with antibodies recognizing GFP to label control transfected neurons or recognizing either the Flag (a, b) or V5 (c) epitope tag to label neurons transfected with either TDP43 or TDP43A315T. All transfected neurons were co-immunolabeled with antibodies recognizing Sox5 (a), Bcl11b (b), or Rorβ (c) and with DAPI. Quantification of the fraction of Sox5+, Bcl11b+, or Rorβ+ neurons among all transfected neurons is shown to the right of the representative images. At least 50 cells were counted for each replicate of every transfection. Data are shown as means ± standard error of the mean (SEM), n = 3 for each transfection. *p≤0.05, **p≤0.01, ***p≤0.001, two-tailed t-test. Scale bar: 100 μm.

To determine whether similar effects could be observed with TDP-43 in vivo and would extend to Pum2 loss of function, we performed IUEs. All electroporated plasmids used the pNeuroD promoter, which drives expression post-mitotically in newly born neurons and is not expressed in progenitors (Guerrier et al., 2009). We confirmed the efficiency of Pum2 deletion and hTDP-43 overexpression by double staining for GFP to label electroporated neurons and either for Pum2 or hTDP-43 (Figure 7—figure supplement 1). As shown in Figure 7, electroporating plasmids at E13.5, encoding either pNeuroD-Cre in Pum2fl/fl mice or WT TDP43 or the ALS-derived mutant TDP43A315T in WT mice, respectively, was sufficient to cell-autonomously drive a switch in expression of Sox5, Bcl11b, and Rorβ in pS. Post-mitotic deletion of Pum2 (Figure 7a) and expression of either WT hTDP-43 or the hTDP-43A315T mutant (Figure 7b) in newly born deep-layer cortical neurons led to robust induction of Sox5 and Bcl11b proteins and reduction of Rorβ protein expression; accordingly, mutant TDP-43 showed a slightly stronger effect than WT TDP-43. These in vivo results obtained after IUE are strikingly reminiscent of those seen in Pum2 cKO or TDP43A315T mice (Figure 1, Figure 1—figure supplement 5a) or after transfection of pS-enriched primary neurons (Figure 6) and provide another line of experimental evidence that loss of Pum2 and gain of TDP-43 function, respectively, yield these phenotypes.

Figure 7 with 2 supplements see all
RNA-binding proteins Pum2 and TDP-43 regulate layer IV and V molecular determinants post-mitotically and cell-autonomously in vivo.

(a, b) Coronal sections from Pum2fl/fl (a) or WT (b) brains at P0 electroporated at E13,5 with pNeuroD-IRES-GFP as control, or with p-NeuroD-IRES-Cre-GFP to ablate Pum2 expression (a) or p-NeuroD-TDP43-IRES-GFP or p-NeuroD-TDP43A315T-IRES-GFP to overexpress hTDP-43 alleles only in post-mitotic neurons. Sections are co-stained with antibodies recognizing GFP to label electroporated neurons and antibodies recognizing Sox5, Bcl11b, or Rorβ. High-magnification views are shown to the right. White arrowheads indicate examples of electroporated neurons expressing Sox5-, Bcl11b-, and Rorβ-positive neurons while empty arrowheads indicate electroporated neurons not expressing these proteins. Quantification of the fraction of Sox5+, Bcl11b+, or Rorβ+ neurons among all electroporated cells is shown to the right of the representative images. Data are shown as means ± standard error of the mean (SEM), n = 3 for each electroporation. Both p-NeuroD-IRES-Cre-GFP and hTDP-43 alleles were co-electroporated with T-dimer (red) to distinguish them from littermate control brains electroporated only with pNeuroD-IRES-GFP. For both hTDP-43 alleles, the respective control littermates for each variant were combined to a total of n = 6 for pNeuroD-IRES-GFP electroporations. **p≤0.01, ***p≤0.001, two-tailed t-test. UL, V, VI: upper layers, layers V and VI. Scale bar: 100 μm.

Electroporation of the same plasmids at E14.5 to target upper layer neurons revealed that the fate of these neurons could not be altered by either loss of Pum2 function or gain of TDP-43 function (Figure 7—figure supplement 2), consistent with our earlier data with mutant and transgenic lines. Electroporated upper-layer neurons with either pNeuroD-Cre in Pum2fl/fl mice or WT TDP43 or TDP43A315T in WT mice did not show ectopic Sox5 or Bcl11b expression, exactly like neurons electroporated with the control pNeuroD-IRES GFP. Collectively, our results with transfection of primary neurons from the pS and IUE of developing pS in vivo support the idea that TDP-43 gain of function and Pum2 loss of function can cell-autonomously and post-mitotically change the relative expression of known molecular determinants of layer IV/V neuronal identity in the pS of developing neocortex.

Evidence that Pum2 and TDP-43 probably use post-transcriptional mechanisms to regulate layer IV/V neuronal identity determinants

We next investigated the molecular mechanisms used by Pum2 and TDP-43 to control area-specific neuronal identity and connectivity in S1. For these studies, we again focused for simplicity on the TDP43A315T line since it showed quantitatively stronger phenotypes relative to WT TDP43. Because both RBPs are known to post-transcriptionally regulate their target mRNAs, we first analyzed mRNA levels for the previously characterized layer IV/V molecular determinants Sox5, Bcl11b, and Rorb, which we showed in Figure 1 and Figure 1—figure supplement 9 to have an increased or decreased number of cells positive for these proteins in the neocortex of Pum2 cKO mice and in mice overexpressing either hTDP-43A315T or WT hTDP-43 protein transgenically. In parallel, we also analyzed mRNA levels for Fezf2, a master regulator of subcerebral identity, which functions upstream of Bcl11b to specify the fate of layer V subcerebral neurons (Chen et al., 2005; Chen et al., 2008; McKenna et al., 2011; Molyneaux et al., 2005; Rouaux and Arlotta, 2013). qRT-PCR with RNA obtained from dissected pS-enriched neocortex at P0 indicated no significant differences in steady-state mRNA levels of any of these mRNAs in either Pum2 cKO or TDP43A315T relative to littermate controls (Figure 8a and b; Table 1). This suggests that altered mRNA levels are not likely to be the basis for altered levels of Sox5, Bcl11b, and Rorβ proteins in S1, although effects within specific cell types might potentially be missed in a pS-wide assay.

mRNA levels of layer IV/V neuronal identity determinants remain unchanged in Pum2 cKO or TDP43A315T mutants.

qRT-PCR of RNA derived from P0 somatosensory area-enriched cortical lysates for Pum2 cKO (a) or TDP43A315T (b). The fold change for Sox5, Bcl11b, Rorb, and Fezf2 mRNAs normalized to GAPDH mRNA is shown for mutants relative to respective control samples (Ctrl). Data are displayed as means ± standard error of the mean (SEM) for at least n = 4 of each genotype. (c) Single-molecule fluorescent in situ hybridization (smFISH) for Sox5, Bcl11b, Rorb, and Fezf2 mRNAs on coronal sections from the prospective somatosensory area (pS) of controls (Ctrl), Pum2 cKO, and TDP43A315T mice at P0. Distribution of cells across six equal-sized bins is shown. (d) Quantification from (c). The number of RNA dots in the bins where they are mostly expressed is normalized to the total number of cell nuclei (DAPI) within that bin. Data are shown as means ± SEM, at least n = 3 for each genotype. *p≤0.05 by two-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre; IV, V, VI: layers IV, V and VI, respectively. Scale bar: 100 μm.

Table 1
qRT-PCR primers.
mRNAForward primer (5′–3′)Reverse primer (5′–3′)
Sox5CCAGGACTTGTCTTTCCAGCCCTGAAGCAGAGGAAGATG
Bcl11bAAGCCATGTGTGTTCTGTGCAAAGGCATCTGTCCAAGCAG
RorbATGCCAGCTGATGGAGTTCTTAGCTCCCGGGATAACAATG
Fezf2GTGGCTCCCACCTTTGTACATTCATCACGGTGACAGGCTGGGATTAAA
Cux1CCTGCAGAGTGAGCTGGACGCTTGCTGAAGGAGGAGAAC
GapdhTTGATGGCAACAATCTCCACCGTCCCGTAGACAAAATGGT
Pum2CCCCGAGATTCTAATGCAAGCTGGAAGAAGCACGGTGAAT
Pum2 exons 6&7ATTGGGCCCTCTTCCTAATCCCAACTTGGTCCATTGCAT
TardbpCGTGTCTCAGTGTATGAGAGGAGTCCTGCAGAGGAAGCATCTGTCTCATCC
Emx1ACCATAGAGTCCTTGGTGGCTGGGGTGAGGATAGTTGAGC
Sox6GCATAAGTGACCGTTTTGGCAGGGGCATCTTTGCTCCAGGTGACA
Unc5CACTCAATGGCGGCTTTCAGCCTGGTCCAGAATTGGAGAGTTGGTC
18s rRNACTTAGAGGGACAAGTGGCGACGCTGAGCCAGTCAGTGTA
RlucTGGTAACGCGGCCTCTTCTGCCTGATTTGCCCATACCAA

Next, we sought to confirm the results from our qRT-PCR assays using an independent method with higher spatial resolution. To this end, we performed RNA-specific single-molecule fluorescenct in situ hybridization (smFISH) to enable quantification of mRNA levels within newly born neurons in specific layers of the pS. To enable direct comparison, these experiments were also performed at P0, the time when protein levels and cell fate were strongly altered in the Pum2 cKO and TDP43 transgenic lines. In order to determine whether a change in mRNA levels within specific layer neurons might explain the protein level changes observed by antibody staining in Figure 1, we hybridized specific antisense probes to Sox5, Bcl11b, Rorb, and Fezf2 mRNAs and analyzed mRNA levels in pS using the same binning approach, but now for the mRNAs (Figure 8c). Specifically, we counted the number of smFISH dots, which correspond to single mRNAs, in specific regions of the pS for confocal images obtained from each genotype. As shown in Figure 8d, this revealed no significant differences in the levels of Sox5, Bcl11b, or Fezf2 mRNA levels in either mutant relative to controls. In contrast, we observed a paradoxical increase in Rorb mRNA in both genotypes (Figure 8d), even though Rorβ protein levels were decreased (Figure 1). Taken together, our qRT-PCR and smFISH data do not reveal evidence for transcriptional or stability effects on mRNA levels. Accordingly, such changes may therefore not be the reason for altered Sox5, Bcl11b or Rorβ protein levels in the pS of Pum2 cKO or TDP43A315T mutants. .

It is important to note that we cannot exclude potential effects on transcription and/or mRNA stability in neuronal subpopulations that might be missed in our bulk assays. Moreover, smFISH may not be sufficiently quantitative to detect these effects in situ. Potential caveats notwithstanding, these orthogonal assays provide reasonable evidence that the protein-level phenotypes may result from post-transcriptional effects impinging on mRNA translation and/or protein stability.

No detectable tissue-wide effects of Pum2 or TDP-43 on splicing or polyadenylation site usage of Sox5, Bcl11b, or Rorb mRNAs in developing neocortex

Our qRT-PCR and smFISH data did not provide evidence for mRNA-level changes as the basis for the observed protein-level changes in layer IV/V of pS. We therefore considered whether other RNA regulatory mechanisms might underlie changes in Sox5, Bcl11b, and Rorβ protein levels. Thus, we next examined the potential effects on alternative pre-mRNA splicing and alternative 3′ end formation/polyadenylation (APA), two post-transcriptional regulatory mechanisms that can indirectly affect translation and/or protein stability and are implicated in the control of brain development (Furlanis and Scheiffele, 2018; Hermey et al., 2017; Nguyen et al., 2016; Zheng and Black, 2013). Consistent with its cytoplasmic localization, Pum2 has not been implicated in either of these nuclear pre-mRNA processing events. However, numerous studies have demonstrated alternative splicing regulation by TDP-43, including an analysis of the transgenic TDP43 line that we examined here (Arnold et al., 2013; Lagier-Tourenne et al., 2012; Polymenidou et al., 2011; Tollervey et al., 2011). Moreover, TDP-43 knockdown in cultured cell lines has also been shown to affect APA site usage (Rot et al., 2017), suggesting that this might also potentially occur with hTDP-43 overexpression in the intact developing brain. We therefore examined the potential effects on splicing and APA in pS-enriched neocortex of the Pum2 cKO and TDP43A315T lines.

Focusing initially on pre-mRNA splicing, we designed primers to specific splice variants of Sox5, Bcl11b, and Rorb (Table 2) annotated in the Ensembl release 98 database for mouse (GRCm38.p6) (Zerbino et al., 2018). As shown in Figure 9—figure supplement 1a and b, we detected expression of these mRNA variants at different levels in pS at P0 using this approach, consistent with alternative splicing occurring in this tissue. However, we did not observe any significant changes in their levels relative to littermate controls in tissue from either Pum2 cKO or TDP43A315T mice. To further probe the potential effects on alternative splicing of Sox5 mRNA with an independent approach, we used previously described RT-PCR primer sets (Table 3) that produce different amplicon sizes resolvable by agarose gel electrophoresis depending on alternative splicing (Edwards et al., 2014). Consistent with qRT-PCR, this approach revealed that mRNA variants previously characterized in non-neuronal tissues are also generated by alternative splicing in developing neocortical pS. However, these splicing patterns were not altered significantly in either Pum2 cKO or TDP43A315T mice (Figure 9—figure supplement 1c). These data suggest that there are no significant tissue-wide effects on splicing of Sox5, Bcl11b, or Rorb mRNAs in the neocortical pS of either Pum2 cKO or TDP43A315T mice.

Table 2
qRT-PCR splicing isoforms primers.
mRNAForward primer (5′–3′)Reverse primer (5′–3′)
Sox5 204CGTACATGATACGTCCTCCCCCAGCCCCACTGTTTATTC
Sox5 206CTTGAGGTTTGTTCTCCTCTGGCCATAGTGGTTGGGATCAG
Sox5 211GTACATGATACGTCCTCCCCTCTTGTCTGTGTGAATGCTG
Sox5 diffATGCTTACTGACCCTGATTTACTCTCACTCTCCTCCTCTTCC
Bcl11b 201CAGTGTGAGTTGTCAGGTAAAGGCTCCAGGTAGATTCGGAAG
Bcl11b 202TCCCAGAGGGAACTCATCACGCTCCAGGTAGATTCGGAAG
Bcl11b 203CCTACTGTCACCCACGAAAGGCTCCAGGTAGATTCGGAAG
Rorb 201CTGCACAAATTGAAGTGATACCAAACAGTTTCTCTGCCTTGG
Rorb 202AAGCATAGCACGCAGCACTCATCCCGGAGGATTTATCGCCAC
Rorb 203AGCGGAATTTTTGGGTTCTCACGTGATGACTCCGTAGTG
Table 3
Sox5 isoforms PCR primers.

Each forward primer has its reverse primer below. F: forward; R: reverse.

AllelePrimer (5′–3′)Predicted size (bp)
mSox5-346FCCT TTC ACC TTC CCT TAC ATG833
mSox5-1178RAGC AGC TGC CAT AGT GGT TG
mSox5-512FCAA CTC ATC TAC CTC ACC TCA G457
mSox5-968RCAG AAG CTG CTG CTG TTG
mSox5-899FACA GCG TCA GCA GAT GGA G637
mSox5-1535RGCT AAC TCT TGC AGA AGG AC
mSox5-1426FCTG CAT CAC CCA CCT CTC535
mSox5-1960RCTG ATG TTG GAA TTG TGC ATG

After not finding any significant tissue-wide effects on alternative splicing of key determinants of layer IV/V neuronal identity, we next examined the potential effects on mRNA 3′ end formation via APA. Transcript isoforms with different 3′ ends were annotated in the Ensembl release 98 database for mouse (GRCm38.p6) (Zerbino et al., 2018) for Sox5, Bcl11b, and Rorb (Table 4), and we confirmed expression of these isoforms in the pS at P0 by qRT-PCR using specific primer sets (Figure 9—figure supplement 2a). This revealed clear differences in the relative expression of the isoforms in the developing pS at baseline, but no significant changes in the relative levels of the mRNA isoforms in the mutant lines relative to their respective littermate controls (Figure 9—figure supplement 2b). We conclude that APA of Sox5, Bcl11b, and Rorb mRNAs is not generally affected in the pS area of developing neocortex in either Pum2 cKO or TDP43A315T mice.

Table 4
qRT-PCR 3′UTR isoforms primers.
mRNAForward primer (5′–3′)Reverse primer (5′–3′)
Sox5 S1GCCGTTCTCAGGTGAAAAGAGCCTGACATTATTCCCCAAT
Sox5 S2CAGACAACTGCAGCCACTTCTTGGCAACATGAGAGGACTG
Sox5 S3TAGGTCACTTGGGGGAAAGCGCAAGGGCATTGTGTTGTTA
Sox5 S4TGCAAACTACCATCTCACTTG AATGGCATGAATGATAACATAAAA CC
Bcl11b B1GGACGGGAAAATGCCATAAGAAGTCACCTCCACTCCATATC
Bcl11b B2TACCCTGCCCTTTTGACACCTTGACAGAGACACACAAGTCC
Rorb R1GGAAAACAGGGTAATGGAAGGGGGAACATCAAGTAGACACAG
Rorb R2AAATATGTACTCGCTCCCTTTCAGCCCTGTCCCTTTCTTAG

While we cannot rule out subtle effects in neuronal subpopulations that might be missed in our tissue-wide assay, these results with pS-enriched RNA and isoform-specific primers do not support either alternative splicing or APA of Sox5, Bcl11b, and Rorb mRNAs as a likely basis for effects on the corresponding proteins observed in Pum2 cKO or hTPD-43 transgenic mice.

Evidence for both translational activation and repression of Sox5, Bcl11b, and Rorb mRNAs by Pum2 and TDP-43 in developing neocortex

We next considered whether there might be specific effects on the translation of Sox5, Bcl11b, and Rorb mRNAs. To examine the potential effects of Pum2 and hTDP-43A315T on translation in developing neocortex, we used sucrose density gradient fractionation-based polysome profiling of neocortical lysates from mutants and littermate controls. This classic biochemical fractionation method can reveal changes in the relative number of ribosomes engaged with cellular mRNAs on a global and mRNA-specific level (Figure 9a and b). Importantly, because the percentage of total RNA signal in the different fractions is plotted, changes in an mRNA’s translational status in this assay are unrelated to the mRNA levels themselves.

Figure 9 with 3 supplements see all
Translational control of layer IV/V neuronal identity determinants by Pum2 and TDP-43 in developing neocortex.

(a) Schematic overview of polysome profiling for developing neocortices. Lysates from dissected E14.5 cortices were separated on polysome gradients, and RNA was prepared from fractions (F1–6) corresponding to the indicated ribosomal densities. (b) A schematic representation showing dissection of an enriched prospective somatosensory region from P0 brains using millimeter paper to eliminate 1 mm from the rostral end and 1 mm from the caudal end of cortices. Lysates for polysome profiling were made from the remaining part. F/M: frontal/motor area; pS: prospective somatosensory cortex; A1: primary auditory cortex; V1: primary visual cortex. (c, d) Histograms depict the distribution of the Sox5, Bcl11b, Rorb, and Fezf2 mRNAs across the gradient fractions for TDP43A315T (c) and Pum2 cKO (d), relative to corresponding controls (Ctrl). Samples in heavier gradient fractions were virtually pooled at analysis to simplify visualization in (d) and in the case of the Bcl11b B1 primer in (c). Levels of specific mRNAs in each fraction were analyzed by qRT-PCR with normalization to an RLuc mRNA spike-in control, which was added in an equal amount to the fractions prior to RNA preparation. Data are shown as means ± standard error of the mean (SEM), n = 3 for each genotype. *p≤0.05, **p≤0.01, one-tailed t-test. Pum2 cKO: Pum2fl/fl; Emx1Cre.

Unlike mice lacking the RBP HuR, which show strong defects in brain development that correlated with effects on both general and mRNA-specific translation (Kraushar et al., 2014), we observed no differences in the overall polysome profiles in Pum2 cKO or TDP43A315T neocortices (Figure 9—figure supplement 3a), suggesting that general translation is not strongly affected in this tissue in these lines. We next used qRT-PCR from the polysome fractions to investigate mRNA-specific translational regulation, normalizing to an in vitro transcribed Renilla luciferase (RLuc) ‘spike-in’ standard that we added to the fractions prior to RNA purification (Figure 9c and d). As noted above, multiple 3′UTR isoforms of Sox5, Bcl11b, and Rorb mRNAs with different numbers of predicted binding sites for Pum2 and/or TDP-43 are annotated in the Ensembl release 98 database for mouse (GRCm38.p6) (Zerbino et al., 2018), and we found that a mixed population of transcripts appears to be expressed in developing neocortex (Figure 9—figure supplement 2a and b). In our sucrose density gradient polysome profile analyses, we focused on primer sets (Tables 1 and 4) recognizing mRNA isoforms with predicted binding sites for Pum2 and/or TDP-43 (Figure 9—figure supplement 2a) wherever possible because material was limited and we reasoned that this would improve sensitivity in this bulk tissue assay.

Results for polysome profiling for TDP43A315T from whole neocortices at E14.5, the peak time of birth for layer IV neurons, are shown in Figure 9c. For the specific Sox5 and Bcl11b mRNA isoforms examined, we observed a significant shift in the percentage distribution to heavier polysome fractions, consistent with an increased number of ribosomes translating these mRNAs in the mutant transgenic line. Strikingly, Rorb mRNA was regulated in exactly the opposite manner, showing a significant shift to a lighter gradient fraction corresponding to approximately one ribosome/mRNA (i.e., monosomes) in TDP43A315T compared to the percentage of mRNA signal present in a heavier fraction (corresponding to greater than approximately seven ribosomes/mRNA). This pattern is consistent with a reduced number of ribosomes engaged with this mRNA in mutant neocortex. In contrast, no significant differences were found with Fezf2 mRNA, highlighting apparent specificity of the effects on the other layer IV/V identity determinants.

Unlike with TDP43A315T, for Pum2 cKO neocortices, we did not observe significant effects on mRNA translational status in the polysome assay at E14.5 (Figure 9—figure supplement 3b). Therefore, we performed additional polysome analyses at other stages to gain insight into when during development translational control by Pum2 might be detectable using this assay. At P0, when neurogenesis is complete (Buratti and Baralle, 2014; Chen et al., 2008) and it is technically possible to enrich for the pS by dissection (Figure 9b), we found evidence for increased ribosome engagement with Sox5 and Bcl11b mRNAs and reduced ribosome density on Rorb mRNA (Figure 9d). Conversely, we did not observe an effect on Sox5, Bcl11b, or Rorb mRNA translation at E13.5, the peak birth time for layer V neurons (Greig et al., 2013; Molyneaux et al., 2007), or at E18.5 (Figure 9—figure supplement 3b). Taken together, these data support the idea that translational regulation of the mRNAs encoding Sox5, Bcl11b, and Rorβ proteins by Pum2 may begin after birth and is therefore more likely to occur in post-mitotic neurons, rather than in neuronal progenitors. Consistent with this idea, when we directly examined nascent neurons of Pum2 cKO mice at E13.5, we did not observe increased protein expression of regulators of layer VI and V neuronal identity Sox5, Bcl11b, or Tbr1 (Figure 9—figure supplement 3c), providing further evidence that regulation might be post-mitotic, rather than at progenitor level. Because our polysome gradient assay detects changes in translational status independently of mRNA levels and because we did not find any evidence of corresponding effects on mRNA levels, splicing, or polyadenylation of these mRNAs, we conclude that increased translation of Sox5 and Bcl11b mRNAs, together with decreased translation of Rorb mRNA, is likely to be at least one molecular mechanism contributing to the corresponding changes detected at the protein level in developing pS of the Pum2 cKO and TDP43A315T lines. Taken together, our genetic and biochemical data establish a correlation between effects on the translational status of Sox5, Bcl11b, and Rorb mRNAs and area-specific effects on levels of the encoded proteins in S1.

Cytoplasmic Pum2 and TDP-43 localize with and directly bind to mRNAs encoding key regulators of layer IV/V neuronal identity in developing neocortex

We next asked whether apparent effects on translation by Pum2 and TDP-43 in developing neocortex could potentially be mediated by direct interaction of these proteins with the regulated mRNAs. Endogenous mouse TDP-43 is present in cytoplasmic lysates from neocortex at P0 (Figure 1—figure supplement 8), implying that it could conceivably function in the cytoplasm to regulate post-transcriptional processes such as translation at this stage. Moreover, immunostaining revealed that both Pum2 and endogenous mouse TDP-43 were detectable in the cytoplasm of both progenitors and post-mitotic neurons in the pS during early neurogenesis and postnatally (Figure 10—figure supplement 1). We also performed high-resolution imaging of post-mitotic neurons in layer IV/V of the developing pS using combined immunostaining/smFISH. Bcl11b and Rorb mRNAs were observed as discrete foci primarily in the cytoplasm, whereas Sox5 mRNA foci were detected in both the nucleus and cytoplasm (Figure 10a and b). Cytoplasmic mRNA foci overlapped with the diffuse staining seen throughout the cytoplasm for both Pum2 and TDP-43 (Figure 10a and b). These data demonstrate that both these mRNAs and the RBPs that regulate them are present in the cytoplasm of post-mitotic neurons in developing pS, suggesting that they could potentially interact there in neuronal messenger ribonucleoprotein (mRNP) complexes. In addition, our immunoblot analyses in Figure 1—figure supplement 8 demonstrated increased levels of both hTDP-43 and hTDP-43A315T proteins in the cytoplasm at P0. This observation is consistent with a possible gain-of-function effect of hTDP-43 in this cellular compartment.

Figure 10 with 1 supplement see all
Pum2 and TDP-43 interact directly with mRNAs encoding key regulators of layer IV/V neuronal identity in developing neocortex.

(a, b) Single-molecule fluorescent in situ hybridization (smFISH) for Sox5, Bcl11b, and Rorb mRNAs coupled with immunofluorescence for Pum2 (a) or TDP-43 (b) on coronal sections from the prospective somatosensory area (pS) of WT mice. High-magnification views taken in layer V for Sox5 and Bcl11b or layer IV for Rorb are shown to the right. White arrows indicate examples of Sox5, Bcl11b, and Rorb mRNAs that overlap with Pum2 or TDP-43 protein immunofluorescence signal. Individual channels for a representative cell (delineated with dashed lines) are shown to the very right of each respective image. Scale bars: 25 μm. (c) UV Cross-linking immunoprecipitation (UV-CLIP) results from E18.5 cortices are shown. Dissociated cells were either cross-linked with UV light or left untreated as a control. Lysates were used for immunoprecipitations with antibodies against TDP-43 (top), Pum2 (bottom), or control nonspecific IgG (not shown). RNA in the input and immunoprecipitated (IP) eluate were analyzed by qRT-PCR for the indicated mRNAs. After verifying enrichment relative to IgG controls for UV-treated samples, histograms were generated that represent the fraction of input mRNA co-immunoprecipitated with either Pum2 or TDP-43 in the presence or absence of UV cross-linking. Statistically significant enrichment was evaluated relative to 18S rRNA, which is not known to interact significantly with either protein. Reduced signal in the absence of UV cross-linking implies an interaction is cross-linking-dependent, that is, direct. Data are represented as means ± standard error of the mean (SEM) from n = 3–6 samples. *p≤0.05, **p≤0.01 Mann–Whitney U test.

