1. Immunology and Inflammation
  2. Stem Cells and Regenerative Medicine
Download icon

β-catenin and γ-catenin are dispensable for T lymphocytes and AML leukemic stem cells

  1. Xin Zhao
  2. Peng Shao
  3. Kexin Gai
  4. Fengyin Li
  5. Qiang Shan
  6. Hai-Hui Xue  Is a corresponding author
  1. Center for Discovery and Innovation, Hackensack University Medical Center, United States
  2. Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa, United States
  3. Hefei National Laboratory for Physical Sciences at Microscale, the CAS Key Laboratory of Innate Immunity and Chronic Disease, School of Basic Medical Sciences, Division of Life Sciences and Medicine, University of Science and Technology of China, China
  4. New Jersey Veterans Affairs Health Care System, United States
Short Report
  • Cited 4
  • Views 976
  • Annotations
Cite this article as: eLife 2020;9:e55360 doi: 10.7554/eLife.55360


The β-catenin transcriptional coregulator is involved in various biological and pathological processes; however, its requirements in hematopoietic cells remain controversial. We re-targeted the Ctnnb1 gene locus to generate a true β-catenin-null mutant mouse strain. Ablation of β-catenin alone, or in combination with its homologue γ-catenin, did not affect thymocyte maturation, survival or proliferation. Deficiency in β/γ-catenin did not detectably affect differentiation of CD4+T follicular helper cells or that of effector and memory CD8+ cytotoxic cells in response to acute viral infection. In an MLL-AF9 AML mouse model, genetic deletion of β-catenin, or even all four Tcf/Lef family transcription factors that interact with β-catenin, did not affect AML onset in primary recipients, or the ability of leukemic stem cells (LSCs) in propagating AML in secondary recipients. Our data thus clarify on a long-standing controversy and indicate that β-catenin is dispensable for T cells and AML LSCs.


β-catenin is a known transcriptional coregulator that interacts with transcription factors in the Tcf/Lef family and others to modulate gene expression (Cadigan, 2012; Mosimann et al., 2009). β-catenin protein is regulated through post-translational modifications. Phosphorylation at a cluster of Ser/Thr residues in its N-terminus results in proteasome-mediated degradation of β-catenin (Cadigan, 2012; Mosimann et al., 2009). Activation of several signaling pathways such as Wnt and prostaglandin E2 leads to inactivation of the kinases that are responsible for β-catenin phosphorylation and therefore accumulation of β-catenin protein (Goessling et al., 2011; Klaus and Birchmeier, 2008). Due to its strong impact on transcription, the activity of β-catenin is tightly controlled, with aberrant β-catenin activation frequently associated with malignant transformation and various cancers (Clevers and Nusse, 2012). In the hematopoietic system, modest activation of β-catenin has been shown to have beneficial effects, such as extending survival of thymocytes (Xie et al., 2005) and regulatory T cells (Ding et al., 2008), promoting expansion of memory CD8+ T cells (Gattinoni et al., 2009; Zhao et al., 2010). However, excessive β-catenin activation, through deletion of exon 3 of Ctnnb1 gene (which encodes the Ser/Thr cluster in β-catenin protein), has detrimental effects on the function of hematopoietic stem cells (HSCs) (Kirstetter et al., 2006; Scheller et al., 2006), blocks thymocyte maturation and promotes thymocyte transformation (Guo et al., 2007b).

Whereas it is clear that β-catenin activation bears strong biological effects on blood cells, the requirement for β-catenin has been controversial. During thymocyte maturation, for example, genetic deletion of exons 3–6 of the Ctnnb1 gene caused modest developmental blocks and modest reduction in thymic cellularity (Xu et al., 2003). In other reports, however, no thymocyte maturation defects were observed when Ctnnb1 exons 2–6 were inducibly deleted with Mx1-Cre (Cobas et al., 2004), or in chimeric mice reconstituted with fetal liver cells lacking β-catenin and its homologue, γ-catenin (Jeannet et al., 2008; Koch et al., 2008). Additionally, mature CD8+ T cells in these β-catenin-targeted models showed intact response to viral infections (Driessens et al., 2010; Prlic and Bevan, 2011). On the other hand, among the Tcf/Lef family transcription factors (TFs) that interact with β-catenin, Tcf1 and Lef1 are expressed in T lineage cells (Staal et al., 2008; Xue and Zhao, 2012). Null mutations of Tcf1 alone or together with Lef1 show more profound T cell developmental blocks and more severe decrease in thymic cellularity (Germar et al., 2011; Okamura et al., 1998; Verbeek et al., 1995; Weber et al., 2011; Yu et al., 2012b). Recent studies also revealed multifaceted roles of Tcf1 in mature T cell responses including differentiation of follicular helper T cells (Choi et al., 2015; Raghu et al., 2019; Wu et al., 2015; Xu et al., 2015). These discrepancies have posed a major challenge in the past two decades as to the true requirements for β-catenin and its connection with Tcf/Lef TFs in hematopoietic cells.

One notable observation is that both Ctnnb1-targeted strains used in previous studies retain a truncated protein in hematopoietic cells (Jeannet et al., 2008). The Ctnnb1 gene has 15 exons, deletion of exons 2–6 or exons 3–6 in both models (Brault et al., 2001; Huelsken et al., 2000) may have allowed in-frame translation from downstream exons, giving rise to an N-terminally truncated β-catenin protein of 40–50 kDa. Because the N-terminus of β-catenin contains phosphorylation sites for ubiquitin-dependent degradation, an N-terminally truncated form of β-catenin protein has longer half-life, and its ectopic expression has been shown to stimulate proliferation and apoptosis of intestinal crypts (Wong et al., 1998). In addition, a C-terminally truncated β-catenin is a naturally occurring β-catenin paralog in planarians, and acts as a negative regulator of full-length β-catenin during planarian eye photoreceptor specification (Su et al., 2017). Therefore, the presence of the truncated β-catenin protein in previously β-catenin-targeted models may functionally compensate for loss of full-length β-catenin, underlying the lack of severe defects in T cell development or mature T cell responses. On the other hand, the truncated β-catenin protein may function as a dominant negative, and this possibility then raises questions on observed requirements for β-catenin using the existing β-catenin-targeted models. For example, β-catenin is considered essential for self-renewal of leukemic stem cells (LSCs) in both chronic and acute myeloid leukemia (CML and AML, respectively) (Hu et al., 2009; Wang et al., 2010; Yeung et al., 2010; Zhao et al., 2007). This work aims to address these long-standing questions.

Results and discussion

We previously obtained the Ctnnb1 exons 2–6 floxed model (Brault et al., 2001). We aimed to ablate β-catenin protein in all hematopoietic cells using Vav-Cre, but found accumulation of a truncated form of β-catenin protein of approximately 40 kDa in bone marrow (BM) cells (Figure 1—figure supplement 1), consistent with a previous report (Jeannet et al., 2008). To achieve complete ablation of β-catenin protein, we re-targeted the Ctnnb1 gene locus by inserting LoxP sites into introns 1 and 14, respectively (Figure 1A) so that a Cre recombinase removes 13 of a total of 15 Ctnnb1 exons. The resulting Ctnnb1-floxed mice were crossed with a strain that expresses Cre recombinase and estrogen receptor fusion protein (Cre-ERT2) in the ubiquitously expressed Rosa26 locus (Guo et al., 2007a). We maintained a single Rosa26Cre-ERT2 allele in all mice used in this study (referred to as CreER+ for simplicity), so as to avoid dose-dependent effects by tamoxifen and/or Cre. Lineage-negative BM cells and peripheral T cells from CreER+Ctnnb1fl/fl mice were cultured in vitro with tamoxifen or its carrier solvent, DMSO, and immunoblotting validated effective ablation of β-catenin protein without generating truncated form(s) (Figure 1B). A band of 50 kDa was detected in both tamoxifen- and DMSO-treated T cells, which was considered non-specific because its size was larger than the truncated β-catenin protein resulting from translation from downstream exons (compare with Figure 1—figure supplement 1). These analyses validate that the new targeting strategy can generate a true β-catenin null mutation.

Figure 1 with 5 supplements see all
β-catenin null mutation alone or combined deletion with γ-catenin did not detectably affect thymocyte development.

