Stem cell regionalization during olfactory bulb neurogenesis depends on regulatory interactions between Vax1 and Pax6

  1. Nathalie Coré  Is a corresponding author
  2. Andrea Erni
  3. Hanne M Hoffmann
  4. Pamela L Mellon
  5. Andrew J Saurin
  6. Christophe Beclin
  7. Harold Cremer  Is a corresponding author
  1. Aix Marseille Univ, CNRS, IBDM, Campus de Luminy, France
  2. Department of Obstetrics, Gynecology, and Reproductive Sciences and the Center for Reproductive Science and Medicine, University of California, San Diego, United States


Different subtypes of interneurons, destined for the olfactory bulb, are continuously generated by neural stem cells located in the ventricular and subventricular zones along the lateral forebrain ventricles of mice. Neuronal identity in the olfactory bulb depends on the existence of defined microdomains of pre-determined neural stem cells along the ventricle walls. The molecular mechanisms underlying positional identity of these neural stem cells are poorly understood. Here, we show that the transcription factor Vax1 controls the production of two specific neuronal subtypes. First, it is directly necessary to generate Calbindin expressing interneurons from ventro-lateral progenitors. Second, it represses the generation of dopaminergic neurons by dorsolateral progenitors through inhibition of Pax6 expression. We present data indicating that this repression occurs, at least in part, via activation of microRNA miR-7.


In the postnatal and adult rodent forebrain, new interneuron precursors are continuously generated by neural stem cell populations along the walls of the lateral ventricles. After their amplification in the subventricular zone (SVZ) and long-distance migration via the rostral migratory stream (RMS) they are added to the preexisting circuitry of the olfactory bulb (OB) (Alvarez-Buylla and Garcia-Verdugo, 2002; Whitman and Greer, 2009; Platel et al., 2019).

OB interneurons produced in this SVZ-RMS-OB neurogenic system show a wide spectrum of phenotypic diversity at the levels of morphology, terminal position, connectivity, and neurotransmitter use (Whitman and Greer, 2007). Lineage studies demonstrated that this diversity relies on the existence of defined microdomains of predetermined neural stem cells in the ventricular-subventricular zone [V-SVZ (Merkle et al., 2007; Ventura and Goldman, 2007; Lledo et al., 2008; Fiorelli et al., 2015; Chaker et al., 2016)].

A key question concerns the molecular mechanisms underlying this diversity. It has been shown that Gli1 activation by Sonic Hedgehog (SHH) is necessary to generate Calbindin-expressing periglomerular neurons (CB-N) in the ventral aspect of the ventricular wall (Ihrie et al., 2011). Moreover, the zinc-finger transcription factors (TF) Zic1 and Zic2 act as inducers of Calretinin (CR)-expressing GABAergic interneurons in the dorso-septal region (Tiveron et al., 2017). However, the high diversity of the postnatal generated interneuron subtypes suggests that more complex molecular cascades and cross regulatory interactions are put in place to define the stem cell compartment at the necessary resolution.

This is exemplified by the regulation of a group of OB interneurons that, in addition to GABA, use dopamine as their main neurotransmitter (DA-N). This neuron type is generated by neural stem cells located in the dorsal and dorso-lateral aspects of the ventricular wall. Pax6 is a key determinant of this cell type (Hack et al., 2005; Kohwi et al., 2005) and is expressed in the entire lineage from stem cells to neurons (Hack et al., 2005; de Chevigny et al., 2012b). In addition to this positive transcriptional regulation, post-transcriptional mechanisms have been shown to be crucial for the negatively control of DA-N production. Indeed, Pax6 mRNA expression in the postnatal ventricular wall is not restricted to the DA-N producing dorsal progenitor pool, but extends far into the lateral region where other cell types, including purely GABAergic granule cells and CB-N, are produced. However, the presence of the microRNA miR-7 in a Pax6-opposing ventro-dorsal gradient precludes Pax6 mRNA translation and restricts protein expression, and consequently DA-N phenotype, to the dorsal region (de Chevigny et al., 2012a). Thus, complex molecular events implicating transcriptional and post-transcriptional control mechanisms underlie the functional diversity of OB interneurons.

The Ventral Homeodomain Protein 1 (Vax1), an intracellular mediator of SHH signaling, is expressed in ventral territories of the developing mouse forebrain as well as in ventral aspects of the developing eye (Hallonet et al., 1999; Ohsaki et al., 1999). In both systems, the expression pattern of Vax1 is complementary to that of Pax6, and genetic studies provided evidence for cross regulatory interactions between both factors (Hallonet et al., 1998; Bertuzzi et al., 1999; Hallonet et al., 1999; Stoykova et al., 2000; Bäumer et al., 2002; Mui et al., 2005).

At embryonic stages, constitutive Vax1 mutants show a strong decrease in GABAergic interneurons in the developing neocortex, indicating an essential function in their generation (Taglialatela et al., 2004). Vax-1 homozygous mutants die generally at perinatal stages and only few ‘escapers’ survive for a few weeks after birth. In these animals, the entire postnatal SVZ-RMS-OB neurogenic system is severely compromised, showing accumulation of precursors in the SVZ and severe disorganization of the RMS (Soria et al., 2004), altogether precluding a detailed analysis of Vax1-function at later stages.

In an attempt to understand the regulatory cascades underlying postnatal OB interneuron diversity, we identified Vax1 as a potential candidate. Indeed, based on a high-resolution gene expression screen, comparing the postnatal pallial and subpallial OB lineages, we found that Vax1 mRNA is present in a ventro-dorsal gradient along the lateral wall of the forebrain ventricles. Functional studies using conditional mutants demonstrate that Vax1 is essential for the generation of CB-N by the ventral stem cell pool. Moreover, we show that Vax1 acts as negative regulator of DA-N OB fate via downregulation of the pro-dopaminergic factor Pax6. Finally, we provide data suggesting that this repressor function is, at least in part, mediated by induction of miR-7.


Vax1 is expressed in a ventro-dorsal gradient along the lateral ventricle

We investigated gene expression during postnatal OB neurogenesis by in vivo electroporation of neural stem cells in the lateral and dorsal aspects of the forebrain lateral ventricle at postnatal day 1 (P1), followed by the isolation of homotypic cohorts at different time points by microdissection and FACS. Microarray analyses provided detailed insight into gene expression changes between the two neurogenic lineages (‘in space’) and during the progression from stem cells to young neurons (‘in time’; Figure 1A; for detail see Tiveron et al., 2017).

Vax1 is expressed in the lateral V-SVZ.