To assess whether Pum2 and TDP-43 might directly interact with Sox5, Bcl11b, or Rorb mRNAs, we examined several published genome-wide binding studies for Pum2 (Hafner et al., 2010; Sternburg et al., 2018; Uyhazi et al., 2020) and TDP-43 (Colombrita et al., 2012; Herzog et al., 2020; Kapeli et al., 2016; Narayanan et al., 2012; Polymenidou et al., 2011; Tollervey et al., 2011). However, as far as we could tell, these mRNAs were not detected in these studies. Presumably, this is because they show a relatively specific temporal and spatial expression pattern in the developing neocortex, whereas most published studies examined cultured cell lines or whole brain/adult material from patients or mice. Interestingly, Bcl11b was detected in a RIP study of TDP-43 targets on E18.5 rat cortical neurons after 14 days in culture (Sephton et al., 2011). Moreover, iCLIP of Pum2 from neonatal mouse brain revealed interaction of Pum2 with Sox5 mRNA and the same study found that Bcl11b mRNA was deregulated in brains of Pum1/Pum2 double knockouts (Zhang et al., 2017). Encouraged by these positive observations, but recognizant of the inherent potential for false positives and negatives in genome-wide studies (Williams et al., 2017), we decided to assess potential interactions ourselves in developing neocortex using a directed approach. To this end, we adapted a directed UV-cross-link immunoprecipitation (UV-CLIP) protocol for neocortex that we used previously with cultured motor neuron-like cells (Neelagandan et al., 2019).

To determine whether Pum2 and endogenous mouse TDP-43 can bind directly to Sox5, Bcl11b, and Rorb mRNAs in developing neocortex, we performed UV-CLIP assays with cytoplasmic lysates from wild-type C57Bl/6J mouse neocortex followed by qRT-PCR. After first verifying enrichment relative to rabbit IgG control immunoprecipitations (IPs), we next measured the percent of input RNA in the IPs, comparing this to 18S rRNA to assess biologically relevant interactions (Figure 10c). As a control for cross-linking dependence of detected interactions, we also included an IP from non-UV-treated lysates. Enrichment in the IP that is UV-dependent implies that direct physical interaction between the protein and the RNA tested was occurring in vivo in the neocortex prior to lysis. As expected, we found strong UV-dependent interaction of each RBP with its own mRNA, consistent with previous reports (Ayala et al., 2011; Galgano et al., 2008; Hafner et al., 2010; Polymenidou et al., 2011; Tollervey et al., 2011). In contrast, Pum2 interacted with TDP-43 mRNA to a much lesser extent, and we did not detect significant interaction of endogenous mouse TDP-43 with Pum2 mRNA, suggesting minimal cross-regulation. Both Pum2 and mouse TDP-43 showed significant interaction with Sox5 and Rorb mRNAs in UV-CLIPs. Pum2 also showed significant cross-linking to Bcl11b mRNA, whereas for TDP-43 this was just above conventional thresholds for statistical significance. We did not see significant interaction of Fezf2 mRNA with Pum2 or Cux1 mRNA with either protein relative to 18S rRNA, consistent with our finding that neither these mRNAs nor the encoded proteins showed altered regulation in developing neocortex in the Pum2 cKO or TDP43A315T lines. Together with our imaging assays, these directed UV-CLIP experiments support the idea that both Pum2 and TDP-43 can directly interact with specific mRNAs encoding layer IV/V neuronal identity determinants in vivo in the cytoplasm of cells in the developing neocortex. This suggests that direct interaction of Pum2 and TDP-43 with these mRNAs could potentially mediate the post-transcriptional regulatory effects described above (Figure 9).

Discussion

In the neocortex, functionally related neuronal ensembles are grouped into areas specialized for processing certain types of information. Within areas, neuronal subtypes with similar projection patterns and connectivity are grouped into characteristic layers (Rakic, 1988; Rash and Grove, 2006; Zilles and Amunts, 2010). Although all neocortical areas have a similar six-layer architecture, layer identity and connectivity are sculpted in an area-specific manner to serve its specialized functions (Dehay and Kennedy, 2007). Genetic approaches in the mouse have identified many proteins that determine neocortical area identity and other proteins that control neuronal sub-specification across the cortex to give rise to the layers (Greig et al., 2013; Jabaudon, 2017; Molyneaux et al., 2007; O’Leary et al., 2007; O’Leary and Nakagawa, 2002; O’Leary and Sahara, 2008). However, a fundamental, unresolved issue is the nature of the downstream molecular mechanisms that control neuronal subtype specification in an area-specific manner. Previous work addressing this issue has highlighted roles for transcriptional regulators, such as Bcl11a/Ctip1 and Lmo4, in sculpting area-specific cytoarchitecture in sensory/visual or rostral motor cortex, respectively (Cederquist et al., 2013; Glickfeld et al., 2013; Greig et al., 2016; Woodworth et al., 2016). Here, we combined genetic approaches with molecular imaging and in vivo biochemical assays and generated evidence supporting a new role for post-transcriptional regulation by RBPs in elaboration of area-specific cytoarchitecture. Specifically our results reveal cell-autonomous and post-mitotic roles for the RBPs Pum2 and TDP-43 in shaping the specialized neuronal cytoarchitecture of layer IV/V that is a hallmark of the sensory cortical area, S1. Moreover, our biochemical analyses support the possibility that these RBPs achieve this regulation, at least in part, through effects on the translational status of mRNAs encoding key molecular determinants of layer IV/V neuronal identity.

The similar neurodevelopmental phenotypes in S1 and common effects on downstream molecular targets (Sox5, Bcl11b, and Rorβ) that we observed upon Pum2 loss of function or hTDP-43/hTDP-43A315T overexpression suggest mechanistic overlap. Collectively, our data support the notion that these two RBPs directly interact with mRNAs encoding key regulators of layer IV/V neuronal fate to regulate them post-transcriptionally, at least in part through effects on translation.

To gain insight into the molecular mechanisms through which Pum2 and TDP-43 affect the expression of layer IV/V molecular determinants, we examined many different steps of gene expression, including transcription/mRNA stability, isoform diversity generated by splicing and alternative 3′ end processing, as well as translation. However, we only detected significant effects on the distribution of Sox5, Bcl11b, and Rorb mRNAs in sucrose density gradients from pS (Figure 9), providing evidence that translation is affected. How strong is the case for translational regulation based on our sucrose density gradient polysome profiling assays? Two big advantages of this assay vs. tagged-ribosome alternatives (Heiman et al., 2008; Sanz et al., 2009) are that it is independent of mRNA levels and can reveal shifts of an mRNA between gradient fractions. The latter reflects translational regulation driven by changes in ribosome number/mRNA, rather than just ribosome access. For example, in the case of Rorb, there is a shift of almost half the mRNA from a fraction with approximately seven ribosomes per mRNA to the fraction with approximately one ribosome/mRNA. In our view, this is a fairly strong effect on ribosome density that would be predicted to lead to a significant reduction in protein output from this mRNA, in perfect agreement with and offering a reasonable explanation for the protein-level phenotypes in the pS. The effects on Sox5 and Bcl11b mRNAs are arguably more subtle, but this might be expected in a bulk tissue assay. Importantly, although our sucrose gradient assays lack cellular resolution, we see no reason why this should lead to false-positive effects. One caveat is that the shifts we observe may not reflect altered ribosome association since we do not purify ribosomes directly or demonstrate that the complexes are disrupted by puromycin treatment of neocortices prior to cell lysis. However, we think the clear congruence between the effects on mRNAs in the gradients and at the protein level favors the simple interpretation of effects on ribosome density on the mRNAs. On balance, we think our positive results in the gradient polysome profiling assays indicate that translational regulation of these mRNAs by Pum2 and TDP-43 is occurring and could therefore contribute to layer IV/V cytoarchitecture in S1. Future experimental approaches with higher cellular resolution will help to determine whether important contributions from transcriptional or other post-transcriptional mechanisms might have escaped detection in the assays that we performed here.

It is important to understand that even though the Pum2 cKO and TDP43 overexpression phenotypes are highly similar, both at the neurodevelopmental and post-transcriptional/translational levels, our genetic strategy implies opposite modes of action for these RBPs. Pum2 loss-of-function phenotypes indicate that Pum2 promotes normal layer IV/V cytoarchitecture in S1, whereas phenocopy by TDP-43 gain of function suggests that TDP-43 can oppose this process. While we cannot yet say the relative contribution of translational control to the overall process, this competing regulation is reflected in our polysome gradient data in Figure 9, which imply that Pum2 normally represses translation of the mRNAs for layer V fate determinants, Sox5 and Bcl11b, whereas TDP-43 activates them. Conversely, Pum2 activates translation of a molecular determinant that can drive layer IV fate: Rorβ, whereas TDP-43 appears to repress Rorb mRNA translation. Importantly, the predicted binding sites for each RBP in the 3′ UTRs of these mRNAs do not overlap for the most part, suggesting that simultaneous binding and competition on the same mRNA molecule would be possible. An interesting line of future experimentation would be to delineate the exact binding sites on the regulated mRNAs for both proteins and dissect the relative contribution they make to regulation in the context of newly born layer IV/V neurons in the pS.

Many other RBPs presumably bind to the mRNAs affected here and may also thereby contribute to post-transcriptional regulation as co-factors, competitors, or independent regulators. Bearing this in mind, it would also be interesting to focus on specific cis-elements in the 3′ UTRs of Sox5, Bcl11b, and Rorb mRNAs and their relative contributions to regulation. This would be conceptually similar to work pioneered in Caenorhabditis elegans to dissect the regulatory logic underlying terminal differentiation of specific neuronal classes (Hobert, 2008; Hobert and Kratsios, 2019), but at a post-transcriptional level. Similar approaches in other systems have provided major insights into the molecular regulatory logic underlying post-transcriptional regulation during oocyte development (Piqué et al., 2008). Given that all of these mRNAs show diversity in their 3′ UTRs which is likely to impact on stability and translation, it will also be important to examine the relative amounts of specific isoforms in developing layer IV/V neurons and incorporate this information into models of post-transcriptional regulation of layer IV/V neuronal specification in S1. Autoregulation and cross-regulation should also be examined, and interplay with transcriptional regulation will clearly be a key aspect to understand.

Our data also provide further support for the idea that RBPs can function in a ‘dual’ translational regulatory mode, acting either as activators or repressors depending on mRNA context. Most previous studies examining mRNA-specific translational regulation by Pum2 and TDP-43 have characterized them exclusively as repressors (Cao et al., 2010; Coyne et al., 2014; Majumder et al., 2012; Vessey et al., 2010; Wickens et al., 2002; Zahr et al., 2018). However, a recent study from our group revealed a translational enhancer function for both hTDP-43 and hTDP-43A315T in cultured neuronal cells (Neelagandan et al., 2019). Pumilio was reported to function as a translational repressor in the context where it was originally identified (Lehmann and Nüsslein-Volhard, 1991; Murata and Wharton, 1995), and this function is clearly conserved among Pumilio family (Puf) proteins (Wickens et al., 2002). Nevertheless, there is also precedent for translation activation of specific mRNAs by Puf proteins in both Xenopus oocytes (Piqué et al., 2008) and C. elegans (Kaye et al., 2009). Recent work with shRNA knockdowns in cultured cortical neurons also reported a translational enhancer function for Pum2, although this appeared to be more general (Schieweck et al., 2021). Other studies have focused on other post-transcriptional effects. For example, simultaneous knockdown of Pum1 and Pum2 in cultured non-neuronal cells affected stability of hundreds of mRNAs (Bohn et al., 2018), although potential effects on translation were not analyzed in this study. Our results with sucrose density gradient polysome profiling provide in vivo evidence for mRNA-specific translational activator roles for both Pum2 and TDP-43 in the context of mammalian brain development. Moreover, they suggest the possibility of dynamic switching between repressor and activator capabilities during development via mechanisms that remain to be defined.

A critical issue raised by our studies is the enigma of area-specific regulation by Pum2 and TDP-43, given that both are ubiquitously expressed RBPs. One possibility is that area-specific signaling mechanisms might converge on post-translational modifications of Pum2 and TDP-43. In addition, RBPs often work together in co-factor complexes (e.g., Vessey et al., 2012; Zahr et al., 2018) and an unidentified RBP co-factor for area-specific post-transcriptional regulation might be expressed in an area-specific manner. There is also evidence that thalamic innervation can affect the molecular composition of the ribosome itself and that this differentially impacts translation of specific mRNAs in a spatial and temporal manner (Kraushar et al., 2015). Thus, one can also imagine that area-specific effects on ribosome composition and function might also play a role in RBP regulatory capacity within specific cortical areas. Clearly, future work will be needed to resolve the important issue of how spatial control arises through ubiquitously expressed proteins.

Our results raise the possibility that post-transcriptional regulation by Pum2 and TDP-43 might reflect a ‘downstream module’ for area-specific neuronal subtype specification. An unusual feature of the S1 layer IV/V ‘motorization’ phenotype, which we show in Figures 1 and 3, is its selective effect on this aspect of area identity. As shown in Figure 5, other molecular and cytoarchitectural aspects of S1 area identity, such as expression of specific molecular markers and formation of characteristic barrels, appear largely preserved in both Pum2 cKO and TDP43A315T mutants. In contrast, other mutants, identified to date that lead to a motorized S1, appear to affect all of these aspects of area identity (Alfano and Studer, 2013; Armentano et al., 2007; O’Leary and Nakagawa, 2002; O’Leary and Sahara, 2008; Tomassy et al., 2010). We interpret the selectivity in Pum2 cKO and TDP43A315T mutants as evidence that they might function as components of a downstream regulatory module for elaboration of specific aspects of area identity, rather than controlling identity per se. Future work will be necessary to resolve whether Pum2 and TDP-43 function directly downstream of previously described area identity determinants or comprise a parallel pathway. Regardless, our results raise the intriguing possibility that neocortical arealization involves at least two genetically separable components: initial ‘area definition’ and subsequent ‘area elaboration.’ This observation suggests a general genetic strategy for identifying downstream elaboration modules of area-specific architectural elements: identifying mutants that selectively affect specific elements of area identity while leaving others intact. Systematic screening for such ‘area elaboration mutants’ might be one fruitful strategy to elucidate the downstream molecular programs that elaborate area-specific subtype specification and connectivity. While transcriptional regulation will certainly play a crucial role here, our results also support casting a broader ‘genetic net’ to include potential contributions of post-transcriptional regulation.

The findings we report here also shed light on a fundamental issue in molecular control of cortical development: Which regulatory mechanisms are established in neuronal precursors, and which take place in post-mitotic neurons? A previous study with Pum2-targeting shRNAs delivered by IUE observed translational de-repression of a lower-layer marker, TLE4, in neuronal progenitors (Zahr et al., 2018). However, several lines of evidence imply that the regulation we observe here with Pum2 cKO mice occurs in post-mitotic neurons. First, regulation is observed at P0, when cortical neurogenesis is complete (Figure 9d) and binding to these mRNAs is also strong at E18.5 (Figure 10c). Second, we did not observe any effect on Sox5 or Bcl11b mRNA translation at E13.5, E14.5, or E18.5 (Figure 9—figure supplement 3b), the peak birth time for layer V and IV neurons and even prenatally, but at P0 when neurogenesis is completed, and neurons are already post-mitotic (Figure 9d). Third, our examination of nascent neurons of Pum2 cKO mice at E13.5 did not show increased protein expression of Sox5, Bcl11b, or Tbr1 (Figure 9—figure supplement 3c). Fourth, we saw apparent neuronal fate changes in pS1 when we performed IUE with either Cre or TDP43 in the pNeuroD context, which is believed to be exclusively expressed in post-mitotic neurons (Guerrier et al., 2009). It will be important to verify that conclusions based on Pum2 loss-of-function phenotypes can be rescued by restoring Pum2 protein levels. Nevertheless, our results support the notion that regulation of Sox5, Bcl11b, and Rorβ protein levels can occur post-mitotically.

One developmental mechanism that seems to be implied by our data is that some newly born S1 neurons that are normally fated to become layer IV neurons might conceivably be re-specified if the levels or activity of Pum2 or TDP-43 would be sufficiently reduced or increased, respectively. Assuming this model is correct, two issues are raised. (1) What might be the underlying molecular basis for this hypothetical and apparently highly selective re-specification capacity? (2) What might be its biological value as a regulatory mechanism? With respect to the first point, we can speculate that these S1 neurons in layer IV, and no other layers, might be inherently predisposed to re-specification by virtue of having related genetic programs to the recently derived layer V neurons. Shared molecular expression patterns in these populations have been described at both the transcriptomic and proteomic levels (Ayoub et al., 2011; Poulopoulos et al., 2019; Sadegh et al., 2021). Interestingly, shared molecular expression signatures extend to the noncoding genome and include microRNAs (miRNAs) miR-128, miR-9, and let-7, which are functionally distinct, yet commonly involved in specifying neurons of layers VI and V and layers IV, III, and II, respectively: they can transiently alter their relative levels of expression to change from stem-cell competence towards a neurogenic stage-specific pattern. Furthermore, these shared miRNAs are able to shift neuron production between earlier-born and later-born fates to generate laminar identity (Shu et al., 2019; Zolboot et al., 2021). Future work could validate the predictions of this intriguing model and explore potential interplay between transcriptional and post/transcriptional regulation in this context.

Regarding our data, the most obvious molecular determinants to be relevant here would be Sox5 and Bcl11b, which are expressed in at least a subset of newly born layer IV neurons at a low level. In this model, regulation by Pum2 and TDP-43 can tune production of these transcription factors, with Pum2 normally putting a brake on their synthesis, and TDP-43 having the capacity to amplify the output from lower mRNA levels in these newly born neurons. However, we also see reciprocal effects on Rorb mRNA in the polysome gradients. This could be a consequence or epiphenomenon, but this observation does suggest that it might also contribute to effects on expression. Under normal conditions, Pum2 might activate translation of this mRNA, amplifying the switch to a layer IV fate, whereas increased TDP-43 levels appear able to downregulate Rorb mRNA’s translation. In the most extreme version of this model, translational regulation is the key element, with Pum2 and TDP-43 governing a ‘translational switch’ controlling neuronal fate. A more likely scenario is that other yet-to-be-defined post-transcriptional mechanisms (e.g., regulated protein turnover) may play equally or even more important roles. Determining whether this model is correct and defining the relative contribution of translational control vs. other regulatory mechanisms will require new approaches with much higher spatial and temporal resolution to correlate the fate of these specific neuronal populations with specific molecular changes within them, including assays specifically measuring translational effects. From this perspective, we find it extremely encouraging that regulation seems strikingly similar in our IUE assays in vivo and in our pS-enriched primary neuron transfection assays in vitro (compare results in Figures 6 and 7). To us, this suggests strong potential to recapitulate the core regulatory effects on expression of proteins affecting cell fate and gene expression in an ex vivo system (e.g., slice cultures) that would be amenable to live imaging and enable more rapid experimental manipulations with a wider variety of readouts.

Considering the second point regarding biological value, our work raises the intriguing – albeit currently speculative – possibility that altering the relative activity of Pum2 and TDP-43 within the cytoplasm of developing pS neurons might potentially provide a mechanism to dynamically tune the fate of layer IV/V neurons in response to environmental inputs. According to this view, neuronal identity in S1 is not fully hardwired, but somewhat plastic. We can further speculate that optimal setting of network-level parameters in the developing brain might require fine-tuning of neuronal identity between SCPNs in response to evolving input from the hypothalamus and presumably intracortical signaling as well. In other words, neuronal fate for these populations might not yet be locked in, but rather remain plastic until particular later critical periods in cortical development have been completed. In this regard, we find it interesting that the effects we observe are manifested post-mitotically and that altered translational regulation is observed at least as late as P0 in the Pum2 cKO, a time when neurogenesis per se is complete, and activity-dependent, wiring-driven effects will play an increasingly important role. One can hypothesize that there is still capacity to tune layer-neuron cytoarchitecture in S1 at this stage in response to network activity and that competing regulation by Pum2 and TDP-43 might play a role in re-specification. Experiments to directly examine this possibility can be envisaged. Specifically, we think it would be interesting to integrate electrophysiological approaches with detailed cellular-level analyses of post-transcriptional regulation by Pum2 and TDP-43 and its interplay with transcriptional regulation in this specific developmental context.

What might be the broader impact on brain function and implications for human health of altered S1 cytoarchitecture resulting from loss of Pum2 or increased levels of TDP-43? Reduced Pum2 function has been implicated in epilepsy in both rodents and humans (Follwaczny et al., 2017; Siemen et al., 2011; Wu et al., 2015), and altered cortical wiring in S1 during development might conceivably contribute to seizures due to perturbations of excitation/inhibition balance that propagate through the network (Guerrini and Dobyns, 2014). However, the contribution of altered sensory system function to epilepsy remains unclear and seizures reported by others in Pum2 KO mice might very well have a completely different origin. Other behavioral phenotypes associated with loss of Pum protein function in the brain have also been described (Siemen et al., 2011; Zhang et al., 2017). Although technically challenging, it would clearly be of great interest to examine whether altered wiring of S1 contributes to these behavioral effects and, if so, the underlying physiological basis.

In contrast to Pum2, TDP-43 deregulation is mainly implicated in neurodegenerative diseases, particularly ALS and FTD, both of which strike layer V neurons in multiple cortical areas late in life (Geser et al., 2010; Taylor et al., 2016). We found that modest overexpression of a patient-derived mutant allele of TDP-43 during cortical development significantly increases the number of layer V neurons and dramatically alters connectivity of S1, significantly enhancing the number of subcerebral projections (Figures 1 and 3). Whether these alterations contribute causally to disease remains to be determined; however, they are not sufficient for disease since Pum2 cKO mice show a similar phenotype, but do not develop ALS-like symptoms. Effects on laminar identity in a wild-type TDP43 transgenic line that does not develop ALS symptoms (Figure 1—figure supplement 9) also seem to favor the idea that altered specification in S1 is unrelated to ALS/FTD. However, the effects in this asymptomatic line were weaker than those observed in the patient-derived mutant line that develops symptoms (compare Figure 1—figure supplement 9 to Figure 1). The weaker effect on S1 specification in this line might conceivably be below a threshold needed to contribute to disease, and this might also explain the absence of ALS-like phenotypes in mice lacking Pum2. Future work should therefore examine whether altered connectivity is a general phenomenon of loss of Pum2 or gain of TDP-43 function and whether there might be a correlation between the level of TDP-43 expression and altered wiring. Assuming this proves true, it would then be of great interest to examine how developmental alterations in area-specific connectivity seen in these mice affect signaling in cortical networks and whether this ultimately contributes to degeneration of layer V cortical neurons and their subcerebral targets in spinal cord.

Materials and methods

Animal welfare and approvals

Request a detailed protocol

All animal care and experimental procedures were performed according to the institutional guidelines of the UKE or University of Geneva and relevant national law. In Hamburg, guidelines were those of the UKE Animal Research Facility (FTH) and conformed to the requirements of the German Animal Welfare Act. Ethical approvals were obtained from the State Authority of Hamburg, Germany (G10/107_Pumilio, G14/003_Zucht Neuro, N086/2020_Pum2/TDP43 IUEs, ORG_520 and ORG_765).

Generation and use of Pum2 cKO mice

Request a detailed protocol

ES cell lines targeting cassette for exons 6 and 7 of Pum2 were obtained from KOMP (link: CSD45770; parental ES cell line: JM8A1.N3) and expanded for injection according to their protocol. Cells were injected into morulae derived from BALB/C mice using the PiezoXpert (Eppendorf).

Germline transmission was verified by the long PCR procedure recommended by KOMP, as well as by Southern blotting. Founder lines were mated to a line expressing Flp recombinase in the germline (Rodríguez et al., 2000) to excise the targeting cassette and generate the ‘floxed’ conditional allele. The constitutive Pum2 KO line was generated by mating this line with mice expressing Cre recombinase in the germline (Schwenk et al., 1995). As the original KOMP ES cell lines were on a C57Bl/6N background, the floxed Pum2 and Pum2 KO lines were backcrossed more than 10 times to C57Bl/6J prior to use and were also maintained by routine backcrossing to C57Bl/6J.

Mouse housing and genetics

Request a detailed protocol

Mice were housed in a barrier facility and maintained under standard housing conditions with a 12 hr light/dark cycle and ad libitum access to water and chow.

Pum2fl/fl mice were crossed to Emx1Cre to inactivate Pum2 in forebrain principal neurons and glia (Iwasato et al., 2000). Pum2fl/fl littermates were taken as controls. For experiments characterizing conditional heterozygotes, Emx1Cre; Pum2+/fl mice were mated to Pum2+/fl.

Mice expressing either hTARDBP (Arnold et al., 2013) or hTARDBPA315T (Wegorzewska et al., 2009) were obtained from the Jackson Laboratory (Bar Harbor, Maine, USA; stocks 017907 and 010700, respectively) on a congenic C57Bl/6J background. Non-transgenic littermates were taken as controls. At least three independent litters were used for each analysis. All mouse lines used for experiments were congenic on C57Bl/6J and maintained by backcrossing to this wild-type background. Mouse lines were genotyped using primers in Table 5. Early morning of the day of the vaginal plug was considered as embryonic day 0.5 (E0.5).

Table 5
Genotyping primers.
AlleleForward primer (5′–3′)Reverse primer (5′–3′)
Pum2 KOGCTGCTACTCCCTTTCTTGCGAGCACATGTGGAGGTCAGA
Pum2 WT and floxedGCTGCTACTCCCTTTCTTGCCCAAGGCGCTCAACTACTTC
CreTAACATTCTCCCACCGCTAGTACGAAACGTTGATGCCGGTGAACGTGC
ActinCAATAGTGATGACCTGGCCGTAGAGGGAAATCGTGCGTGAC
TDP43A315TGGATGAGCTGCGGGAGTTCTTGCCCATCATACCCCAACTG
TDP43GGATGAGCTGCGGGAGTTCTTGCCCATCATACCCCAACTG
Control for TDP43CAAATGTTGCTTGTCTGGTGGTCAGTCGAGTGCACAGTTT

Postmortem tissue collection

Request a detailed protocol

Embryonic and postnatal brain samples were fixed either for 2 hr (for immunohistochemistry [IHC]) or overnight (for fluorescent in situ hybridization) at 4°C in PFA 4%. Samples were then embedded in optimal cutting temperature (OCT) medium (JUNG) after being equilibrated progressively in 10, 20, and 30% sucrose, and cut on a Leica cryostat. No samples were excluded in this work. For each experiment, a minimum of three animals from different litters were used.

Nissl staining

Request a detailed protocol

20 μm coronal and sagittal sections were rinsed for 2 min in distilled water and incubated for 30 min in cresyl violet and washed twice in distilled water. Additional sequential incubation for 2 min in 20, 50, and 75% ethanol, 96% ethanol/acetic acid, and 100% ethanol followed. Sections were then incubated twice for 5 min in 100% ethanol first and then with xylol. After drying, sections were finally mounted with Eukitt and stored at room temperature (RT).

Immunofluorescent staining and imaging

Request a detailed protocol

Immunofluorescent imaging was performed on cryosections. Briefly, slides were boiled in an unmasking buffer (sodium citrate 0.1 M, pH 6). After three PBS washes, cryosections were blocked with 10% goat serum and 0.3% Triton X-100 for 1 hr at RT. Primary antibody incubations were carried out overnight at 4°C. Secondary antibodies were added for 2 hr at RT. The following primary antibodies were used: rat anti-Ctip2/Bcl11b (dil 1:300, Abcam ab18465), rabbit anti-Sox5 (1:300, Abcam ab94396), mouse anti-Rorβ (1:200, Perseus Proteomics PP-N7927-00), rabbit anti-Cux1 (1:100, Millipore ABE217), rabbit anti-Tbr1 (1/300, Abcam ab31940), rat anti-Lmo4 (1:500, gift from J. Valsvader), guinea pig anti-Bhlhb5 (1:500, gift from B. Novitch), rabbit anti 5-HT (1/10000, Immunostar 20080), rabbit anti-Pum2 (1:100, Bethyl A300-202A), rabbit anti-Tdp43 (1:300, Abcam AB41881), guinea pig anti-NeuN (1: 300, Synaptic Systems 266004), and mouse anti-GFAP (1:300 Synaptic Systems 173211). The following Alexa-conjugated secondary antibodies from Life Technologies were used: goat anti-rabbit FC (488, 594), goat anti-rat FC (488, 594), goat anti-mouse FC (488, 594, 633), and goat anti-guinea pig FC (488) (dil 1:300). Slides were incubated for 10 min in PBS with DAPI (1:1000, Thermo Fisher) and mounted with ROTI Mount FluorCare (Roth).