(A) Targeting strategy to generate β-catenin null mutant mouse strain. All Ctnnb1 exons are shown, with red triangles denoting LoxP sites and red arrows denoting genotyping primers. Shown in the lower panel is partial Ctnnb1 transcript with blue arrows marking RT-PCR primers. (B) Ex vivo β-catenin ablation. Lineage-negative BM cells and splenic CD3+ T cells were isolated from CreER+Ctnnb1fl/fl mice and cultured with DMSO or tamoxifen followed by immunoblotting for β-catenin and β-actin with the latter as equal loading control. (C) Experimental design for generation of BM chimeras and analysis. (D) In vivo β-catenin ablation. BM chimeras reconstituted with WT or CreER+Ctnnb1fl/fl BM cells were treated with tamoxifen as in C). CD45.2+ total thymocytes, TCRβ+ splenocytes, or total BM cells were sorted and immunoblotted for β-catenin and β-actin. Data from two independent experiments are shown. In (B and D), the 50 kDa band that appeared in some blots are considered non-specific reactivity to the anti-β-catenin antibody. Refer to Figure 1—figure supplement 1 for size comparison with a truncated β-catenin protein produced from Ctnnb1 exons 2–6-targeted allele. (E) Thymic cellularity. WT, CreER+Ctnnb1fl/fl, or CreER+Ctnnb1fl/flJupfl/fl BM chimeras were treated with tamoxifen as in C), and CD45.2+ thymocytes were enumerated. (F) Detection of thymic maturation stages. CD45.2+ thymocytes were surface-stained with biotinylated lineage markers (minus CD3ε) to exclude non-T cells, and with CD4 and CD8 to identify DN, DP, CD4+ and CD8+ subsets. (G) Detection of DN subsets. CD45.2+ DN thymocytes were surface-stained with CD44 and CD25 to identify DN1 to DN4 subsets. In panels (E–G), values in representative contour plots denote percentages, and bar graphs are cumulative data of means ± s.d. from ≥3 experiments. None of the parameters was statistically significant among the groups as determined by one-way ANOVA, and thus unmarked for clarity.

Figure 1—source data 1

Source files, containing original data for Figure 1E,F and G, to document thymic cellularity (E), frequency of thymocyte subsets at different developmental stages (F, G).


When the whole mice were treated with tamoxifen in vivo for four consecutive days, however, CreER+Ctnnb1fl/fl mice exhibited morbidity within 10 days, while CreER+Ctnnb1+/+ mice remained healthy (Figure 1—figure supplement 2), indicating ablating β-catenin in multiple organs may have severely compromised vital functions. To specifically address the function of β-catenin in hematopoietic cells, we transplanted BM cells from CD45.2+ CreER+Ctnnb1+/+ (WT) or CreER+Ctnnb1fl/fl mice into irradiated CD45.1+ recipients (Figure 1C). After ≥6 weeks when the BM chimeras were stably established, treatment of the recipients with the same tamoxifen regimen did not cause lethality (not shown). Effective ablation of β-catenin was observed in sorted CD45.2+CreER+Ctnnb1fl/fl thymocytes, splenic T cells, and total BM cells (Figure 1D). We further determined the efficacy of deleting floxed exons in genomic DNAs, where the PCR products from F1 and R1 primers were detected from the WT Ctnnb1 allele (Figure 1A), but were barely detectable in sorted CD45.2+ BM cells from tamoxifen-treated CreER+Ctnnb1fl/fl recipients (Figure 1—figure supplement 3A). On the other hand, PCR products from the F1 and R2 primer combination were only detected after the intervening exons were deleted (Figure 1—figure supplement 3A). Effective deletion of Ctnnb1 transcripts was also validated by RT-PCR using primer 13F (complementary to the deleted exon 13) in combination with primer 15R (complementary to undeleted exon 15) (Figure 1—figure supplement 3B). These characterizations further validated that null mutation of β-catenin is achieved in vivo in all hematopoietic cells in the BM chimeras.

To directly address the functional redundancy between β-catenin and its homologue γ-catenin (encoded by Jup), we crossed the Jupfl/fl strain (Demireva et al., 2011) with CreER+Ctnnb1fl/fl mice to produce CreER+Ctnnb1fl/flJupfl/fl mice and generated BM chimeras as in Figure 1C. Excision of the floxed Jup exons 3–5 after tamoxifen treatment was validated in genomic DNAs from sorted CD45.2+ BM cells with similar strategy as above (Figure 1—figure supplement 4A). The PCR products from Jup F1 and R1 primers detected from the WT Jup allele in WT cells were greatly diminished in tamoxifen-treated CreER+Ctnnb1fl/flJupfl/fl cells, while PCR products from Jup F1 and R2 primer combination were only detected in the latter (Figure 1—figure supplement 4B). On the mRNA level, Jup transcripts were only one fiftieth as abundant as Ctnnb1 transcripts in WT cells, but both Jup and Ctnnb1 transcripts were effectively deleted in tamoxifen-treated CreER+Ctnnb1fl/flJupfl/fl BM cells (Figure 1—figure supplement 4C). Consistent with low Jup transcript abundance, detection of γ-catenin protein in WT or targeted BM cells proved to be challenging; however, γ-catenin protein was readily detectable in WT hepatocytes and was greatly diminished in hepatocytes in tamoxifen-treated CreER+Ctnnb1fl/flJupfl/fl mice (non-BM chimeras, Figure 1—figure supplement 4D). These analyses validated effective ablation of γ-catenin in our experimental system.

Following tamoxifen-induced target gene deletion in the chimeras, total thymic cellularity was similar in WT chimeras and those lacking β-catenin alone or both β-catenin and γ-catenin (Figure 1E). Thymocyte maturation follows sequential stages from CD4CD8double negative (DN) to CD4+CD8+double positive (DP) followed by further differentiation to CD4+ or CD8+ single positive cells. Each thymic subset was detected at similar frequency among all genotypes examined (Figure 1F). By intracellular staining of Ki67, DN and DP cells exhibited more active proliferation than CD4+ and CD8+ thymocytes, and each subset showed similar frequency of Ki67+ cells among all genotypes (Figure 1—figure supplement 5A). Detection of active Caspase-3/7 revealed that DN thymocytes showed modestly increased susceptibility to apoptosis than thymocytes in later stages, and each subset showed similar frequency of Caspase-3/7+ cells among all genotypes (Figure 1—figure supplement 5B). In addition, subfractionating the DN thymocytes based on CD25 and CD44 expression showed that distribution of DN1-4 subsets was similar among all genotypes (Figure 1G). A cohort of CreER+ WT and CreER+Ctnnb1fl/flJupfl/fl BM chimeras (n = 5 each) was monitored for 16 weeks after tamoxifen treatment, and none of these mice showed signs of malignant transformation of thymocytes or other hematopoietic lineage cells. These analyses showed that complete loss of β-catenin or both β- and γ-catenin did not detectably cause T cell developmental blocks, or alterations in thymocyte proliferative capacity or survival.

In response to acute viral infections, antigen-specific mature CD4+ and CD8+ T cells mount protective immune responses by clonal expansion and differentiation into functional effector cells. To test the requirements for β-catenin and γ-catenin in mature T cell responses, we infected tamoxifen-treated BM chimera with lymphocytic choriomeningitis virus Armstrong strain (LCMV-Arm) to elicit acute viral infection. Activated CD4+ T cells predominantly differentiate into CXCR5SLAMhi T helper 1 (TH1) and CXCR5+SLAMloT follicular helper (TFH) lineage cells (Crotty, 2014). TFH cells depend on Tcf1 and Lef1 for Bcl6 induction and further differentiation (Choi et al., 2015; Wu et al., 2015; Xu et al., 2015); in contrast, deletion of β-catenin alone or in combination with γ-catenin did not affect the frequency of TH1 or TFH cells at the peak response (i.e., 8 days post-infection, dpi) (Figure 2A). In addition, Bcl6-expressing germinal center (GC)-TFH cells were detected at similar frequency among all genotypes (Figure 2B), suggesting that β-catenin and γ-catenin are not essential for TFH cell differentiation. Whereas TFH cells maintain Tcf1 expression similar to naïve CD4+ T cells (Gullicksrud et al., 2017), fully differentiated cytotoxic effector CD8+T cells downregulate Tcf1 (Gullicksrud et al., 2017; Zhao et al., 2010). Consistent with this Tcf1 expression pattern, loss of Tcf1 has little impact on differentiation of effector CD8+T cells (Shan et al., 2017; Zhou et al., 2010). Not surprisingly, deletion of β-catenin alone or both β/γ-catenin did not detectably affect generation of antigen-specific effector CD8+T cells, identified as IFN-γ-producing cells upon stimulation with peptides derived from the LCMV glycoprotein (GP) 33 epitope (Figure 2C). The GP33-specfic effector CD8+T cells showed similar capacity of producing TNF-α and similar expression of granzyme B among all genotypes (Figure 2C,D), suggesting that β-catenin and γ-catenin are dispensable for CD8+ T cells to differentiate into functional cytotoxic T cells.

β-catenin and γ-catenin are not required for T cell responses to acute viral infection.

