Neuronal hyperexcitability is a DLK-dependent trigger of herpes simplex virus reactivation that can be induced by IL-1
- Department of Microbiology, Immunology and Cancer Biology, University of Virginia, United States
- Neuroscience Graduate Program, University of Virginia, United States
- Department of Pharmacology, University of Virginia, United States
- MRC-University of Glasgow Centre for Virus Research (CVR), Garscube Campus, United Kingdom
Figures
Figure 1
HSV-1 Reactivation from sympathetic neurons is induced by adenylate cyclase activation.
(A) Schematic of the primary sympathetic superior cervical ganglia (SCG)-derived model of HSV latency. Reactivation was quantified based on Us11-GFP-positive neurons in presence of WAY-150168, which …
-
Figure 1—source data 1
Quantification of GFP-positive neurons for Figure 1.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig1-data1-v3.xlsx
Figure 2 with 2 supplements
Reactivation triggered by forskolin involves a DLK/JNK-dependent phase I of viral gene expression.
(A) Reactivation was induced by forskolin in the presence of JNK inhibitor SP600125 (20 μM). (B) Reactivation was induced by forskolin in the presence of the DLK inhibitor GNE-3511 (4 μM). In A and …
-
Figure 2—source data 1
Quantification of GFP-positive neurons, RT-qPCR and western blot band densities for Figure 2.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig2-data1-v3.xlsx
Figure 2—figure supplement 1
Reactivation triggered by forskolin triggers a wave of lytic gene expression that precedes DNA Replication and infectious virus production.
(A) Titers of infectious virus detected from reactivating neurons induced with forskolin (n = 4). (B) Quantification of the relative viral genome copy number following forskolin-mediated …
-
Figure 2—figure supplement 1—source data 1
Quantification of HSV titer, GFP-positive neurons and RT-qPCR for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig2-figsupp1-data1-v3.xlsx
Figure 2—figure supplement 2
Effect of PKA, CREB, Rapgef2 and EPAC Inhibition on HSV-1 Reactivation.
(A) Latently infected cultures were reactivated with forskolin (60 μM) in the presence of the PKA inhibitor KT 5720 (3 µM) and the number of Us11-GFP-positive neurons quantified at 3 days …
-
Figure 2—figure supplement 2—source data 1
Quantification of GFP-positive neurons and RT-qPCR for Figure 2—figure supplement 2.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig2-figsupp2-data1-v3.xlsx
Figure 3 with 1 supplement
The Initial wave of viral lytic gene expression during forskolin-mediated reactivation is independent on histone demethylase activity.
(A) Quantification of the percentage of genome foci stained using click-chemistry that co-localize with H3K9me3/S10p. At least 15 fields of view with 1–8 genomes per field of view were blindly …
-
Figure 3—source data 1
Quantification of genome co-localization and RT-qPCR for Figure 3.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig3-data1-v3.xlsx
Figure 3—figure supplement 1
Forskolin induces hyperexcitability-associated chromatin changes, and hsv reactivation that requires histone demethylase.
(A) SCG neurons were treated with forskolin and immunofluorescence staining was carried out for H3K9me3/S10p, the DNA damage marker γH2AX and the neuronal marker beta III-tubulin. (B) Quantification …
-
Figure 3—figure supplement 1—source data 1
Quantification of nuclear staining intensity and GFP-positive neurons Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig3-figsupp1-data1-v3.xlsx
Figure 4 with 1 supplement
HSV Reactivation Mediated by Forskolin Requires Neuronal Excitability.
(A) Latently infected cultures were reactivated with forskolin in the presence of the voltage-gated sodium channel blocker tetrodotoxin (TTX; 1 µM) and the number of Us11-GFP-positive neurons …
-
Figure 4—source data 1
Quantification of GFP-positive neurons, RT-qPCR and nuclear staining intensity for Figure 4.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig4-data1-v3.xlsx
Figure 4—figure supplement 1
HSV Reactivation Mediated by Forskolin Requires Neuronal Excitability.