Retrograde labeling with cholera toxin B

Request a detailed protocol

For retrograde labeling, anesthetized P0 pups were injected with Alexa Fluor 555-conjugated CTB (1 mg/ml; Invitrogen, volume injected: 300 µl) under ultrasound guidance using a Vevo 770 ultrasound backscatter microscopy system (Visual Sonics). Subcerebral injections were performed at the midbrain–hindbrain junction using a nanojector (Nanoject II Auto-Nanoliter Injector, Drummond Scientific Company 3-000-204) to label all SCPNs, including corticopontine projection neurons and corticospinal motor neurons. Injected pups were perfused at P7, and brains were collected and 40-µm-thick sections were cut at the cryostat and either directly incubated for 10 min with DAPI and mounted with ROTI Mount FluorCare (Roth) or treated for immunostaining. In the last case, slides were incubated with the blocking solution (10% goat serum and 0.3% Triton X-100) for 1 hr at RT and were then incubated with primary antibodies overnight at 4°C. The primary antibodies used were rat anti-Ctip2 (Bcl11b) (dil 1:300, Abcam ab18465), and rabbit anti-Sox5 (1:200, Abcam ab94396). Subsequent to three washes with PBS, the slides were incubated with corresponding Alexa Fluor 488 secondary antibody (1:300; Life Technologies) for 2 hr at RT. Sections were washed with PBS three times and incubated for 10 min in PBS with DAPI (1:1000) (Thermo Fisher) and mounted with ROTI Mount FluorCare (Roth).

smFISH and combined IHC/smFISH

Request a detailed protocol

Collected brains were fixed for 24 hr in PFA 4% at 4°C. Samples were then embedded in OCT medium (JUNG) after being equilibrated progressively in 10, 20, and 30% sucrose, and cut on a Leica cryostat (thickness: 16 μm). Cryosections were left 1 hr to dry at –20°C and then stored at –80°C. RNAscope in situ hybridization assays were performed according to the manufacturer’s instructions (Advanced Cell Diagnostics [ACD]). Briefly, cryosections were gradually dehydrated in 50%, 70%, and twice in 100% ethanol for 5 min each at RT. Slides were left to dry for 30 min at RT. In between all pretreatment steps, tissue sections were briefly washed into a Tissue-Tek Slide Rack submerged in a Tissue-Tek Staining dish with distilled water. Incubations were performed on the HybEz II hybridization system (ACD). The pretreat solution 1 (hydrogen peroxide reagent) was applied for 10 min at RT, and then the tissue sections were boiled in pretreat solution 2 (target retrieval reagent) for 5 min. Slides were treated with pretreat solution 3 (protease III reagent) for 30 min at 40°C for FISH while with pretreat solution 4 (protease IV reagent) for 20 min for FISH combined with IHC. Custom mouse Sox5 (413291), Bcl11b (413271-C2), Fezf2 (313301-C3), Cux1 (442931), and Rorb (444271-C3) RNAscope probes were designed and purchased from ACD. In addition, the negative (Cat# 310043, ACD) and positive (Cat# 313911, ACD) control probes were applied and allowed to hybridize for 2 hr at 40°C. The amplification steps were performed according to the manufacturer’s instructions. In between every amplification step, sections were washed with 1× wash buffer. Detection was performed using TSA Plus fluorophore (fluorescein, cyanine 3, or cyanine 5) (1:1500-1:3000) from PerkinElmer for 30 min at 40°. Slides were rinsed twice in 1× wash buffer, incubated for 10 min in distilled water with DAPI (ACD), and then mounted with ROTI Mount FluorCare (Roth). For combined IHC/smFISH, following the amplification step, sections were processed for IHC. Briefly, slides were incubated with the blocking solution (10% goat serum and 0.3% Triton X-100) for 1 hr at RT and were then incubated with primary antibodies ON at 4°C. The primary antibodies used were rabbit anti-Pum2 (1:100, Millipore 03-241) and rabbit anti-Tdp43 (1:300, Abcam AB41881). Subsequent to three washes with PBS, the slides were incubated with corresponding Alexa Fluor 555 secondary antibody (1:300; Life Technologies) for 2 hr at RT. Brain sections were rinsed with PBS three times and incubated for 10 min in PBS with DAPI (ACD) and mounted with ROTI Mount FluorCare (Roth).

Polysome profiling and total RNA preparation

Request a detailed protocol

Animals were collected at either E13.5, E14.5, E18.5, or P0, and cortices were dissected in a dissection buffer containing 2.5 mM HEPES-KOH (pH 7.4), 35 mM glucose, 4 mM NaHCO3, and 100 μg/ml cycloheximide and flash frozen in liquid nitrogen and stored at –80°C. For P0 cortices, a somatosensory area-enriched region has been dissected by using a millimeter paper and taking out with a blade 1 mm from the rostral and 1 mm from the caudal regions of the cortex (Figure 9b). After genotyping, three replicates for controls and either Pum2 or TDP-43 mutants were processed. Each replicate consists of one, two, three, or four pooled cortices for P0, E18.5, E14.5, and E13.5, respectively.

Cortices were homogenized using a glass dounce in 400 μl of lysis buffer containing 20 mM HEPES KOH (pH 7.4), 150 mM KCl, 5 mM MgCl2, 0.5 mM DTT, 100 μg/ml cycloheximide (Sigma-Aldrich), 1X cOmplete mini EDTA-free Protease Cocktail (Roche), 40 units/ml RNaseIn (Promega), and 20 units/ml SUPERaseIn (Thermo Fisher Scientific). Cortical lysates were centrifuged for 10 min at 2000 × g at 4°C, and supernatants were supplemented with 1% NP-40 and 1% Triton X-100 and incubated on ice for 5 min. After centrifugation for 10 min at 20,000 × g at 4°C, the debris-free supernatants were collected. 20 μl of the input lysates were saved as a reference for qRT-PCR. The OD260 of each lysate was measured on a NanoDrop spectrophotometer, and volumes were adjusted to ensure equal OD unit loading. 400 μl of each sample was loaded onto 14 × 95 mm Polyclear centrifuge tubes (Seton Scientific) containing 17.5–50% sucrose gradients (in Gradient Buffer containing 20 mM Tris-HCl, pH 7.4, 5 mM MgCl2, 150 mM NaCl, 1 mM DTT, 100 μg/ml cycloheximide); the sucrose gradients were generated using the Gradient Master 108 programmable gradient pourer (BioComp). The sucrose gradients containing the cortical lysates were then centrifuged for 2 hr and 15 min at 35,000 rpm in a SW40Ti rotor in a Beckman L7 ultracentrifuge (Beckman Coulter). After centrifugation, gradients were fractionated and measured for RNA content using a Piston Gradient Fractionator (BioComp) attached to a UV monitor (Bio-Rad).

For puromycin treatment, both control lysates and the puromycin-treated lysates (2 mM in lysate) were incubated on ice for 15 min followed by another 15 min at 37°C prior to loading on the 17.5–50% sucrose gradient.

For polysome to monosome (P/M) ratio analysis, areas under the curves representing the monosome and polysome peaks in gradient profiles were quantified using ImageJ (Schneider et al., 2012), and the P/M ratio was calculated by dividing the area under the curve of polysome peaks by area under the curve of the monosome peak.

qPCR and PCR with polysome gradient fractions and total RNA

Request a detailed protocol

Prior to RNA purification, individual gradient fractions were aligned with corresponding profiles and pooled according to the scheme presented in Figure 9. Pool 1 contains the non-ribosome-bound portion of the gradient, pool 2 contains 80S monosomes, pool 3 contains disomes and trisomes, pool 4 contains mRNAs with ~4–6 ribosomes bound, and fractions from the deeper fractions corresponding to roughly seven or more ribosomes per mRNA were divided into two equal pools, 5 and 6, respectively. 1 ng of an in vitro-transcribed RLuc spike-in mRNA was added to each of the six pools as a recovery control and for normalization of the samples.

Total RNA was prepared from the six gradient fraction pools and the corresponding input lysate samples using Trizol in a ratio of 3:1 and the PureLink RNA mini kit (Thermo Fisher Scientific) according to the manufacturer’s specifications. The purified RNA was concentrated by ammonium acetate precipitation using GlycoBlue carrier (Thermo Fisher Scientific). Pellets were washed with 70% ethanol, air-dried, and resuspended in nuclease-free water. RNA concentrations were determined using a NanoDrop spectrophotometer, and 250 ng of RNA was reverse transcribed with random primers using the SuperScript II cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. qPCR was performed using FastStart Universal SYBR Green Master (ROX) (Roche). All reagents and kits were used according to the manufacturer’s instructions. The ΔCt method was used for relative quantification of qPCR data. For polysome fractions, levels of spike-in RLuc RNA were measured first and their relative distribution across the fraction pools was calculated and normalized to the non-ribosome-bound pool. The same procedure was used for all other RNAs analyzed, and their distribution was additionally normalized to the one obtained for RLuc RNA and expressed as a percentage of cumulative signal. For input lysate RNA samples, values for specific mRNAs were normalized to GAPDH and represented as fold change of mutants to controls. Primers used for all qPCR analyses are described in Table 1; Table 4; Table 2.Similar cDNA from input lysate RNA of P0 somatosensory area-enriched cortical lysates was also used for RT-PCR to detect Sox5 splicing isoforms (Table 3) as in Edwards et al., 2014.

UV-CLIP with qRT-PCR as readout

Request a detailed protocol

Embryos were collected at E18.5 and cortices from 10 embryos were dissected and harvested in 5 ml ice-cold 1× PBS, in which they were resuspended by pipetting using P1000 then P10 tips. Dissociated cortices that were enough for 10 immunoprecipitations were then divided equally into two 10 cm dishes on ice. One half was UV irradiated (4 * 100 mJ/cm2) using a Stratalinker. The other half was used as control non-UV-treated sample. Cross-linked cells and non-cross-linked cells were divided into 500 µl samples and were centrifuged at top speed for 10 s at 4°C. Pellets were lysed in 1 ml of lysis buffer (50 mM Tris–HCl, pH 7.4, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% Na-deoxycholate, 1× cOmplete Protease Inhibitor Cocktail [Roche]). A fraction of the lysate corresponding to 5% of the input material (50 μl) was retained to use as a reference for calculating the fraction of input material in the IP pellet. The remaining lysate was added to Protein G Dynabeads pre-bound with either 4 μg rabbit polyclonal TDP-43 antibody (Abcam ab41881) or 5 μg of Pum2 antibody (Millipore #03-241) or 5 μg rabbit IgG (Millipore #03-241) as a control and rotated at 4°C overnight. Beads were subsequently washed twice for 2 min in high salt buffer (50 mM Tris–HCl, pH 7.4, 1 M NaCl, 1 mM EDTA, pH 8.0, 1% NP-40, 0.1% SDS, 0.5% Na-deoxycholate), followed by washing twice for 2 min in wash buffer (20 mM Tris–HCl, pH 7.4, 10 mM NaCl, 0.2% Tween-20) and a final washing step for 2 min in NT2 buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1 mM MgCl2, 0.05% NP-40). RNA was eluted by incubation with 30 μg Proteinase K (Carl Roth) in NT2 buffer for 30 min at 55°C. RNA extraction was carried out from the eluate and input sample using Trizol reagent in a ratio of 3:1 followed by the addition of chloroform and subsequent purification by PureLink kit (Ambion). All RNA obtained from each sample (input or IP) were used to generate cDNA libraries using random hexamers (Thermo Scientific) and the RevertAid RT reverse transcription kit (Thermo Scientific), following the manufacturer’s protocol.

We first verified that we had lower Cts for a given mRNA in the specific IPs relative to IgG control in the UV-cross-linked samples, implying specific signal over background. To calculate target mRNA enrichments, we first calculated the ΔCt for TDP-43 or Pum2 IP versus input and converted this to a linear ‘fold change’ value. These were then corrected for the reduced amount of input analyzed (i.e., divided by 20), and then multiplied by 100 to obtain ‘% of input mRNA in IP.’ Statistical comparisons were performed relative to 18S rRNA as neither protein has been shown to functionally regulate this RNA.

Immunoblotting

Request a detailed protocol

Cerebral cortices from P0 controls, TDP43, and TDP43A315T pups were dissected after genotyping, and nuclear and cytoplasmic proteins were separated using the NE-PER kit from Pierce (Thermo Scientific) according to the manufacturer’s instructions. Samples were loaded on a 10% SDS polyacrylamide gel and subjected to standard SDS-PAGE electrophoresis on Mini-Protean tetra cell (Bio-Rad).

Immunoblotting to nitrocellulose or PVDF was performed using an iBlot rapid transfer device (Life Technologies) according to the manufacturer’s guidelines. Blots were blocked in 5% milk/TBS-T solution and probed with antibodies diluted as indicated. Signals were visualized using fluorescent secondary antibodies and imaged on a LI-COR Odyssey CLx (LI-COR). Antibodies used in this study were mouse anti-human monoclonal TDP-43 (Novus Biologicals, H000023435-M01) (1:500), rabbit polyclonal TDP-43 (G400) (CST-3448) (1:1000), rabbit anti-Emx1 (Abcam, ab136102) (1:500). goat anti-rabbit IRDye 680LT (1:15000, LI-COR), goat anti-mouse IRDye 680LT (1:15000, LI-COR), goat anti-rabbit IRDye 800CW (1:15000, LI-COR), and goat anti-mouse IRDye 800CW (1:15000, LI-COR).

Primary neuron transfections

Request a detailed protocol

Primary neuronal cultures were prepared from somatosensory area-enriched cortices (Figure 9b) of E18.5 C57BL/6J mice. After Hanks' Balanced Salt Solution (HBSS) washes, neurons were incubated for 10 min at 37°C with Papain and DNase I (Worthington). Tissue was then triturated with a Pasteur pipette, and supernatant was separated from cell debris into a new tube. Cells were resuspended in Dulbecco's Modified Eagle Medium (DMEM)/fetal calf serum (FCS) after centrifugation for 10 min at 1000 × g and were immediately transfected. Transfections were performed using the Amaxa nucleoporation system using Mouse Neuron Nucleofector Kit (VPG-1001) following the manufacturer’s manual. 5 * 106 cells were used for each transfection. Briefly, neurons were resuspended in 100 µl of nucleofector solution containing 3 µg of DNA and transferred into the special electroporation cuvette. The transfection program used was O-005. Cells were collected after electroporation in DMEM/FCS and left for 1 hr at 37°C in the incubator. 0.5 * 106 cells were grown on glass coverslips (12 mm diameter, Carl Roth) coated with poly-l-lysine in 12-well plates (Sarstedt) in Primary Neuro Basal Medium (Lonza) supplemented with NSF-1, penicillin/streptomycin antibiotics to 1% (v/v) and l-glutamine to 0.5 μM. Neurons were cultured for 2 days at 37°C in a 5% CO2 environment prior to immunofluorescent staining. Neurons were fixed for 2 min with 4% PFA and 3 min with ice-cold methanol and then washed three times in PBS for 10 min each. Neurons were incubated with the blocking solution (10% goat serum and 0.3% Triton X-100) for 1 hr at RT, and were then incubated with primary antibodies overnight at 4°C. The primary antibodies used were rabbit anti-Flag (dil 1:200, Sigma-Aldrich F7425), mouse anti-V5 (dil 1:300, Invitrogen P/N 46-1157), chicken anti-GFP (dil 1:400, Abcam 13970) rat anti-Ctip2 (Bcl11b) (dil 1:300, Abcam ab18465), rabbit anti-Sox5 (1:200, Abcam ab94396), and mouse anti-Rorβ (1:100, Perseus Proteomics PP-N7927-00). After three washes with PBS, the slides were incubated with corresponding Alexa Fluor (488, 594, 633) secondary antibodies (1:300; Life Technologies) for 2 hr at RT. Neurons were rinsed with PBS three times and incubated for 10 min in PBS with DAPI (1:1000) (Thermo Fisher) and mounted with ROTI Mount FluorCare (Roth).

Plasmids used for transfection of cortical neurons

Request a detailed protocol

The human TDP-43 plasmids (WT TDP43 and A315T mutant) and the control plasmid pEGFP-C1 have been previously described (Neelagandan et al., 2019). Briefly, the human TDP43 plasmids were generated in a pCMV Sport6 vector backbone with an N-terminal FLAG tag and C-terminal V5 tag. pKM29 contains the WT TDP43 coding sequence (CDS) in this context and pKM36 has the A315T mutant. The full-length ORF of human TDP43 was amplified from human TDP43 (TDP43) clone ID30389805 (Open Biosystems) without a stop codon (to allow the addition of 3′ tags to the protein product) and cloned using SalI and NotI into pCMV Sport 6.1. A FLAG-tag-encoding sequence for the 5′ end and a V5-tag-encoding sequence for the 3′ end were made by oligo annealing and cloned using KpnI/SalI (FLAG) and XbaI/HindIII (V5) into the human TDP-43-containing plasmid. The A315T mutation was introduced into the human TDP-43-containing plasmid using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Cat# 200519).

Plasmids used for in utero electroporation

Request a detailed protocol

The pNeuroD-IRES-GFP (Guerrier et al., 2009) plasmid was obtained from Addgene (plasmid number 61403). The pNeuroD-Cre-IRES-GFP (Vitali et al., 2018) was obtained from Dr. Denis Jabaudon Laboratory (Geneva, Switzerland).

For human TDP-43 and TDP-43A315T mutant plasmids, the full-length ORF were generated as described above for primary neurons transfection. Briefly TDP43 V5 and TDP43A315T V5 were excised from Flag-pCMV Sport 6.1- TDP43 -V5 and Flag-pCMV Sport 6.1- TDP43A315T-V5 using SalI/HindIII and cloned into the p-NeuroD-IRES-GFP plasmid obtained from Addgene using XhoI/PstI.

In utero electroporation

Request a detailed protocol

The Institutional Animal Care and Use Committee of the City of Hamburg, Germany, approved all experiments (approval n0. 86/2020 acc. to the Animal Care Act, §8 from May 18, 2006). Time-pregnant C57BL/6J or floxed Pum2 mice were given a preoperative dose of buprenorphine (0.01 mg/kg body weight) by subcutaneous injections at least 30 min before surgery. Animals were then anesthetized using 2.5% isoflurane/O2 inhalation. Oxygen was delivered with a flow rate of 0.65 l/min and together with isoflurane were applied via a vaporizer (Föhr Medical Instruments, Seeheim-Oberbeerbach, Germany). The uterine horns were exposed, and respective plasmids mixed with Fast Green (Sigma) were microinjected into the lateral ventricles of the embryos. Five current pulses (50 ms pulse, 950 ms interval; 32 mV or 35 mV, respectively, for E12/13 or E14 embryos) were delivered across the heads of the embryos. Post surgery, 2–3 drops of meloxicam (0.5 mg/kg body weight) were given orally through soft food for 96 hr. Brains were collected at P0, and 40-µm-thick sections were cut at the cryostat and treated for immunostaining. Sections were incubated with the blocking solution (10% goat serum and 0.3% Triton X-100) for 1 hr at RT, and were then incubated with primary antibodies overnight at 4°C. The primary antibodies used were chicken anti-GFP (dil 1:800, Abcam 13970), rat anti-Ctip2 (Bcl11b) (dil 1:300, Abcam ab18465), rabbit anti-Sox5 (1:200, Abcam ab94396), mouse anti-Rorβ (1:200, Perseus Proteomics PP-N7927-00), mouse anti-human monoclonal TDP-43 (1:100, Novus Biologicals, H000023435-M01), and rabbit anti-Pum2 (1:100, Bethyl A300-202A). Subsequent to three washes with PBS, the slides were incubated with donkey anti-chicken Alexa Fluor 488 secondary antibodies (1:300, Jackson by Dianova #703-545-155) and corresponding secondary antibody goat anti-rat, rabbit, or mouse Alexa Fluor 633 (1:300; Life Technologies) for 2 hr at RT. Sections were washed with PBS three times and incubated for 10 min in PBS with DAPI (1:1000) (Thermo Fisher) and mounted with ROTI Mount FluorCare (Roth).

Imaging, counting, and statistical analysis

Request a detailed protocol

Images were acquired using an Olympus FluoView 1000 microscope, and similar acquisition settings for laser power, offset, and detector gain across conditions were used. Bright-field brain and low-magnification Nissl staining images were acquired using a Zeiss Stemi 2000-C binocular. Higher-magnification images of Nissl staining were acquired using a Zeiss Axiophot microscope.

For counting, images of P0 neocortices from coronal sections of the pS and F/M regions were divided into six equal bins. At P7, the radial surface of analyzed neocortices was divided into eight equal bins. Counting of single-labeled cells was normalized to the total number of DAPI cells in each bin. For DAPI cells and cholera toxin-labeled neurons, the counting was performed on cortical images with a constant width of 600 μm. In general, cells were counted using ImageJ Fiji. The trainable Weka Segmentation plugin was used to distinguish signal from background, and the resulted images were counted for each bin using Analyze Particles option for ImageJ Fiji. For Bcl11b, only high-expressing neurons mainly located in layer V were counted by setting low Bcl11b expression as background. For Sox5 and Bcl11b colocalization analysis, single staining for Sox5 and Bcl11b was submitted to trainable Weka Segmentation using ImageJ Fiji, and the generated images were analyzed for colocalization using JaCoP plugin in individual bins. For IUE, GFP and marker-specific channels were submitted to trainable Weka Segmentation using ImageJ Fiji, and the generated images were analyzed for colocalization of GFP-labeled electroporated neurons with Sox5, Bcl11b, or Rorβ using JaCoP plugin. FISH, transfected primary neurons, and CTB-labeled images were manually counted using Photoshop. Cortical thickness, hemisphere length, and width were measured using the measure option of ImageJ Fiji after setting scale using scale bar. Hemisphere area was measured by selecting hemisphere and the measure option of ImageJ Fiji. Nuclei size was analyzed using the average nuclei size for DAPI signal ×60 magnification images after particle analysis for DAPI channel.

Data were statistically analyzed in GraphPad Prism or Microsoft Office Excel and graphically represented using GraphPad Prism. Error bars represent the standard error of the mean (SEM). In general, a two-tailed Student’s t-test was used for the analysis of statistical significance (*p≤0.05, **p≤0.01, ***p≤0.001) between different groups. One-tailed t-tests were used for the analysis of statistical significance of polysome profiling experiments because we have a specific prediction about the direction of the difference. The Mann–Whitney U test was used for analysis of statistical significance of CLIP-qRT-PCR experiments.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Conference
    1. O’Leary DDM
    2. Chou SJ
    3. Hamasaki T
    4. Sahara S
    5. Takeuchi A
    6. Thuret S
    7. Leingärtner A
    (2007)
    Regulation of laminar and area patterning of mammalian neocortex and behavioural implications
    Novartis Foundation Symposium. pp. 141–159.
    1. Sarnat H
    (1992) Neocortical Development
    Journal Canadien Des Sciences Neurologiques 19:414.
    https://doi.org/10.1017/S0317167100042414

Decision letter

  1. Jeffrey Macklis
    Reviewing Editor; Harvard University, United States
  2. Catherine Dulac
    Senior Editor; Harvard University, United States
  3. Jeffrey Macklis
    Reviewer; Harvard University, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

Thank you for submitting your article "Pum2 and TDP-43 area-specifically modulate neuronal identity in mouse neocortex via bi-directional translational control" for consideration by eLife. Your manuscript has been reviewed by three peer reviewers, including Jeffrey Macklis as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)

Summary:

The authors investigate the role of post-transcriptional regulation by RNA binding proteins Pum2 and TDP-43 in defining area-specific cytoarchitecture and in specifying neuronal subtype composition within the primary somatosensory cortex (S1) and the frontal/motor cortex (FM). Specifically, the authors characterize the phenotypes of mice with Pum2 knockout in forebrain progenitors (Pum2 cKO) or those with over-expression of wild-type or ALS-causative human TDP-43 (hTDP-43 or hTDP-43 A315T). By combining genetics, immunostaining, and biochemical approaches, this interesting study proposes that a bidirectional mRNA translational control switch, driven by Pum2 and TDP-43, is important to control binary molecular programs that define the specialized neuronal identity and connectivity of cortical region S1.

Either Emx1-driven conditional Pum2 KO or human TDP-43 over-expression is reported to result in "motorization" of Layers V+VI of primary somatosensory cortex. While S1 in these mice retains features of normal arealization such as proper thalamic input, the authors find alteration of its laminar organization: expansion of layer V neurons with protein expression of subcerebral- and broader corticofugal-related transcription factors Sox5 and Ctip2, increased subcerebral projection, and reduction of layer IV neurons expressing Rorβ. The effect is area-specific, since FM remains normal. These results suggest that Pum2 and TDP-43 are necessary for establishment of the cytoarchitecture, but not area identity, of S1. Interestingly, the authors report unchanged Sox5, Ctip2, and paradoxically increased Rorβ mRNA expression in either PUM2 cKO or hTDP-43A315T mice, suggesting that Pum2 and TDP-43 might regulate Sox5, Ctip2, and Rorβ via translation control.

The authors also provide evidence that this effect may be due to direct Pum2 and TDP-43 translational regulation of target mRNAs Sox5, Ctip2, and Rorb. Polysome profiling on whole brain or S1-containing cortex shows a monosome-to-heavy-polysome shift for Sox5 and Ctip2 transcripts as evidence for their enhanced translation, as well as the opposite trend for Rorβ, in both E14.5 hTDP-43 A315T mice and P0 Pum2 cKO mice. The authors also report that Pum2 and TDP-43 interact physically with the three mRNA species. With these lines of evidence, the authors suggest that Pum2 and TDP-43 act as two opposing parts of a switch to regulate translation of subtype-specific regulators of S1 cortex downstream of arealization.

While this is an interesting study, and relatively novel in its question, there are several important points that would need to be addressed to support the conclusions of this study, which are at times not supported by the results, and often lacking statistical clarity.

Essential revisions:

The concept that both RNA binding proteins regulate cytoarchitecture specifically in the somatosensory cortex via translational regulation is quite novel and interesting. However, the data presented are insufficient to rule out other mechanisms in addition to and/or beside translational regulation by Pum2 and TDP-43, and there are a number of questions about data acquisition, data analysis, additional undiscussed phenotypes, selection of model mouse lines, among others. As such, the current submission is not suitable for publication without substantially modifying the claims and interpretations and/or undertaking substantial further experiments to investigate, assess, confirm, or rule out the role of transcription and/or splicing in the specific neurons under consideration, and to consider broader phenotypes seemingly not considered.

In addition, a more comprehensive introductory discussion of why these two RNA binding proteins were chosen for study and why the human over-expression mouse lines were employed instead of alternative options would be very helpful for readers, and important to understand the context and whether this work has conceptual specificity to these RBPs vs. broader implications of the reported mechanism(s)- either could be fine, but enabling the reader to understand would help.

In light of the COVID-19 pandemic and the shutdown of the majority of laboratories, all reviewers support extending revision time per the new eLife editorial policy during COVID-19 lab closures and limitations. We find that there might potentially be much of interest, but there is need for very substantial revision with new experiments, analyses, framing, and very likely reduced claims. That said, we see potential for seriously undertaking these major changes toward successful revision.

1. Do the expression patterns in M1/S1 of endogenous Pum2 and TDP-43 match the predicted model for a simple 'switch'? Are these two RBPs expressed in an area-specific manner that would support the overall model?

2. Why was human (as opposed to mouse) TDP-43 used in the over-expression studies? Although the data are supplemented by use of a WT allele in culture, justification for using a mutated human allele of TDP-43 in the first place was lacking. In order to evaluate the physiological role of TDP43 in regulating neuronal identity in specific areas of the cortex, would other models be more appropriate? Recently, several knock-in mouse models have been generated (Ebstein et al., 2019) which allow to studying disease-related mutations on TDP-43 function and the dose-dependent effect of mutant TDP-43. This line of experiments needs clarification and stronger motivation, and seems weaker than other lines of investigation, since it represents a human mutant protein-in-mouse over-expression experiment without any clear justification.