BM chimeras were established and treated with tamoxifen as in Figure 1C, and infected with LCMV. The infected mice were analyzed on eight dpi for effector (A–D) and ≥40 dpi for memory phase responses (E, F). (A) Detection of CXCR5+SLAMlo TFH and CXCR5SLAMhi TH1 cells in CD45.2+ CD44hiCD62L activated CD4+ splenocytes on eight dpi by cell surface staining. (B) Detection of CXCR5+Bcl6+ GC-TFH cells in CD45.2+ CD44hiCD62L activated CD4+ splenocytes on eight dpi by intranuclear staining. (C) Detection of IFN-γ and/or TNF-α-producing cells in CD45.2+CD8+ splenocytes on eight dpi by intracellular staining after 5 hr incubation with GP33 peptides. (D) Detection of granzyme B expression in CD45.2+ CD11ahi activated CD8+ splenocytes on eight dpi by intracellular staining. Values in half-stacked histograms denote geometric mean fluorescence intensity (gMFI). (E) Detection of CXCR5+ memory TFH cells in CD45.2+CD44hi antigen-experienced CD4+ splenocytes on ≥40 dpi by cell surface staining. (F) Detection of IFN-γ and/or TNF-α-producing memory CD8+ T cells in CD45.2+CD8+ splenocytes on ≥40 dpi by intracellular staining after 5 hr incubation with GP33 peptides. In all panels, values in representative contour plots denote percentages, and cumulative data are means ± s.d. from two experiments. *, p<0.05 by Student’s t-test; all other unmarked parameters were not statistically significant among the groups as determined by one-way ANOVA (A–D) or Student’s t-test (E, F).

Figure 2—source data 1

Source files, containing original data for Figure 2A–F, to document frequency of antigen-specific Tfh cells (A, B) and CD8 T cells (C), expression of Granzyme B in CD8 T cells (D) at the effector response phase, and the frequency of antigen-specific Tfh cells (E) and CD8 T cells (F) at the memory phase.


After the peak responses that resolve acute infections, a fraction of antigen-specific T cells persists as memory T cells (Martin and Badovinac, 2014). Tcf1 is expressed in long and short isoforms with the former having the capacity of interacting with β-catenin through its N-terminal domain (Staal et al., 2008; Xue and Zhao, 2012). Previously we ablated the Tcf1 long isoform, which led to profound reduction of memory TH1 and TFH cells (Gullicksrud et al., 2017). Tcf1 is also required for memory CD8+ T cells (Jeannet et al., 2010; Zhou et al., 2010). To determine if β-catenin and γ-catenin are required for memory T cells, we analyzed the infected BM chimeras at ≥40 dpi. During 15–16 and 30–31 dpi, we added two rounds of tamoxifen treatment to the LCMV-infected BM chimeras, so as to prevent rebound of undeleted cells and ensure persistent deletion of β/γ-catenin proteins. CXCR5+ memory TFH cells were detected at similar frequency in WT and β/γ-catenin-null BM chimeras (Figure 2E). GP33-specific memory CD8+ T cells were not diminished in β/γ-catenin-null BM chimeras and preserved similar capacity of producing TNF-α (Figure 2F). Collectively, loss of β-catenin and γ-catenin did not detectably affect T cell responses at either effector or memory phase.

β-catenin ablation using previously Ctnnb1-targeted models did not show potent impact on maintenance of HSCs (Ruiz-Herguido et al., 2012; Zhao et al., 2007). Consistent with these observations, null mutation of β-catenin alone or both β/γ-catenin did not affect BM cellularity (Figure 3A), or the frequency of LinSca1+c-Kit+ (LSK) cells, in which HSCs were enriched (Figure 3B). HSCs with long-term repopulation capacity, as marked by CD150+CD48 phenotype, were detected at similar frequency among all genotypes (Figure 3B), suggesting that loss of β/γ-catenin did not perturb HSC homeostasis.

Figure 3 with 2 supplements see all
β-catenin is not essential for HSC homeostasis and AML LSC self-renewal.

(A–B) BM chimeras were established and treated with tamoxifen as in Figure 1C, and analyzed for CD45.2+ BM cellularity (A), LSKs and HSCs by cell surface staining (B). Values in representative contour plots (B) denote percentages, and cumulative data on frequency of LSKs or HSCs are means ± s.d. from two experiments. None of the parameters was statistically significant among the groups as determined by one-way ANOVA. (C) Experimental design for modeling AML initiation and propagation in mice. After initial tamoxifen (Tam) treatments for four consecutive days, the 1o recipients and 2o recipients were subjected to recurring Tam treatment for three consecutive days at 4 week intervals to ensure long-term elimination of targeted proteins from the floxed alleles. For 1o recipients, MLL-AF9 retrovirus-infected LinBM cells containing 104 GFP+LincKit+ cells were transplanted. For 2o recipients, 103 LSCs were sorted from 1o recipients at 4 weeks after initial transplantation and then transplanted. GOI, gene of interest. (D) Complete deletion of β-catenin in AML cells as determined by immunoblotting of sorted CD45.2+GFP+Mac1+ BM cells from 1o recipients on day 28 after BM transplantation, where WT and Ctnnb1-floxed cells were subjected to two rounds of tamoxifen treatment. (E) Kaplan-Meier survival curves of 1o and 2o recipients of WT or β-catenin-deficient LSCs. Data are pooled from two independent experiments. ns, not statistically significant as determined by log-rank test. (F) Longitudinal tracking of CD45.2+GFP+Mac1+ AML leukemic cells in PBCs of 2o recipients. For week 8, the surviving recipients were analyzed. Data from two independent experiments were displayed separately because modest differences were observed in kinetics of leukemic cell expansion at week 4. These differences did not affect recipient survival (see E). **, p<0.01; ***, p<0.001 by Student’s t-test.

Figure 3—source data 1

Source files, containing original data for Figure 3A,B and F, to document BM cellularity (A), and frequency of LSKs and Slam HSCs in BM cells (B), and leukemia burden in peripheral blood of AML receipt mice (F).


Unlike HSCs, AML LSCs have been reported to critically depend on β-catenin using the MLL-AF9 or MLL-ENL mouse models (Wang et al., 2010; Yeung et al., 2010). To reappraise this requirement with our new animal model, we used the same MLL-AF9 AML model by retroviral delivery of the fusion protein (co-expressed with GFP) into Lin BM cells from tamoxifen-treated CreER+ WT or CreER+Ctnnb1fl/fl BM chimeras (Figure 3C). The MLL-AF9-GFP-infected Lin BM cells were then transplanted into CD45.1+ primary (1o) recipients (Figure 3C). Because tamoxifen-mediated target gene ablation may not achieve 100% deletion efficiency in all cells, rare non-deleted cells could have growth advantage over β-catenin-deficient cells, especially in long-term studies such as LSC serial transplantation. To eliminate potential outgrowth of the rare non-deleted cells, we took the approach of recurring tamoxifen treatments at a standardized interval. Our optimizing experiments found that following the initial 4 doses of tamoxifen administration, 3 doses of tamoxifen delivery at 4 week intervals sustained elimination of β-catenin protein in Ctnnb1-targeted cells with minimal impact on hematopoietic cellularity. The efficacy of this regimen was validated by immunoblotting for β-catenin in CD45.2+GFP+Mac1+ AML cells in the BM of 1o recipients (Figure 3D). The 1o recipients in both groups showed similar rate of survival (Figure 3E), suggesting that β-catenin null mutation did not affect the onset of AML.

To specifically investigate self-renewal of AML LSCs, we sort-purified CD45.2+GFP+LinMac1loc-Kithi Sca1loCD16/CD32hi cells as AML LSCs from the 1o recipients (see Figure 3—figure supplement 1 for gating strategy), followed by transplantation into secondary (2o) recipients (Figure 3C). Both WT and β-catenin-deficient AML LSCs showed similar capacity of propagating AML as determined by longitudinal tracking of CD45.2+Mac1+ GFP+ AML leukemia burden in peripheral blood cells (PBCs, Figure 3F), and by the survival rate of 2o recipients (Figure 3E). In an independent experiment, 2o recipients of β/γ-catenin-deficient AML LSCs showed similar survival as those of WT or β-catenin-deficient LSCs (Figure 3—figure supplement 2). These data collectively argue against an essential role of β-catenin for AML LSCs.