(A) Representation of the strategy used for transcriptomic analysis in time and space in the dorsal and lateral OB lineages. pCX-GFP plasmid was introduced into neural stem cells (NSCs) residing within the dorsal or lateral V-SVZ and GFP-positive cells were isolated by FACS at different time points after electroporation (Elpo). The mRNA content was analyzed by micro-array (Tiveron et al., 2017). (B) Quantification of Vax1 mRNA expression detected by micro-array analysis in dorsal (brown) and lateral (purple) progenies during neurogenesis. (C–H) In situ hybridization revealing Vax1 mRNA (in blue) combined with immuno-histochemistry using antibodies detecting (in brown) PAX6 (C, C’, G), ASCL1 (D, D’), DLX2 (E, E’, H) or KI67 (F, F’) proteins in the V-SVZ (C–F) or RMS (G, H) at postnatal day 3 (P3). (C’–F’) High magnification of cellular staining in the V-SVZ (area indicated by the yellow bracket in C-F). Arrows (C’): examples of strong PAX6 only positive cell in the dorso-lateral SVZ; blue staining underneath labels cells from a distinct plane. Arrow heads (E’, F’): double positive cells for DLX2 and KI67, respectively. High magnification of the RMS highlights the differential expression of Vax1 and Pax6 along the dorso-ventral axis (G’,G”) and the co-localization with Dlx2 (H’,H”). (I) Schematic representation of gene expression profile in different cell types of the neurogenic sequence. Circular arrow indicates proliferating cells. LV: lateral ventricle, RG: radial glia, TAP: transit amplified precursor, VZ: ventricular zone, SVZ: sub-ventricular zone. D: dorsal, L: lateral, S: septal, V: ventral. Scale bars: 100 µm (C–F), 20 µm (C’–F’), 50 µm (G–H).

These analyses showed that Vax1 was confined to the neurogenic lineage derived from the lateral ventricular wall (Figure 1B). Vax1 mRNA was induced at low levels at 1 day post-electroporation (dpe) when most GFP-positive cells were transit amplifying precursors [Boutin et al., 2008; Figure 1B]. Expression strongly increased at 2dpe and remained stably high at 4dpe, when most cells were migratory neuronal precursors, before steeply decreasing at 7dpe when cells arrived in the OB and emigrated from the RMS to invade the granule cell (GCL) and the glomerular (GL) layers (Tiveron et al., 2017). In comparison, isolates from dorsally electroporated brains showed no obvious Vax1 mRNA expression over all analyzed time points (Figure 1B).

Next, we investigated Vax1 co-expression with known markers of defined neuronal subsets or differentiation stages in the postnatal V-SVZ. In the absence of a Vax1 antibody that provided reliable signals on postnatal tissue sections, we combined in situ hybridization for Vax1 mRNA with immunohistochemistry for the proteins PAX6, ASCL1, KI67, and DLX2 (Figure 1C–H). Vax1 mRNA always showed a gradient-like distribution along the lateral ventricular wall, with highest expression in the ventral-most aspect and extending far into dorsal regions (Figure 1C,D,E,F). Fainter expression was observed along the septal wall. In the lateral wall, Vax1 mRNA was excluded from the VZ but expressed in the underlying SVZ (Figure 1C’,D’,E’,F’). Vax1 mRNA in the lateral wall was generally non-overlapping with PAX6, a marker for the dorsal stem cell pool and a determinant for the DA-N lineage (Figure C,C’). Vax1 mRNA-positive cells rarely expressed ASCL1 (3.3%±0.32), a marker for transit amplifying precursors (Figure 1D,D’), but the vast majority was labeled with a DLX2 antibody (90%±0.89) (Figure 1E,E’; arrowheads), confirming the preferential expression of Vax1 in migratory neuronal precursors (Doetsch et al., 2002Figure 1I). Finally, about one third (32.6%±3.07) of the Vax1+ cells in the SVZ expressed the proliferation marker KI67 (Figure 1F,F’, arrowheads), likely representing mitotic neuroblasts. In the RMS, Vax1 mRNA was also present in a ventro-dorsal gradient, complementary to PAX6 immunostaining (Figure 1G), although this organization was less evident than in the SVZ, probably due to cell intermingling in this migratory compartment (Figure 1G’, G”). Like in the SVZ, Vax1 mRNA in the RMS co-localized strongly with DLX2 immunoreactivity (Figure 1H, close up H’, H’).

Altogether, the combination of microarray studies in defined neuronal lineages and histological approaches led to the conclusion that Vax1 is expressed in the lateral and ventral SVZ in a subset of proliferating precursors and in most neuroblasts, the latter maintaining expression during their migration in the RMS.

Vax1 is necessary for the generation of calbindin-positive interneurons

Previous work demonstrated that CB-N destined for the GL are generated from the ventral-most region of the anterior lateral ventricles (LV), and SHH signaling has been implicated in their specification (Merkle et al., 2007; Ihrie et al., 2011). As Vax1 is strongly expressed in this area, and has been shown to act as an intracellular mediator of SHH signaling (Take-uchi et al., 2003; Furimsky and Wallace, 2006; Zhao et al., 2010), we first asked if the TF is implicated in the generation of the CB-N subtype.

Vax1 conditionally mutant mice (Vax1cKO) (Hoffmann et al., 2016) were bred to R26tdTomato mice to monitor CRE-induced recombination and to follow the distribution and fate of mutant and control cells over time. We used postnatal in vivo brain electroporation to express CRE protein in the lateral wall (Figure 2A). Since targeting of the Vax1-positive ventral region of the ventricular wall with DNA-based expression constructs is inefficient, we used Cre mRNA, that is highly efficient for the transfection of stem cells along the entire wall, including the most ventral aspect (Bugeon et al., 2017). Animals were electroporated at P0 and analyzed 15 days later, when labeled neurons reached the OB and integrated into the GCL and GL (Figure 2B). Quantification of labeled neurons in the GCL and GL revealed no significant differences between control and mutant mice (Figure 2C; Figure 2—figure supplement 2). TH-positive PGC were also not significantly affected (Figure 4I). However, there was a significant loss in the small population of CB-positive neurons in the GL (Figure 2D,E).

Figure 2 with 2 supplements see all
Vax1 is necessary for the production of Calbindin-positive interneurons in the olfactory bulb.

(A) Representation of the Vax1 conditional allele (Vax1cKO) and the the inducible reporter tdTomato allele in the Rosa26 locus (R26tdTom). Right panel: strategy used to recombine the Vax1 mutant allele in the V-SVZ cells in the lateral wall at postnatal day 0 (P0). TdTomato (Tom)-positive cells were analyzed 15 days post-electroporation (dpe) in the olfactory bulb (OB). (B) Images showing the distribution of Tom+ cells (in red) in the OB at 15dpe in control and mutant brains. Nuclei (in blue) are stained by Hoechst. (C) Quantification of granule cells (GC) number in the OB GCL in both conditions. Data are shown as means ± SD, dots represent individual animals. WT: n = 12, Vax1cKO: n = 17. (D) Images showing Calbindin+ (in green) and Tom+ cells in the GL at 15dpe. Arrow heads indicate double stained neurons. High magnification of representative double positive cells is shown below. (E) Quantification of the percentage of Calbindin+ neurons among the Tom+ PGC population (WT: n = 11, Vax1cKO: n = 17) showing reduction of CB-N in the mutant. GCL: granule cell layer, GL: glomerular layer. *p≤0.05. Scale bars: 200 µm (B), 50 µm (D).

Figure 2—source data 1

Quantification of tdTomato+ granule cells and Calbindin+ PGC in Vax1 mutant.

Thus, Vax1 expression in the ventro-lateral-derived neurogenic lineage is necessary for the correct generation of CB-N in the GL.