3. When over-expressing a human protein several issues require consideration. Constitutive over-expression (under the PRNP promoter) of a human protein could affect the downstream machinery of protein regulation, complicating the analysis on layer V subcerebral neurons. Also, a potential competition with the endogenous murine protein can occur. The authors have shown that one of the TDP43wt lines does not have a sustained expression of the human protein, and therefore is not suitable for their analysis. It appears that at least the other human wild type TDP43 overexpression L2 model, which shows instead a small, yet significant, difference in the number of Sox5 and Ctip2 in pS, should be used throughout as a reference to estimate the function of the wild-type human protein and the defects induced by the specific mutation. This is missing in most of the analyses of the manuscript. The manuscript should be restructured including this control line from the beginning, and clearly state what are the functional effects of over-expressed hTDP43 on layer V development, and what are the effects induced by the mutant ALS-related form. Connectivity effects in the L2 model should also be addressed.

4. An important point is that Emx1 is itself involved in neocortical area patterning (deletion of Emx1 can lead to motor area expansion). No stock number is given for the Emx-Cre line used, but a reference to Iwasato et al., 2000 would suggest this is the KI Emx1-Cre (Emx1 disruption allele). If so, the cKO mice in this study would also be missing one copy of functional Emx1. Can the authors show that the Emx-Cre transgene does not affect Emx1 levels? While Figure 1's supplement 5 partially addresses the concern about the Cre line, the data are limited (can neural connectivity by retrograde tracing data be shown for the constitutive Pum2 KO? This line of investigation is further motivated below.) and the effects of the Cre line itself on Emx1 mRNA/protein expression levels would be critical to know.

5. Since the determination of neuronal identity and connectivity are assessed by imaging-based measures, it would be important to use some form of unbiased stereological counting of the reported markers, as well as normalization to some unchanged cell marker to account for differences in staining/tissue quality between biological replicates. This concern applies more broadly across methods employed in multiple data analyses.

Manually Photoshop quantifications are extremely inaccurate when it comes to discriminating packed cell nuclei in particularly dense regions of the brain, such as upper layers of the somatosensory cortex in sections. An alternative, more suitable, ideally automated, method should be chosen (from the many available, free resources) for any quantification present in the manuscript, and consistency of the measurements should be assured when analyzing the different molecular markers in all the models and their controls.

6. Pum2 and TDP-43 have been shown to regulate thousands of mRNAs across many studies. Although this study reports that Pum2 and TDP-43 both bind directly to Sox5 and Rorb, these two genes themselves may not be the ones directly responsible for the proposed 'switch.'

7. Connected to this issue is another major concern, the seemingly over-simplistic suggested mechanism of action of these two RBPs. Upregulation of a few layer specific markers (individually estimated) upon over-expression of a mutant human protein (hTDP43 mutant) seems unlikely to explain a physiological modulation of a binary fate decision in neurons. Strong statements should therefore be toned down. It would probably be more faithful to the data to discuss the regulation of specific layer markers by RBPs, unless further analysis on the hTDP43 L2 or event murine ko/kI can support those statements.

On the other hand, to better define the time window of action, it would be really interesting to develop a strategy to revert the effect of Pum2 deletion and bring back the "normal" number of layer V Ctip2 and Sox5 and Rorb, and ideally their connectivity.

8. Related to the previous two points, can the authors provide any evidence that genes that are in turn regulated by Sox5 and Ctip2 are altered in expression by non-imaging-based measures? This would be a good addition to the imaging-heavy data and support the overall hypothesis.

9-25. Throughout the figures and related text, there are confusing aspects. The authors should improve the presentation of data in the figures, and clarify the numerous analysis, quantification, statistical, and other issues raised consistently by all three reviewers.

9. Figure 1: It is not clear why quantitation is to DAPI as opposed to a neuronal marker (e.g. NeuN+ cells), since it is in theory possible that glial cell numbers are changed. Also, not clear why Ctip2+ cell quantification is different across panels 1a and 1b. And is it true that only ~10% of DAPI+ cells would express Ctip2 in the F/M region as the quantitation (but not presented image) suggests in 1b?

10. The analysis of the different subtype and layer markers is not adequately organized. Why have different measurement criteria been used to quantify cell percentage in the layers for each marker in Figure 1 (% TF positive cells/dapi /bin vs cells FC increase/ ctrl)? From the images, it appears that there is an upregulation/ectopic expression of CTIP2 (as shown for Sox5 in bin 5) also in the upper layers of hTDP43A315T. Showing the data as is done for Sox5 would help clarify this. Tbr1 staining (shown in supplementary Figure1-4a) shows a small, albeit significant, increase in hTDP43A315T, which should be reported in a similar way. These data together, if confirmed by blinded / automated analysis as discussed above, might suggest an increased number of deep layer identity neurons with a concomitant decrease of RobB expressing neurons in P0 pS1 in both Pum2cKO and hTDP43A315T mutants.

11. Further raising question is that the statistical methods are not clear: How many litters have been analyzed? The legend states n=3 for each genotype. Are they all coming from one litter? How are the t-Test performed? Are the animals littermates? It would be useful to clarify to which comparison the asterisks refer in the graph. Again here, the proper control should be reported (ideally both hTDP43wt and NT).

12. Co-expression of Ctip2 and Sox5, at least in pS1, also would be interesting to understand the extent of increased number of layer V neurons in both models.

13. Also, the sections shown in Figure 1 (both pS and F/M) display a strong difference in cortical thickness in the mutants, especially in the hTDP43 A315T line. The quantification of the DAPI positive nuclei does not seem to reflect such evident differences, not even in bin 5 and 6 in pS for the hTDP43A315T line, where the differences appear to be striking. The higher cell density in the ULs is also clearly visible in Figure 2, where the increased thickness of hTDP43 A315T cortex also appears. Further raising question is that nuclei in both mutants also seem to be smaller.

14. Are the overall brains larger in experimentals (it appears so)? Gross morphological characterizations of the different models should be reported, ideally with histological staining (e.g. Nissl), both at birth. Cortical thickness quantification (which can be performed on DAPI staining too) would allow for a basic understanding of the overall cortical architecture, which is critical to fully interpret the results.

15. One major concern of the whole papers regards the controls. There are several independent mouse lines compared throughout the study (i.e. Pum2 conditional, Pum2 KO, hTDP43 A315T, hTDP43 wt, NT). It is important that littermates are compared, then, averaged data cross-compared with the other lines for developmental studies. It is unclear both in the figures and in the text what is considered control in each location. In the Methods, Pum floxed mice and NT are described as control, but in the figures (i.e. Figure 1) only one control is shown. How was this selected? The authors should clarify this in each case, and, when possible, add the proper internal control to each experiment.

16. Overall Figures 1-3 and associated supplemental figures: The characterization of area identity, cytoarchitecture, and axon projection phenotypes in experimental mice is qualitatively fairly convincing. The figures appear to show that Pum2 cKO or hTDP-43, wildtype or mutant, overexpression exhibit S1-specific laminar change: increase in Sox5+/Ctip2+ cells in layer V, decrease in Rorß+ cells in layer IV, and increase in subcerebral projections to the pons. In addition, S1 areal identity seems likely preserved, as the expression pattern of Lmo4 and Bhlhb5, "motor" and "somatosensory" area marker respectively, do not appear from the images shown to change, and neither does the stereotypical "barrel" pattern of thalamocortical innervation.

That said, in Figure 2, it would be helpful to combine retrograde labeling of SCPN with staining for the markers of interest, Sox5 and Ctip2, to test whether the increased retrogradely labeled neurons in S1 directly correspond with the increased number of Sox5+/Ctip2+ neurons.

17. However, area-specific layer markers such as Lmo4 and Bhlhb5, and even barrel analysis, are only qualitatively reported in Figure 3. Robust quantifications, as per Figure 1, are required with the appropriate controls to draw such a central conclusion for the overall story. It is also confusing that, while in the lower magnification panel a clear layer of Bhlhb5 positive cells appears to be present in Pum2 cKO F/M, in the magnified image, the TDP43A315T cortex instead shows Bhlhb5 ectopic expression in the deep layers.

18. There are no bidirectional data for either Pum2's or TDP-43's effects. To show genetic necessity and sufficiency, Pum2 over-expression and TDP-43 cKO experiments would be needed as well. Figure 4 demonstrates that overexpression of wild-type TDP-43 is sufficient to drive an increase in Layer V Sox5+/Ctip2+ neurons and a decrease in Layer IV Rorβ+ neurons in S1, and immediate transfection of wild-type or mutant hTDP-43 into E18.5 primary neuron cultures is sufficient to cause similar expression changes. When lab access allows, it would be interesting to directly test the in vivo sufficiency of TDP-43 over-expression to induce subtype change, as well as extending this assessment to Pum2 knockout. One could perform in utero electroporation (IUE) of either hTDP-43 or Cre (into a PUM2fl/fl background) to test whether the electroporated cells also misexpress Sox5, Ctip2, and Rorβ, and aberrantly project subcerebrally. Since the authors have positive results in E18.5 primary culture with hTDP-43 overexpression, and find evidence for Pum2 post-mitotic mode of action, this IUE experiment at E12.5 to hit both layer V and IV progenitors, or even E14.5 to test upper layer progenitors, would seem feasible and informative, and quick once labs are accessible. While not absolutely necessary for the scope of this study, such experiments would strengthen the interpretations, and the Discussion section should at least discuss these limits of interpretation.

19. Figure 4—figure supplement 1-2 show evidence for gain-of-function over-expression of TDP-43 in hTDP-43 transgenic lines. The authors should discuss the apparent expression pattern of hTDP-43 transgenes in the cortex in more depth: compared to hTDP-43 (line 1) or wild-type TDP-43, "hTDP-43 L2" and hTDP-43A315T seem to be expressed more highly in superficial layer neurons. Why is this the case, and why does this not cause Sox5, Ctip2, Rorβ expression in superficial layer neurons? In addition, the western blots show increased TDP-43 protein level in the nucleus but not in the cytoplasm, for both hTPD-43 A315T and hTDP-43 L2. The authors should discuss how these predominantly nuclear changes in TDP-43 expression affect Sox5, Ctip2, and Rorβ expression through translational control. Since global cytoplasmic TDP-43 levels are not statistically different, it is difficult to reconcile these results with a purely cytoplasmic (translational) mechanism. In this regard, it would be advised to substantially "soften" the title and text to acknowledge something like "at least partially via translational control", once new experiments are completed, and assuming that they confirm this.

20. In addition, these supplemental figures appear to be out of order and are quite confusing. Figure 4S2 would seem to better go before Figure 4S1, because it is mentioned first in the text. In particular, the immunostainings in Figure 4S2 should come first, as they provide the proper context for interpreting the rest of Figure 4. In addition, the associated text ("TDP-43 gain-of-function.… cell autonomously" result section) is confusing because the first hTDP-43 line doesn't have a distinct name. Perhaps better to list together all the names of the transgenic lines near the paragraph's beginning before phenotype description: "hTDP43-L1", "hTDP43-L2", and "hTDP-43A315T".

21. Figure 5 and Figure 5—figure supplement 1 examine steady-state mRNA levels of Sox5, Ctip2, Rorβ, and Fezf2 with either smFISH in P0 S1 or qRTPCR in E14.5 cortical lysates. The data currently do not convincingly rule out the possibility of mRNA level changes of these transcripts (another of multiple reasons identified by all three reviewers to soften the interpretation, text, and title). Although not statistically significant, there is a trend toward higher Sox5 and Ctip2 signal. In addition, smFISH is likely not the most accurate method to quantify mRNA levels. One option for a more quantitative experiment that is area and layer specific would be to use at least relatively layer V or IV-specific Cre-driver (such as Rbp4-Cre for layer V1), micro-dissect S1, sort labeled neurons, then examine expression in them via qRT-PCR. Further investigation of potential mRNA expression changes of these genes in the appropriate neurons is critical because an alternative hypothesis explaining the change in mRNA association with heavy polysomes seen in Figure 6 is that there are simply changes in the number of neurons expressing the genes, rather than the translational efficiency of the mRNAs in S1. This alternative would essentially negate/substantially reduce the central claim of the manuscript, so more deeply investigating that alternative would seem to be critical, not an incremental "bell or whistle". All reviewers concur that substantial experiments need to be performed to confirm and/or refute aspects of the interpretations and conclusions presented.

22. Figure 6 and Figure Supplements infer the translational status of Sox5, Ctip2, and Rorβ mRNA of interest by testing the association with heavy polysomes. They show increased association for Sox5 and Ctip2, and decreased association for Rorβ, in both E14.5 hTDP-43A315T whole cortex and P0 Pum2 cKO micro-dissected S1 cortex. Interestingly, no changes were seen in E14.5 Pum2 cKO cortical lysates. Overall, the effects seen are quite weak, and likely represent only modest changes in the global translational output from these mRNAs. In addition, there are several concerns over the design of this experiment. First, as a bulk assay, it does not address whether translational regulation of the transcripts specifically occurs in the neuron population of interest. Second, there is circular logic regarding Sox5 and Ctip2: the change in the laminar composition of the cortex might result in increased association with heavy polysomes without any translational regulatory mechanism simply because there are more cells expressing these genes. For Rorβ, the paradoxical increase in mRNA and decrease in heavy polysome association is a more likely case of translational control. Third, there is a possibility that some transcripts found in heavy polysome fractions do not actually associate with translating ribosomes, but co-sediment because of association with other ribonucleoprotein complexes (a valid concern given Pum2 and TDP-43 function as RNA-binding proteins that possibly form large RNA-protein granules). It would be optimal to add a control in the experiment to ensure that Sox5, Ctip2, and Rorβ are truly engaged by ribosomes. Adding puromycin as a polysome disruptor prior to profiling will shift bona-fide translated transcripts toward lighter ribosome fractions. This is likely to be possible in the coming months.

How do the authors explain the paradoxical effect of Rorb RNA and protein levels? Why do they exclude that the Pum2 and TDP43 could have a role in regulating the amount of Rorb RNA available in the neurons? In addition, despite not being significant, both Sox5 and CTIP2 appear to show a trend of increase. How many replicates were analyzed, and how many litters? It does not seem conclusive, and additional points should be added to finalize the quantification and investigate RNA level involvement.

23. A more direct test of translational regulation, likely beyond the scope of this paper, would be to perform the PUM2 cKO or hTDP-43 overexpression experiments in a "RiboTag" (RPL22-HAfl/fl) background. One could express tagged ribosomes in either layer V or layer IV through specific Cre drivers, immunoprecipitate the tagged ribosomes, then compare ribosome association with the mRNAs of interest between experimental mice. This could be done or at least discussed.

24. A key limitation and missed opportunity of the manuscript is the lack of attention given to alternative splicing and isoform-specific translational regulation. Figure 6 – Supplement 1 shows the importance of this consideration. The figure explores the expression of various 3' UTR variants of Sox5, Ctip2, and Rorβ, finding multiple isoforms expressed at significantly different levels in the wildtype cortex. Surprisingly, considering TDP-43 is reported to be a key splicing regulator (2,3) and TDP-43 binding sites are found on the transcripts of interest, there is no analysis of possible alternative splicing in TDP-43 over-expression in this manuscript. It is possible that differential isoform usage of subtype identity regulators might be the/a mechanism underlying the expansion of layer V/shrinkage of layer IV. Related to this, the qPCR experiment performed on different polysome fractions to determine the translational status of mRNAs frequently contains results from only one isoform-specific primer set (Figure 6c, d). In Sox5's case, "S4" primers capture the longest- but also the least abundant- isoform. Hence, it is possible that the shift to heavy polysome found in Sox5 and Ctip2 is only valid for one isoform, and not the global transcript population. It is also entirely possible that translational control exists, but acts in an isoform-specific manner. However, the current manuscript does not explore this important topic at all, nor seem to really acknowledge or engage it.

25. Figure 7 demonstrates that both TDP-43 and PUM2 proteins localize to the cytoplasm along with the mRNAs of interest in the cortex, and that these proteins specifically associate with the mRNAs of interest in cortical, cytoplasmic lysates. RNA IP experiments are notoriously noisy, and while the authors controlled for enrichment over IgG and no UV conditions, the most appropriate control would be to establish a baseline of IP in PUM2 cKO cortices or wild-type mouse cortices not expressing hTDP-43. Perhaps more importantly, some discussion of prior literature on PUM2 and TDP-43 interactions with these mRNAs of interest (especially relevant CLiP experiments (2-4)) would be a helpful addition. These articles are cited, but their results are not discussed in comparison to the present study's UV-RIP experiments.

26. All reviewers identified apparent oversights or inadequacy in citation of several clearly relevant papers on related topics that set a context and foundation for elements of this work. Some are listed above when discussing related issues, and others are commented on below. These should be corrected:

26a. The manuscript should mention some previous papers that investigate area-restricted neuronal subtype specification; the manuscript now reads as if this has not been encountered previously, nor seemingly even considered. For example the transcription factor Bcl11a/Ctip1 regulates area-specific composition/proportions of neuronal subtypes: cortical Bcl11a/Ctip1 KO causes an increase in SCPN in sensory and visual cortex, but not in the motor cortex (5, 6). Cederquist et al., 2013 similarly addresses this issue re: Lmo4 control in rostral motor cortex (7). Discussing / incorporating these papers of course would not take away from the novelty of the current work, which focuses on post-transcriptional effectors of specification downstream of molecular-genetic (particularly transcriptional) control.

26b. Curiously, the authors omit Molyneaux et al., 2005 (8), the first report re: Fezf2 (then Fezl) and its control over Ctip2 and subcerebral identity/fate when they cite two later papers on p.11, line 24.

26c. The authors should provide more depth on the motivation for studying TDP-43 and PUM2 in arealization and cortical development specifically. Although these are "classic RNA binding proteins", the rationale for such a detailed look at these RNA binding proteins in particular is not fully explained in the Introduction and Discussion. One might assume that it is because of their connections with motor neuron disease/ALS, but this and/or other reasons should be made clear and explicit early in the manuscript. Also, the observation that both have similar reported cortical organization phenotypes, and both regulate the genes of interest, requires additional discussion regarding potential mechanistic overlap.

26d. In the Intro, the authors should acknowledge that there have been reports on the contribution of RNA-binding proteins in cortical cytoarchitecture such as FMRP (Altered cortical Cytoarchitecture in the Fmr1 knockout mouse, 2019, Frankie H. F. Lee, Terence K. Y. Lai, Ping Su and Fang Liu).

1. Glickfeld, L.L., Andermann, M.L., Bonin, V. and Reid, R.C. Cortico-cortical projections in mouse visual cortex are functionally target specific. Nature Neuroscience 16, 219-226 (2013).

2. Polymenidou, M. et al. Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nature neuroscience 14, 459-468 (2011).

3. Arnold, E.S. et al. ALS-linked TDP-43 mutations produce aberrant RNA splicing and adult-onset motor neuron disease without aggregation or loss of nuclear TDP-43. Proceedings of the National Academy of Sciences of the United States of America 110, E736-E745 (2013).

4. Tollervey, J.R. et al. Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nature neuroscience 14, 452-458 (2011).

5. Greig, L.C., Woodworth, M.B., Greppi, C. and Macklis, J.D. Ctip1 Controls Acquisition of Sensory Area Identity and Establishment of Sensory Input Fields in the Developing Neocortex. Neuron 90, 261-277 (2016).

6. Woodworth, M.B., Greig, L.C., Liu, K.X., Ippolito, G.C., Tucker, H.O., and Macklis, J.D. (2016). Ctip1 Regulates the Balance between Specification of Distinct Projection Neuron Subtypes in Deep Cortical Layers. Cell Rep. 15, 999-1012.

7. Cederquist GY, Azim E, Shnider SJ, Padmanabhan H, Macklis JD. (2013). Lmo4 establishes rostral motor cortex projection neuron subtype diversity. J Neurosci. 2013; 33(15): 6321-6332.

8. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD. Fezl is required for the birth and specification of corticospinal motor neurons. Neuron 2005; 47: 817-831.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Pum2 and TDP-43 area-specifically modulate neuronal identity in developing mouse neocortex via post-transcriptional and post-mitotic mechanisms" for further consideration by eLife. Your revised article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Catherine Dulac as the Senior Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

After open discussion between the three reviewers, taking into consideration both (1) the balance of the importance of the work presented vs. its relatively less critical remaining shortcomings and (2) the experimental complexities of the pandemic, the reviewers all agree that this paper should be published with modifications to the text in appropriate sections to address those remaining shortcomings. The reviewers all agree that the authors performed the majority of requested experiments, and provided a highly thoughtful, comprehensive, and insightful response to the initial reviews, addressing most things well. The authors provided a substantial amount of new data in the revised manuscript, despite the difficult times, and these new data address most of the concerns initially raised by all three reviewers. Overall, all reviewers agree that this study addresses novel and significant questions, and presents experiments and data that will motivate further study in the field.

However, the reviewers also agree that the authors should soften some statements (as pointed out in reviewer comments), especially about (1) neuronal identity definition, (2) direct control over neuronal diversification, (3) whether there might also be transcriptional control occurring, in addition to translational control. That said, we agree that the polysome profiling and smFISH experiments in Figure 8 do address the transcriptional vs. translational contribution question to a reasonable degree. The reviewers all request that the authors temper their language regarding their interpretations and conclusions, and include consideration of some possible alternatives/complementary possibilities regarding their findings. This softening and "toning down" of the absoluteness of these and a few other claims would provide the gentle re-framing necessary to be admirably publishable in eLife.

The authors should also address the other issues raised in the reviews, whether in one case about the author list by direct communication to the handling editor, or within the manuscript itself.

The authors' additional work and revision substantially solidified an already novel and interesting project, and will be an important addition to the literature. While some aspects still remain partially open to further experimentation and solidification, all reviewers agree that, overall, the work presented will enable and inspire other interesting studies in the field.

Essential revisions:

The reviewers also agree that the authors should soften some statements (as pointed out in reviewer comments), especially about:

1) Neuronal identity definition;

2) Direct control over neuronal diversification;

3) Whether there might also be transcriptional control occurring, in addition to translational control.

The reviewers also all request that the authors

4) Temper their language regarding their interpretations and conclusions, and include consideration of some possible alternatives/complementary possibilities regarding their findings.

Reviewer #1:

This is a substantially revised manuscript, with major effort evident to address the limitations and reviewer criticisms raised in initial review. The authors performed the majority of requested experiments, and provided a highly thoughtful, comprehensive, and insightful response to the reviewers.

However, while the authors have convincingly demonstrated translational modulation of Sox5, Bcl11b, Rorb by Pum2 and TDP-43, they did not rule out transcriptional regulation as the or a root cause – in particular, they did not perform the suggested experiments to investigate whether there might be transcriptional changes that might drive regulation of these proteins' abundance in developing layer IV/V.

This is a serious oversight, as it potentially undermines the entire claim of "post-transcriptional" regulation. While there is not sufficient evidence to claim Pum2 and TDP-43 function in appropriate S1-specific laminar organization via post-transcriptional control instead of regulation of steady state levels of their target mRNAs, the post-transcriptional effect per se is novel, and will be worthy of reporting once the possibility of transcriptional regulation is properly investigated. For this pivotal reason that could potentially undermine the central conclusion, this manuscript is not currently publishable in eLife.

Specific Comments:

Authorship: Denis Jabaudon was listed as an author on the first submission, but not this revision, yet author contributions from "DJ" are listed in this revision. There is no other author with initials DJ. Is Denis Jabaudon no longer an author on the paper intentionally, but included in the author contributions? What is the explanation? Do we know that he requested to be removed as an author? If so, why? If not, why was he removed? Are there any disagreements among the initial author list in terms of interpretations of the data or approach to this revision? Since authorship is conventionally "earned", it is of note that an authorship has been revoked or deleted for any reason following initial submission.

Line 182: Possible typo: "hippocampal significant staining", should this be e.g., "significant hippocampal staining"?

Figure 4: Satisfies the request for co-localization of retrolabeled SCPN with new Sox5+ and Bcl11b+ cells in layer IV. Would be best to also perform a quantification of Sox5+ SCPN-label+ and Bcl11b+ SCPN-label+ double positive cells per bin as done for Sox5+ Bcl11b+ in Figure 4a.

Figure 5 description in Results section "Somatosensory area identity.… being "motorized": A more precise description of Lmo4 and Bhlhb5 expression patterns in experimental mice is needed, since the patterns do not seem to be "fully wildtype". By acknowledging up-front subtle differences, then highlighting specific evidence showing distinct and unmixed pS and F/M areal identities, the authors could put readers' minds at ease and prevent them from getting distracted from the main argument. The authors' response to reviewer comment 17 would be well suited here, thus could be considered for incorporation into the text.

Figure 7: IUE of either Cre-GFP in a Pum2fl/fl background, or hTDP43-GFP constructs under NeuroD promoters, at E13.5 demonstrate increased Sox5+ or Bcl11b+ cells among the electroporated neurons (mostly layer IV or upper layer neurons in WT or Cre- conditions), and a decrease in Rorb+ neurons. This is consistent with the previous observations using Pum2 cKO or TDP-43 transgenic lines, and a direct test of the model that these RNA binding proteins regulate the relative proportions of cortical lamina. We understand that the authors were unable to perform E12.5 IUE successfully; this is a difficult experiment, and E13.5 IUE seems acceptable given the developmental timing of layer IV differentiation.

Is there is a change in axonal connectivity toward subcerebral projection of the electroporated population that is consistent with an increase in the number of cells expressing Sox5 and Bcl11b, and consistent with the retrograde labeling result? Such an "optional" analysis could make the manuscript more complete, and could be done relatively easily (perhaps especially so if the authors have saved extra samples for tissue processing and microscopy).

Figure 8: Initial review raised concerns that the smFISH method used to quantify Sox5 and Bcl11b mRNA expression in Pum2 cKO or TDP43A315T lines is not accurate. The current figure quantifies expression using the metric "mRNA dots/DAPI cells". However, the FISH signal does not appear to be especially dot-like, and the numbers imply multiple dots per cell, when it looks like the signal largely fills most of the cell. Might this quantification be more appropriate by defining cell positions, integrating fluorescence intensity within a cell, and then comparing the distributions of intensities?

Figure 9 and supplements: The authors' investigation of potential differences in Sox5, Bcl11b, Rorb splicing and 3' UTR usage is admirable. That said, the suggested investigation of isoform-specific translational regulation would not require a "tour de force of multi-omic data integration"; the authors could simply repeat their qPCR analysis of their existing polysome profiles with their isoform-specific qPCR primers, and test if any isoforms show changes in the % of each isoform in the gradients, as is done in Figure 9 without isoform-specific primers. The authors' inclusion of a detailed explanation of polysome profiling analysis and quantification is also a positive; this is very helpful to the diverse audience for this paper, and for interpreting the translational changes.

However, the authors did not perform suggested and critical experiments focusing on quantifying Sox5, Bcl11b, and Rorb mRNA levels in layer IV/V, citing difficulties obtaining layer-specific Cre-driver lines, e.g. Rbp4-Cre for layer V or Rorb-Cre for layer IV, as well as difficulties obtaining sorter facility access due to COVID restrictions.

Although unfortunate and understandable that this might require a longer revision period, this is a serious limitation. Initial review was very clear that these sets of experiments are crucial for full interpretation of the hypothesis of post-transcriptional regulation by Pum2 and TDP-43. It is both very conceivable and very possible that these proteins actually act primarily by regulating the mRNA abundance of the relevant mRNAs in the subtypes of interest, and the observed translational effects are merely secondary. The only cell population-specific evidence the authors present to argue against transcriptional regulation is the smFISH experiments in Figure 8, which are improved, but remain semi-quantitative at best, and thus insufficient to rule out transcriptional effects.