To further substantiate the unexpected lack of impact on AML LSCs by null mutation of β/γ-catenin, we extended our AML studies to determine a requirement for Tcf/Lef family TFs that interact with β-catenin. There are four members in the Tcf/Lef family: Tcf1, Lef1, Tcf3 and Tcf4 (encoded by Tcf7, Lef1, Tcf7l1, and Tcf7l2, respectively). To fully address functional redundancy among Tcf/Lef family TFs, we used Tcf7l1-targeted murine embryonic stem (ES) cells generated by the International Knockout Mouse Consortium (Figure 4A) to produce Tcf7l1fl/fl mouse strain. By crossing with CreER and Tcf7l2fl/fl (Angus-Hill et al., 2011) strains, we generated CreER+Tcf7l1fl/flTcf7l2fl/fl (CreER+Tcf3/4-dKO) mice. This line was further crossed with our established CreER+Tcf7fl/flLef1fl/fl (CreER+Tcf1/Lef1-dKO) mice (Yu et al., 2016) to generate CreER+Tcf7fl/flLef1fl/flTcf7l1fl/flTcf7l2fl/fl mice (called CreER+Tcf-qKO herein). Following treatment with the same tamoxifen regimen as above, the CreER+Tcf-qKO mice did not exhibit early lethality, and Tcf1 and Lef1 proteins were ablated in thymocytes of CreER+Tcf1/Lef1-dKO mice as determined by intracellular staining (Figure 4B). While ablation of Tcf4 protein was also effective in thymocytes as determined by immunoblotting (Figure 4B), Tcf3 protein was not reliably detected in thymocytes or BM cells (not shown), likely due to its expression in very low abundance (see Figure 4C). It should be noted that deletion efficacy for Tcf3 protein was independently verified in mouse embryonic fibroblasts in a recent report using the same ES clone (Mašek et al., 2016). We further verified with quantitative RT-PCR that the targeted exon in Tcf7l1 transcripts was as effectively deleted as that in Tcf7l2 transcripts, in spite of the low abundance (Figure 4C). Tamoxifen treatment resulted in >90% reduction in thymic cellularity in CreER+Tcf1/Lef1-dKO and CreER+Tcf-qKO mice, but did not detectably affect CreER+Tcf3/4-dKO thymocyte numbers (Figure 4D). Consistent with a requirement for Tcf1 for DP thymocyte survival (Ioannidis et al., 2001), tamoxifen-treated CreER+Tcf1/Lef1-dKO and CreER+Tcf-qKO mice showed profound reduction in DP thymocyte frequency, with concomitant relative increase in CD4+ and CD8+ single positive thymocyte frequency (Figure 4E). Within the DN compartment, CreER+Tcf1/Lef1-dKO and CreER+Tcf-qKO mice both showed DN1 accumulation and apparent loss of DN2 thymocytes (Figure 4F), in line with a key function of Tcf1 in specification of early thymic progenitors to T cell lineage (Germar et al., 2011; Weber et al., 2011). In all these critical aspects, CreER+Tcf3/4-dKO mice exhibited little or modest changes; furthermore, the defects observed in CreER+Tcf1/Lef1-dKO mice were not detectably more exacerbated in CreER+Tcf-qKO mice with additional deletion of Tcf3 and Tcf4. Taken together, these observations suggest that Tcf3 and Tcf4 are not essential for thymopoiesis and further validate critical function of Tcf1 and Lef1 among the Tcf/Lef family in T cell development.

Tcf/Lef TFs are critical for T cell development but not essential for AML LSC self-renewal.

(A) Targeting strategy for Tcf7l1 gene locus. Yellow boxes denote exons, with exon numbers marked on top. Exon six is flanked with two LoxP sites (marked with red triangles). The LacZ/Neo cassette flanked by Frt Sites (cyan wedges) was removed with Flippase in germline-transmitted mice. (B) In vivo ablation of Tcf/Lef proteins. CreER+ WT, Tcf1/Lef1 dKO, and Tcf3/4 dKO mice were treated with tamoxifen for four consecutive days. Three days later, total thymocytes were intracellularly stained for Tcf1 and Lef1 in Tcf1/Lef1 dKO and control mice, and values denote geometric mean fluorescent intensity in representative half-stacked histograms (left panels). Total thymocytes were immunoblotted for Tcf4 protein in Tcf3/4 and control mice (right panel). (C) Validation of efficient deletion of targeted Tcf7l1 and Tcf7l2 exons in hematopoietic stem/progenitor cells. CreER+Tcf-qKO and WT mice were treated with tamoxifen for four consecutive days, and two days later, Flt3LSK cells, which were enriched in both long-term and short-term HSCs, were sort-purified and analyzed by quantitative RT-PCR. Relative expression of Tcf7l1 and Tcf7l2 was determined by normalizing to Hprt, and shown as means ± s.d. (n = 5). NRD, not reliably detected. (D) Thymic cellularity. CreER+ WT, Tcf1/Lef1 dKO, Tcf3/4 dKO, and Tcf-qKO mice were treated with tamoxifen as in B), and thymocytes were enumerated. (E) Detection of thymic maturation stages. Thymocytes were surface-stained with biotinylated lineage markers (minus CD3ε) to exclude non-T cells, and with CD4 and CD8 to identify DN, DP, CD4+ and CD8+ subsets. (F) Detection of DN subsets. DN thymocytes were surface-stained with CD44 and CD25 to identify DN1 to DN4 subsets. Note that deletion of Tcf1 and Lef1, as in Tcf1/Lef1 dKO and Tcf-qKO mice, caused premature, modest upregulation of CD25 in a portion of DN1 cells, and the gate was adjusted accordingly to demarcate DN1 and DN2 subsets. Data in D–F are means ±s.d. from ≥2 experiments. Statistical significance for multiple groups was first assessed by one-way ANOVA, and that for indicated pair comparison was determined with Tukey’s correction. *, p<0.05; **, p<0.01; ***, p<0.001; ns, not statistically significant. In F), n = 2 for Tcf1/Lef1 dKO, and thus no p values are shown. (G) Kaplan-Meier survival curves of 1o and 2o recipients of WT or Tcf-qKO LSCs. Data are pooled from two independent experiments. ns, not statistically significant as determined by log-rank test. (H) Longitudinal tracking of CD45.2+GFP+Mac1+ AML leukemic cells in PBCs of 2o recipients. For week 8, the surviving recipients were analyzed. Data from two independent experiments were displayed separately because modest differences were observed in kinetics of leukemic cell expansion at week 4. These differences did not affect recipient survival (see G). ns, not statistically significant as determined by Student’s t-test.

Figure 4—source data 1

Source files, containing original data for Figure 4D–H, to document thymic cellularity (D), frequency of thymocyte subsets at different developmental stages (E, F), and leukemia burden in peripheral blood of AML receipt mice (G).


Given the demonstrated efficacy of ablating Tcf/Lef factors in hematopoietic cells, we extended our studies to investigate their requirement in AML LSCs. We used Lin BM cells from tamoxifen-treated CreER+ WT or CreER+Tcf-qKO mice directly for the AML studies, without establishing BM chimeras. The 1o recipients of MLL-AF9-infected Tcf-qKO BM cells showed similar survival rate as those of WT BM cells (Figure 4G), indicating ablation of all four Tcf/Lef TFs did not affect AML onset. In addition, WT and Tcf-qKO AML LSCs isolated from the 1o recipients showed similar capacity of propagating AML leukemic cells in PBCs in 2o recipients (Figure 4H), resulting in similar survival rate of the 2o recipients (Figure 4G). Collectively, our data do not support an essential requirement for Tcf/Lef and β-catenin proteins in AML LSCs. It is of note that the lack of impact on AML LSCs by ablating Tcf/Lef TFs or β-catenin was not due to technical issues, because we have used the same protocol to demonstrate that 1) constitutive activation of non-canonical NF-κB pathway (Xiu et al., 2018) or 2) genetic ablation of Groucho/TLE corepressors (to be described elsewhere) impairs AML LSC self-renewal.

By use of the newly established β-catenin null mutation, this study clarifies on a long-standing controversy and provides more conclusive evidence indicating that β-catenin and γ-catenin are not essential for thymocyte development, T cell responses to viral infection at either effector or memory phase. This is in stark contrast to the versatile functions described for Tcf1 and Lef1 in T lineage cells (Raghu et al., 2019). We previously showed that deletion of the N-terminal domain in Tcf1, which abrogates interaction with β-catenin, does reduce thymic cellularity and compromise TFH cell differentiation at effector and memory phases (Gullicksrud et al., 2017; Xu et al., 2017). Given the apparent lack of impact upon β/γ-catenin deletion, Tcf1 may engage coactivators other than β-catenin to exert those biological functions. Indeed, we recently reported that Tcf1 interacts with a Ser21-phosphorylated form of Ezh2 to cooperatively induce Bcl6 and Icos during TFH cell differentiation in response to acute viral infection (Li et al., 2018). It may thus be fruitful to search for novel Tcf1 partners in developing thymocytes and antigen-responding mature T cells (Steinke and Xue, 2014).