(A and B) Latently infected cultures were reactivated with forskolin in the presence of the HCN channel inhibitors ivabradine (20 µM; A) and CsCl (3 mM; B). Latently infected cultures were …
-
Figure 4—figure supplement 1—source data 1
Quantification of GFP-positive neurons and RT-qPCR for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig4-figsupp1-data1-v3.xlsx
Figure 5
HSV Reactivation triggered by prolonged neuronal hyperexcitability is DLK/JNK-dependent.
(A) Latently infected SCG cultures were treated with forskolin or KCl (55 mM) for the indicated times followed by wash-out. Reactivation was quantified by number of Us11-GFP-positive neurons at 3 …
-
Figure 5—source data 1
Quantification of GFP-positive neurons for Figure 5.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig5-data1-v3.xlsx
Figure 6 with 1 supplement
IL-1β Treatment of sympathetic neurons results in changes consistent with heightened neuronal excitability.
(A) Adult P36 SCG neurons were treated with IL-1β (30 ng/mL) for 15 hr and stained for H3K9me3/S10p, γH2AX and beta II-tubulin to mark neurons. (B and C) Quantification of the intensity of …
-
Figure 6—source data 1
Quantification of nuclear staining intensity and ratiometric calcium imaging for Figure 6.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig6-data1-v3.xlsx
Figure 6—figure supplement 1
IL-1β Treatment of mature scg neurons induces excitability-associated histone post-translational modifications (supplement to Figure 6).
Quantification of the nuclear staining intensity in P36 sympathetic neurons for H3K9me3/S10 (A) and γH2AX (B) following treatment with IL-1β (30 ng/mL) from 150 nuclei from two independent …
-
Figure 6—figure supplement 1—source data 1
Quantification of nuclear staining intensity for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig6-figsupp1-data1-v3.xlsx
Figure 7
IL-1β-Induced HSV Reactivation is linked to heightened neuronal excitability and dlk activation.
(A) Quantification of Us11-GFP expressing neurons following addition of IL-1β to latently infected cultures of mature SCG neurons. (B) Numbers of Us11-GFP-positive neurons following addition of …
-
Figure 7—source data 1
Quantification of GFP-positive neurons for Figure 7.
- https://cdn.elifesciences.org/articles/58037/elife-58037-fig7-data1-v3.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, M/F) | CD1 | Charles River | Crl:CD1(ICR) | |
| Strain, strain background (Human herpesvirus 1) | HSV Us11-GFP | I gift from Ian Mohr, NYU. PMID:12915535 | ||
| Strain, strain background (Human herpesvirus 1) | HSV-1 17syn+ | A gift from Roger Everett, MRC Virology Unit Glasgow | ||
| Cell line (Homo sapiens) | 293LTV | Cell Biolabs | Cat # LTV-100 RRID:CVCL_JZ09 | |
| Cell line (Cercopithecus aethiops) | Vero | ATCC | Cat # CCCL-81 RRID:CVCL_0059 | |
| Recombinant DNA reagent | pCMV-VSV-G | A gift from Bob Weinberg/Addgene PMID:12649500 | Cat # 8454 RRID:Addgene_8454 | |
| Recombinant DNA reagent | psPax2 | A gift from Didier Trono/Addgene | Cat # 12260 RRID:Addgene_12260 | |
| Antibody | Anti-phospho-Akt (S473) (Rabbit monoclonal) | Cell Signalling Technologies | Cat # 4060 RRID:AB_2315049 | WB (1:500) |