If Cre-lines experiments remain overly challenging, the following experiment could be performed: layer V and layer IV neurons have different "birthdates", and can be labeled by BrdU incorporation at different developmental times. It is likely that in the Pum2 cKO, and hTDP-43 lines, there is a shift toward increased layer V specification at the times that typically yield layer IV neurons. The authors could perform a BrdU labeling experiment at E13.5-E14.5, and (1) look to see whether there is an increase in BrdU+Sox5+ or Bcl11b+ at P0, and decrease in BrdU+Rorb+ cells by immunofluorescence in Pum2 cKO and/or hTDP-43 lines, and (2) FACS-purify the BrdU+ cells, and perform qRT-PCR for Sox5, Bcl11b, and Rorb. This experiment should take only a few weeks to complete, requires no Cre driver lines to be imported, and requires no specialized procedures.

In summary: the polysome profiling experiments demonstrate translational regulation of Sox5, Bcl11b, and Rorb in the developing cortex in Pum2 cKO or hTDP-43 overexpression mice compared to wild-type. However, this could be primarily due to transcriptional regulation, and only secondarily with translation effects. To be able to claim "bona-fide" post-transcriptional regulation, the authors would need to rigorously test the alternative hypothesis that Pum2 and TDP-43 regulate mRNA abundance of the genes of interest in the relevant cells. The evidence presented (smFISH) fails to rigorously test this hypothesis. The central conclusion of manuscript relies on this, and would fall apart if the alternative were the case, so the current set of experiments is incomplete without such rigorous tests of the alternative hypothesis.

Reviewer #2:

The authors have adequately addressed all of my points, and I support publication of this revised manuscript.

Reviewer #3:

The revised manuscript by Harb and colleagues has greatly improved and few key new experiments in support of the cell autonomous effect of the RBPs on the translational regulation of Bcl11b, Sox5 and Rorb. In particular, the IUE data as well as the colabeling analysis of Sox5 and Bcl11b, coupled with the in vitro neuronal culture, provide strong evidence for the control that Pum2 and TDP43 exert on these key players of neuronal diversification during corticogenesis.

Nevertheless, some important points raised in the first review have not been fully addressed and leave the reader still puzzled by the interpretations of some analyses.

In particular, the authors' choice of using the TDP43 mutant line is still problematic: while determining whether early developmental defects might contribute to the aetiology of neurodegenerative diseases is a compelling and very timely question – as numerous studies have recently been published along these lines – it is still unclear to me the link between translational regulation in area identity acquisition and the disease-associated mutations. This becomes even more puzzling when considering the chosen line does not develop ALS symptoms and therefore does not represent a true "disease model". Moreover, as previously requested in the reviews, the most suitable control line for the experiments involving the mutant line would have been the TDP43 wild type overexpression mouse model. If the goal was to address the effect of the disease-associated mutation any effect of the mutant line should have been properly assessed and 'normalised' to the wild type line, which – as stated by the authors in the revised manuscript – shows a milder alteration; if, on the other hand, the aim was to investigate the role of the control of TDP43 RPB on neuronal/area identity acquisition in the gain-of-function setting, the most appropriate line to be used should be the wild type line and not the mutant line, independently of the extent of the phenotype observed. The decision of the authors of not carrying along in allL the analysis the is therefore arguable and leaves the reader confused on the specific goals of the study.

Connectivity data: While the IUE experiments undoubtedly contributes to support a direct involvement of RBPs in the phenotypes observed by the authors and convincingly determine their control over canonical markers of neuronal subtypes, the lack of connectivity analysis in Pum2 ko as well as in the TDP43 wild type lines limit the finding to the cellular phenotypes. While convincing the data on the cKO and the mutant TDP43 lines, it might be risky to assume similar connectivity defects in the other contexts.

Rescue analysis: The rescue experiment in the Pum2 cKO or PumKO is not addressed at all, and according to the authors is beyond the scope of the study. We respectfully disagree with the authors about this point. Providing the rescue experiments, or at least attempting it with techniques that have been presented in the revised version of the manuscript like IUE, would have provided direct evidence for Pum2 to be sufficient for the expression of layer-specific markers in vivo, highlighting its physiological relevance in area-specific neuronal identity.

One last point still remains problematic in this reviewer's opinion and it concerns the statistical power of the majority of the analysis in the manuscript (a point already raised in the previous review and that according to the point-to-point response the authors claimed to have addressed). Most of the data (including new experiments and analysis) shown in Figure 1-7, 9-10 as well as in the supplementary figures have been performed on "3 replicates per genotype", and in some rare cases even two dot points are shown in the bar plots. There is no reference in the text about the number of litters or sex of the animals and in some experiments – like IUE – this choice of analysis and data collection might dangerously fall below standards and impact the significance of the results.

Ribosome profiling: the text related to these experiments has become significantly more clear and the logics of the different analysis can be easily followed in the description. However, it is unfortunate that no attempt to resolve the ribosome profiling at the population level (or at least at layer level, as already shown for RNA datasets in multiple publications) has been made by the authors in this revision. This would have provided stronger evidence to the mechanisms underlying the protein alteration and brought an additional level of novelty to the work that the bulk profiling analysis is currently lacking.

In addition, although greatly improved in the flow, the manuscript will still benefit from a more rigorous analysis and quantitative approach to better support the general claims. More specifically:

– The quality of the NeuN images shown in Suppl Figure 2 are strongly divergent and do not look quite comparable. Has there any technical problem occurred that could motivate these differences?

– The nissl staining analysis as presented in Supplementary Figure 3 does not bring relevant information about the cytoarchitecture of the different models, as originally motivated in text, as no quantitative morphometric analyses have been performed, remaining merely qualitative. The overall figure will benefit for additional and improved imaging; indeed, multiple matching sections need to be considered to address overall brain architecture at comparable anatomical levels; higher quality images (the sections seem damaged at the pia level, and it is hard to discriminate the canonical tissue features of the cerebral cortex) coupled by punctual analysis of the higher magnification will help determine whether the evident impairment of the hippocampus observed in Pum cko – not claimed by the authors – is confirmed. Given the area phenotype observed, a more detailed analysis of the internal capsule and the somatic morphology of subcerebral PNs in different areas would have been extremely relevant and is currently missing. As presented, the current figure does not bring definitive support to the interpretations reported in the text and for the phenotype described is key to confirm the overall cytoarchitecture of the cerebral cortex: in several panels, indeed, the cortical thickness of the images shown is not comparable.

In suppl. figure 7 there seem to be large differences in the overall cortical thickness where Pum2ko, ko and hz all show significant smaller cortices compare to the control.

Is this a matching problem, an unfortunate selection of the images or this line presents abnormalities in the cortical thickness? it is hard to conlcude such results from the data. It needs to be toned down.

– In the data reported about nuclear size, what cell types/layer is considered? no information are provided about where are those images shown in Figure suppl 2c are taken, neither if they represent any specific area of the cortex.

Rorb staining in Figure 1 shows a great level of variability among the controls of each mouse lines, which is puzzling considering that the same antibody has been used and an automatic counting method has been used. Do the authors have any explanation for this discrepancy? it is important to assess how reliable is the difference observed in this marker expression. Moreover, in this case the TDP43 control becomes key to use as a reference for the mutant line.

https://doi.org/10.7554/eLife.55199.sa1

Author response

Essential revisions:

The concept that both RNA binding proteins regulate cytoarchitecture specifically in the somatosensory cortex via translational regulation is quite novel and interesting. However, the data presented are insufficient to rule out other mechanisms in addition to and/or beside translational regulation by Pum2 and TDP-43, and there are a number of questions about data acquisition, data analysis, additional undiscussed phenotypes, selection of model mouse lines, among others. As such, the current submission is not suitable for publication without substantially modifying the claims and interpretations and/or undertaking substantial further experiments to investigate, assess, confirm, or rule out the role of transcription and/or splicing in the specific neurons under consideration, and to consider broader phenotypes seemingly not considered.

In addition, a more comprehensive introductory discussion of why these two RNA binding proteins were chosen for study and why the human over-expression mouse lines were employed instead of alternative options would be very helpful for readers, and important to understand the context and whether this work has conceptual specificity to these RBPs vs. broader implications of the reported mechanism(s)- either could be fine, but enabling the reader to understand would help.

In light of the COVID-19 pandemic and the shutdown of the majority of laboratories, all reviewers support extending revision time per the new eLife editorial policy during COVID-19 lab closures and limitations. We find that there might potentially be much of interest, but there is need for very substantial revision with new experiments, analyses, framing, and very likely reduced claims. That said, we see potential for seriously undertaking these major changes toward successful revision.

We would like to start by profusely thanking the reviewers, both for their general interest in and overall appreciation for the novelty and significance of our work, as well as for their extremely thorough reviewing of our submission and the many well-considered points they raised. We are happy to report that in the extended time for revision that was granted, we were able to address essentially all points, in the main via new experiments where this was relevant. There is certainly no doubt from our side that this manuscript has been greatly improved by all of their time and input!

The issue about needing a better explanation of the decision to focus on Pum2 and TDP-43 and selection of the specific lines also arises several times in different forms under the specific points. We added new text in the Introduction to indicate more clearly why we chose to focus on these RBPs and what broader implications the work could have. We hope the reviewers find the new text helpful in resolving this issue.

1. Do the expression patterns in M1/S1 of endogenous Pum2 and TDP-43 match the predicted model for a simple 'switch'? Are these two RBPs expressed in an area-specific manner that would support the overall model?

In both, the original and revised manuscript, we included data showing that these proteins are not expressed in an area-specific manner (Figure 1—figure supplement 8, Figure 10—figure supplement1). However, we do not see this as a prediction of a simple “switch”. We think it would be one possible simple explanation for a switch mechanism. Alternatives include e.g. area-specific post-translational regulation. Determining the exact mechanism will be challenging, as it is not due to simple differential expression. We see this as interesting future work well beyond the scope of this manuscript.

In addition, since the claim of a “simple switch” seemed to be a bigger general concern, we followed the suggestion to tone down this aspect. Specifically, we changed how we present the “translational switch” in the abstract, introduction, results, and discussion. We now present it as one interesting possibility that is consistent with our data, rather than as a central conclusion.

2. Why was human (as opposed to mouse) TDP-43 used in the over-expression studies? Although the data are supplemented by use of a WT allele in culture, justification for using a mutated human allele of TDP-43 in the first place was lacking. In order to evaluate the physiological role of TDP43 in regulating neuronal identity in specific areas of the cortex, would other models be more appropriate? Recently, several knock-in mouse models have been generated (Ebstein et al., 2019) which allow to studying disease-related mutations on TDP-43 function and the dose-dependent effect of mutant TDP-43. This line of experiments needs clarification and stronger motivation, and seems weaker than other lines of investigation, since it represents a human mutant protein-in-mouse over-expression experiment without any clear justification.

We understand all of the issues raised. It is important to appreciate that we did not choose human TDP-43 over mouse per se for our studies. We were interested in the idea that early developmental defects might contribute to etiology of neurodegenerative disease. Thus, our primary goal was to analyze this aspect of cortical development in an established model of the neurodegenerative disease ALS driven by a patient mutant allele of TDP-43. The specific lines used are established ALS models or control lines available from JAX. We already had them in the lab for other projects (e.g. Marques et al., 2020; Neelagandan et al., 2019), so we used them for this project as well and obtained the interesting results reported here.

While we appreciate that arguably more suitable models may have recently become available, we think repeating everything with new mouse models is beyond the scope of this manuscript. Presumably the main concern is that the results might be model-specific artifacts. In that case, we address this by explaining our controls more thoroughly and also with new experimental approaches (e.g. IUE – see completely new Figure 7 with these data).

We modified the text to clarify our choices and motivate this aspect better.

3. When over-expressing a human protein several issues require consideration. Constitutive over-expression (under the PRNP promoter) of a human protein could affect the downstream machinery of protein regulation, complicating the analysis on layer V subcerebral neurons.

This is obviously a possibility and therefore a caveat for all of the numerous published studies that use this approach, including those describing the ALS models and controls that we have used here.

On the other hand, we do not use this approach with Pum2, where we have a conditional knockout line and no overexpression of a protein from mouse or human. Thus, this caveat does not apply generally to the data that we present here. In our view, this suggests it is not likely to be the simplest explanation for the phenotypes.

Moreover, we found essentially the same phenotype of a Layer V SCPN molecular determinants increase and layer IV decrease in our IUE experiments. In these new experiments, we over-express hTDP-43 WT and mutant under the control of the pNeuroD promoter. This promoter is highly regulated and is specifically expressed in post-mitotic neurons. Thus, constitutive expression (such as with the Prnp promoter) is not required for the phenotypes with TDP-43 either. Altogether, we do not think the issue raised underlies the phenotypes.

Also, a potential competition with the endogenous murine protein can occur. The authors have shown that one of the TDP43wt lines does not have a sustained expression of the human protein, and therefore is not suitable for their analysis. It appears that at least the other human wild type TDP43 overexpression L2 model, which shows instead a small, yet significant, difference in the number of Sox5 and Ctip2 in pS, should be used throughout as a reference to estimate the function of the wild type human protein and the defects induced by the specific mutation. This is missing in most of the analyses of the manuscript. The manuscript should be restructured including this control line from the beginning, and clearly state what are the functional effects of over-expressed hTDP43 on layer V development, and what are the effects induced by the mutant ALS-related form. Connectivity effects in the L2 model should also be addressed.

We completely agree that this restructuring makes sense and have implemented it in the revised manuscript. Our apologies for any confusion.

We removed all sections regarding the hTDP-43 L1 line and kept only a single WT hTDP-43 line (hTDP-43 L2) which we moved to the beginning. Higher hTDP-43 cytoplasmic overexpression and major phenotypic aspects led us to choose this hTDP-43 over-expressing line in addition to the hTDP-43 A315T. Since primary neurons and in utero electroporations show similar phenotypes with both the WT and mutant allele, we chose to focus our additional analyses (regarding MA, connectivity, arealization, gross morphological features, RNA analysis, polysome profiling) using the hTDP-43 line alone to simplify the experiments and the presentation.

Unfortunately, new connectivity experiments were not possible. Due to the pandemic animal transfers are not as we expected. Moreover, to get the approval in house is not possible right now due to the slowdown of the bureaucratic paperwork, again due to the pandemic. Collectively, these factors made new assays with the Jabaudon lab impossible.

We explored alternatives and were initially excited that a colleague at the ZMNH had some expertise with CTB injection. Unfortunately, they were not familiar with injecting into sub-cerebral regions and lacked the ultrasound device typically used to guide these injections. Moreover, they would also need to obtain approval for these animal experiments, a process which has been proceeding even slower than usual due to the CoViD-19 pandemic.

In summary, while we see the added scientific value of performing these assays, they were logistically impossible even in the extended time-frame of this revision due to the CoViD-19 pandemic. On balance, we think we nevertheless were able to address most of the other key issues raised and hope that this specific aspect will not be considered essential for publication. We try to be clear in the revised text about what we have shown vis-à-vis connectivity.

4. An important point is that Emx1 is itself involved in neocortical area patterning (deletion of Emx1 can lead to motor area expansion). No stock number is given for the Emx-Cre line used, but a reference to Iwasato et al., 2000 would suggest this is the KI Emx1-Cre (Emx1 disruption allele). If so, the cKO mice in this study would also be missing one copy of functional Emx1. Can the authors show that the Emx-Cre transgene does not affect Emx1 levels? While Figure 1's supplement 5 partially addresses the concern about the Cre line, the data are limited (can neural connectivity by retrograde tracing data be shown for the constitutive Pum2 KO? This line of investigation is further motivated below.) and the effects of the Cre line itself on Emx1 mRNA/protein expression levels would be critical to know.

We thank the reviewers for reminding us that the Emx1::Cre line described in (Iwasato et al., 2000) is a disruptive knock-in at the Emx1 locus (we were aware). This raises the possibility that phenotypes in the Pum2 cKO line (but not hTDP-43 lines) might involve genetic interaction between full loss of Pum2 and the half genetic dose of Emx1 in these mice.

However, as the reviewers mention, we addressed this concern already in Figure 1, Figure Supplement 5 of our original manuscript (now Figure 1—figure supplement 7). There we showed – at least qualitatively – that Emx1::Cre; Pum2 fl/+ mice (i.e. Pum2 cKO heterozygotes) have no phenotype. Conversely, we also showed there that the Pum2 constitutive KO (with two WT Emx1 loci and no Cre transgene present) also shows the phenotypes seen with the Pum2-cKO line. In our view, these observations from our control experiments in our original manuscript are already reasonable evidence that Pum2-cKO phenotypes are not due to reduced dose of the Emx1 gene.

Consistent with these results, we did not detect a clear reduction in Emx1 mRNA or Emx1 protein levels in the Emx1::Cre line relative to littermate controls (Author response image 1).

Author response image 1

Moreover, we also addressed this issue by performing IUE experiments, as suggested under point 18 below. These results are presented in a completely new Figure 7. Briefly, introducing pNeuroD-Cre into the pS of Pum2fl/fl mice via IUE recapitulates the phenotypic effects on layer neuron identity seen in the cKO line. Obviously, these mice have two fully WT copies of the Emx1 locus.Together with the control experiments described above, we believe that these new data clearly demonstrate that reduced levels of Emx1 expression due to using this Emx1::Cre line are not an important factor for the phenotypes seen in Pum2-cKO mice.

Unfortunately, new connectivity experiments were not possible, for reasons described above. Accordingly, in the revised manuscript, we try to be careful about making general conclusions about effects on connectivity, since we were only able to show this with our “core genotypes” and not in every additional analysis. We hope reviewers will find our new presentation of these data to be fair, with the conclusions justified by the underlying data.

5. Since the determination of neuronal identity and connectivity are assessed by imaging-based measures, it would be important to use some form of unbiased stereological counting of the reported markers, as well as normalization to some unchanged cell marker to account for differences in staining/tissue quality between biological replicates. This concern applies more broadly across methods employed in multiple data analyses.

Manually Photoshop quantifications are extremely inaccurate when it comes to discriminating packed cell nuclei in particularly dense regions of the brain, such as upper layers of the somatosensory cortex in sections. An alternative, more suitable, ideally automated, method should be chosen (from the many available, free resources) for any quantification present in the manuscript, and consistency of the measurements should be assured when analyzing the different molecular markers in all the models and their controls.

We agree that automated counting is preferable in principle for many reasons. To address this issue, we first identified an automated counting workflow that seemed able to give proper discrimination, as mentioned by reviewers. We then reanalyzed most of our earlier imaging data using automated counting with an Image J-based workflow. Gratifyingly, the new, automated counting results are largely similar to those generated with manual counting and fully support all of our original conclusions. For the revised manuscript, we have updated many figures (Figures 1, 2, 4, 5a and 7 and Figure 1—figure supplement 2, 5, 6 and 9) with the new automated imaging quantification results and associated statistical analyses. We also include new text, particularly in the methods section describing our automated counting procedure in detail. Because the results with automated and manual counting were so similar in cases where we did both, and because packed cell nuclei problems do not apply for CTB labeled neurons, primary neurons in vitro or barrels number and because our 20x FISH mRNA dots could not be counted with our automated image J approach, we retained the manual counting results for certain figures (Figure 3, 5b, 6 and 8 and Figure 1—figure supplement 7). We make it clear in the methods which procedure was followed in each specific case.

6. Pum2 and TDP-43 have been shown to regulate thousands of mRNAs across many studies. Although this study reports that Pum2 and TDP-43 both bind directly to Sox5 and Rorb, these two genes themselves may not be the ones directly responsible for the proposed 'switch.'

It is certainly true that both proteins have been shown to bind to thousands of mRNAs. However, it has also been observed that only a much smaller subset of these mRNAs appears to be detectably regulated when the proteins are depleted or mutant versions are expressed. In any case, it could very well be that other mRNAs are involved in the regulation that we see. In the revised manuscript, we explicitly acknowledge this in the relevant sections.

That said, we think it is important to bear in mind that the examined mRNAs encode proteins that are themselves known to play important roles as transcription factors in driving fate changes – this is particularly true for Sox5 and Ctip2(Chen et al., 2008; Kwan et al., 2008; Lai et al., 2008). Overexpression of Rorβ alone is also sufficient to drive a Layer IV neuronal fate (Jabaudon et al., 2012; Nakagawa and O'Leary, 2003). Thus, if TDP-43 and Pum2 bind them directly and affect their translation in the cortex, this is consistent with a direct regulatory effect on mRNAs encoding proteins known to drive layer neuron fate. Moreover, we examined directly one possible alternative: an effect on the upstream regulator, FEZF2, and obtained data that show TDP-43 and Pum2 do not operate through this regulator. As mentioned already, in the revised manuscript, we now present the “simple switch” driven by translational control of these mRNAs as merely one interpretation consistent with our data.

7. Connected to this issue is another major concern, the seemingly over-simplistic suggested mechanism of action of these two RBPs. Upregulation of a few layer specific markers (individually estimated) upon over-expression of a mutant human protein (hTDP43 mutant) seems unlikely to explain a physiological modulation of a binary fate decision in neurons. Strong statements should therefore be toned down. It would probably be more faithful to the data to discuss the regulation of specific layer markers by RBPs, unless further analysis on the hTDP43 L2 or event murine ko/kI can support those statements.

We apologize for giving the impression that all conclusions were based on overexpressing a human mutant protein, but we also see this effect with WT hTDP-43 protein, consistent with the common belief in the field that the hTDP-43A315T mutant retains almost all WT function. In addition, we see these phenotypes with conditional loss of murine Pum2 (Pum2 cKO), which is the same strategy used by countless papers in the field. Moreover, we also see these effects cell-autonomously both in vivo by IUE (new figure 7) and, as reported in the original manuscript, in vitro with transfection of primary SA neurons (Figure 6).

We think a key issue is not how many other regulatory targets there might be, but could deregulation of these specific mRNAs be sufficient to explain the observed effects? As already mentioned above under point 6, the specific proteins deregulated are not merely “individually estimated markers”, but are themselves previously characterized to be important regulators of cortical neuronal identity in the relevant layers.

Nevertheless, we endeavored in the revised manuscript both to “tone down strong statements” and to incorporate the notion that other factors may also contribute. We hope the reviewers find the new presentation to be a fully accurate representation of the underlying data.

On the other hand, to better define the time window of action, it would be really interesting to develop a strategy to revert the effect of Pum2 deletion and bring back the "normal" number of layer V Ctip2 and Sox5 and Rorb, and ideally their connectivity.

We agree that these experiments would be really interesting, but find them beyond the scope of this manuscript.

8. Related to the previous two points, can the authors provide any evidence that genes that are in turn regulated by Sox5 and Ctip2 are altered in expression by non-imaging-based measures? This would be a good addition to the imaging-heavy data and support the overall hypothesis.

We performed new experiments with non-imaging methods to evaluate the levels of some downstream targets which are now presented in Author response image 2. Sox5 is known to repress Fezf2 expression until all layer VI neurons are born (Kwan et al., 2008; Lai et al., 2008). Our qRT-PCR of both Fezf2 and Ctip2 on both mutants doesn’t show any effect on their mRNAs (Figure 8-Figure supplement 1), suggesting a translational regulation of Ctip2 mRNA rather than transcriptional control through Fezf2 or Sox5. Sox5 and Sox6 are known to be cross-repressive (Azim et al., 2009) in cortical progenitors. We analyzed Sox6 mRNA by qRT-PCR in prospective somatosensory region of both Pum2 and TDP-43 mutants and found that Sox6 is significantly down-regulated in Pum2 cKO (consistent with increased Sox5 expression) but not in hTDP-43A315T (Author response image 2) suggesting possibly different timing actions and cell compartments (progenitors/post-mitotic neurons) for both RNA binding proteins. In addition, Ctip2 and Satb2, are known to negatively regulate Unc5C and DCC respectively to regulate sub-cerebral vs callosal axonal projections (Srivatsa et al., 2014). However our qRT-PCR analysis for Unc5C showed no significant changes in both mutants probably due to earlier regulation timing of Unc5C by Ctip2. These new data are now included as Author response image 2.

Author response image 2

However, as the reviewers themselves noted below, the non-imaging, biochemical approaches lack resolution and can potentially lead to false-negative results. Single-cell sequencing of sorted neurons would probably be an appropriate method to address this point, but we hope the reviewers will agree that this is beyond the scope of our current manuscript.

9-25. Throughout the figures and related text, there are confusing aspects. The authors should improve the presentation of data in the figures, and clarify the numerous analysis, quantification, statistical, and other issues raised consistently by all three reviewers.

We apologize to the reviewers for any confusing aspects. In the revised manuscript we thoroughly re-worked all figures and adjusted the text accordingly with the goal to present our data in a manner that is easier to follow and to clarify all issues raised by the reviewers.

9. Figure 1: It is not clear why quantitation is to DAPI as opposed to a neuronal marker (e.g. NeuN+ cells), since it is in theory possible that glial cell numbers are changed. Also, not clear why Ctip2+ cell quantification is different across panels 1a and 1b. And is it true that only ~10% of DAPI+ cells would express Ctip2 in the F/M region as the quantitation (but not presented image) suggests in 1b?

We agree with reviewers that normalizing to a neuronal marker is better than normalizing to DAPI cells. However, since normalizing to DAPI is much more practical than normalizing to NeuN given that NeuN staining is not only nuclear but cytoplasmic as well. Moreover, NeuN staining is not possible in many cases due to antibody species, it is very difficult for us to repeat stainings normalizing to NeuN. Based on our understanding of cortical development, we reasoned that there would be very few astrocytes present in the cortex at the stages analyzed (astrogenesis begins at E18.5-P0). It is also true that microglia infiltration is already taking place in utero; although, those cells are restricted to proliferative places and not in the cortical plate (CP) (e.g, Garcia-Marques and Lopez-Mascaraque, 2013; Ge et al., 2012). Therefore, we reasoned that most cells in the imaged field (CP) would be neurons. In theory, this might be different in our mutants as reviewers mentioned. To address this concern directly with new experiments, we performed new staining with GFAP as a glial marker and NeuN as a neuronal marker to examine whether we have a change in the % of neurons relative to glial cells at P0 in both Pum2 and TDP-43 mutants. As expected, we do not see much glial staining at this stage at baseline, and this is not altered in our mutant lines. This is not a technical issue, since we were able to detect robust glial staining in the hippocampus stained in parallel. Moreover, NeuN neuronal staining was colocalizing with the majority of cells in cortex of controls and mutants. We conclude that glia cells are unlikely to be a significant cell population in neocortical layers at this point in development and our mutant lines do not affect this. These new results are presented in Figure 1, Figure Supplement 2d. We think they support the validity of DAPI normalization.

For Ctip2, we only consider Ctip2 high-expressing neurons which are mainly in layer Vb in S1 and the thick layer V in M1. The % of high-expressing Ctip2+ cells to total number of DAPI cells in all layers is around 17% in M1 with our new automated counting. The problem with S1 is that the number is lower and is distributed in bin 3 and 4, and this distribution changes when cortical thickness changes along the tangential axis of the cortex. For this reason, we previously grouped bins 3 and 4 into layer V and normalized only to layer V neurons to better show the difference of a small population normalized to very high number of cells. In M1, both quantifications show no differences and we now present the results of the single bins. We understand the concern of the reviewers and to reduce variability in presenting our data between different markers, we changed our figures and represented all markers counting in different bins in main figure 1 and grouped in layer V or total in Figure 1—figure supplement 5. Importantly, all presentation methods shown at the end support our results and conclusions. (single bins, layer specific or total cells) and our primary source data are now submitted with the manuscript.

10. The analysis of the different subtype and layer markers is not adequately organized. Why have different measurement criteria been used to quantify cell percentage in the layers for each marker in Figure 1 (% TF positive cells/dapi /bin vs cells FC increase/ ctrl)? From the images, it appears that there is an upregulation/ectopic expression of CTIP2 (as shown for Sox5 in bin 5) also in the upper layers of hTDP43A315T. Showing the data as is done for Sox5 would help clarify this. Tbr1 staining (shown in supplementary Figure1-4a) shows a small, albeit significant, increase in hTDP43A315T, which should be reported in a similar way. These data together, if confirmed by blinded / automated analysis as discussed above, might suggest an increased number of deep layer identity neurons with a concomitant decrease of RobB expressing neurons in P0 pS1 in both Pum2cKO and hTDP43A315T mutants.