Vax1 regulates Pax6 during OB neurogenesis

In situ hybridization indicated that Vax1 mRNA was expressed in a ventro-dorsal gradient (Figure 1). To confirm the existence of such a gradient, we micro-dissected V-SVZ tissue from the dorsal, dorso-lateral, and ventro-lateral regions of the ventricular walls of postnatal and adult mice and subjected the isolates to RT-qPCR analyses for Vax1 mRNA. In agreement with the histological data, Vax1 mRNA showed a steep ventro-dorsal gradient, opposed to, and partially overlapping with, the well-described localization of Pax6 mRNA, that extends dorso-ventrally (Figure 3A, Figure 3—figure supplement 1de Chevigny et al., 2012a). This observation appeared significant for two main reasons. First, several studies provided evidence that Vax1 can negatively regulate Pax6 expression during development (Bertuzzi et al., 1999; Hallonet et al., 1999; Mui et al., 2005). Second, repression of Pax6 translation along the lateral wall is necessary to confine Pax6 protein, and consequently DA-N phenotype, to the dorsal stem cell pool (de Chevigny et al., 2012a).

Figure 3 with 1 supplement see all
Vax1 inhibits PAX6 expression in the V-SVZ and the OB.

(A) Quantitative RT-PCR revealing Vax1 and Pax6 gene expression in tissue micro-dissected from three distinct areas of the V-SVZ. D: dorsal, DL: dorso-lateral, VL: ventro-lateral. (B) Strategy design for the Vax1 gain-of-function experiment. The Vax1 expressing plasmid (pCAG-Vax1) was introduced into lateral or dorsal progenitors in combination with pCX-GFP by electroporation at P1. Brains were analyzed at different time points in the V-SVZ or the OB. (C) Representative images showing simultaneous expression of PAX6 and GFP proteins in dorsal or lateral lineage in the V-SVZ. (D) High-magnification images illustrating the downregulation of Pax6 in GFP+ cells after electroporation of lateral V-SVZ by Vax1. White arrows: GFP/Pax6 double positive cells, yellow arrows point to cells with reduced or absentPax6 expression. (E) Quantification of PAX6 mean intensity in control or Vax1-overexpressing (OE) V-SVZ GFP+ cells from dorsal (D, n = 6 for the control, n = 7 for Vax1 condition) or lateral (L, n = 6 for the CTL, n = 7 for Vax1 condition) walls. (F) Images showing simultaneous expression of PAX6 and GFP in the OB glomerular layer of control or Vax1OE brains. Arrow head: double GFP/PAX6-positive cells; yellow arrow: GFP only cells. (G) Quantification of GFP+PAX6+ neurons in the OB GL at 15dpe (n = 6 for the CTL, n = 6 for Vax1OE) and 25dpe (n = 8 for the CTL, n = 6 for Vax1OE). PGC: periglomerular cell. *p≤0.05, **p≤0.01. Scale bars: 50 µm (C,F), 10 µm (D).

Figure 3—source data 1

Quantification of PAX6 in Vax1-overexpressing progenitors and neurons.

Based on this information, we hypothesized that Vax1 is implicated in Pax6 down-regulation in the postnatal SVZ. To test this, we overexpressed Vax1 in the dorsal and lateral neurogenic lineages by electroporation and investigated the impact on Pax6 expression. A Vax1 expression plasmid (pCAG-Vax1), or an empty control vector, was co-electroporated with pCX-GFP into either the dorsal or the lateral ventricular wall (Figure 3B). Two days later, animals were sacrificed and intensity of Pax6 immunostaining in GFP-positive cells was measured in the dorsal and dorso-lateral SVZ (Figure 3C,D,E). GFP-positive cells generated in both compartments showed a significant decrease in Pax6 expression levels at this early time point (Figure 3D,E).

Then we asked if Pax6 expression was affected at late time points, after the arrival of newborn neurons in the OB GL. Indeed, 15 and 25 days after pCAG-Vax1 electroporation into the dorsal wall the proportion of GFP-positive neurons that showed Pax6 expression was reduced by over 80% (Figure 3F,G).

We conclude that Vax1 has the capacity to act as a negative regulator of Pax6 expression during postnatal OB neurogenesis.

Vax1 negatively regulates dopaminergic phenotype

DA-N in the OB GL are derived from the dorsal and dorso-lateral aspects of the ventricle walls (Merkle et al., 2007; Fernández et al., 2011; de Chevigny et al., 2012a) and Pax6 expression is necessary and sufficient for the acquisition of this neurotransmitter phenotype (Hack et al., 2005; Kohwi et al., 2005). We asked if Vax1 overexpression in Pax6-positive cells was sufficient to inhibit the generation of DA-N in the OB.

We first targeted the dorsal compartment (Figure 4A–D), where the majority of DA-N are generated (Fernández et al., 2011; de Chevigny et al., 2012a). Ectopic expression of Vax1 led to a significant loss of TH/GFP-positive neurons 15 days later in the OB (Figure 4B). Loss of TH-positive cells was robust over time and could be observed at 25 and 60 dpe (Figure 4C). Two observations pointed toward the specific loss of dopaminergic neurons. First, the number of the second major identified neuron type that is generated in the dorsal ventricular wall, CR-N of the glomerular layer (Fernández et al., 2011; Tiveron et al., 2017), was unaffected by Vax1 expression (Figure 4B), arguing against a fate shift toward this neuron type (Tiveron et al., 2017). Second, the density of total GFP+ cells in the GL of Vax1-electroporated animals was significantly reduced (Figure 4D), whereas the number of GFP+ granule cells was not affected (Figure 4—figure supplement 1). As dopaminergic neurons represent a substantial population of all dorsal generated periglomerular cells such an overall loss is coherent with a loss of the DA-N subtype.

Figure 4 with 1 supplement see all
Overexpression of Vax1 in V-SVZ neural stem cells inhibits dopaminergic phenotype.

(A) Experimental design (left) for the electroporation of NSCs in the dorsal wall with pGAC-Vax1 + pCX-GFP. Images (right) showing expression of Tyrosine Hydroxylase (TH) and Calretinin (CR) in the OB glomerular layer 15 days after electroporation in Vax1 over-expression (OE) and control brains. White arrow head: GFP/CR- double positive neuron, yellow arrow head: GFP/TH double positive neuron, yellow arrow: GFP-only cell. (B) Histogram showing the reduction of the density of GFP+ periglomerular cells (PGC) in the Vax1OE OB (CTL n = 15, Vax1 n = 14). (C) The quantification of TH+ and CR+/GFP-positive cells shows a large decrease of the proportion of dopaminergic neurons among the total GFP+ cells in the OB of Vax1 condition (TH n = 14, CR n = 15) compared to control (n = 13/14). (D) The reduction of the TH+ population is sustained with time as it is still observed at 25- (CTL n = 7, Vax1 n = 5) and 60- (CTL n = 5, Vax1 n = 4) days post electroporation. (E) Experimental design (left) for the electroporation of NSCs in the lateral wall with pGAC-Vax1 + pCX-GFP. Representative images (right) of immunostaining with TH, Calbindin (CB), and CR antibodies in the OB GL. Arrow head: example of double positive staining with GFP for each marker. (F) Histogram presenting the quantification of the three different neuronal populations among the GFP+ neurons in the OB of control (n = 10 for each marker) or Vax1OE (TH n = 11, CB and CR n = 9) conditions. (G) Histogram showing the density of GFP + PGC in both conditions (CTL n = 10, Vax1 n = 10). (H) Lateral NSCs of Vax1cKO: rosa26tdTom brains were electroporated at birth with pCX-CRE and neuronal phenotype was analyzed in OB at 15 dpe. Representative images of TH staining in the GL of control or Vax1 deficient OB. Arrow head: GFP+ cells co-labelled with TH. Insert: high magnification of a double positive neuron. (I) Histograms presenting the percentage of TH+ neurons among Tom+ PGC (CTL: n = 12, three independent litters; Vax1: n = 12, three independent litters). A slight increase of the TH+ population was observed in absence of Vax1 compared to control but statistical test (Mann Whitney U test) failed to give significant p values (p=0.16). **p≤0.01, ****p≤0.0001. All scale bars: 20 µm except in H (50 µm).