| Antibody | Anti-Akt (pan) (Rabbit monoclonal) | Cell Signalling Technologies | Cat # C67E7 RRID:AB_915783 | WB (1:1000) |
| Antibody | Anti-phopsho-c-Jun (Rabbit monoclonal) | Cell Signalling Technologies | Cat # 3270 RRID:AB_2129575 | WB (1:500) |
| Antibody | Anti-DLK/MAP3K12 (Rabbit polyclonal) | Thermo Fisher | PA5-32173 RRID:AB_2549646 | WB (1:500) |
| Antibody | Anti-a-tubulin (Mouse monoclonal) | Millipore sigma | Cat # T9026 RRID:AB_477593 | WB (1:2500) |
| Antibody | Anti-Rabbit IgG Antibody (H+L), Peroxidase (Goat polyclonal) | Vector Labs | Cat # PI-1000 RRID:AB_2336198 | WB (1:10000) |
| Antibody | Anti-mouse IgG Antibody (H+L), Peroxidase (Horse polyclonal) | Vector Labs | Cat # PI-2000 RRID:AB_2336177 | WB (1:10000) |
| Antibody | Anti- H3K9me3S10P (Rabbit polyclonal) | Abcam | Cat # Ab5819 RRID:AB_305135 | IF (1:250) |
| Antibody | Anti-Beta-III Tubulin (Chicken polyclonal) | Millipore Sigma | Cat # AB9354 RRID:AB_570918 | IF (1:1000) |
| Antibody | Anti-γH2A.X (Mouse monoclonal) | Cell Signalling Technologies | Cat # 80312 RRID:AB_2799949 | IF (1:100) |
| Antibody | Anti-c-Fos (Rabbit polyclonal) | Novus | Cat # NB110-75039 RRID:AB_1048550 | IF (1:125) |
| Antibody | F(ab’)2 Anti-Mouse IgG (H+L) Alexa Fluor 647, (Goat polyclonal) | Thermo Fisher | Cat # A21237 RRID:AB_2535806 | IF (1:1000) |
| Antibody | F(ab’)2 Anti-Rabbit IgG (H+L) Alexa Fluor 555 (Goat polyclonal) | Thermo Fisher | Cat # A21425 RRID:AB_2535846 | IF (1:1000) |
| Antibody | Anti-Chicken IgY (H+L) Alexa Fluor 647 (Goat pAb) | Abcam | Cat # Ab150175 RRID:AB_2732800 | IF (1:1000) |
| Antibody | Anti-Chicken IgY (H+L) Alexa Fluor 488 (Goat polyclonal) | Abcam | Cat # Ab150173 RRID:AB_2827653 | IF (1:1000) |
| Antibody | F(ab’)2 Anti-Rabbit IgG (H+L) Alexa Fluor 488 (Goat polyclonal) | Thermo Fisher | Cat # A-11070 RRID:AB_2534114 | IF (1:1000) |
| Antibody | Anti-Mouse IL-1R (Goat polyclonal) | Leinco Technologies | Cat # I-736 RRID:AB_2830857 | Blocking (2 ug/mL) |
| Sequence-based reagent | mGAP F | PMID:19515781 | PCR primers | CATGGCCTTCCGTGTGTTCCTA |
| Sequence-based reagent | mGAP R | PMID:19515781 | PCR primers | GCGGCACGTCAGATCCA |
| Sequence-based reagent | ICP27 F | PMID:21285374 | PCR primers | GCATCCTTCGTGTTTGTCATTCTG |
| Sequence-based reagent | ICP27 R | PMID:21285374 | PCR primers | GCATCTTCTCTCCGACCCCG |
| Sequence-based reagent | ICP8 F | PMID:23322639 | PCR primers | GGAGGTGCACCGCATACC |
| Sequence-based reagent | ICP8 R | PMID:23322639 | PCR primers | GGCTTAAATCCGGCATGAC |
| Sequence-based reagent | ICP4 F | This paper | PCR primers | TGCTGCTGCTGTCCACGC |
| Sequence-based reagent | ICP4 R | This paper | PCR primers | CGGTGTTGACCACGATGAGCC |
| Sequence-based reagent | UL30 F | PMID:22383875 | PCR primers | CGCGCTTGGCGGGTATTAACAT |
| Sequence-based reagent | UL30 R | PMID:22383875 | PCR primers | TGGGTGTCCGGCAGAATAAAGC |
| Sequence-based reagent | UL48 F | This paper | PCR primers | TGCTCGCGAATGTGGTTTAG |
| Sequence-based reagent | UL48 R | This paper | PCR primers | CTGTTCCAGCCCTTGATGTT |
| Sequence-based reagent | gC F | This paper | PCR primers | CAGTTTGTCTGGTTCGAGGAC |