We apologize again for any confusing aspects of our analyses and their presentation. We always performed our analysis in 6 single bins, but as mentioned earlier, in the specific case of Ctip2 we previously grouped bin 3 and 4 to show clearly the effect on layer V, high-Ctip2 expressing neurons. We followed a similar approach for Tbr1 in layer VI (where we grouped bins 1, 2 and 3) and Cux1 for upper layers (bins 4, 5 and 6) because the expression of these genes is mainly restricted to these layers and grouping them may show a phenotype which cannot be observed in different bins due to variability of the binning system in sections with variable thickness across the cortical tangential axis.

We showed the Ctip2 increase as a fold-change compared to controls to better appreciate the differences in a small cell population normalized to all DAPI cells. We understand that this might be confusing and in our revised manuscript we always present the results in 6 bins for all markers (Figure 1,2 Figure 1-Figure Supplement 6), and present additionally either the total number of cells or layer-restricted analyses in supplementary figures (Figure 1-Figure supplement 5). Importantly, all presentation methods shown at the end support our results and conclusions.

Regarding Tbr1, in our original manual counting, we had a slight increase in the case of hTDP-43A315T mutants only when we grouped bins 1, 2 and 3 to present layer VI but not in single bins. In our repeated automated counting, we did not observe a significant change of Tbr1 in either mutant, irrespective of whether we grouped in single bins (as shown in Figure 1-Figure supplement 6) or as total or layer VI-specific (see original counting Tables submitted with the manuscript). We hope this adequately addresses this issue.

11. Further raising question is that the statistical methods are not clear: How many litters have been analyzed? The legend states n=3 for each genotype. Are they all coming from one litter? How are the t-Test performed? Are the animals littermates? It would be useful to clarify to which comparison the asterisks refer in the graph. Again here, the proper control should be reported (ideally both hTDP43wt and NT).

We regret that this crucial issue was not properly addressed in our initial submission. Of course we appreciate how important it is to use littermate controls for the comparisons and this is precisely what we did. In the revised manuscript, we now show a direct comparison of the mutant mice to their corresponding littermate controls with mainly 3 independent different litters in all figures. In some cases, we used more than 3 animals, in this case the number of animals can be seen in figures and we state “at least 3 or 4 or 5” in the legends. For both hTDP-43 lines we used non-transgenic littermates as controls. In the case of Pum2 cKO, we used Pum fl/fl, Cre-negative littermates as controls.

We perform our t-tests in Excel software according to the procedure indicated in our methods section. It is a standard two-tailed test apart from polysome profiling, where we did a 1-tailed T-test, since we already had a directional hypothesis, as mentioned in the methods. Our analyses can be reviewed in our primary data and analysis submission with the revised manuscript. We hope the asterisks in all graphs clearly indicate the relevant comparisons now.

12. Co-expression of Ctip2 and Sox5, at least in pS1, also would be interesting to understand the extent of increased number of layer V neurons in both models.

This is a very important point that we have effectively addressed with new experimental data. As shown in our new Figure 4a, we consistently observed statistically significant increase in the number of cells with co-expression of Ctip2 and Sox5 in all genotypes examined.

To further confirm the identity and connectivity of these neurons, we also performed either Sox5 or Ctip2 co-expression analysis together on the original CTB-labelling in the Pons for retrograde tracing of sub-cerebral projection neuron identity. This confirmed co-expression of all labelled neurons with Ctip2 or Sox5 in controls and in the case of both mutants, all retrogradely labelled neurons expressed Sox5 or Ctip2 as well and also the ones with altered connectivity in upper layer V, exactly as expected suggesting that the increase of Sox5 and Ctip2 colocalize with the increase of SCPN. These new experimental data address point 16 below as well and are presented in a new Figure 4b.

13. Also, the sections shown in Figure 1 (both pS and F/M) display a strong difference in cortical thickness in the mutants, especially in the hTDP43 A315T line. The quantification of the DAPI positive nuclei does not seem to reflect such evident differences, not even in bin 5 and 6 in pS for the hTDP43A315T line, where the differences appear to be striking. The higher cell density in the ULs is also clearly visible in Figure 2, where the increased thickness of hTDP43 A315T cortex also appears. Further raising question is that nuclei in both mutants also seem to be smaller.

We performed a number of additional new experiments to address these issues. Specifically, we measured cortical thickness in the different genotypes in somatosensory cortex (Figure 1-Figure supplement 2c). This did not reveal any significant differences between the experimental genotypes and their respective littermate controls. Analyzing the average thickness in at least 6 images of somatosensory cortex in at least 3 animals of each genotype showed no final significant change between different genotypes. We also increased the number of animals analyzed for DAPI staining in hTDP43 A315T mutants where we had big variability in our original data. Repeating these analysis with automated counting and higher animal numbers did not show any significant change in the number of DAPI cells in single bins or in total in the different genotypes (Figure 1, 2 and Figure 1-Figure supplement 5). We also checked the nuclei size with 60X high magnification images in high number of cells with Fiji and it showed a slight increase in the nuclei size in the case of Pum2 CKO but not A315T mutants. These data now appear in Figure 1-Figure supplement 2b.

14. Are the overall brains larger in experimentals (it appears so)? Gross morphological characterizations of the different models should be reported, ideally with histological staining (e.g. Nissl), both at birth. Cortical thickness quantification (which can be performed on DAPI staining too) would allow for a basic understanding of the overall cortical architecture, which is critical to fully interpret the results.

To address this issue we acquired bright-field images of full brains from controls and mutant animals and analyzed hemisphere length, width and area. This did not reveal any significant differences between the experimental genotypes and their respective littermate controls. These additional new data appear in Supplemental figure 1-Figure supplement 2a.

We also performed Nissl staining. This did not reveal any major morphological changes as far as we could tell. These additional new data now appear in Figure 1-Figure Supplement 3. Collectively, these new results presented together in new Figure 1—figure supplement 2 and 3 support our conclusion that overall cortical architecture is not altered in any of the mutant lines relative to littermate controls.

15. One major concern of the whole papers regards the controls. There are several independent mouse lines compared throughout the study (i.e. Pum2 conditional, Pum2 KO, hTDP43 A315T, hTDP43 wt, NT). It is important that littermates are compared, then, averaged data cross-compared with the other lines for developmental studies. It is unclear both in the figures and in the text what is considered control in each location. In the Methods, Pum floxed mice and NT are described as control, but in the figures (i.e. Figure 1) only one control is shown. How was this selected? The authors should clarify this in each case, and, when possible, add the proper internal control to each experiment.

This is related to point 11 above. Once again, we regret that this fundamental issue was not properly presented in our initial submission. Of course, it is crucial to use littermate controls for the comparisons and this is precisely what we did. For the revised manuscript, we now show a direct comparison of the mutant mice to their corresponding littermate controls in the quantifications of all figures.

Moreover, we have endeavored to make it absolutely crystal clear for every single figure in the legend and associated text exactly what animals were selected for controls in every single case. In multi-animal, qualitative images, we show only one representative control image to simplify presentation – not because we did not process the littermate controls in each individual case. For all quantifications in the revised manuscript, we have included the comparisons to the littermate controls in all analyses. We trust that this crucial issue has now been adequately and convincingly addressed by these changes.

16. Overall Figures 1-3 and associated supplemental figures: The characterization of area identity, cytoarchitecture, and axon projection phenotypes in experimental mice is qualitatively fairly convincing. The figures appear to show that Pum2 cKO or hTDP-43, wildtype or mutant, overexpression exhibit S1-specific laminar change: increase in Sox5+/Ctip2+ cells in layer V, decrease in Rorß+ cells in layer IV, and increase in subcerebral projections to the pons. In addition, S1 areal identity seems likely preserved, as the expression pattern of Lmo4 and Bhlhb5, "motor" and "somatosensory" area marker respectively, do not appear from the images shown to change, and neither does the stereotypical "barrel" pattern of thalamocortical innervation.

That said, in Figure 2, it would be helpful to combine retrograde labeling of SCPN with staining for the markers of interest, Sox5 and Ctip2, to test whether the increased retrogradely labeled neurons in S1 directly correspond with the increased number of Sox5+/Ctip2+ neurons.

We performed new experiments that we think effectively address this concern (see related point 12). Co-staining for Sox5 and Ctip2 co-expression together with CTB-labelling confirmed co-expression of Ctip2 and Sox5 in the neurons with altered connectivity, exactly as expected. These new experimental data are presented in a completely new Figure 4b.

17. However, area-specific layer markers such as Lmo4 and Bhlhb5, and even barrel analysis, are only qualitatively reported in Figure 3. Robust quantifications, as per Figure 1, are required with the appropriate controls to draw such a central conclusion for the overall story. It is also confusing that, while in the lower magnification panel a clear layer of Bhlhb5 positive cells appears to be present in Pum2 cKO F/M, in the magnified image, the TDP43A315T cortex instead shows Bhlhb5 ectopic expression in the deep layers.

Robust quantifications as per Figure 1of Lmo4/Bhlhb5 (using automated counting) are now included in the revised manuscript in Figure 5. Quantitative analysis of total number of Lmo4 and Bhlhb5 cells normalized to DAPI showed major significant differences between motor and somatosensory cortex in all genotypes, as expected, suggesting that the pS maintains its areal identity and doesn’t show an F/M identity.

Comparison of Lmo4 and Bhlhb5 analysis between controls and mutants in different bins and in total is not presented in figures, but is provided in the primary data counting table associated with manuscript. These showed no significant changes in Lmo4 and Bhlhb5 in the pS of Pum2 cKo compared to controls, but a significant increase of Lmo4 in bin1 and decrease of Bhlhb5 in bins 3 and 4 in hTDP-43 A315T. In the case of the motor cortex, an increase in Bhlhb5 has been observed in bin 6 of hTDP-43 A315T while Lmo4 has been unaltered in all bins. Instead Pum2 cKO didn’t show any change for Bhlhb5 but Lmo4 expression is decreased in bins 1 and 4. These differences do not affect our conclusion regarding the unchanged areal identity of pS or F/M.

Moreover, we performed a manual counting of barrels across different P7 sagittal sections of controls and mutants and showed no significant changes in the number of barrels. Conservation of the barrels in the somatosensory cortex both qualitatively and quantitatively further confirms our conclusion about the conserved identity of this area in the lines examined.

18. There are no bidirectional data for either Pum2's or TDP-43's effects. To show genetic necessity and sufficiency , Pum2 over-expression and TDP-43 cKO experiments would be needed as well. Figure 4 demonstrates that overexpression of wild-type TDP-43 is sufficient to drive an increase in Layer V Sox5+/Ctip2+ neurons and a decrease in Layer IV Rorβ+ neurons in S1, and immediate transfection of wild-type or mutant hTDP-43 into E18.5 primary neuron cultures is sufficient to cause similar expression changes. When lab access allows, it would be interesting to directly test the in vivo sufficiency of TDP-43 over-expression to induce subtype change, as well as extending this assessment to Pum2 knockout. One could perform in utero electroporation (IUE) of either hTDP-43 or Cre (into a PUM2fl/fl background) to test whether the electroporated cells also misexpress Sox5, Ctip2, and Rorβ, and aberrantly project subcerebrally. Since the authors have positive results in E18.5 primary culture with hTDP-43 over-expression, and find evidence for Pum2 post-mitotic mode of action, this IUE experiment at E12.5 to hit both layer V and IV progenitors, or even E14.5 to test upper layer progenitors, would seem feasible and informative, and quick once labs are accessible. While not absolutely necessary for the scope of this study, such experiments would strengthen the interpretations, and the Discussion section should at least discuss these limits of interpretation.

We separately address the two concerns raised, bidirectionality and IUE.

Bidirectionality: It is true that we have not addressed bi-directionality in the genetic sense – by overexpressing and knocking out both TDP-43 and Pum2 and seeing opposite phenotypes. However, we do not claim to have done so or interpret our data as if we did. We agree that these experiments would be informative, but do not view their absence as a major flaw.

It occurred to us that this issue might have arisen because we referred to “bidirectional translational control” in the original title and text. For R1, we have modified the title and text to remove any references to bi-directionality and found a different way to describe the fact that we find evidence that Pum2 and TDP-43 can both repress and activate translation of specific mRNAs, a point that we consider important and worth highlighting.

IUE assays: To address this point we performed IUE experiments in collaboration with the group of Dr. Froylan Calderon de Anda at the ZMNH. The specific IUE injections performed and results are briefly described here. We started by electroporating wild type mice at E12. as requested either with pNeuroD-GFP or with pNeuroD-hTDP-43 or pNeuro-hTDP-43A315T coupled with T-dimer. However, we didn’t have any success with these electoporations since we didn’t see any GFP positive brain from this stage. Even when we co-electroporated with Tdimer, we didn’t detect any Red fluorescent brains apart in very few cases where electroporated red cells didn’t show as well any green expression. This suggest either that the hTDP-43 over-expression at this stage is toxic and is leading to cell death, or that pNeuroD expression is almost undetectable when electroporated at E12.5 or both. For this reason, we made our IUE at early E13,5, the peak time of birth of layer V neurons (see new Figure 7) versus IUE at late E14,5 to hit mainly upper layer progenitors (Figure 7—figure supplement 2) which both worked very well. Also, since our phenotype is on layers IV and V, we think E13.5 is a suitable stage for our analysis. Our in utero electroporations at E13,5 yielded in vivo data for both hTDP-43 and hTDP-43A315T electroporation that were strikingly congruent with those obtained via in vitro transfection of primary neurons. Moreover, by introducing Cre recombinase into the Pum2 fl/fl background under the control of the pNeuroD promoter at E13.5, we also found upregulation of Sox5 and CTIP2, as well as downregulation of Rorβ (See new Figure 7). These data are completely consistent with the data obtained in Pum2-cKO and KO mice. These new data are presented in a new main figure 7 and Figure 7—figure supplement 1 and 2 and their implications are discussed in corresponding text sections.

We find it worth emphasizing here that these experiments were actually considered “optional” by the reviewers. Moreover, while they were certainly feasible and informative, they were definitely not “quick”. We first had to apply for animal experiment approval from the relevant authorities in order to be allowed do these experiments at all. This is normally a time-consuming process under the best of circumstances, but it proved even more challenging during the pandemic: it took >6 months to get approval.

Challenges notwithstanding, we are glad we decided to delay resubmission for these assays, since we believe results from IUE experiments significantly strengthen our conclusions in a number of important ways. First, they demonstrate direct cell-autonomous fate-switching in pS driven by either the absence of Pum2 or the overexpression of TDP-43 (WT or the A315T patient mutant). In addition, the genes expressed in these assays were under control of a post-mitotically activated promoter in pNeuroD, which should not be active in progenitors (Guerrier et al., 2009). Thus, these experiments strongly suggest that these proteins act cell autonomously and post-mitotically in newly born neurons to control cell-fate in pS. This is a completely new observation for both proteins, whose roles have previously only been examined and interpreted in the context of effects in neural progenitors.

Finally, as a completely orthogonal assay performed in WT mice, our IUE results also address many of the specific concerns raised above about whether phenotypes might potentially be artifacts related to the specific mouse lines used. We clearly see the same phenotypes with IUE in a WT background, so they are certainly not line-dependent artifacts.

When we performed IUE of either pNeuroD cre in Pum2 flox or hTDP-43 or hTDP-43 A315T in wt animals, none of the mentioned experiments resulted in a change of fate in upper layer neurons. This is consistent with our in-vivo analysis of Pum2 CKO and hTDP-43 mutants. None of them showed a phenotype in upper layer neurons suggesting both, an area specificity and layer specificity of the function of our RBPs. Even though they are expressed ubiquitaryly in most cortical cells, they act specifically on the interface between layers IV and V of the somatosensory cortex, leading to the fine adjustment of the thickness of layers IV/V in the somatosensory cortex with respect to its function. One interpretation could be that both, Pum2 and TDP-43 functions, are controlled by an early upstream regulator of area and layer identity.

19. Figure 4—figure supplement 1-2 show evidence for gain-of-function over-expression of TDP-43 in hTDP-43 transgenic lines. The authors should discuss the apparent expression pattern of hTDP-43 transgenes in the cortex in more depth: compared to hTDP-43 (line 1) or wild-type TDP-43, "hTDP-43 L2" and hTDP-43A315T seem to be expressed more highly in superficial layer neurons. Why is this the case, and why does this not cause Sox5, Ctip2, Rorβ expression in superficial layer neurons? In addition, the western blots show increased TDP-43 protein level in the nucleus but not in the cytoplasm, for both hTPD-43 A315T and hTDP-43 L2. The authors should discuss how these predominantly nuclear changes in TDP-43 expression affect Sox5, Ctip2, and Rorβ expression through translational control. Since global cytoplasmic TDP-43 levels are not statistically different, it is difficult to reconcile these results with a purely cytoplasmic (translational) mechanism. In this regard, it would be advised to substantially "soften" the title and text to acknowledge something like "at least partially via translational control", once new experiments are completed, and assuming that they confirm this.

Two separate issues are raised. One relates to upper layer expression and lack of phenotypes there. The other centers on the apparent absence of increased steady-state levels of TDP-43 in the cytoplasm and how this can be compatible with translational effects. We address each below, beginning with the issue of cytoplasmic overexpression.

We now observe increased TDP-43 in the cytoplasm, consistent with effects on translation

We repeated these immunoblots to enable a direct comparison of controls to hTDP-43 L2 and hTDP-43 A315T and removed hTDP-43 L1. Our new WB experiment presented now in Figure 1-Figure supplement 8 shows a significant increase in both cytoplasmic and nuclear expression of total (m+h) TDP-43. Overexpression of TDP-43 in the cytoplasm of both transgenic lines is consistent with regulatory effects in this compartment (e.g. on translation).

Transgene expression in upper layers – why no phenotype there?

We adjusted the text to better describe the apparent expression pattern of the transgenes. This point (regarding no phenotype in UL) is discussed just above and confirmed by our IUE at E14.5.

20. In addition, these supplemental figures appear to be out of order and are quite confusing. Figure 4S2 would seem to better go before Figure 4S1, because it is mentioned first in the text. In particular, the immunostainings in Figure 4S2 should come first, as they provide the proper context for interpreting the rest of Figure 4. In addition, the associated text ("TDP-43 gain-of-function.… cell autonomously" result section) is confusing because the first hTDP-43 line doesn't have a distinct name. Perhaps better to list together all the names of the transgenic lines near the paragraph's beginning before phenotype description: "hTDP43-L1", "hTDP43-L2", and "hTDP-43A315T".

We grouped both Figure 4 S1 and S2 into a single Figure 1-Figure Supplement 8 and presented the staining data before the western blot as requested.

We also decided to remove the L1 line from the manuscript entirely, since it became superfluous with new L2 data and new data from IUE experiments. This should simplify things and reduce confusion.

21. Figure 5 and Figure 5—figure supplement 1 examine steady-state mRNA levels of Sox5, Ctip2, Rorβ, and Fezf2 with either smFISH in P0 S1 or qRT-PCR in E14.5 cortical lysates. The data currently do not convincingly rule out the possibility of mRNA level changes of these transcripts (another of multiple reasons identified by all three reviewers to soften the interpretation, text, and title). Although not statistically significant, there is a trend toward higher Sox5 and Ctip2 signal.

To obtain more convincing data addressing this important point, we performed additional qRT-PCR assays with a new cohort of mutant mice and littermate controls in pS at P0 and increased the number of animals used (n = 4-6, Figure 8a,b). In our updated figure with these additional data, we find no evidence for a trend toward mRNA-level changes (presented now in Figure 8). We hope the reviewers will agree that these new data fully support our conclusion that there is no significant difference in the mRNA levels for Sox5, Ctip2 or Rorβ in the samples examined.

In addition, smFISH is likely not the most accurate method to quantify mRNA levels.

Despite its limitations, other investigators have used this approach in published studies (e.g. Zahr et al., 2018). Even if smFISH is not the most accurate method on its own, we did not see any other straightforward way to examine mRNA levels with the requisite spatial resolution. For the revised manuscript, we also increased the number of images/animal and the number of animals analyzed (n=4 for most of them) in the smFISH assays to improve reliability (Figure 8c).

Taken together with the clear absence of tissue-wide effects in the bulk qPCR data, we are convinced that this completely independent method provides sufficient data supporting our conclusion that mRNA level changes do not underlie the protein-level changes we see.

One option for a more quantitative experiment that is area and layer specific would be to use at least relatively layer V or IV-specific Cre-driver (such as Rbp4-Cre for layer V1), microdissect S1, sort labeled neurons, then examine expression in them via qRT-PCR. Further investigation of potential mRNA expression changes of these genes in the appropriate neurons is critical because an alternative hypothesis explaining the change in mRNA association with heavy polysomes seen in Figure 6 is that there are simply changes in the number of neurons expressing the genes, rather than the translational efficiency of the mRNAs in S1. This alternative would essentially negate/substantially reduce the central claim of the manuscript, so more deeply investigating that alternative would seem to be critical, not an incremental "bell or whistle". All reviewers concur that substantial experiments need to be performed to confirm and/or refute aspects of the interpretations and conclusions presented.

We appreciate the elegance and potential added value of an experiment like the one proposed. In theory it could overcome some of the caveats of the two methods that we have used already to address potential mRNA level changes. However, due to work limitations in the pandemic period, we were unable to import new mouse lines (considering we need to do embryo transfer and our animal facility is not running at full capacity). Moreover, sorting, and sequencing facilities are devoted to COVID-related projects. Therefore, the waiting list is huge. We regret this, but hope that reviewers will find our interpretation of the data to be appropriate.

Further investigation of potential mRNA expression changes of these genes in the appropriate neurons is critical because an alternative hypothesis explaining the change in mRNA association with heavy polysomes seen in Figure 6 is that there are simply changes in the number of neurons expressing the genes, rather than the translational efficiency of the mRNAs in S1.

While we greatly appreciate the reviewers’ helpful feedback and find their thoroughness admirable, we do not think this particular caveat is logically correct. We think the issue probably arises from insufficient explanation of how our sucrose gradient polysome assay works and what it can reveal. In fact, a big advantage of the polysome gradient approach is that it reveals the percentage of total mRNA signal in each of the different fractions. An mRNA will only show an altered distribution across the gradient if it is associating with heavy complexes (e.g. ribosomes) to a greater or lesser extent. There is no theoretical reason to believe that total mRNA level changes- even if occurring – would affect the percentage of the mRNA in one fraction or another. A 10-fold increase (or decrease) in levels of mRNA X in the absence of translational regulation would therefore be expected to lead to no change whatsoever in the percentage distribution of the mRNA across the gradient. This will be true whether the increase in mRNA levels is within the same set of cells or results from more cells in the analyzed population expressing that gene. More cells or mRNA ≠ mRNA deeper in gradient!

Countless publications and our own experience over the years provides empirical support for the fact that the polysome gradient assay is independent of mRNA level measurements. Indeed, it can even reveal translational regulation that is occurring either in the presence or absence of mRNA level changes and might even be “paradoxical” (i.e. opposite direction to mRNA level changes). One example appears to be Rorβ (see point 22 below): mRNA levels go up, but the mRNA shifts out of the deeper fractions of the gradient, consistent with reduced translation of more mRNA, and the observed reduction in protein levels.

Bottom line: We disagree that a change in the number of cells expressing Sox5, Ctip2 or any gene is an alternative explanation for an altered distribution of that mRNA in the polysome gradient. If this is indeed the major concern of the reviewers, then we trust that our explanation of how the polysome assay is not affected by mRNA level changes will alleviate their concerns.

In the revised manuscript, we added new text in Results and Discussion to improve our explanation of how sucrose-gradient polysome assays work and why they are mRNA-level independent.

22. Figure 6 and Figure Supplements infer the translational status of Sox5, Ctip2, and Rorβ mRNA of interest by testing the association with heavy polysomes. They show increased association for Sox5 and Ctip2, and decreased association for Rorβ, in both E14.5 hTDP-43A315T whole cortex and P0 Pum2 cKO microdissected S1 cortex. Interestingly, no changes were seen in E14.5 Pum2 cKO cortical lysates. Overall, the effects seen are quite weak, and likely represent only modest changes in the global translational output from these mRNAs. In addition, there are several concerns over the design of this experiment. First, as a bulk assay, it does not address whether translational regulation of the transcripts specifically occurs in the neuron population of interest.

In the revised manuscript, we now explicitly acknowledge the limitation of the polysome gradient approach as a bulk assay in the Discussion. However, because the assay can provide a window on translational regulation we think it still has significant value. In our view, the key issue with bulk assays would actually be false negative results due to lack of sensitivity. On the other hand, modest positive effects in the global translational output are exactly what one might expect in such a bulk assay for regulation that is occurring mainly in a sub-population of cells. In that sense, it is arguably impressive that we are able to detect significant effects at all. This is especially true for Sox5 mRNA, which is also expressed strongly in neurons in Layer VI, where we do not see any phenotype.

We also note now in the discussion that the effect on Rorβ mRNA is actually not so weak: ~50% of this mRNA shifts from a fraction corresponding to ~7 ribosomes/mRNA to a fraction corresponding to ~1 ribosome/mRNA (Figure 9c and d). We think such a change in ribosome density could readily account for a biologically meaningful reduction in protein synthesis and steady-state levels of the encoded Rorβ protein – exactly as we observe.

We agree that having a quantitative, cell-specific assay for translation rates for each of these mRNAs would be very useful. However, as explained earlier for point 21, introduction of neuron-specific cre lines or FACS sorting of specific neuronal cohorts is beyond the scope of the revision of this manuscript. We hope that this crucial issue has been adequately addressed by changes we included in figures and text.

Second, there is circular logic regarding Sox5 and Ctip2: the change in the laminar composition of the cortex might result in increased association with heavy polysomes without any translational regulatory mechanism simply because there are more cells expressing these genes. For Rorβ, the paradoxical increase in mRNA and decrease in heavy polysome association is a more likely case of translational control.

We thought hard about this concern, trying to understand it. As far as we can tell, it is exactly the same issue as point 21, namely that more cells expressing a gene might affect the % of the encoded mRNA found in specific fractions of polysome gradients.

We do not see any theoretical reason why having more cells expressing a particular mRNA would increase the percentage of that mRNA in the deeper fractions of a polysome gradient (that is what is plotted in all polysome gradient figures). Moreover, we know empirically from countless published studies (e.g. Blair et al., 2017; Floor and Doudna, 2015, 2016) and all of our own work with this assay over the past decade (e.g. Neelagandan et al., 2019), that changes in the mRNA level in either direction do not per se have any impact on the distribution of that mRNA in the gradient

Thus, we do not understand this concern and we do not believe that there is any “circular logic” here for Sox5, Ctip2, or any other mRNA/protein pair examined. We think this concern arose from our need to better explain how the polysome gradient assays work. As mentioned under point 21, we added new text in Results and Discussion to help all readers better understand how sucrose-density gradient polysome assays work. There, we emphasize how their design enables us to provide insights into translation independent of any changes to mRNA levels.

Third, there is a possibility that some transcripts found in heavy polysome fractions do not actually associate with translating ribosomes, but co-sediment because of association with other ribonucleoprotein complexes (a valid concern given Pum2 and TDP-43 function as RNA-binding proteins that possibly form large RNA-protein granules). It would be optimal to add a control in the experiment to ensure that Sox5, Ctip2, and Rorβ are truly engaged by ribosomes. Adding puromycin as a polysome disruptor prior to profiling will shift bona-fide translated transcripts toward lighter ribosome fractions. This is likely to be possible in the coming months.

It is true that mRNA shifts in a polysome gradient might be due to association with large complexes other than ribosomes. However, here the changes in the gradients correlate with protein level changes that are not explained by mRNA level changes. We think this makes the interpretation that they reflect ribosome density changes more likely.