It is surprising that ablation of neither β-catenin nor Tcf/Lef TFs affected LSC self-renewal in the AML mouse model. The reported requirements for β-catenin using previously Ctnnb1-targeted mouse strains may be likely ascribed to unwanted effects by the truncated β-catenin protein. Although genetic alterations in Wnt-β-catenin pathway components are not among the primary driver mutations of AML (Papaemmanuil et al., 2016; Tyner et al., 2018), frequent translocation products including MLL-AF9 result in elevated β-catenin accumulation (Lane et al., 2011; Müller-Tidow et al., 2004). Our data do not refute the facts that aberrant activation of β-catenin has pathological effects, and there is no denial of therapeutic values in inhibiting Wnt-β-catenin pathway for debulking AML blasts. The findings in this study nonetheless caution that for the purpose of eradicating AML LSCs, targeting β-catenin may not be as effective as previously hoped.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
Genetic reagent
(Mus. musculus)
C57BL/6JJackson LaboratoryRRID:IMSR_
Genetic reagent
(Mus. musculus)
Ctnnb1fl/flThis paperCtnnb1 exons 2–14 floxed. Send reagent request to haihui.xue@hmh-cdi.org
Genetic reagent
(Mus. musculus)
Genetic reagent
(Mus. musculus)
Genetic reagent
(Mus. musculus)
Genetic reagent
(Mus. musculus)
Tcf7l1fl/flThis paperTcf7l1 Exonsix floxed. Send reagent request to haihui.xue@hmh-cdi.org
Genetic reagent
(Mus. musculus)
Strain, strain background (virus)Lymphocytic choriomeningitis virus Armstrong strain E-350ATCCVR-1271
Antibodyanti-β-catenin (Mouse monoclonal)BD BiosciencesCat. No.
Clone 14
IB (1:2000)
Antibodyanti-γ-catenin (Mouse monoclonal)BD BiosciencesCat. No. 610253
Clone 15
IB (1:2000)
(Rabbit monoclonal)
Cell Signaling TechnologyCat. No. 2565
Clone C9B9
IB (1:1000)
Recombinant DNA reagentMLL-AF9-GFP plasmidPMID:17463288
Chemical compound, drug4-hydroxy-tamoxifenMillipore-SigmaCat. No. T176
Chemical compound, drugTamoxifenMillipore-SigmaCat. No. T5648
Commercial assay or kitVybrant FAM caspase-3/7 assay kitInvitrogenCat. No. V35118
Commercial assay or kitQuantiTect Reverse Transcription KitQiagenCat. No. 205313
Software, algorithmFlowJohttps://www.flowjo.comRRID:SCR_008520
Software, algorithmGraphPad Prismhttp://www.graphpad.com/SCR_015807

Animals and generation of BM chimeras

Request a detailed protocol

Ctnnb1fl/fl and Tcf7l1fl/fl mice were generated in this study. The following mouse strains were previously described, Ctnnb1-exons 2–6 floxed strain (Stock No. 004152, the Jackson Laboratory) (Brault et al., 2001), Jupfl/fl (Demireva et al., 2011), Tcf7fl/fl (Steinke et al., 2014), Lef1fl/fl (Yu et al., 2012b), Tcf7l2fl/fl (Angus-Hill et al., 2011), and Rosa26Cre-ERT2/+ (Guo et al., 2007a). Transplantation of BM cells was performed as previously reported (Li et al., 2017; Yu et al., 2012a). All mouse experiments were performed under protocols approved by the Institutional Animal Use and Care Committee of the University of Iowa (Protocol No. 8021178) and Center for Discovery and Innovation, Hackensack University Medical Center (Protocol No. 276.00).

Conditional targeting of the Ctnnb1 locus

Request a detailed protocol

The Ctnnb1fl/fl mice were generated using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology by Applied StemCell Inc. In brief, two LoxP cassettes were inserted into introns 1 and 14, flanking exons 2 to 14 of the Ctnnb1 locus (Figure 1A). A mixture containing active guide RNA molecules (gRNA) and Cas-9 protein was injected into the cytoplasm of C57BL/6J (B6) embryo. The gRNA sequence for intron 1 is 5’- ACTGCTCTGACTTCACCCGAggg, that for intron 14 is 5’- CTATCATCACTCTATCCCAGagg. The pups born from the microinjection were screened by PCR and further confirmed by sequencing. Germline-transmitted F1 progeny was crossed with Cre-expressing strains for further analysis. For genotyping, the following primers were used to amplify genomic DNA: F1, 5’-CTGCTTACAGTGTGAGACACC; R1, 5’- CCAGTACTGCTCTGACTTCAC; and R2, 5’- CTGCCTGTCACAGATCAGATG. The combination of F1 and R1 detected Ctnnb1 WT allele at 144 bp, and Ctnnb1-floxed allele at 178 bp, and the combination of F1 and R2 detected Ctnnb1-deleted allele at 218 bp. For detection of the Ctnnb1 transcripts in RT-PCR, the following primers were used: Ex13F, 5’-GTCCTATTCCGAATGTCTGAGG; Ex15R, 5’-GGCCAGCTGATTGCTATCAC.

Verification of conditional deletion of the Jup locus

Request a detailed protocol

For detecting deletion of Jup-floxed exons on genomic DNA level, the following primers were used: F1, 5’- CTTCTGGGATCTCAGGAGTGTAC; R1, 5’- GTCATGTGCTAGCCCAGTCTAAG; and R2, 5’- TCACAGCCACTACCACTGAC. The combination of F1 and R1 detected Jup-floxed allele at 250 bp, and the combination of F1 and R2 detected Jup-deleted allele at approximately 280 bp. For detection of the Jup transcripts in RT-PCR, the following primers were used: Ex5F, 5’- AGACGGGCTGCAGAAGATG; Ex6R, 5’- GGGCTTGTTGCTAGGACAC.

Conditional targeting of the Tcf7l1 locus

Request a detailed protocol

The Tcf7l1-floxed embryonic stem (ES) cells were generated by the European Conditional Mouse Mutagenesis Program (EUCOMM), currently part of the International Knockout Mouse Consortium (IKMC) (Figure 4A). The allele is designated as Tcf7l1tm1a(EUCOMM)Wtsi (http://www.informatics.jax.org/allele/MGI:4432867). Microinjection of ES cells was performed at the Wellcome Trust Sanger Institute (UK), and germline-transmitted mice were bred with Flippase recombinase (expressed in the Rosa26 locus, Jackson Laboratory, Stock No. 003946) to remove the LacZ/Neomycin cassette flanked by FRT sites. For genotyping of the resulting Tcf7l1fl/+ allele, the following primers were used to amplify genomic DNA: 5’-AGCAACCAAATGAAGGCTCAC and 5’-CTGCTGCCCCTCTTTTCATC, which detects Tcf7l1 WT allele at 335 bp, and Tcf7l1-floxed allele at 424 bp, and Tcf7l1-deleted allele at 562 bp. Effective ablation of Tcf3 protein in Tcf7l1fl/fl mice was demonstrated by an independent study using the same ES cell-derived allele (Mašek et al., 2016). We also confirmed efficient CreER-mediated deletion of the floxed exon six in Tcf7l1 transcripts in BM Flt3LSKs by RT-PCR using the following primer sets: 5’-TCACCTACAGCAACGACCAC and 5’-TACGGTGACAGCTCAGATGG, with the latter complementary to the targeted exon 6 (Figure 4C). Deletion of the floxed exon one in Tcf7l2 transcripts by CreER was confirmed in BM Flt3LSKs by RT-PCR using 5’-ATGTCAAGTCCTCGCTGGTC and 5’-CCCTTAAAGAGCCCTCCATC primers, with the former complementary to the targeted exon 1 (Figure 4C).

Induced target gene deletion by tamoxifen treatment

Request a detailed protocol

For ex vivo treatment, lineage-depleted BM cells from CreER+WT or CreER+Ctnnb1fl/fl mice were cultured in IMDM medium supplemented with 15% fetal bovine serum (FBS), 20 ng/ml thrombopoietin (TPO), and 50 ng/ml stem cell factor (SCF). Positively selected CD3+ T cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 50 ng/ml IL-7, and 50 ng/ml IL-15. On second day of culture, 4-hydroxy-tamoxifen (T176, Millipore-Sigma) was added to a final concentration of 250 nM, and cells were harvested 3–5 days later for immunoblotting. For in vivo treatment, the mice were administered with tamoxifen (T5648, Millipore-Sigma) at 0.2 mg/g body weight via oral gavage for four consecutive days, as illustrated in Figure 1C. For long-term studies including serial transplantation of AML LSCs, the mice were given 3-day treatment every 4 weeks till the experimental endpoints, as illustrated in Figure 3C.


Request a detailed protocol

Cell lysates were prepared from sorted CD45.2+ thymocytes, splenic T cells, BM cells, or GFP+Mac1+ AML cells, resolved on SDS-PAGE, followed by immunoblotting with anti-β-catenin (Clone 14/Beta-Catenin, Cat. No. 610154, mouse monoclonal, BD Transduction Laboratories), with anti-β-actin (clone I-19, Santa Cruz Biotechnology) detection as control for equal loading. Thymocytes, BM and liver cells were detected with anti-γ-catenin (Cat. No. 610253, BD Biosciences) or anti-Tcf4 (C9B9, Cell Signaling Technologies).