Figure 4—source data 1

Quantification of OB neuronal subpopulations in Vax1- overexpressing or Vax1 mutant mice.

Next, we targeted the lateral ventricular wall (Figure 4E–G), where smaller but still significant numbers of DA-N are produced from a dorso-lateral stem cell pool (Figure 4F). Overexpression of Vax1 in the lateral wall induced a significant loss of TH-positive neurons in the GL 15 days later (Figure 4F). At the same time point, numbers of CB-N and CR-N were unchanged (Figure 4F), indicating again that no phenotypic switch toward these subtypes occurred. The density of GFP+ cells was also unaffected in both GL (Figure 4G) and GCL (Figure 4—figure supplement 1). Thus, Vax1 overexpression specifically inhibits DA-N phenotype of newborn neurons in the OB.

We also investigated whether Vax1 loss-of-function had a positive impact on DA-N phenotype in the OB. NSCs along the lateral wall of Vax1cKO animals were electroporated with pCX-CRE (Figure 4H) and the proportion of TH-positive neurons in the OB was analyzed 15 days later. These analyses failed to show a significant increase in DA-N at a confidence level of p≤0.05 (Figure 4I).

We conclude that Vax1, likely via regulation of Pax6, has the capacity to negatively control the generation of DA-N for the OB. Moreover, these data show that while Vax1 is necessary for the generation of CB-N, it is not sufficient.

Vax1 induces miR-7 expression in the lateral wall

Previous work demonstrated that mature microRNA miR-7 is expressed in a ventro-dorsal gradient along the lateral ventricular wall and post-transcriptionally inhibits Pax6 protein expression. This interaction confines the generation of DA-N to the very dorso-lateral aspect (de Chevigny et al., 2012a). As Vax1 and miR-7 are expressed in a similar gradient, we hypothesized that the repression of Pax6 protein expression by Vax1 is mediated by miR-7. To address this idea, we overexpressed Vax1 together with GFP in the lateral stem cell compartment and isolated GFP-positive cells 2 days later by microdissection, dissociation and flow cytometry cell sorting (Figure 5A). qRT-PCR analyses demonstrated that augmented Vax1 expression (Figure 5B) led to a strong increase in miR-7 levels (Figure 5C), suggesting that Vax1 regulates MiR-7 expression. In agreement, bioinformatical analyses of the proximal promoters of the three MiR-7 loci (MiR-7–1, MiR-7–2, MiR-7b) identified a significant match of the Vax1 DNA binding motif within 500 bp of the transcription start site of each of the three MiR-7 loci present in the mouse genome (Figure 5D). Altogether, these results suggest that the negative impact of Vax1 on Pax6 expression is, at least in part, mediated via the positive regulation of MiR-7.

Vax1 induces the expression of miR-7 in the lateral V-SVZ.

(A) Strategy used to determine the expression of microRNAs in Vax1-overexpressing progenitors. PCAG-Vax1 and pCX-GFP were simultaneously introduced into NSCs by electroporation of the lateral wall of postnatal P1 brains. Lateral V-SVZ was dissected out 2 days after electroporation and GFP+ cells were isolated by flow cytometry (FACS) to perform quantitative RT-PCR analysis. (B) Quantification of Vax1 mRNA level by qRT-PCR in control and Vax1OE conditions, normalized to beta-actin and reported in Vax1 condition as relative level to control, validating the overexpression of Vax1 after electroporation. (C) Quantification of miR-7 expression in both conditions. Expression level of miR-7 was normalized by invariant expression of microRNA let-7a and reported in Vax1 condition as relative level to control. Experiments in B and C were performed in triplicate, and data were obtained from (B) two independent biological replications or (C) three technical replications. (D) Genome browser images representing the chromosomal portions encoding the three MiR-7 loci (depicted in pink). Mir-7–1 lies within an intronic sequence of the Hnrnpk gene whereas MiR-7–2 and MiR-7b reside within intergenic sequences. Vax1-binding sites found in the upstream regulatory region of the three MiR-7 are represented by red boxes. (E) Model of cross-regulatory interaction between Vax1, miR-7, and Pax6 in the lateral V-SVZ to control the number of dopaminergic neurons generated by the neural stem cells regionalized in this aspect. This model is supported by our present data and previous work (de Chevigny et al., 2012a) where it was shown that miR-7 was required to inhibit PAX6 expression in lateral NSCs to produce the correct number of dopaminergic neurons in the postnatal OB. Here, we propose that Vax1 acts upstream of miR-7 by positively regulating its expression and consequently inhibiting PAX6. However, it is also possible that Vax1 directly represses the expression of Pax6 mRNA (dashed line) by acting on its promoter (Mui et al., 2005). Additionally, Vax1 is required to generate Calbindin neurons from the ventral aspect of the lateral V-SVZ.

Figure 5—source data 1

Quantification of expression level of Vax1 and miR-7 in V-SVZ cells.


Here, we show that Vax1 is strongly expressed in the ventral stem cell compartment of the OB neurogenic system where it is necessary for the generation of CB-N. In addition to this actively phenotype-determining function, our data show that Vax1 acts as a negative regulator of Pax6, likely via the induction of miR-7, thereby restricting the generation of DA-N, which are generated in a neighboring progenitor domain (Figure 5Ede Chevigny et al., 2012a).

During nervous system development, determination of neuronal phenotype is controlled by the combinatorial expression of transcription factors (Flames et al., 2007; Guillemot, 2007; Lai et al., 2016). Moreover, cross regulatory interactions between such TFs have been shown to tightly define progenitor domains that generate specific neuron subtypes (Jessell, 2000; Sagner and Briscoe, 2019). Such spatial information has to be maintained during postnatal and adult stages and neuronal output has to be adapted to the needs of the ongoing neurogenesis in the OB. In agreement, regionalization of the postnatal stem cell compartment has been shown to depend on spatially restricted and combinatorial expression of TFs like, for example, Pax6, Emx1, Gsx1/2, Gli1/2, or Zic1/2 (Alvarez-Buylla et al., 2008; Weinandy et al., 2011; Fiorelli et al., 2015; Angelova et al., 2018).