| Sequence-based reagent | gC R | This paper | PCR primers | ACGGTAGAGACTGTGGTGAA |
| Sequence-based reagent | shRNA: DLK-1 | Broad Institute: Genetic Perturbation Platform/Millipore Sigma | TRCN0000022573 | |
| Sequence-based reagent | shRNA: DLK-2 | Broad Institute: Genetic Perturbation Platform/Millipore Sigma | TRCN0000022572 | |
| Sequence-based reagent | shRNA: non-targeting control | PMID:16873256 | ||
| Commercial assay or kit | Quick-RNA Miniprep | Zymo Research | R1054 | |
| Commercial assay or kit | SuperScript IV First-Strand Synthesis System | ThermoFisher | 18091050 | |
| Commercial assay or kit | SYBR Green PCR Master Mix | ThermoFisher | 4309155 | |
| Chemical compound, drug | Acycloguanosine | Millipore Sigma | A4669 | 10 µM, 50 µM |
| Chemical compound, drug | FUDR | Millipore Sigma | F-0503 | 20 µM |
| Chemical compound, drug | Uridine | Millipore Sigma | U-3003 | 20 µM |
| Chemical compound, drug | SP600125 | Millipore Sigma | S5567 | 20 µM |
| Chemical compound, drug | GNE-3511 | Millipore Sigma | 533168 | 4 µM |
| Chemical compound, drug | GSK-J4 | Millipore Sigma | SML0701 | 2 µM |
| Chemical compound, drug | L-Glutamic Acid | Millipore Sigma | G5638 | 3.7 µg/mL |
| Chemical compound, drug | Forskolin | Tocris | 1099 | 60 µM |
| Chemical compound, drug | LY 294002 | Tocris | 1130 | 20 µM |
| Chemical compound, drug | 666–15 | Tocris | 5661 | 2 µM |
| Chemical compound, drug | SQ 22,536 | Tocris | 1435 | 50 µM |
| Chemical compound, drug | KT 5720 | Tocris | 1288 | 3 µM |
| Chemical compound, drug | TEA | Tocris | 3068 | 10 mM |
| Chemical compound, drug | CsCl | Tocris | 4739 | 3 mM |
| Chemical compound, drug | OG-L002 | Tocris | 6244 | 30 µM |
| Chemical compound, drug | S2101 | Tocris | 5714 | 20 µM |
| Chemical compound, drug | Tetrodotoxin | Tocris | 1069 | 1 µM |
| Chemical compound, drug | ESI-09 | Tocris | 4773 | 10 µM |
| Chemical compound, drug | ZD 7288 | Cayman | 15228 | 20 µM |
| Chemical compound, drug | 8-bromo-cyclic AMP | Cayman | 14431 | 125 µM |
| Chemical compound, drug | NGF 2.5S | Alomone Labs | N-100 | 50 ng/mL |
| Chemical compound, drug | Primocin | Invivogen | ant-pm-1 | 100 µg/mL |
| Chemical compound, drug | Aphidicolin | AG Scientific | A-1026 | 3.3 µg/mL |
| Chemical compound, drug | IL-1β | Shenendoah Bio. | 100–167 | 30 ng/mL |
| Chemical compound, drug | WAY-150138 | Pfizer, gift from Lynn Enquist and Jay Brown. | NA | 10 µg/mL |
| Chemical compound, drug | Fura-2 AM | Thermo Fisher | F1221 | 5 µM |
| Other | Hoescht Stain | Thermo | 62249 | 2 µM |
Additional files
-
Supplementary file 1
Table 1.
Cell Body Score for Neuronal Health and Degeneration IndexScoring system used to determine neuronal health based on morphology of the soma following treatment with compounds used in this study. Table 2. Axon Score for Neuronal Health and Degeneration IndexScoring system used to determine neuronal health based on morphology of the axons following treatment with compounds used in this study.
- https://cdn.elifesciences.org/articles/58037/elife-58037-supp1-v3.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/58037/elife-58037-transrepform-v3.pdf