Flow cytometry and cell sorting

Request a detailed protocol

Single cell suspension was prepared from thymus, spleen, and BM and surface-stained as previously described (Li et al., 2018; Shao et al., 2019). All fluorochrome-conjugated antibodies were from eBiosciences/ThermoFisher Scientific. The antibodies and their clone numbers are TCRβ (H57-597), CD4 (RM4-5), CD8α (53–6.7), CD25 (PC61.5), CD44 (IM7), anti-IFN-γ (XMG1.2), anti-TNFα (MP6-XT22), anti-Icos (C398.4A), CD45.2 (104), Sca1(D7), c-Kit (2B8), CD48 (HM48.1), CD16/CD32 (93), Mac1 (M1/70), CD62L (MEL-14), and Streptavidin (eBiosciences Cat. No. 48-4317-82). For lineage markers, the following biotinylated antibodies were used: B220 (RA3-6B2), CD3ε (145–2 C11), γδTCR (GL3), NK1.1 (PK136), CD11c (N418), Gr-1 (RB6-8C5), Mac1 (M1/70), and TER-119 (TER-119). CXCR5 (L138D7) and SLAM (TC15-12F12.2) are from BioLegend and used in single step staining for TFH cells. For detection of Bcl6 (K112-91) and Ki67 (B56, both from BD Biosciences), Tcf1 (C63D9) and Lef1 (C12A5) and corresponding isotype control (rabbit mAb IgG DA1E, all from Cell Signaling Technologies), surface-stained cells were fixed and permeabilized with the Foxp3/Transcription Factor Staining Buffer Set (eBiosciences/ThermoFisher Scientific), followed by incubation with corresponding fluorochrome-conjugated antibodies. Active Caspsase-3/7 was detected using the Vybrant FAM caspase-3/7 assay kit (Invitrogen/Life Technologies) as described (Li et al., 2018). Peptide-stimulated cytokine production and detection by intracellular staining were as described (Zhao et al., 2010). Anti-human granzyme B (FGB12) and corresponding isotype control were from Invitrogen/ThermoFisher Scientific. Data were collected on FACSVerse (BD Biosciences) and analyzed with FlowJo software (Version X, TreeStar). For cell sorting, surface-stained cells were sorted on BD FACSAria II or FACSAria Fusion cell sorter.

Viral infection

Request a detailed protocol

BM chimeric mice were infected intraperitoneally (i.p) with 2 × 105 PFU of LCMV-Armstrong strain to elicit acute viral infection (Li et al., 2018; Shao et al., 2019). Splenocytes were harvested from the infected mice at eight dpi or ≥40 dpi to characterize mature CD4+/CD8+ T cell responses at the effector and memory phases, respectively.

AML mouse model and LSC secondary transplantation

Request a detailed protocol

The AML mouse model was established following similar protocol in our previous CML/AML studies (Li et al., 2017; Xiu et al., 2018; Yu et al., 2012a). In brief, Lin BM cells (either from CreER+Ctnnb1fl/fl BM chimeras or directly from CreER+Tcf-qKO mice, all treated with tamoxifen) were infected with MLL-AF9-GFP retrovirus. The infected cells containing 1 × 104 GFP+c-Kit+ cells were transplanted into lethally irradiated congenic mice along with 2 × 105 CD45.1+ protector BM cells. The primary recipients were treated with tamoxifen during days 25–27 after BM transplantation, and one day later, the BM cells were harvested and sorted for CD45.2+ AML LSCs following the gating strategy outlined in Figure 3—figure supplement 1. One thousand of AML LSCs were mixed with 2 × 105 CD45.1+ protector BM cells and transplanted into secondary recipients, followed by tracking CD45.2+GFP+Mac1+ AML leukemia burden in PBCs. Both primary and secondary recipients were subjected to repeated rounds of tamoxifen treatment for three consecutive days by the end of every 4 weeks, and monitored for survival.

Statistical analysis

Request a detailed protocol

For comparison between two experimental groups, Student’s t-test was used, with a two-tailed distribution assuming equal sample variance. For multiple group comparisons, one-way ANOVA was used to determine whether any of the differences between the means are statistically significant. As post hoc correction, Tukey’s test was used to determine statistically significance between two groups of interest. Comparison of AML mouse survival among different experimental groups was determined by log-rank test using Prism8 software. Statistical parameters, including numbers of samples or recipient mice analyzed (n), descriptive statistics (means and standard deviation) are reported in the figures and figure legends. P values equal to or more than 0.05 are considered not statistically significant (marked as ‘ns’ or unmarked for clarity). P values of less than 0.05 are considered statistically significant, the following asterisk marks are used to indicate the level of significance: *, p<0.05; **, p<0.01; ***, p<0.001.

Data availability

Source data files provided. Mouse strain will be made available to other investigators on request.


    1. Brault V
    2. Moore R
    3. Kutsch S
    4. Ishibashi M
    5. Rowitch DH
    6. McMahon AP
    7. Sommer L
    8. Boussadia O
    9. Kemler R
    Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development
    Development 128:1253–1264.

Decision letter

  1. Ravi Majeti
    Reviewing Editor; Stanford University, United States
  2. Utpal Banerjee
    Senior Editor; University of California, Los Angeles, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

The findings reported here add to the body of literature, often conflicting, on the role of β-catenin in particular in AML stem cells and T lymphocytes. In particular, the finding that the complete knockout of β-catenin and γ-catenin does not impair AML in primary or secondary recipients is an interesting and important finding with scientific and translational implications.

Decision letter after peer review:

Thank you for submitting your article "β-catenin and γ-catenin are dispensable for T lymphocytes and AML leukemic stem cells" for consideration by eLife. Your article has been reviewed by two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Utpal Banerjee as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


In the manuscript by Zhao et al., the authors investigate the requirement for β- and γ-catenin in T cell development, T cell activation, and AML LSCs using a novel β-catenin knockout mouse that eliminates most exons of this gene. Prior studies investigating β-catenin in these processes used mice with limited exon targeting, raising the possibility that these mice actually expressed a truncated protein with potentially novel functions. Using the new mice alone or bred with γ-catenin knockout, the authors show that these proteins are not required for normal T cell development, T cell activation and viral immune responses, and AML development and LSC transplantation using the MLL-AF9 retroviral model. Moreover, deletion of all 4 LEF/TCF transcription factors also had no effect on AML development or LSC transplantation in this same model. In general, the role and requirement of β-catenin in T cell development and AML is of interest – and has been controversial due to confounding reports in the literature. However, there are several issues with the current manuscript.

Essential revisions:

1) One of the key issues with this manuscript is the discrepancy between the findings here and the results from the prior published studies with the alternative models. Thus, it is key to identify mechanisms that account for the discrepancy. Is there any evidence that the prior β-catenin mice targeted in exons 2/3-6 produce a truncated protein? Independent of these mice, can a truncated β-catenin be generated from the non-targeted exons? what is the phenotype of this truncated protein in relevant assays of β-catenin function?

2) In the Western blot in Figure 1D showing absence of β-catenin protein, a band is detected at 50kD labeled as non-specific. However, this band seems to be decreased in the β-catenin KO cells as well, raising the possibility that it is not non-specific. Can the authors comment on the identity of this band? Is it possibly an aberrant form of β-catenin?

3) The KO of γ-catenin should be validated with Western blot and DNA/RNA analysis as was done for β-catenin.

4) In Figure 4A,B, the authors conclude that normal hematopoiesis and HSCs are unaffected by β- and γ-catenin double KO. However, in order to formally make this conclusion, transplantation assays should be conducted showing no difference compared to WT control.

5) What is the efficacy of β- and γ-catenin knockout at time of primary mice analysis and secondary mice analysis as determined by Western blot? It is possible that rare non-deleted cells are growing out, particularly at later time points.

6) For the Tcf-qKO cells, Western blot should be shown demonstrating elimination of each protein. What is the effect of Tcf-qKO on T cell development and activation in the experiments shown in Figures 2,3?

7) Do the β-catenin and γ-catenin individual or double knockout mice develop T cell lymphoma?


Author response

Essential revisions:

1) One of the key issues with this manuscript is the discrepancy between the findings here and the results from the prior published studies with the alternative models. Thus, it is key to identify mechanisms that account for the discrepancy. Is there any evidence that the prior β-catenin mice targeted in exons 2/3-6 produce a truncated protein? Independent of these mice, can a truncated β-catenin be generated from the non-targeted exons? what is the phenotype of this truncated protein in relevant assays of β-catenin function?