CB-N are produced by NSCs positioned in the ventral aspect of the V-SVZ (Merkle et al., 2007) and SHH signaling, via its effector GLI1, has been implicated in the specification of this subtype (Ihrie et al., 2011). Interestingly, previous work demonstrated that Vax1 expression is positively controlled by SHH signaling (Hallonet et al., 1999; Take-uchi et al., 2003; Furimsky and Wallace, 2006). In light of our finding that Vax1 deletion also leads to specific loss of CB-N, it appears probable that Vax1 acts downstream of SHH expression in the ventral SVZ to control CB-N production for the OB.

In addition to this local role in CB-N generation, Vax1 regulates the generation of a neighboring neuron type. Indeed, its expression extends in a gradient far into dorsal regions of the ventricular wall, where Pax6 is expressed and acts as a key component of DA-N generation (de Chevigny et al., 2012a). Forced expression of Vax1 in the Pax6-positive domains was sufficient to reduce PAX6 protein expression and to inhibit the production of DA-N, but not of other neuron types, in the OB. This strongly indicates that Vax1 acts as a repressor of Pax6, comparable to the situation in the developing eye (Bertuzzi et al., 1999; Hallonet et al., 1999; Mui et al., 2005).

Loss-of-function of Vax1 through targeted electroporation with a CRE expression vector in the lateral wall of conditional mutants did not lead to a statistically significant increase in DA-N at the classically used confidence level of p≤0.05. The observed tendency toward DA-N increase was, however, quite robust over several independent electroporation approaches implicating a large cohort of animals. We decided to include these data, as they complement the gain-of-function approach and as we believe that they could be biologically relevant. Indeed, the cell population in the lateral wall that will be able to induce DA-N fate after deletion of Vax1 is probably quite small. A large proportion of cells targeted by electroporation in the dorso-lateral wall do not express Vax1 and these cells will follow their normal differentiation program after recombination. Only cells in intermediate positions, that express sufficiently high Pax6 levels to be able to induce the DA-N phenotype, while at the same time having sufficient Vax1 levels to suppress this differentiation pathway, will show a DA-N phenotype after Vax1 removal. In addition, other factors, like lower recombination efficiency of the Vax1 allele versus the R26tdTomato allele, might further diminish the number of cells in which the impact of gene inactivation can be studied (Long and Rossi, 2009; Luo et al., 2020). Thus, while our electroporation approach allows targeting and manipulating specific stem cell compartments, it also has limitations that restrict interpretation.

Finally, the implication of microRNAs introduces an additional level of complexity into the cross regulatory machinery that underlies OB interneuron fate determination. In previous work, we demonstrated that PAX6 protein, and consequently DA-N production, is confined to the dorsal aspect of the lateral ventricle wall by post-transcriptional regulation of the Pax6 3’UTR by the microRNA mir-7. The latter is, like Vax1, expressed in a ventro-dorsal and Pax6 opposing gradient. Thus, it is tempting to speculate that the repression of Pax6 by Vax1 is, at least in part, indirect and produced via activation of miR-7. Our finding that overexpression of Vax1 in vivo induced a strong increase in miR-7 levels, and the presence of Vax1-binding sites in all three MiR-7 promoter regions supports such a scenario. Indeed, regulatory networks implicating transcription factors and miRNAs have been described in other contexts of developmental neurogenesis. For example, in the developing spinal cord, progenitor domains producing defined types of interneurons depend on the cross regulation between the transcription factors Olig2 and Irx3. This interaction is fine-tuned by the induction of miR-17–3 p that represses Olig2 and refines the boundary between domains (Chen et al., 2011). Thus, such regulatory modules could be a general mechanism to assure the precise definition of progenitor compartments.

In conclusion, we identified in the postnatal brain a regulatory network, based on transcription factors and miRNAs, which controls the regionalization of the stem cell compartment (Figure 5E). The observation that the ventro-dorsally oriented Vax1 gradient (Figure 3—figure supplement 1) as well as the graded expression of Pax6 and miR-7 (de Chevigny et al., 2012a) are maintained in adult stages points to the possibility that this regulatory cascade is also active in adult neurogenesis.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
Strain, strain background (Mus musculus)Vax1floxPMID:27013679RRID:MGI:5796178
Strain, strain background (Mus musculus)Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (Ai14)Jackson LaboratoriesRRID:IMSR_JAX:007914
Strain, strain background (Mus musculus)CD1Charles RiverCrl : CD1(ICR)
Sequence-based reagentMouse Vax1 cDNAGenBankBC111818
Sequence-based reagentCre mRNAMiltenyi Biotec130-101-113
Recombinant DNA reagentpCX-EGFP
PMID:17934458Dr Xavier Morin (CNRS, Aix-Marseille University)
Recombinant DNA reagentpCX-CRE
PMID:17934458Dr Xavier Morin (CNRS, Aix-Marseille University)
AntibodyAnti-digoxigenin (Sheep polyclonal)Roche11093274910
IHC (1:1000)
(Rabbit polyclonal)
IF, IHC (1: 1000)
(mouse monoclonal)
BD Biosciences556604
IHC (1:100)
(mouse monoclonal)
BD Biosciences550609
IHC (1:200)
(guinea pig polyclonal)
Prof. K. Yoshikawa, Osaka University, Osaka, JapanPMID:16707790IHC (1: 2000)
AntibodyAnti-Calbindin D-28K
(Rabbit polyclonal)
IF (1 :1000)
AntibodyAnti-Calbindin D-28K
(mouse monoclonal)
IF (1:3000)
AntibodyAnti- Calretinin
(mouse monoclonal)
Synaptic systems214111
IF (1:1000)
AntibodyAnti-Tyrosine hydroxylase (chicken polyclonal)Avès LabsTYH, RRID:AB_10013440IF (1:1000)
Commercial assay or kitSYBR GreenER qPCR SuperMixThermoFisher Scientific11762100
Commercial assay or kitmiScript SYBR Green PCR KitQiagen218073
Commercial assay or kitmiRCURY LNA miRNA PCR AssayQiagen339306
Commercial assay or kitmiRNAeasy kitQiagen217004
Software, algorithmZEN BlueZeissRRID:SCR_013672
Software, algorithmAxiovision imaging systemZeissRRID:SCR_002677
Software, algorithmFijihttp://fiji.scRRID:SCR_002285
Software, algorithmImageJ
Software, algorithmR Commander
Software, algorithmFlowJo


All animal procedures were carried out in accordance to the European Communities Council Directie 2010/63/EU and approved by French ethical committees (Comité d'Ethique pour l'expérimentation animale no. 14; permission numbers: 00967.03; 2017112111116881 v2). Animals were held on a 12 h day/night cycle and had access to food and water ad libitum. Animals of both sexes were used for experiments. CD1 mice (Charles River, Lyon, France) were used for in vivo electroporation and expression pattern analyses. Vax1flox (Vax1cKO) conditional mutants (Hoffman 2016) and Rosa26tdTomato reporter mice (Ai14, Jackson Laboratories, USA, RRID:IMSR_JAX:007914) were bred on a mixed C57BL/6*CD1 genetic background. Vax1flox genotyping was performed with Vax1flox forward: 5’-GCCGGAACCGAAGTTCCTA; Vax1wt forward: 5’-CCAGTAAGAGCCCCTTTGGG, reverse 5’-CGGATAGACCCCTTGGCATC. Ai14 genotyping was performed with R26wt forward: 5’-AAGGGAGCTGCAGTGGAGTA, reverse 5’-CCGAAAATCTGTGGGAAGTC; R26tdTom forward: 5’- CTGTTCCTGTACGGCATGG and reverse: 5’- GGCATTAAAGCAGCGTATCC.