Nonetheless, we agree it would be optimal to add a control to ensure that Sox5, Ctip2, and Rorβ mRNAs are truly engaged by ribosomes. We tried a post lysis puromycin treatment. In this case, we generated lysates in the absence of cycloheximide then raised lysate temperature briefly to 37 degrees in the presence of 2mM puromycin. The idea was that this would allow for a very brief resumption of translation on the mRNAs in the lysates, so puromycin would have time to act selectively on these elongating ribosomes. As can be seen in our Author response image 3, we were not able to observe any difference in polysome association of any mRNAs in the tissue under the conditions we tested. One potential explanation is that translation did not actually resume under the cell-free polysome buffer conditions. These buffer conditions are optimized to stabilize polysomes and not for in vitro translation elongation post-lysis. Since we also have extensive experience in the group with cell-free translation assays, we know all too well that slight changes in buffer components can massively affect translational activity in cell lysates. Regardless of the underlying cause for puromycin not working under the conditions we tested, this disappointing result suggested to us that it might take quite some time to identify robust conditions enabling efficient and selective disruption of actively translating ribosome-mRNA complexes in lysates from mouse neocortex.

Author response image 3

The problem is that puromycin is not really a “polysome disruptor” per se. Puromycin can only function as desired when the ribosomes are indeed actively in the act of translating. This mechanism of action makes it ideal for disrupting translation elongation taking place under physiological conditions in living cells. However, it raises issues for designing a good “polysome disruption” experiment with puromycin for lysed tissue samples from mouse cortex.When exactly do you add puromycin “prior to profiling”? And importantly: at what temperature? To stabilize polysomes in their physiological state one chills the tissue prior to lysis and keeps everything cold thereafter. This makes sense: translation elongation, which we want to stall in a physiological state, involves GTP hydrolysis and is absolutely temperature dependent. Ergo, if you just add puromycin to polysome lysates made from chilled tissue and then stored on ice for stability, it should not actually do anything helpful: under these conditions there is no active translation taking place for it to disrupt.

For cultured cells you can simply add puromycin directly to the cells in the dish and return them to the incubator briefly prior to lysis (e.g. Nottrott et al., 2006). In this case, it is also feasible to add cycloheximide either just before or during lysis as a polysome stabilizer. But how do you do this in an informative way with dissected mouse neocortical tissue? Do you disrupt cells first and then puromycin treat ex vivo at 37 degrees like for cultured cells prior to lysis? Or should you perfuse the mice with puromycin before dissecting the tissue? Or do you try to treat the lysates themselves? Our attempts at the latter did not succeed and led us to believe that this is a tricky control to properly implement with dissected tissue.

We sincerely regret that we were unable to address this particular concern by performing the suggested control experiment. In the revised manuscript and we now explicitly acknowledge the implications of not performing this control in the Discussion.

How do the authors explain the paradoxical effect of Rorb RNA and protein levels?

We were not completely sure what type of explanation reviewers were seeking here, so we do our best to cover several potential issues.

Presumably the reviewers appreciate that one simple explanation for paradoxical changes between mRNA and protein levels is translational regulation. Examining the percentage distribution of an mRNA in a polysome gradient can help support this notion. For example, if the percent distribution of Rorb mRNA would shift from heavy polysomes to lighter ones, this would be consistent with decreased ribosome engagement with this mRNA, leading to reduced protein synthesis. Such a result would support reduced translation of the increased amount of mRNA being responsible for paradoxically reduced levels of Rorβ protein. This is exactly what we find. In the revised manuscript, we show it in the new Figure 9

An alternative explanation to explain increased Rorβ mRNA with decreased protein would be that there are mitigating effects on protein stability. This is not mutually exclusive with translational regulation. In the text, we acknowledge this could also be occurring. However, we propose that protein stability effects are less likely to be the main driver for two reasons: (1) we have direct evidence (via the polysome assays) for regulatory effects on translation and (2) it seems easier to imagine how mRNA-binding proteins regulate translation of mRNAs they bind vs. stability of the proteins encoded by those mRNAs. We reworked the relevant sections of text to make these points clearer.

Probably, these issues are clear and the reviewers’ question is more about why there is an increase in Rorβ mRNA at all? Obviously, it could be due to effects on transcription and/or stability and could be either direct or indirect. One possibility could be activation of a compensatory transcriptional pathway that senses the decreased protein levels and tries to restore balance via upregulating mRNA levels. Based on all we know, a direct effect of Pum2 on Rorβ transcription seems very unlikely, but indirect effects are possible. It is also possible that both proteins directly or indirectly affect stability of the mRNA.

One possible indirect mechanism for effects on Rorβ mRNA stability would actually be consistent with a primary effect on translation (as evidenced from the polysome gradient data) that indirectly affects the stability of the mRNA. The field tends to think in either/or terms, but there is actually a lot of extant data implying that the translational status of an mRNA can impact on the mRNA’s stability. Actually, testing this here would require assays that would be challenging to do in vivo in a complex tissue and are certainly beyond the scope of this manuscript.

In the revised manuscript, we expanded discussion of these issues.

Why do they exclude that the Pum2 and TDP43 could have a role in regulating the amount of Rorb RNA available in the neurons?

In addition, despite not being significant, both Sox5 and CTIP2 appear to show a trend of increase. How many replicates were analyzed, and how many litters? It does not seem conclusive, and additional points should be added to finalize the quantification and investigate RNA level involvement.

As explained above (point 21), we have addressed it with new experiments by performing additional replicates with additional litters, exactly as suggested. These new data show no trend of increase for Sox5 or Ctip2 (New Figure 8). These observations from additional new experiments fully support our original conclusion that there is no significant difference in the levels of these mRNAs in the cortical regions analyzed.

23. A more direct test of translational regulation, likely beyond the scope of this paper, would be to perform the PUM2 cKO or hTDP-43 overexpression experiments in a "RiboTag" (RPL22-HAfl/fl) background. One could express tagged ribosomes in either layer V or layer IV through specific Cre drivers, immunoprecipitate the tagged ribosomes, then compare ribosome association with the mRNAs of interest between experimental mice. This could be done or at least discussed.

We respectfully disagree that using the Ribotag would be a “more direct test of translational regulation”. In fact, a major caveat of this approach is that it cannot by itself distinguish changes in translation from changes in mRNA levels in the cells examined. Changes in mRNA levels in the absence of any translational control will be reflected by corresponding changes in the ribosome-associated mRNA population. For example, if you observe a 10x change in the amount of ribosome-associated mRNA X in your mutant vs. control RiboTag pulldown, this could be either due to changes in that mRNA’s level or its translation or both. There is no way to distinguish whether observed changes reflect translational or transcriptional effects based on RiboTag data alone. Importantly, you cannot reliably reference the input material here to make the call, since this includes confounding signal from other cells.

We believe that this is precisely the caveat raised above for our polysome gradient assays. We reiterate here that this caveat does not apply to polysome gradients because the percentage of all mRNA signal is distributed across the gradient. Changes in an mRNA’s polysome distribution can be observed whether or not there are changes in mRNA levels and do not depend on the mRNA levels in any obvious manner.

A separate, equally important issue is that tagged ribosome IP approaches (RiboTag or TRAP) are inherently insensitive to changes in ribosome density (the number of ribosomes engaged with an mRNA). Theoretically, an mRNA would be expected to be found in the ribosome-associated pool after pulldown whether there are 2, 4 or 10 ribosomes translating it and we have verified in our lab that this is indeed the case (Marques, Stenzler, and Duncan, unpublished). Why does this matter? Because we know that translational control frequently involves changes in the number of ribosomes engaged with an mRNA, rather than whether any ribosomes at all are engaged with it. Such changes can be observed in many published analyses using polysome gradients (e.g. Barbieri et al., 2017; Blair et al., 2017; Floor and Doudna, 2016; Neelagandan et al., 2019) and we also see them here in Figure 9.

We are not saying that RiboTag and related approaches are not useful. They offer the major advantage of cell-type specific analysis of ribosome-associated mRNAs. Moreover, if properly used, they can also help to overcome the caveat that mRNAs may shift in a polysome gradient independently of association with ribosomes. However, they definitely do not by themselves constitute a “more direct test of translational regulation”. They actually provide a less direct and less sensitive assay for translational regulation than the one that we have used here: classical sucrose-density gradient polysome profiling from developing neocortex.

In the revised manuscript, we briefly discuss these aspects in the Discussion, emphasizing the limitations of the Ribotag method and the advantages of the classical polysome approach that we have used here for our specific application.

24. A key limitation and missed opportunity of the manuscript is the lack of attention given to alternative splicing and isoform-specific translational regulation. Figure 6 – Supplement 1 shows the importance of this consideration. The figure explores the expression of various 3' UTR variants of Sox5, Ctip2, and Rorβ, finding multiple isoforms expressed at significantly different levels in the wildtype cortex. Surprisingly, considering TDP-43 is reported to be a key splicing regulator (2,3) and TDP-43 binding sites are found on the transcripts of interest, there is no analysis of possible alternative splicing in TDP-43 over-expression in this manuscript. It is possible that differential isoform usage of subtype identity regulators might be the/a mechanism underlying the expansion of layer V/shrinkage of layer IV. Related to this, the qPCR experiment performed on different polysome fractions to determine the translational status of mRNAs frequently contains results from only one isoform-specific primer set (Figure 6c, d). In Sox5's case, "S4" primers capture the longest – but also the least abundant- isoform. Hence, it is possible that the shift to heavy polysome found in Sox5 and Ctip2 is only valid for one isoform, and not the global transcript population. It is also entirely possible that translational control exists, but acts in an isoform-specific manner. However, the current manuscript does not explore this important topic at all, nor seem to really acknowledge or engage it.

We agree that isoform-specific translational regulation is an interesting aspect that could potentially have been developed more in our manuscript.

For the revised manuscript, we addressed this point by performing additional experimental analyses with new cortical RNA samples from a higher number of replicates in pS of controls and both mutants. We examined potential effects on both 3’UTR diversity and the splicing of the mRNAs identified. As shown in Figure 9-Figure supplement 1 and 2, we observed no changes in levels of the 3’UTR isoforms examined in mutants relative to respective controls. Moreover, guided by annotations in ENSEMBL and the literature, we examined potential effects on the splicing of multiple introns using either custom qRT-PCR primers or previously published RT-PCR primers where available. The conclusion from all of these studies is that there is no apparent effect on the splicing of any of the mRNAs that we see deregulated at the translational and protein levels in developing neocortical tissue.

The revised text now includes explicitly acknowledges that we have considered the possibility of effects on other steps of gene expression and that our new data suggests they may not be the main drivers of the phenotypes we observe. We further acknowledge that there could be subtle isoform- or cell-type-specific effects that we may have missed.

We also revised the text to more explicitly address isoform-specific translational control and the issue of how this might relate to the phenotypes that we observe, as well as how future studies could explore this in more detail, perhaps on a genome-wide level.

Finally, we completely agree that a comprehensive examination of the potential interplay between alternative splicing and polyadenylation and the impact this has on translation during cortical development would be fascinating. However, this vast undertaking would require a tour-de-force of multi-omic data integration and follow-up analyses. As such, it seems far beyond the scope of our manuscript and entirely appropriate for a separate future study.

25. Figure 7 demonstrates that both TDP-43 and PUM2 proteins localize to the cytoplasm along with the mRNAs of interest in the cortex, and that these proteins specifically associate with the mRNAs of interest in cortical, cytoplasmic lysates. RNA IP experiments are notoriously noisy, and while the authors controlled for enrichment over IgG and no UV conditions, the most appropriate control would be to establish a baseline of IP in PUM2 cKO cortices or wild-type mouse cortices not expressing hTDP-43. Perhaps more importantly, some discussion of prior literature on PUM2 and TDP-43 interactions with these mRNAs of interest (especially relevant CLiP experiments (2-4)) would be a helpful addition. These articles are cited, but their results are not discussed in comparison to the present study's UV-RIP experiments.

Two points are raised, one about additional controls and the other about discussing previously published datasets in the context of our CLIP assays.

1. Are the two current controls of control IgG and no-UV crosslinking sufficient?

For Pum2, we agree that the additional suggested control for Pum2-KO material is appropriate and arguably superior to IgG control. However, we also wonder how much additional value it would truly add, given that we already included two standard specificity controls routinely used in numerous published studies. In the end, we decided to focus limited resources in the revision period on other issues that we found more pressing.

For TDP-43, we are analyzing interactions of endogenous mouse TDP-43 with mRNA in these assays. Therefore, we believe that we cannot think of a better control than the two that we have already used, rather than to establish a baseline in the absence of hTDP-43 (as suggested by the Referees). We reworked the relevant text to emphasize this point in order to minimize potential confusion about this aspect.

2. Discussion of the cited previously published interaction studies

We searched for Sox5, Ctip2, and Rorβ mRNAs in previously published CLIP and RIP datasets. Interactions with Pum2 or TDP-43 were not detected in most studies, but some were found in studies that looked at P0 mouse brains. To confirm and extend these observations, we looked ourselves directly in the developing neocortex. In the revised manuscript we now summarize these previous results in the relevant section of Results.

26. All reviewers identified apparent oversights or inadequacy in citation of several clearly relevant papers on related topics that set a context and foundation for elements of this work. Some are listed above when discussing related issues, and others are commented on below. These should be corrected:

We appreciate the reviewers’ attention to detail and scholarly accuracy, which we also consider important. For the revised manuscript, we incorporated all suggested changes.

26a. The manuscript should mention some previous papers that investigate area-restricted neuronal subtype specification; the manuscript now reads as if this has not been encountered previously, nor seemingly even considered. For example the transcription factor Bcl11a/Ctip1 regulates area-specific composition/proportions of neuronal subtypes: cortical Bcl11a/Ctip1 KO causes an increase in SCPN in sensory and visual cortex, but not in the motor cortex (5, 6). Cederquist et al., 2013 similarly addresses this issue re: Lmo4 control in rostral motor cortex (7). Discussing / incorporating these papers of course would not take away from the novelty of the current work, which focuses on post-transcriptional effectors of specification downstream of molecular-genetic (particularly transcriptional) control.

We now cover this important issue in the Discussion and cite the publications mentioned.

26b. Curiously, the authors omit Molyneaux et al., 2005 (8), the first report re: Fezf2 (then Fezl) and its control over Ctip2 and subcerebral identity/fate when they cite two later papers on p.11, line 24.

We now cite Molyneaux et al., 2005 (8) in addition to the two later papers. We appreciate the reviewers highlighting this important reference to include here.

26c. The authors should provide more depth on the motivation for studying TDP-43 and PUM2 in arealization and cortical development specifically. Although these are "classic RNA binding proteins", the rationale for such a detailed look at these RNA binding proteins in particular is not fully explained in the Introduction and Discussion. One might assume that it is because of their connections with motor neuron disease/ALS, but this and/or other reasons should be made clear and explicit early in the manuscript. Also, the observation that both have similar reported cortical organization phenotypes, and both regulate the genes of interest, requires additional discussion regarding potential mechanistic overlap.

Two points are raised:

(26c.1) motivation for studying Pum2 and TDP-43 in this context

This was raised several times previously. We addressed it by adding text in the Introduction.

(26c.2) Additional discussion regarding potential mechanistic overlap

As suggested, for R1 we added additional text in the Discussion covering the implications of similar phenotypes for the two RBPs and potential mechanistic overlap.

26d. In the Intro, the authors should acknowledge that there have been reports on the contribution of RNA-binding proteins in cortical cytoarchitecture such as FMRP (Altered cortical Cytoarchitecture in the Fmr1 knockout mouse, 2019, Frankie H. F. Lee, Terence K. Y. Lai, Ping Su and Fang Liu).

This is acknowledged in the intro and we now cite the publication mentioned.

References:

Azim, E., Jabaudon, D., Fame, R. M., and Macklis, J. D. (2009). SOX6 controls dorsal progenitor identity and interneuron diversity during neocortical development. Nat Neurosci, 12(10), 1238-1247. https://doi.org/10.1038/nn.2387

Barbieri, I., Tzelepis, K., Pandolfini, L., Shi, J., Millan-Zambrano, G., Robson, S. C., Aspris, D., Migliori, V., Bannister, A. J., Han, N., De Braekeleer, E., Ponstingl, H., Hendrick, A., Vakoc, C. R., Vassiliou, G. S., and Kouzarides, T. (2017). Promoter-bound METTL3 maintains myeloid leukaemia by m(6)A-dependent translation control. Nature, 552(7683), 126-131. https://doi.org/10.1038/nature24678

Blair, J. D., Hockemeyer, D., Doudna, J. A., Bateup, H. S., and Floor, S. N. (2017). Widespread Translational Remodeling during Human Neuronal Differentiation. Cell Rep, 21(7), 2005-2016. https://doi.org/10.1016/j.celrep.2017.10.095

Chen, B., Wang, S. S., Hattox, A. M., Rayburn, H., Nelson, S. B., and McConnell, S. K. (2008). The Fezf2-Ctip2 genetic pathway regulates the fate choice of subcortical projection neurons in the developing cerebral cortex. Proc Natl Acad Sci U S A, 105(32), 11382-11387. https://doi.org/10.1073/pnas.0804918105

Floor, S. N., and Doudna, J. A. (2015). Get in LINE: Competition for Newly Minted Retrotransposon Proteins at the Ribosome. Mol Cell, 60(5), 712-714. https://doi.org/10.1016/j.molcel.2015.11.014

Floor, S. N., and Doudna, J. A. (2016). Tunable protein synthesis by transcript isoforms in human cells. eLife, 5. https://doi.org/10.7554/eLife.10921

Garcia-Marques, J., and Lopez-Mascaraque, L. (2013). Clonal identity determines astrocyte cortical heterogeneity. Cereb Cortex, 23(6), 1463-1472. https://doi.org/10.1093/cercor/bhs134

Ge, W. P., Miyawaki, A., Gage, F. H., Jan, Y. N., and Jan, L. Y. (2012). Local generation of glia is a major astrocyte source in postnatal cortex. Nature, 484(7394), 376-380. https://doi.org/10.1038/nature10959

Guerrier, S., Coutinho-Budd, J., Sassa, T., Gresset, A., Jordan, N. V., Chen, K., Jin, W. L., Frost, A., and Polleux, F. (2009). The F-BAR domain of srGAP2 induces membrane protrusions required for neuronal migration and morphogenesis. Cell, 138(5), 990-1004. https://doi.org/10.1016/j.cell.2009.06.047

Iwasato, T., Datwani, A., Wolf, A. M., Nishiyama, H., Taguchi, Y., Tonegawa, S., Knopfel, T., Erzurumlu, R. S., and Itohara, S. (2000). Cortex-restricted disruption of NMDAR1 impairs neuronal patterns in the barrel cortex. Nature, 406(6797), 726-731. https://doi.org/10.1038/35021059

Jabaudon, D., Shnider, S. J., Tischfield, D. J., Galazo, M. J., and Macklis, J. D. (2012). RORbeta induces barrel-like neuronal clusters in the developing neocortex. Cereb Cortex, 22(5), 996-1006. https://doi.org/10.1093/cercor/bhr182

Kwan, K. Y., Lam, M. M., Krsnik, Z., Kawasawa, Y. I., Lefebvre, V., and Sestan, N. (2008). SOX5 postmitotically regulates migration, postmigratory differentiation, and projections of subplate and deep-layer neocortical neurons. Proc Natl Acad Sci U S A, 105(41), 16021-16026. https://doi.org/10.1073/pnas.0806791105

Lai, T., Jabaudon, D., Molyneaux, B. J., Azim, E., Arlotta, P., Menezes, J. R., and Macklis, J. D. (2008). SOX5 controls the sequential generation of distinct corticofugal neuron subtypes. Neuron, 57(2), 232-247. https://doi.org/10.1016/j.neuron.2007.12.023

Marques, R. F., Engler, J. B., Kuchler, K., Jones, R. A., Lingner, T., Salinas, G., Gillingwater, T. H., Friese, M. A., and Duncan, K. E. (2020). Motor neuron translatome reveals deregulation of SYNGR4 and PLEKHB1 in mutant TDP-43 amyotrophic lateral sclerosis models. Hum Mol Genet, 29(16), 2647-2661. https://doi.org/10.1093/hmg/ddaa140

Nakagawa, Y., and O'Leary, D. D. (2003). Dynamic patterned expression of orphan nuclear receptor genes RORalpha and RORbeta in developing mouse forebrain. Dev Neurosci, 25(2-4), 234-244. https://doi.org/10.1159/000072271

Neelagandan, N., Gonnella, G., Dang, S., Janiesch, P. C., Miller, K. K., Kuchler, K., Marques, R. F., Indenbirken, D., Alawi, M., Grundhoff, A., Kurtz, S., and Duncan, K. E. (2019). TDP-43 enhances translation of specific mRNAs linked to neurodegenerative disease. Nucleic Acids Research, 47(1), 341-361. https://doi.org/10.1093/nar/gky972

Nottrott, S., Simard, M. J., and Richter, J. D. (2006). Human let-7a miRNA blocks protein production on actively translating polyribosomes. Nat Struct Mol Biol, 13(12), 1108-1114. https://doi.org/10.1038/nsmb1173

Srivatsa, S., Parthasarathy, S., Britanova, O., Bormuth, I., Donahoo, A. L., Ackerman, S. L., Richards, L. J., and Tarabykin, V. (2014). Unc5C and DCC act downstream of Ctip2 and Satb2 and contribute to corpus callosum formation. Nat Commun, 5, 3708. https://doi.org/10.1038/ncomms4708

Zahr, S. K., Yang, G., Kazan, H., Borrett, M. J., Yuzwa, S. A., Voronova, A., Kaplan, D. R., and Miller, F. D. (2018). A Translational Repression Complex in Developing Mammalian Neural Stem Cells that Regulates Neuronal Specification. Neuron, 97(3), 520-537 e526. https://doi.org/10.1016/j.neuron.2017.12.045

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Essential revisions:

The reviewers also agree that the authors should soften some statements (as pointed out in reviewer comments), especially about:

1) Neuronal identity definition;

2) Direct control over neuronal diversification;

3) Whether there might also be transcriptional control occurring, in addition to translational control.

The reviewers also all request that the authors

4) Temper their language regarding their interpretations and conclusions, and include consideration of some possible alternatives/complementary possibilities regarding their findings.

We thank the reviewers for their overall positive view and willingness to publish our manuscript after the requested text revisions have been implemented

We softened our statements and conclusions regarding all above-mentioned points throughout the text, including the title and abstract. We also updated the text to include a consideration of possible alternative interpretations. Specific cases where we toned down or added additional consideration of possible alternative interpretations are highlighted in R2. Finally, we also address the specific additional points raised by reviewers 1 and 3 below and modified the text where requested.

Reviewer #1:

This is a substantially revised manuscript, with major effort evident to address the limitations and reviewer criticisms raised in initial review. The authors performed the majority of requested experiments, and provided a highly thoughtful, comprehensive, and insightful response to the reviewers.

However, while the authors have convincingly demonstrated translational modulation of Sox5, Bcl11b, Rorb by Pum2 and TDP-43, they did not rule out transcriptional regulation as the or a root cause – in particular, they did not perform the suggested experiments to investigate whether there might be transcriptional changes that might drive regulation of these proteins' abundance in developing layer IV/V.

This is a serious oversight, as it potentially undermines the entire claim of "post-transcriptional" regulation. While there is not sufficient evidence to claim Pum2 and TDP-43 function in appropriate S1-specific laminar organization via post-transcriptional control instead of regulation of steady state levels of their target mRNAs, the post-transcriptional effect per se is novel, and will be worthy of reporting once the possibility of transcriptional regulation is properly investigated. For this pivotal reason that could potentially undermine the central conclusion, this manuscript is not currently publishable in eLife.

We appreciate the potential added value of the proposed experiments and strongly considered performing them. However, it required us to import new Cre lines and cross-breed them prior to performing the experiments. During the pandemic there was tremendous institutional pressure to reduce mouse lines, rather than expand them and resources for embryo transfer – normally a bottleneck anyway – were extremely limited. There was simply no way for us to do these experiments even in the extended revision period. We’re glad that the collective discussion appears to have led reviewers to decide not to demand this experiment after all and to accept the results from the bulk qRT-PCR and smFISH as reasonable evidence that there are not major steady-state mRNA level changes. For R2 we have also tried to temper the strength of our claims here as requested and acknowledge caveats of the assays performed, as well as the potential for mRNA level changes within specific cell types.

However, even if we were to detect mRNA level changes using the proposed experiment, that would not in and of itself be evidence for transcriptional changes, since mRNA levels could be post-transcriptionally regulated at the level of mRNA stability. In that sense, while the proposed experiment is certainly worthwhile, we think it is important to acknowledge that it would also not be definitive for distinguishing transcriptional vs. post-transcriptional effects.

Specific Comments:

Authorship: Denis Jabaudon was listed as an author on the first submission, but not this revision, yet author contributions from "DJ" are listed in this revision. There is no other author with initials DJ. Is Denis Jabaudon no longer an author on the paper intentionally, but included in the author contributions? What is the explanation? Do we know that he requested to be removed as an author? If so, why? If not, why was he removed? Are there any disagreements among the initial author list in terms of interpretations of the data or approach to this revision? Since authorship is conventionally "earned", it is of note that an authorship has been revoked or deleted for any reason following initial submission.

We appreciate the potential added value of the proposed experiments and strongly considered performing them. However, it required us to import new Cre lines and cross-breed them prior to performing the experiments. During the pandemic there was tremendous institutional pressure to reduce mouse lines, rather than expand them and resources for embryo transfer – normally a bottleneck anyway – were extremely limited. There was simply no way for us to do these experiments even in the extended revision period. We’re glad that the collective discussion appears to have led reviewers to decide not to demand this experiment after all and to accept the results from the bulk qRT-PCR and smFISH as reasonable evidence that there are not major steady-state mRNA level changes. For R2 we have also tried to temper the strength of our claims here as requested and acknowledge caveats of the assays performed, as well as the potential for mRNA level changes within specific cell types.

However, even if we were to detect mRNA level changes using the proposed experiment, that would not in and of itself be evidence for transcriptional changes, since mRNA levels could be post-transcriptionally regulated at the level of mRNA stability. In that sense, while the proposed experiment is certainly worthwhile, we think it is important to acknowledge that it would also not be definitive for distinguishing transcriptional vs. post-transcriptional effects.

Line 182: Possible typo: "hippocampal significant staining", should this be e.g., "significant hippocampal staining"?

We thank the reviewer for catching this typo, and have now corrected it in R2.

Figure 4: Satisfies the request for co-localization of retrolabeled SCPN with new Sox5+ and Bcl11b+ cells in layer IV. Would be best to also perform a quantification of Sox5+ SCPN-label+ and Bcl11b+ SCPN-label+ double positive cells per bin as done for Sox5+ Bcl11b+ in Figure 4a.

According to our images analysis, and as it can be seen in Figure 4 b and c, we found that all labelled SCPN are Sox5+ and Ctip2+ (100%) as expected, while the opposite is not true since the CTB injection is variable between animals and does not always target all subcerebral axons. We focused on higher magnification images to zoom in on layer IV- and V- labelled neurons, instead of showing a low-level magnification (as in Figure 4a) with all bins included.

Figure 5 description in Results section "Somatosensory area identity.… being "motorized": A more precise description of Lmo4 and Bhlhb5 expression patterns in experimental mice is needed, since the patterns do not seem to be "fully wildtype". By acknowledging up-front subtle differences, then highlighting specific evidence showing distinct and unmixed pS and F/M areal identities, the authors could put readers' minds at ease and prevent them from getting distracted from the main argument. The authors' response to reviewer comment 17 would be well suited here, thus could be considered for incorporation into the text.

We changed this part and include our response to reviewer comment 17 from R1 in the manuscript text.