These are important points. Production of a truncated β-catenin protein from existing mouse models was previously reported by Held and colleagues (Jeannet et al., 2008). The authors examined bone marrow cells from both mouse models, exons 2-6 floxed model (the RK model, developed by R Kelmer and colleagues, Brault et al., 2001), and exons 3-6 floxed model (the JH model, developed by Birchmeier W and colleagues, Huelsken et al., 2000).

Author response image 1

As shown in Author response image 1 panel A, single allele deletion of β-catenin in either model resulted in enhanced production of the truncated protein (lanes 2 and 3 for the RK and JH models, respectively). The truncated protein can be detected in non-targeted wild-type bone marrow cells in low amount (lane 1), which becomes more discernible after longer exposure (middle panel). It is of interest to mention that the truncated form of β-catenin was not detected in keratinocytes (panel B), suggesting a tissue-specific effect.In our own experiments, we previously (about 5 years ago) obtained the RK model (Stock No. 004152, the Jackson Laboratory) and crossed with Vav-Cre to ablate β-catenin. By immunoblotting bone marrow cell lysates with the same β-catenin antibody as above (clone 14, BD Transduction Laboratory), the truncated β-catenin was detected at approximately 40 kDa in the targeted cells, validating the findings by Held and colleagues. We now include the data in Figure 1—figure supplement 1, described the relevant information in the Results and Discussion to highlight this critical point.

As for the function of truncated forms of β-catenin protein, because the N-terminus of β-catenin contains phosphorylation sites for ubiquitin-dependent degradation, an N-terminal truncated form of β-catenin protein has been shown to have longer half-life, and ectopic expression of the N-terminal truncated β-catenin stimulates proliferation and apoptosis of intestinal crypts (Wong et al., 1998). In planarians (flatworms), a C-terminal truncated β-catenin is a naturally occurring paralog and acts as a negative regulator of full-length β-catenin during planarian eye photoreceptor specification (Su et al., 2017). We now cited these papers and described relevant findings in the Introduction.

2) In the Western blot in Figure 1D showing absence of β-catenin protein, a band is detected at 50kD labeled as non-specific. However, this band seems to be decreased in the β-catenin KO cells as well, raising the possibility that it is not non-specific. Can the authors comment on the identity of this band? Is it possibly an aberrant form of β-catenin?

As described in response to Point #1 and shown in Figure 1—figure supplement 1, the truncated β-catenin resulting from exon 7 translation in the RK model was detected at ~40 kDa. The non-specific band was at ~50 kDa. To substantiate our interpretation that the 50 kDa band results from non-specific reaction to the β-catenin antibody, we added the following two sets of data:

First, we treat lineage-negative bone marrow and peripheral T cells with tamoxifen in vitro. As shown in immunoblots in Figure 1B, the lineage-negative BM cells were completely devoid of non-specific bands; while T cells had the non-specific band, the signal intensity was similar between DMSO- and tamoxifen-treated cells. This was included as new Figure 1B, and described in the Results and Discussion first paragraph.

Second, we updated original Figure 1D which showed one set of data with the new Figure 1E which now includes two sets of data. The non-specific bands were not always detected (Thymocytes Exp1 and BM cells Exp2), and if detected, the non-specific bands did not always show decreased intensity in β-catenin KO cells (for example, BM cells Exp1, the non-specific band was stronger in KO cells, if any).

Taking the new Ctnnb1-targeting strategy into consideration, where Ctnnb1 exons 2-14 are floxed, the extensive immunoblot data suggest that the 50 kb band is unlikely a truncated form of β-catenin.

3) The KO of γ-catenin should be validated with Western blot and DNA/RNA analysis as was done for β-catenin.

As requested, we have designed primers based on the published γ-catenin (gene name, Jup) targeting strategy as summarized below and in Figure 1—figure supplement 4A.

On the genomic DNA level, we validated effective excision of the floxed Jup exons using the F1-R1 and F1-R2 primer combinations (Figure 1—figure supplement 4B).

On the mRNA level, we found that Jup transcripts were much less abundant compared with β-catenin transcripts in WT BM cells (only 1/50th of the latter after normalized to the Hprt housekeeping gene). Nonetheless, we were able to observe consistent deletion of Jup transcripts upon tamoxifen treatment in the KO bone marrow chimeras, after zooming in to Jup transcripts only (right panel in Figure 1—figure supplement 4C).

Because of the low abundance of Jup transcripts, the γ-catenin protein was below detection limit by immunoblotting in bone marrow cells (left panel Figure 1—figure supplement 4D). However, γ-catenin protein was more readily detectable in hepatocytes, and we confirmed induced deletion of γ-catenin by tamoxifen in non-BM chimera, KO mice (right panel Figure 1—figure supplement 4D).

Overall, these analyses validated effective ablation of γ-catenin in our experimental system.

4) In Figure 4A,B, the authors conclude that normal hematopoiesis and HSCs are unaffected by β- and γ-catenin double KO. However, in order to formally make this conclusion, transplantation assays should be conducted showing no difference compared to WT control.

We agree with the reviewers that if we were to conclude that ablation of β-/γ-catenin does not affect HSC function and self-renewal, it would be necessary to perform serial transplantation assays. Based on data in Figure 3A,B, we were careful to conclude that “loss of β-/γ-catenin did not perturb HSC homeostasis” but did not comment on HSC self-renewal. The rationale is that previous studies on HSCs using the existing RK or JH β-catenin targeted models did not observe a strong impact of deleting β-catenin on HSC self-renewal, even if truncated β-catenin protein may have been present in those analyses (Zhao et al., 2007 and Ruiz-Herguido et al., 2012). In contrast, previous studies on AML LSCs using these models reported a requirement for β-catenin for LSC self-renewal (Yeung et al., 2010 and Wang et al., 2010). We therefore focused on biological aspects where β-catenin was considered to have a prominent role, and this focus is reflected in manuscript title “T lymphocytes and AML leukemic stem cells”.

Nonetheless, we did perform one serial transplantation experiment on WT and CreER+Ctnnb1fl/fl HSCs, where the contribution of WT and β-catenin deficient HSCs contributed similarly to blood reconstitution and LSK compartment in secondary recipients when analyzed at 6 weeks after transplantation (see Author response image 2). We are happy to include these data if required by the reviewers, but respectfully suggest that the manuscript would benefit from focusing on currently unsolved issues on β-catenin.

Author response image 2

5) What is the efficacy of β- and γ-catenin knockout at time of primary mice analysis and secondary mice analysis as determined by Western blot? It is possible that rare non-deleted cells are growing out, particularly at later time points.

We thank the reviewers for raising this point, we are fully aware of the “escapee” cells that may have growth advantage over KO cells. We therefore have laid out an experiment plan (Figure 3C), where the tamoxifen was administered repeatedly to ensure that the rare non-deleted cells were eliminated for the duration of the entire study.

As depicted in Figure 3C in the AML studies, the BM chimeras were treated with tamoxifen for the initial induced deletion, which were then retrovirally transduced with MLL-AF9 and transplanted into the primary recipients. The primary recipients were treated with another round of tamoxifen on days 25, 26 and 27 after transplantation, so as to be sure that AML LSCs contained minimal, if any, non-deleted cells before transplanted into secondary recipients. Both primary and secondary recipients were continuously treated every 4 weeks.

It is a fine balance to weed out “non-deleted” cells and avoid unwanted side-effects resulting from too frequent tamoxifen treatments. The regimen of treatment at 4-weeks interval was optimized at the early stages of the studies. In fact, from the primary recipients, we sorted CD45.2+GFP+Mac1+ AML cells on day 28 after BM transplantation (i.e., after days 25-27 tamoxifen treatment), and validated absence of β-catenin protein in the KO AML cells (shown in Figure 3D). Although we did not perform the same experiment on AML cells from the secondary recipients, we deduce that the standardized tamoxifen regimen should have consistent effect in both primary and secondary recipients under the same experimental system.

We refined the description of the tamoxifen regimen and its purpose in the text and figure legends.

6) For the Tcf-qKO cells, Western blot should be shown demonstrating elimination of each protein. What is the effect of Tcf-qKO on T cell development and activation in the experiments shown in Figures 2,3?

As requested, we performed the following analyses:

1) To demonstrate efficiency of protein ablation, we used intracellular staining for Tcf1 and Lef1 in thymocytes, where both proteins are mostly abundantly expressed. As shown in Figure 4B, both Tcf1 and Lef1 proteins were greatly reduced to a level similar to isotype controls.