Plasmid and in vivo electroporation

Request a detailed protocol

The full-length rat cDNA sequence of Vax1 was excised from pCMV2-Rn-Vax1-FLAG (a gift of Kapil Bharti) and subcloned into pCAGGS vector to produce pCAG-Vax1. Postnatal day 0 (P0) or day 1 (P1) pups were electroporated as previously described (Boutin et al., 2008; de Chevigny et al., 2012a) with plasmid DNA or RNA (Bugeon et al., 2017). CRE Recombinase mRNA (130-101-113, a generous gift from S. Wild and A. Bosio, Miltenyi Biotec, Bergisch Gladbach, Germany) and pCX-CRE (Morin et al., 2007) were used at a concentration of 0.5 µg/µl. Recombination efficiency was tested by qRT-PCR from tdTomato+ cells isolated by FACS (Figure 2—figure supplement 1). In CD1 pups, pCX-EGFP (Morin et al., 2007) was co-injected with pCAG-Vax1 or empty pCAGGS (as control) in a 1:2 molecular ratio to label the electroporated cells. Targeting of the dorsal or lateral wall of the lateral ventricle was directed by distinct orientation of the electrodes. Brains were collected at different time points after electroporation.

In situ hybridization and immunohistochemistry

Request a detailed protocol

For all procedures, tissues were fixed by intracardiac perfusion with ice-cold 4% paraformaldehyde (wt/vol) in phosphate buffered saline (PBS) and cryoprotected in 30% sucrose solution in PBS. Brains were sliced coronally using either a microtome (Microm Microtech, France) or a cryostat (Leica Biosystems, France).

Mouse Vax1 cDNA clone (GeneBank: BC111818, Imagene) was used to produce the anti-sense RNA probe. Combined in situ hybridization (ISH) and immunohistochemistry (IHC) were performed as previously described (Tiveron et al., 1996) on 16 µm cryosections at postnatal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP) substrate NBT/BCIP (Promega, S3771) was necessary to detect AP-DIG-labeled Vax1 mRNA at maximal level. Subsequently, antibodies directed against PAX6 (rabbit polyclonal, 1: 1000, Millipore, AB2237, RRID:AB_1587367), KI67 (mouse IgG1k clone B56, 1:200, BD Biosciences, 550609, RRID:AB_393778), ASCL1 (mouse, clone 24B72D11.1, 1:100, BD Biosciences, 556604, RRID:AB_396479), or DLX2 (rabbit polyclonal, 1: 2000 a gift from Prof. K. Yoshikawa) were applied to the ISH treated sections and were revealed with secondary antibodies coupled to horseradish peroxidase (Jackson ImmunoResearch Laboratories, UK), using 3, 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate. Sections were finally mounted in fluoromount medium and analyzed by light microscopy using Axiovision Rel. 4.8 software (Zeiss, Germany).

For immunofluorescence, 50 µm floating sections were blocked in PBS supplemented with 0.5% Triton-X100, 10% foetal calf serum (FCS) and incubated overnight at 4°C in PBS, 0.1% Triton, 5% FCS with primary antibodies: anti-Calbindin D-28K (rabbit polyclonal, 1:1000, Millipore, AB1778, RRID:AB_2068336 or mouse IgG1, 1:3000, Swant, 300, RRID:AB_10000347), anti-Calretinin (mouse IgG1, clone 37C9, 1:1000, Synaptic systems, 214111, RRID:AB_2619906), anti-Tyrosine hydroxylase (chicken IgY, 1:1000, Avès labs, TYH, RRID:AB_10013440). After washing in PBS, Alexa Fluor-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories) were applied diluted at 1:500 in blocking solution for 2 hr at room temperature. After staining of cell nuclei with Hoechst 33258 (Invitrogen, H3569), sections were mounted with Mowiol (Sigma-Aldrich, 81381).

RNA isolation, qRT-PCR, cell dissociation, and FACS

Request a detailed protocol

Animals (P1-P3) were decapitated and brains were cut into 300 μm thick sections using a Vibrating-Blade Microtome (Thermo Scientific, HM 650V). V-SVZ and RMS tissues were micro-dissected under a binocular microscope and kept in cold Hank’s balanced salt solution (HBSS, Gibco, 14170120). RNA was extracted using the miRNAeasy kit (Qiagen, 217004) or by Trizol reagent (life technologies, 15596026) according to manufacturer instructions, allowing the recovery of long and short RNAs. For Pax6 and Vax1 expression analysis, cDNA was prepared using superscript III reverse transcriptase (ThermoFisher Scientific, 12574–030) following manufacturer instructions and quantitative PCR was performed on a BioRad CFX system using SYBR GreenER qPCR SuperMix (ThermoFisher Scientific, 11762100) in technical triplicates. ß-Actin was used as reference gene. Primers used for mRNA detection are the following: Beta Actin forward 5’-CTAAGGCCAACCGTGAAAAG and reverse 5’-ACCAGAG GCATACAGGGACA; Pax6 forward 5’-TGAAGCGGAAGCTGCAAAGAAA and reverse 5’-TTTGGCCCTTCGATTAGAAAACC; Vax1 forward 5’- GCTTCGGAAGATTGTAACAAAAG and reverse 5’- GGATAGACCCCTTGGCATC.

For miRNA expression, cDNA was prepared using miScript II (Qiagen, 218160) and qPCR was performed using miScript SYBR Green PCR Kit (Qiagen, 218073) together with miRCURY LNA miRNA PCR Assay (Qiagen, 339306) on a StepOne Real-Time PCR System (Applied Biosystems). Let-7a was used as normalizer miRNA. Three independent technical replications for each condition were processed in triplicates.

To generate single-cell suspensions for FACS, dissected tissues were subjected to cell dissociation using a Papain solution and mechanical dissociation as described previously (Lugert et al., 2010). Cells were resuspended in HBSS/Mg/Ca supplemented with 10 mM HEPES (Gibco, 15630080), 40 μg/ml DNase I (Roche, 10104159001), 4.5 g/L Glucose (Gibco, A2494001) and 2 mM EDTA, filtered through a 30 μm pre-separation filter (Miltenyi Biotec, 130-041-407) and sorted on MoFlo Astrios EQ cytometer (Beckman- Coulter) gating on GFP- or tdTomato- positive population.