Figure 7: IUE of either Cre-GFP in a Pum2fl/fl background, or hTDP43-GFP constructs under NeuroD promoters, at E13.5 demonstrate increased Sox5+ or Bcl11b+ cells among the electroporated neurons (mostly layer IV or upper layer neurons in WT or Cre- conditions), and a decrease in Rorb+ neurons. This is consistent with the previous observations using Pum2 cKO or TDP-43 transgenic lines, and a direct test of the model that these RNA binding proteins regulate the relative proportions of cortical lamina. We understand that the authors were unable to perform E12.5 IUE successfully; this is a difficult experiment, and E13.5 IUE seems acceptable given the developmental timing of layer IV differentiation.

Is there is a change in axonal connectivity toward subcerebral projection of the electroporated population that is consistent with an increase in the number of cells expressing Sox5 and Bcl11b, and consistent with the retrograde labeling result? Such an "optional" analysis could make the manuscript more complete, and could be done relatively easily (perhaps especially so if the authors have saved extra samples for tissue processing and microscopy).

We first aimed to include this connectivity analysis in our IUE experiments. The best way would have been if samples electroporated at E14.5 would change their connectivity. In that case we would have found GFP-labelled subcerebral projections of the cells over-expressing hTDP-43 alleles or ablating Pum2 compared to no subcerebral projections in the control group. We saved later samples at P7 and P21 to analyze that. However, we found that electroporating UL neurons at E14.5 does not change their identity (Figure 7—figure supplement 2).

Regarding our E13.5 experiments, we aimed to do the same, however many difficulties appeared:

1 – Most but not all our electroporated pups with Cre or hTDP43 A315T were either not delivered or eaten by the mother at P0. We could mostly save the ones that were picked immediately after delivery. Due to the high number of electroporations that we have done at different stages from E12.5 to E14.5 and our limited time, we didn’t have so many extra brains to save for later stages (P7, P21) or for the different optimal cut (sagittal) for assessment of connectivity. We kept our saved brains for cell identity analysis.

2 – The brains electroporated with Cre or hTDP-43 variants showed a lot of electroporation efficiency differences (rate and GFP intensity of GFP expression in electroporated neurons) between each other and with GFP controls. This variability would make it hard to reliably assess a change in GFP+ subcerebral projections among the relatively low number of brains we had. This intensity-based analysis couldn’t be normalized to the efficiency of electroporation as we have done in the cell identity analysis.

Figure 8: Initial review raised concerns that the smFISH method used to quantify Sox5 and Bcl11b mRNA expression in Pum2 cKO or TDP43A315T lines is not accurate. The current figure quantifies expression using the metric "mRNA dots/DAPI cells". However, the FISH signal does not appear to be especially dot-like, and the numbers imply multiple dots per cell, when it looks like the signal largely fills most of the cell. Might this quantification be more appropriate by defining cell positions, integrating fluorescence intensity within a cell, and then comparing the distributions of intensities?

In our FISH analysis, we used the ACD/Bio-Techne RNAscope kit. We had several discussions with their technical team about best practices for analyzing the data. They made it clear to us that this single RNA molecule labeling approach reflects 1 RNA molecule per dot. They also emphasized that the intensity of dots does not reflect higher RNA expression, as the method involves massive non-linear amplification of signal to enable sm detection (the dots). For this reason, an intensity-based analysis is not appropriate with these data.

However, the number of dots does reflect the number of RNA molecules in one bin. In this case, the issue is only whether there are a countable number of discrete single-molecule dots and similar hybridization efficiencies can be assumed. The technical team believes that hybridization should be saturated under our conditions and parallel processing of test and controls would internally control for potential variability here. Moreover, in the all-representative high-resolution images in the figure, there are a discrete, countable set of green dots reflecting single molecules of the mRNAs in question.

We normalized to the total number of cells to reduce variability. We understand Reviewer 3’s point that it would have been better to assess the number of dots in every cell and compare it between controls and mutants. Because our zoomed in image analyses revealed almost exclusively intracellular dots, we think it is OK to analyze the data without laborious masking of individual cells.

Figure 9 and supplements: The authors' investigation of potential differences in Sox5, Bcl11b, Rorb splicing and 3' UTR usage is admirable. That said, the suggested investigation of isoform-specific translational regulation would not require a "tour-de force of multi-omic data integration"; the authors could simply repeat their qPCR analysis of their existing polysome profiles with their isoform-specific qPCR primers, and test if any isoforms show changes in the % of each isoform in the gradients, as is done in Figure 9 without isoform-specific primers. The authors' inclusion of a detailed explanation of polysome profiling analysis and quantification is also a positive; this is very helpful to the diverse audience for this paper, and for interpreting the translational changes.

We thank this reviewer for the appreciative comments regarding these analyses. The point with the “tour-de-force of multi-omic data integration” was simply in consideration of what it would take to do a comprehensive analysis of this subject using genome-wide approaches. Of course, isoform-specific primers can be used on the polysome fractions.

In fact, we have performed ORF and 3’UTR qPCR analysis on all our polysome profiles and showed the significant results in Figure 9.

We did not test all isoform-specific primers with our polysomes samples because we obtained a limited supply of material from the fractions and used up the samples for screening all ORF candidates and 3’UTR isoforms, so we didn’t have samples left for additional analyses (e.g., with newly designed splicing isoforms primers). Repeating all the polysome experiments yet again would have been very difficult and time consuming in our limited time under challenging circumstances. We decided to focus on making progress on the other important experiments requested. Moreover, had we found evidence for isoform-specific effects, this would certainly have required additional non-polysome experimentation to understand the significance for development. All in all, we think these are fascinating areas to explore systematically in the future (perhaps using multi-omic approaches).

However, the authors did not perform suggested and critical experiments focusing on quantifying Sox5, Bcl11b, and Rorb mRNA levels in layer IV/V, citing difficulties obtaining layer-specific Cre-driver lines, e.g. Rbp4-Cre for layer V or Rorb-Cre for layer IV, as well as difficulties obtaining sorter facility access due to COVID restrictions.

Although unfortunate and understandable that this might require a longer revision period, this is a serious limitation. Initial review was very clear that these sets of experiments are crucial for full interpretation of the hypothesis of post-transcriptional regulation by Pum2 and TDP-43. It is both very conceivable and very possible that these proteins actually act primarily by regulating the mRNA abundance of the relevant mRNAs in the subtypes of interest, and the observed translational effects are merely secondary. The only cell population-specific evidence the authors present to argue against transcriptional regulation is the smFISH experiments in Figure 8, which are improved, but remain semi-quantitative at best, and thus insufficient to rule out transcriptional effects.

If Cre-lines experiments remain overly challenging, the following experiment could be performed: layer V and layer IV neurons have different "birthdates", and can be labeled by BrdU incorporation at different developmental times. It is likely that in the Pum2 cKO, and hTDP-43 lines, there is a shift toward increased layer V specification at the times that typically yield layer IV neurons. The authors could perform a BrdU labeling experiment at E13.5-E14.5, and (1) look to see whether there is an increase in BrdU+Sox5+ or Bcl11b+ at P0, and decrease in BrdU+Rorb+ cells by immunofluorescence in Pum2 cKO and/or hTDP-43 lines, and (2) FACS-purify the BrdU+ cells, and perform qRT-PCR for Sox5, Bcl11b, and Rorb. This experiment should take only a few weeks to complete, requires no Cre driver lines to be imported, and requires no specialized procedures.

In summary: the polysome profiling experiments demonstrate translational regulation of Sox5, Bcl11b, and Rorb in the developing cortex in Pum2 cKO or hTDP-43 overexpression mice compared to wild-type. However, this could be primarily due to transcriptional regulation, and only secondarily with translation effects. To be able to claim "bona-fide" post-transcriptional regulation, the authors would need to rigorously test the alternative hypothesis that Pum2 and TDP-43 regulate mRNA abundance of the genes of interest in the relevant cells. The evidence presented (smFISH) fails to rigorously test this hypothesis. The central conclusion of manuscript relies on this, and would fall apart if the alternative were the case, so the current set of experiments is incomplete without such rigorous tests of the alternative hypothesis.

We understand the limitation of smFISH and the benefit of the mentioned experiments. We do not exclude potential effects on transcription and/or mRNA stability (which would be bona fide post-transcriptional regulation) in neuronal subpopulations that might be missed in our bulk assays. We acknowledge that smFISH may not be sufficiently quantitative to detect these effects in situ. In R2 we try now to be even more explicit about these issues.

Very important: additional animal experiments need to be submitted for approval by an ethics committee in the context of a detailed animal experiment application where the 3R rules will be carefully considered. There are very few animal experiments that we can legally do in “a few weeks” even if the experiment itself can be done that quickly. The suggested BrdU experiment would have to be carefully justified and would need to be reviewed prior to approval. That process typically takes several months after the application itself is finished. We think it is important for the reviewers to take this into consideration.

Reviewer #3:

The revised manuscript by Harb and colleagues has greatly improved and few key new experiments in support of the cell autonomous effect of the RBPs on the translational regulation of Bcl11b, Sox5 and Rorb. In particular, the IUE data as well as the colabeling analysis of Sox5 and Bcl11b, coupled with the in vitro neuronal culture, provide strong evidence for the control that Pum2 and TDP43 exert on these key players of neuronal diversification during corticogenesis.

Nevertheless, some important points raised in the first review have not been fully addressed and leave the reader still puzzled by the interpretations of some analyses.

In particular, the authors' choice of using the TDP43 mutant line is still problematic: while determining whether early developmental defects might contribute to the aetiology of neurodegenerative diseases is a compelling and very timely question – as numerous studies have recently been published along these lines – it is still unclear to me the link between translational regulation in area identity acquisition and the disease-associated mutations. This becomes even more puzzling when considering the chosen line does not develop ALS symptoms and therefore does not represent a true "disease model". Moreover, as previously requested in the reviews, the most suitable control line for the experiments involving the mutant line would have been the TDP43 wild type overexpression mouse model. If the goal was to address the effect of the disease-associated mutation any effect of the mutant line should have been properly assessed and 'normalised' to the wild type line, which – as stated by the authors in the revised manuscript – shows a milder alteration; if, on the other hand, the aim was to investigate the role of the control of TDP43 RPB on neuronal/area identity acquisition in the gain-of-function setting, the most appropriate line to be used should be the wild type line and not the mutant line, independently of the extent of the phenotype observed. The decision of the authors of not carrying along in ALL the analysis the is therefore arguable and leaves the reader confused on the specific goals of the study.

We understand this point and the unresolved issue about whether this early developmental defect is linked to disease-associated mutations. We have covered this issue in the Discussion. As shown in Figure 1—figure supplement 8, the hTDP-43A315T line shows higher over-expression of cytoplasmic and nuclear TDP-43 which explains the milder but significant effect seen in the hTDP43 WT line which also suggests a dose-dependent effect of TDP-43 on cell identity. We aimed to re-do the retrograde labeling in this line as requested, but it was technically not possible to send these lines again to Geneva to perform new experiments. Repeating all our qRT-PCR, polysome profiling and FISH experiments again with this line was not possible in our revision time during the pandemic. Moreover, both our primary neuron transfection and IUE experiments with both alleles over-expressed in the same conditions showed similarly significant phenotypes.

Connectivity data: While the IUE experiments undoubtedly contributes to support a direct involvement of RBPs in the phenotypes observed by the authors and convincingly determine their control over canonical markers of neuronal subtypes, the lack of connectivity analysis in Pum2 ko as well as in the TDP43 wild type lines limit the finding to the cellular phenotypes. While convincing the data on the cKO and the mutant TDP43 lines, it might be risky to assume similar connectivity defects in the other contexts.

As mentioned in our R1 response, we were dependent on our collaborators (i.e., DJ) to perform these experiments. Ultimately, the complex logistics of mouse transfer during the CoViD pandemic, coupled with personnel changes in the Jabaudon lab, made it impossible to organize these experiments in the required time.

For R2, we have reviewed the sections about connectivity again and changed them to acknowledge the point that we have to be careful about assuming the connectivity phenotypes extrapolate to the lines/conditions not explicitly tested.

Rescue analysis: The rescue experiment in the Pum2 cKO or PumKO is not addressed at all, and according to the authors is beyond the scope of the study. We respectfully disagree with the authors about this point. Providing the rescue experiments, or at least attempting it with techniques that have been presented in the revised version of the manuscript like IUE, would have provided direct evidence for Pum2 to be sufficient for the expression of layer-specific markers in vivo, highlighting its physiological relevance in area-specific neuronal identity.

We agree that the experiments would have been useful and originally hoped to slot them in. Unfortunately, initial Pum2 constructs generated for IUE were problematic and we lacked the time and resources to generate and test new ones. We added a statement in the discussion indicating that it will be important to verify phenotypic rescue by Pum2.

One last point still remains problematic in this reviewer's opinion and it concerns the statistical power of the majority of the analysis in the manuscript (a point already raised in the previous review and that according to the point-to-point response the authors claimed to have addressed). Most of the data (including new experiments and analysis) shown in Figure 1-7, 9-10 as well as in the supplementary figures have been performed on "3 replicates per genotype", and in some rare cases even two dot points are shown in the bar plots. There is no reference in the text about the number of litters or sex of the animals and in some experiments – like IUE – this choice of analysis and data collection might dangerously fall below standards and impact the significance of the results.

We show in our legends and Methods section the use of 3 different litters per genotype. We do not use less than 3 animals, if only two dots might have appeared in any plot, it could be because 2 dots are very close or overlapping. We do not specify the sex of our animals because in our first analysis in mutant lines we haven’t noticed any difference in cell identity markers between males and females.

Ribosome profiling: the text related to this experiments has become significantly more clear and the logics of the different analysis can be easily followed in the description. However, it is unfortunate that no attempt to resolve the ribosome profiling at the population level (or at least at layer level, as already shown for RNA datasets in multiple publications) has been made by the authors in this revision. This would have provided stronger evidence to the mechanisms underlying the protein alteration and brought an additional level of novelty to the work that the bulk profiling analysis is currently lacking.

We agree that polysome profiling methods with enhanced cellular resolution would have been helpful for this manuscript. However, these methods are just emerging. Once robust workflows are established, we too are convinced they will greatly enable progress in the future – not only in the field of cortical development.

In addition, although greatly improved in the flow, the manuscript will still benefit from a more rigorous analysis and quantitative approach to better support the general claims. More specifically:

– The quality of the NeuN images shown in Suppl Figure 2 are strongly divergent and do not look quite comparable. Has there any technical problem occurred that could motivate these differences?

We thank the reviewer for this comment. We have now shown better representative images that show consistent staining across genotypes.

– The nissl staining analysis as presented in Supplementary Figure 3 does not bring relevant information about the cytoarchitecture of the different models, as originally motivated in text, as no quantitative morphometric analyses have been performed, remaining merely qualitative. The overall figure will benefit for additional and improved imaging; indeed, multiple matching sections need to be considered to address overall brain architecture at comparable anatomical levels; higher quality images (the sections seem damaged at the pia level, and it is hard to discriminate the canonical tissue features of the cerebral cortex) coupled by punctual analysis of the higher magnification will help determine whether the evident impairment of the hippocampus observed in Pum cko – not claimed by the authors – is confirmed. Given the area phenotype observed, a more detailed analysis of the internal capsule and the somatic morphology of subcerebral PNs in different areas would have been extremely relevant and is currently missing. As presented, the current figure does not bring definitive support to the interpretations reported in the text and for the phenotype described is key to confirm the overall cytoarchitecture of the cerebral cortex: in several panels, indeed, the cortical thickness of the images shown is not comparable.

In our R2, we only claim cortical architecture is not impaired and we show better high magnification images for motor and prospective somatosensory cortex. We do not exclude any impairment in other brain structure especially the hippocampus in Pum2 mutants. Previous work has shown that Pum2 knockout affects hippocampal spine and synapse density. For R2, we have toned down our conclusion to say that cortical architecture is not impaired, which is related to our phenotype. Cortical thickness has been addressed with a high number of DAPI images with high number of animals in Figure 1—figure supplement 2b and it is shown not to be significantly impaired in either mutant.

In suppl. figure 7 there seem to be large differences in the overall cortical thickness where Pum2ko, ko and hz all show significant smaller cortices compare to the control.

Is this a matching problem, an unfortunate selection of the images or this line presents abnormalities in the cortical thickness? it is hard to conlcude such results from the data. It needs to be toned down.

Our detailed analysis of cortical thickness in WT and Pum2 cKO in Figure 1-Figure supplement 2b shows no differences in cortical thickness. We do not claim that cortical thickness is not impaired in hZ and Pum2KO since we haven’t analyzed this aspect there. However, in our view, Suppl figure 7 does not show huge differences in DAPI staining in cortical thickness (Layer VI to pial membrane) between the different genotypes.

– In the data reported about nuclear size, what cell types/layer is considered? no information are provided about where are those images shown in Figure suppl 2c are taken, neither if they represent any specific area of the cortex.

High magnification images at the level of somatosensory cortex were taken. They mostly cover layer IV and V since they mostly overlap with Ctip2 and Rorb stainings, and partly with layer VI and UL. For R2, we modified the text in the relevant figure legend to make this missing part clearer.

– Rorb staining in Figure 1 shows a great level of variability among the controls of each mouse lines, which is puzzling considering that the same antibody has been used and an automatic counting method has been used. Do the authors have any explanation for this discrepancy? it is important to assess how reliable is the difference observed in this marker expression. Moreover, in this case the TDP43 control becomes key to use as a reference for the mutant line.

The overall number of Rorb normalized to DAPI is almost 30% in both controls of both lines as shown in Figure 1-Figure supplement 5. The same antibody has been used in all experiments. However, an approximately 10% differences in lower cell number in single bins between both controls might arise from differences in binning system, subtle cortical thickness changes between pure wt and flox animals, different fixation, staining, imaging qualities. In general, the overall pattern is similar. This is not the case only for Rorb, but other markers. To reduce technical differences, we only use control littermates for each mutant line which are treated in the same way from the moment we take the pups until imaging.

https://doi.org/10.7554/eLife.55199.sa2

Article and author information

Author details

  1. Kawssar Harb

    Neuronal Translational Control Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, jointly conceived the project. KH planned and performed most experiments, analyzed, and interpreted data and wrote the manuscript with input from all authors who approved the final version., Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing
    For correspondence
    kawssar.harb@gmail.com
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3112-3084
  2. Melanie Richter

    Institute of Developmental Neurophysiology, Center for Molecular Neurobiology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany
    Contribution
    Data curation, Formal analysis, wrote the license application for IUEs and also planned and performed IUEs, Methodology, Writing – original draft, Writing – review and editing
    Contributed equally with
    Nagammal Neelagandan
    Competing interests
    No competing interests declared
  3. Nagammal Neelagandan

    Neuronal Translational Control Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Present address
    The Institute of Bioengineering (IBI), Ecole Polytechnique Federale de Lausanne (EPFL), Lausanne, Switzerland
    Contribution
    Data curation, Formal analysis, Methodology, planned, performed, analyzed, and interpreted data for CLIP-qRT-PCR and polysomes for TDP43A315T, Writing – review and editing
    Contributed equally with
    Melanie Richter
    Competing interests
    No competing interests declared
  4. Elia Magrinelli

    Department of Basic Neuroscience, University of Geneva, Geneva, Switzerland
    Contribution
    planned and performed CTB retrograde labeling, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5225-5713
  5. Hend Harfoush

    Neuronal Translational Control Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Present address
    Faculty of Science, Alexandria University, Alexandria, Egypt
    Contribution
    Data curation, Formal analysis, performed part of immunostaining and qPCR experiments and quantified FISH images, Methodology, Visualization
    Competing interests
    No competing interests declared
  6. Katrin Kuechler

    Neuronal Translational Control Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Present address
    University Children’s Research @ Kinder-UKE (UCR), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Contribution
    Data curation, generated plasmids for IUE, Methodology, Visualization
    Competing interests
    No competing interests declared
  7. Melad Henis

    1. Institute of Developmental Neurophysiology, Center for Molecular Neurobiology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany
    2. Department of Anatomy and Histology, Faculty of Veterinary Medicine, New Valley University, New Valley, Egypt
    Contribution
    Data curation, Formal analysis, planned and performed polysome profiling experiments with puromycin., Methodology
    Competing interests
    No competing interests declared
  8. Irm Hermanns-Borgmeyer

    Transgenic Service Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Contribution
    generated Pum2 mouse lines, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  9. Froylan Calderon de Anda

    Institute of Developmental Neurophysiology, Center for Molecular Neurobiology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany
    Contribution
    Conceptualization, Data curation, helped in planning and performing IUE experiments, coordinated the study, planned experiments, analyzed, and interpreted data., Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing
    For correspondence
    froylan.calderon@zmnh.uni-hamburg.de
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2743-7774
  10. Kent Duncan

    Neuronal Translational Control Group, Center for Molecular Neurobiology (ZMNH), University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany
    Present address
    Evotec SE, Manfred Eigen Campus, Essener Bogen 7, Hamburg, Germany
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, conceived the project,coordinated the study, planned experiments, analyzed, and interpreted data and wrote the manuscript with input from all above authors, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing
    For correspondence
    kent.duncan5@gmail.com
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4290-2670

Funding

Alexander von Humboldt-Stiftung

  • Kawssar Harb

Deutscher Akademischer Austauschdienst

  • Nagammal Neelagandan

Hamburg Landesforschungsfoerderung (LFF-FV27b/P9)

  • Kent Duncan

Deutsche Forschungsgemeinschaft (CA 1495/4-1 and CA 1495/7-1)

  • Froylan Calderon de Anda

ERA-NET NEURON (01 EW1910 and 01 EW2108B)

  • Froylan Calderon de Anda

JPND (BMBF,ED1806)

  • Froylan Calderon de Anda

Cultural Affairs and Missions Sector, Ministry of Higher Education of the Arab Republic of Egypt (seventh plan 2012-2017)

  • Melad Henis

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We especially thank Eva Kronberg for mouse colony management. We also thank Denis Jabaudon (Geneva, Switzerland) for retrograde labeling experiments, many helpful scientific discussions, and the pNeuroD-Cre-IRES-GFP plasmid. We also thank Christoph Janiesch for helpful advice on methods and technical assistance with qRT-PCR assays, Robin Scharrenberg for helpful advice on automated counting and planning of mice for in utero electroporations, Birgit Schwanke, Saskia Siegel, Maike Voß, Laura Maria Marcelin, Ayob Aleko, and Stine Behrman for technical assistance, and Jane Visvader (WEHI, Melbourne, Australia) and Bennett Novitch (UCLA, Los Angeles, USA) for antibodies. We also thank Laura Frangeul and Sarah Homann for initial help with CTB experiments and Pum2 KO mouse generation, respectively. The vector and ES cells used for Pum2 targeting were generated by the trans-NIH Knock-Out Mouse Project (KOMP) and obtained from the KOMP Repository (https://www.komp.org). NIH grants to Velocigene at Regeneron Inc (U01HG004085) and the CSD Consortium (U01HG004080) funded the generation of gene-targeted ES cells for 8500 genes in the KOMP Program and archived and distributed by the KOMP Repository at UC Davis and CHORI (U42RR024244). FCdA was supported by Deutsche Forschungsgemeinschaft (CA 1495/4-1 and CA 1495/7-1), ERA-NET NEURON (BMBF, 01 EW1910 and 01 EW2108B), and JPND (BMBF, ED1806). This work was supported by an Alexander von Humboldt Foundation Postdoctoral Fellowship to KH, a DAAD Doctoral Fellowship to NN, and a grant from the Hamburg Landesforschungsförderung to KED. MH was partially funded by a scholarship (ID: seventh plan 2012–2017) from the Cultural Affairs and Missions Sector, Ministry of Higher Education of the Arab Republic of Egypt.

Ethics

All animal care and experimental procedures were performed according to institutional guidelines of the UKE Ethical approvals or University of Geneva and relevant national law. In Hamburg, guidelines were those of the UKE Animal Research Facility (FTH) and conformed to the requirements of the German Animal Welfare Act. Ethical approvals were obtained from the State Authority of Hamburg, Germany (G10/107_Pumilio, G14/003_Zucht Neuro, ORG_520, and ORG_765). The Institutional Animal Care and Use Committee of the City of Hamburg, Germany approved all in utero electroporation experiments (Approval N086/2020 acc. to the Animal Care Act, §8 from May 18th, 2006).

Senior Editor

  1. Catherine Dulac, Harvard University, United States

Reviewing Editor

  1. Jeffrey Macklis, Harvard University, United States

Reviewer

  1. Jeffrey Macklis, Harvard University, United States

Publication history

  1. Received: January 15, 2020
  2. Accepted: February 25, 2022
  3. Version of Record published: March 9, 2022 (version 1)

Copyright

© 2022, Harb et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 655
    Page views
  • 89
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Kawssar Harb
  2. Melanie Richter
  3. Nagammal Neelagandan
  4. Elia Magrinelli
  5. Hend Harfoush
  6. Katrin Kuechler
  7. Melad Henis
  8. Irm Hermanns-Borgmeyer
  9. Froylan Calderon de Anda
  10. Kent Duncan
(2022)
Pum2 and TDP-43 refine area-specific cytoarchitecture post-mitotically and modulate translation of Sox5, Bcl11b, and Rorb mRNAs in developing mouse neocortex
eLife 11:e55199.
https://doi.org/10.7554/eLife.55199
  1. Further reading

Further reading

    1. Developmental Biology
    2. Genetics and Genomics
    Janani Ramachandran, Weiqiang Zhou ... Steven A Vokes
    Research Article Updated

    The larynx enables speech while regulating swallowing and respiration. Larynx function hinges on the laryngeal epithelium which originates as part of the anterior foregut and undergoes extensive remodeling to separate from the esophagus and form vocal folds that interface with the adjacent trachea. Here we find that sonic hedgehog (SHH) is essential for epithelial integrity in the mouse larynx as well as the anterior foregut. During larynx-esophageal separation, low Shh expression marks specific domains of actively remodeling epithelium that undergo an epithelial-to-mesenchymal transition (EMT) characterized by the induction of N-Cadherin and movement of cells out of the epithelial layer. Consistent with a role for SHH signaling in regulating this process, Shh mutants undergo an abnormal EMT throughout the anterior foregut and larynx, marked by a cadherin switch, movement out of the epithelial layer and cell death. Unexpectedly, Shh mutant epithelial cells are replaced by a new population of FOXA2-negative cells that likely derive from adjacent pouch tissues and form a rudimentary epithelium. These findings have important implications for interpreting the etiology of HH-dependent birth defects within the foregut. We propose that SHH signaling has a default role in maintaining epithelial identity throughout the anterior foregut and that regionalized reductions in SHH trigger epithelial remodeling.

    1. Developmental Biology
    Yanling Xin, Qinghai He ... Shuyi Chen
    Research Article

    N 6-methyladenosine (m6A) is the most prevalent mRNA internal modification and has been shown to regulate the development, physiology, and pathology of various tissues. However, the functions of the m6A epitranscriptome in the visual system remain unclear. In this study, using a retina-specific conditional knockout mouse model, we show that retinas deficient in Mettl3, the core component of the m6A methyltransferase complex, exhibit structural and functional abnormalities beginning at the end of retinogenesis. Immunohistological and single-cell RNA sequencing (scRNA-seq) analyses of retinogenesis processes reveal that retinal progenitor cells (RPCs) and Müller glial cells are the two cell types primarily affected by Mettl3 deficiency. Integrative analyses of scRNA-seq and MeRIP-seq data suggest that m6A fine-tunes the transcriptomic transition from RPCs to Müller cells by promoting the degradation of RPC transcripts, the disruption of which leads to abnormalities in late retinogenesis and likely compromises the glial functions of Müller cells. Overexpression of m6A-regulated RPC transcripts in late RPCs partially recapitulates the Mettl3-deficient retinal phenotype. Collectively, our study reveals an epitranscriptomic mechanism governing progenitor-to-glial cell transition during late retinogenesis, which is essential for the homeostasis of the mature retina. The mechanism revealed in this study might also apply to other nervous systems.