Immunoblotting also showed that Tcf4 protein was substantially reduced in thymocytes upon induced deletion. On the other hand, Tcf3 protein were not reliably detected in thymocytes and BM cells from WT or Tcf3/4 dKO mice. This is likely due to low abundance of Tcf7l1 expression in hematopoietic cells, as reflected in RT-PCR analysis shown in Figure 4C, where Tcf7l1 transcripts were about 1/25th of Tcf7l2 transcripts in Flt3–LSK cells. In spite of low expression, Tcf7l1 transcripts were ablated to an undetectable level in Tcf-qKO cells (Figure 4C). It is also important to note that the same Tcf7l1-targeted ES clone was used in another independent study to ablate Tcf3 in mouse embryonic fibroblasts (Masek et al., 2016), corroborating the efficacy of Tcf3 deletion using the same model. Because Tcf1, Lef1 and Tcf4 were deleted effectively in our experimental system, we respectfully suggest that it is reasonable to deduce similar capacity of Tcf3 protein in the same cells.

2) We analyzed T cell development in Tcf-qKO mice, along with CreER+ Tcf1/Lef1 KO and CreER+ Tcf3/Tcf4 KO mice. Tamoxifen treatment resulted in over 90% reduction in thymic cellularity in CreER+ Tcf1/Lef1 KO and Tcf-qKO mice, but did not detectably affect thymocyte numbers in CreER+ Tcf3/Tcf4 KO mice.

In CreER+ Tcf1/Lef1 KO and Tcf-qKO thymuses, the DP and DN2 thymocytes showed more pronounced reduction, with DN1 thymocytes showing premature CD25 upregulation and relative accumulation compared with CreER+ WT mice. These aspects are consistent with well-established requirements for Tcf1 in promoting T cell lineage commitment and DP thymocyte survival. In addition, none of these changes was evident in CreER+ Tcf3/Tcf4 KO mice, and the defects in CreER+ Tcf1/Lef1 KO mice were not further exacerbated in Tcf-qKO mice. These observations suggest that Tcf3 and Tcf4 are not required for thymopoiesis and further validate critical function of Tcf1 and Lef1 among the Tcf/Lef family. We now included all these data as Figure 4E and 4F, and described in the Results and Discussion.

The analysis of T cell development also validated the effectiveness of induced deletion of Tcf/Lef proteins in our experimental system, and thus lent additional support to the conclusion that Tcf/Lef factors and β-catenin are dispensable for AML LSC self-renewal. This was also the primary reason and purpose for inclusion of the Tcf-qKO model.

As for T cell activation in the Tcf-qKO model, we agree that is an important scientific question, but respectfully suggest it is beyond the focus on β/γ catenin in this manuscript. As shown in Figure 4E and F, induced deletion of Tcf/Lef proteins (primarily due to deletion of Tcf1) greatly diminished thymic output. As a result, the precursor frequency of antigen-specific T cells was reduced in the peripheral lymphoid organs when challenged with viral infection, making it a less ideal model for investigation of T cell activation and differentiation. This was not a major issue for induced deletion of β- and γ-catenin (Figure 2), because thymic development was not detectably affected. As such, analysis of the contribution of Tcf3/Tcf4 and their possible cooperativity with Tcf1/Lef1 should be performed using a model where these proteins are specifically deleted in mature T cells, like we did for Tcf1 and Lef1 in previous studies (Choi et al., 2015, and Shan et al., 2017). We hope that the reviewers/editors would allow us to address those questions in a separate, dedicated project.

7) Do the β-catenin and γ-catenin individual or double knockout mice develop T cell lymphoma?

We did monitor a cohort of WT and CreER+Ctnnb1fl/flJupfl/fl BM chimeras for 16 weeks after tamoxifen treatment and did not observed signs of malignant transformation of thymocytes or other hematopoietic lineages. We included a statement on this observation.


Article and author information

Author details

  1. Xin Zhao

    Center for Discovery and Innovation, Hackensack University Medical Center, Nutley, United States
    Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Writing - original draft, Writing - review and editing
    Contributed equally with
    Peng Shao
    Competing interests
    No competing interests declared
  2. Peng Shao

    Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa, Iowa City, United States
    Data curation, Formal analysis, Validation, Investigation
    Contributed equally with
    Xin Zhao
    Competing interests
    No competing interests declared
  3. Kexin Gai

    Center for Discovery and Innovation, Hackensack University Medical Center, Nutley, United States
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  4. Fengyin Li

    Hefei National Laboratory for Physical Sciences at Microscale, the CAS Key Laboratory of Innate Immunity and Chronic Disease, School of Basic Medical Sciences, Division of Life Sciences and Medicine, University of Science and Technology of China, Hefei, China
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  5. Qiang Shan

    Center for Discovery and Innovation, Hackensack University Medical Center, Nutley, United States
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  6. Hai-Hui Xue

    1. Center for Discovery and Innovation, Hackensack University Medical Center, Nutley, United States
    2. New Jersey Veterans Affairs Health Care System, East Orange, United States
    Conceptualization, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9163-7669


National Institute of Allergy and Infectious Diseases (AI121080)

  • Hai-Hui Xue

National Institute of Allergy and Infectious Diseases (AI139874)

  • Hai-Hui Xue

U.S. Department of Veterans Affairs (BX002903)

  • Hai-Hui Xue

National Institute of Allergy and Infectious Diseases (AI112579)

  • Hai-Hui Xue

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Drs. Niccolo Zampieri (Max Delbrück Center for Molecular Medicine in the Helmholtz Association, Berlin, Germany) and Thomas Jessell (formerly Columbia University) for sharing the Jupfl/fl mice, Dr. Yiying Zhang (the New York Obesity Nutrition Research Center, with funding support from the NIH, P30DK26687) for sharing Rosa26Cre-ERT2/+ mice, Dr. Melinda L Angus-Hill (University of Utah) for sharing Tcf7l2fl/fl mice, and Dr. John Dick (University of Toronto) for providing the MLL-AF9-GFP retroviral construct. We thank the University of Iowa Flow Cytometry Core facility (J Fishbaugh, H Vignes and G Rasmussen) for cell sorting, and Radiation Core facility (A Kalen) for mouse irradiation. This study is supported in-part by grants from the NIH (AI112579, AI121080 and AI139874) and the Veteran Affairs BLR and D Merit Review Program (BX002903) to H-HX.


Animal experimentation: All mouse experiments were performed under protocols approved by the Institutional Animal Use and Care Committees of the University of Iowa (Protocol No. 8021178) and Center for Discovery and Innovation, Hackensack University Medical Center (Protocol No. 276.00).

Senior Editor

  1. Utpal Banerjee, University of California, Los Angeles, United States

Reviewing Editor

  1. Ravi Majeti, Stanford University, United States

Publication history

  1. Received: January 21, 2020
  2. Accepted: August 14, 2020
  3. Accepted Manuscript published: August 21, 2020 (version 1)
  4. Version of Record published: September 1, 2020 (version 2)


© 2020, Zhao et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 976
    Page views
  • 141
  • 4

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Immunology and Inflammation
    Marie Ghraichy et al.
    Research Article

    Several human B-cell subpopulations are recognized in the peripheral blood, which play distinct roles in the humoral immune response. These cells undergo developmental and maturational changes involving VDJ recombination, somatic hypermutation and class switch recombination, altogether shaping their immunoglobulin heavy chain (IgH) repertoire. Here, we sequenced the IgH repertoire of naïve, marginal zone, switched and plasma cells from 10 healthy adults along with matched unsorted and in silico separated CD19+ bulk B cells. Using advanced bioinformatic analysis and machine learning, we show that sorted B cell subpopulations are characterised by distinct repertoire characteristics on both the individual sequence and the repertoire level. Sorted subpopulations shared similar repertoire characteristics with their corresponding in silico separated subsets. Furthermore, certain IgH repertoire characteristics correlated with the position of the constant region on the IgH locus. Overall, this study provides unprecedented insight over mechanisms of B cell repertoire control in peripherally circulating B cell subpopulations.

    1. Immunology and Inflammation
    Veronika Lang et al.
    Research Article

    Local circadian clocks are active in most cells of our body. However, their impact on circadian physiology is still under debate. Mortality by endotoxic (LPS) shock is highly time-of-day dependent and local circadian immune function such as the cytokine burst after LPS challenge has been assumed to be causal for the large differences in survival. Here, we investigate the roles of light and myeloid clocks on mortality by endotoxic shock. Strikingly, mice in constant darkness (DD) show a three-fold increased susceptibility to LPS as compared to mice in light-dark conditions. Mortality by endotoxic shock as a function of circadian time is independent of light-dark cycles as well as myeloid CLOCK or BMAL1 as demonstrated in conditional knockout mice. Unexpectedly, despite the lack of a myeloid clock these mice still show rhythmic patterns of pro- and anti-inflammatory cytokines such as TNF,α MCP-1, IL-18 and IL-10 in peripheral blood as well as time-of-day and site dependent traffc of myeloid cells. We speculate that systemic time-cues are sufficient to orchestrate innate immune response to LPS by driving immune functions such as cell traffcking and cytokine expression.