Bioinformatics analysis

Request a detailed protocol

Significant Vax1 DNA binding motif (JASPAR Core position-weight matrix MA0722.1) occurrences in the three MiR-7 loci (MiR7-1, MiR7-2, MiR7b) proximal promoters (defined as 500 bp upstream of the transcription start site) from the Mus musculus mm10 genome were determined using FIMO from the MEME suite (Bailey et al., 2009) with a maximum p-value limit of 0.001. FIMO-derived p-values of motif matches in the promoters were 0.000173 (MiR7-1), 0.000333 (MiR7-2), and 0.000806 (MiR7b). Genome browser images were created using the UCSC Genome Browser.

Image analyses

Request a detailed protocol

All images were analyzed blind to the experimental condition. Optical images were acquired with an Axioplan2 ApoTome microscope (Zeiss, Germany) using ZEN software (Zeiss, RRID:SCR_013672), and processing was performed using Fiji software (RRID:SCR_002285, [Schindelin et al., 2012]) or ImageJ (NIH, https://imagej.nih. gov/ij/, RRID:SCR_003070). ISH/IHC double staining experiments were analyzed by counting labelled SVZ cells along the lateral ventricular wall on 40X magnification images (n = 3 SVZ for Ki67 and Dlx2, n = 8 SVZ for Ascl1). For cell counting in V-SVZ and OB tissues from electroporation experiments, a minimum of three sections per brain (n = animal) were analyzed and the totality of GFP+ or Tomato+ cells of each section were counted. To measure mean intensity of fluorescence after antibody staining, ROI were applied on individual electroporated cells.

Statistical analysis

Request a detailed protocol

Control and Vax1 electroporation assays were performed from the same litter and were reproduced in two or three independent experiments for lateral or dorsal electroporation, respectively. Histograms were drawn with GraphPad Prism version 8 (GraphPad Software, San Diego, CA). Data are presented as mean ± SD. Each sample (n = animal/brain) is represented on histograms by dot. Statistical analyses were performed using R software (RRID:SCR_001905) and R Commander Package ( The non-parametric two-tailed Mann Whitney U test was performed for all in vivo experiments, on pooled experimental repetitions when appropriate. Differences were considered statistically significant when p≤0.05.

Data availability

All data generated or analysed during this study are included in the manuscript.


  1. Conference
    1. Alvarez-Buylla A
    2. Kohwi M
    3. Nguyen TM
    4. Merkle FT
    The heterogeneity of adult neural stem cells and the emerging complexity of their niche
    Cold Spring Harbor Symposia on Quantitative Biology. pp. 357–365.
    1. Bäumer N
    2. Marquardt T
    3. Stoykova A
    4. Ashery-Padan R
    5. Chowdhury K
    6. Gruss P
    Pax6 is required for establishing naso-temporal and dorsal characteristics of the optic vesicle
    Development 129:4535–4545.
    1. Hallonet M
    2. Hollemann T
    3. Wehr R
    4. Jenkins NA
    5. Copeland NG
    6. Pieler T
    7. Gruss P
    Vax1 is a novel homeobox-containing gene expressed in the developing anterior ventral forebrain
    Development 125:2599–2610.

Decision letter

  1. Stephen Liberles
    Reviewing Editor; Harvard Medical School, United States
  2. Gary L Westbrook
    Senior Editor; Oregon Health and Science University, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

The olfactory bulb is a rare brain region that incorporates newly born neurons in the adult. The molecular pathways that give rise to the diversity of olfactory bulb neuron types during adult neurogenesis are poorly understood. This study reveals a key role for the transcription factor Vax1 in guiding cell fate decisions of adult-born neurons, promoting formation of calbindin interneurons and suppressing formation of dopaminergic neurons.

Decision letter after peer review:

Thank you for submitting your article "Regulatory interactions between Vax1, Pax6 and miR-7 regionalize the lateral SVZ during mice olfactory bulb neurogenesis" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Gary Westbrook as the Senior Editor. The reviewers have opted to remain anonymous. The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 ( First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)


Neurons in the olfactory bulb are replenished throughout life, but mechanisms underlying the maintenance of neuronal diversity remain poorly defined. In this study, the authors identify a key role for Vax1 and Pax6 in the cell fate decisions that control differentiation of particular olfactory bulb interneurons.

Essential revisions:

– Data implicating a functional role for Mir-7 are preliminary; it is advised that claims be bolstered or toned down.

– Comments from all reviewers are provided below in case they are helpful. Reviewer #3 in particular requested additional data and information prior to rendering a final decision.

Reviewer #1:

Core et al. study the transcription factor Vax1 in the context of cell fate using the SVZ-RMS-OB adult neurogenesis model. The novel part of the data seems incremental and while suggestive it's not always compelling; Particularly so the claims of specificity. Some analyses and controls could be improved.

1) Figure 1 – The combination of ISH and IC is legitimate but the data are not compelling. The overlap in Figure 1G-H are good examples. This is also evident in the qualitative description of overlap. In any event, these data are not very clean. The paper would benefit from a quantitative approach. For example, a double-labeling smFISH expression analysis would be more successful.

2) Figure 2 – The comparison of GCL tdt+ numbers (Figure 2 B,C ) should be compared to PGL numbers. The current comparison to 2D,E is not a fair comparison (apples to apples…). For claim a specificity effect, they should compare to other cell types in the PGL in the same animals.

3) Figure 3D – The large scale gradient is convincing but not very novel. To drive this conclusion home, a similar analysis that is done in 3A should be conducted at a single cell level.

In C-F the claim for specificity is weak. They should show that expression of other TFs are not hampered in the GFP cells. It’s possible that the mere over expression of a Vax1 impacts other proteins in a negative way. I am not from the field but it seems to me that a better control is needed (e.g. at the very least a scrambled version of Vax1OE).

4) Figure 4 – in 4B the CR distribution seems to be different – it has a double peak as compared to controls. More appropriate statistics may show this difference.

4I distributions are very similar. The text description of these as being marginally significant is misleading.

5) The miR-7 data are robust but remain anecdotal and currently not very natural to add it to the storyline of the paper that remains intact without it.

Reviewer #2:

The manuscript by Core et al. examines the molecular players that display spatial segregation and regulate neonatal progenitor fate from the SVZ to the olfactory bulb. They build on previous work from their lab and others that have reported specific function of PAx6 and mir-7 in neuron fate determination. The manuscript is well-written and uses an array of approaches to address their questions. Overall, the data are strong and well presented. My enthusiasm is to some extent limited as outlined in the following comments:

1) Data regarding the contribution of miR-7 are limited. I think more data are either necessary to show that Vax1 works through mir-7 to regulate neuronal fate or the authors should change their writing and conclusion.

For example, in the Abstract: "We provide evidence that this repression occurs via activation of microRNA miR-7, targeting Pax6 mRNA." I think it is overselling the data presented in this manuscript. Much more data would be required for this conclusion. For example, the mir-7 data could be left out of the Abstract but presented at the end of the Introduction as well as discussed.

2) Figure 1: please show analysis of the in situ/immune data.

3) Better images for Figure 3C would be helpful to actually see the decrease in Pax6 intensity.

4) The sentence: "However, we stably observed a tendency for an increase over independent electroporation experiments (3 experiments for each condition with a total of 12 animals/ condition, Figure 4I)." should be removed. There is no effect.

Reviewer #3:

During the process of brain development in mammals, neuronal fates are determined by the combinatorial expression of transcription factors. In the olfactory bulb (OB), different subsets of interneurons are constantly supplied from the subventricular zone (SVZ) not only in neonates but also during adulthood. These OB interneurons demonstrate a wide variety of phenotypes in morphology, migration, connectivity, and the use of neurotransmitters. It has been shown that this diversity of interneurons is generated depending on the stem-cell microdomains along the walls of lateral ventricles. In this study, the authors tried to clarify the molecular mechanism underlying the positional identity of neural stem-cells by analyzing gene expression during postnatal OB neurogenesis.

Using the conditional knockout of a homeodomain protein, Vax1, as well as the in vivo electroporation of the Vax1-expression vector, the authors demonstrated new findings that provide fundamental insights into the cross-regulatory interactions that determine neuronal phenotypes in the mammalian brain. Major findings in this study are: 1) Vax1 is a key determinant for the generation of Calbindin-positive interneurons in the ventral compartment of the SVZ; 2) Vax1 negatively regulates the transcription of Pax6 whose expression is essential for the generation of dopaminergic neurons in the dorsal compartment; and 3) Repression of Pax6 occurs by microRNA miR-7 targeting the Pax6 mRNA.

These findings are novel and will provide new insights into our understanding of fate determination of developing neurons. The paper is clearly written and easy to understand. Experiments in this study are elegantly designed. I therefore support publication of this manuscript in eLife if the reviewer's comments are properly responded.

Specific comments:

1) In the loss-of-function experiment in Figure 2, it would be helpful if the authors could show how efficiently Vax1 expression is suppressed in the targeted tdTomato positive cells by using in situ hybridization.

2) Also in the gain-of-function experiment in Figure 3, the levels of Vax1 derived from the electroporated vector DNA should be shown for the GFP-positive cells, by in situ hybridization.

3) In this manuscript, the authors analyzed regulatory interactions among Vax1, Pax6, and miR-7 only in neonates. Since interneurons are constantly regenerated during adulthood, it would be helpful, if the authors could demonstrate the data showing that the same regulatory cross-talk can be seen in the adult neurogenesis of interneurons.

4) What is the mechanism of Vax1-mediated miR-7 enhancement? Do they directly interact with each other? Is there any binding site for Vax1 within the promoter region of the miR-7 gene?

5) Cross-regulatory interactions for Vax1, Pax6, and miR-7 are nicely shown in this study. It would be helpful if the authors could discuss this regulation strategy in the context of neurogenesis during brain development in order for the paper to attract a wider research audience other than those investigating transcription factors.

Author response

Reviewer #1:

1) Figure 1 – The combination of ISH and IC is legitimate but the data are not compelling. The overlap in Figure 1G-H are good examples. This is also evident in the qualitative description of overlap. In any event, these data are not very clean. The paper would benefit from a quantitative approach. For example, a double-labeling smFISH expression analysis would be more successful.

We quantified the percentage of double stained cells for the different markers used in Figure 1 D-F. Moreover, in the RMS (Figure 1 G,H) cells migrate partially intermingled, making a graded distribution of Vax1 and Pax6 positive cells, as is obvious in the SVZ, less evident. We added higher magnification images to illustrate the differential expression of Vax1 in the ventral (Figure 1G’) and dorsal (Figure 1G’’) aspects of the RMS. We also added higher magnifications to illustrate the co-expression of DLX2 and Vax1 in the RMS (Figure 1H’ and H’’). The Results section was changed accordingly.

2) Figure 2 – The comparison of GCL tdt+ numbers (Figure 2 B,C ) should be compared to PGL numbers. The current comparison to 2D,E is not a fair comparison (apples to apples…). For claim a specificity effect, they should compare to other cell types in the PGL in the same animals.

New data showing the PGC quantification was added to the manuscript as Figure 2—figure supplement 1B. Please also note that, in addition to the CB+ PGC population now presented in Figure 2E, we already analyzed in the same animals the number of TH+ PGC (Figure 4I).

3) Figure 3D – The large scale gradient is convincing but not very novel. To drive this conclusion home, a similar analysis that is done in 3A should be conducted at a single cell level.

In C-F the claim for specificity is weak. They should show that expression of other TFs are not hampered in the GFP cells. It’s possible that the mere over expression of a Vax1 impacts other proteins in a negative way. I am not from the field but it seems to me that a better control is needed (e.g. at the very least a scrambled version of Vax1OE).

Here, the reviewer’s comments/questions are in part a bit unclear to us and we hope we got the main points.

To our knowledge the existence of large-scale gradients in the postnatal SVZ is still a relatively new concept. Designing and performing a single cell analysis experiment that provides reliable information about such gradients is not easy and, to our eyes, exceeds the scope of this study. Use of a scrambled protein as control for gain-of-function experiments in vivo is a rather unusual approach in the field. As far as we know, such a control has so far not been applied. Finally, specific Pax6/Vax1 regulatory interactions have been shown in other brain developmental contexts, like for example the eye, arguing for the specificity of the observed effects here.

4) Figure 4 – in 4B the CR distribution seems to be different – it has a double peak as compared to controls. More appropriate statistics may show this difference.

4I distributions are very similar. The text description of these as being marginally significant is misleading.

Concerning 4b: We agree that there is some heterogeneity in this specific experiment. However, all samples have been treated exactly the same way and analyzed by the appropriate statistical tests. We do not see which variables can be tested to address the reviewers point.

Concerning Figure 4I: We accept the reviewer’s critique and removed any potentially misleading conclusion concerning these data from the Results section.

5) The miR-7 data are robust but remain anecdotal and currently not very natural to add it to the storyline of the paper that remains intact without it.

We added additional data, reinforcing the link between Vax1 and miR-7, by showing the all three miR-7 promoters contain putative Vax1 binding sites. We opted to maintain the data in the manuscript, but tempered our conclusions concerning this aspect. We also removed the mention of miR-7 from the manuscript title.

Reviewer #2:

1) Data regarding the contribution of miR-7 are limited. I think more data are either necessary to show that Vax1 works through mir-7 to regulate neuronal fate or the authors should change their writing and conclusion.

For example, in the Abstract: "We provide evidence that this repression occurs via activation of microRNA miR-7, targeting Pax6 mRNA." I think it is overselling the data presented in this manuscript. Much more data would be required for this conclusion. For example, the mir-7 data could be left out of the Abstract but presented at the end of the Introduction as well as discussed.

We accept the reviewer’s critique and react threefold. First, we provide new data showing that all three miR-7 promoters contain putative Vax1 binding sites. Second, we tempered our conclusions concerning the Vax1-miR-7 link in the Abstract and the main manuscript. Third, we removed the term miR-7 from the title.

2) Figure 1: please show analysis of the in situ/immune data.

As requested, we included quantifications of the in situ/immune staining’s. The data are now presented in the Results section.

3) Better images for Figure 3C would be helpful to actually see the decrease in Pax6 intensity.

We added new images illustrating the downregulation of Pax6 protein after Vax1 electroporation. The new data are now presented as Figure 3D.

4) The sentence: "However, we stably observed a tendency for an increase over independent electroporation experiments (3 experiments for each condition with a total of 12 animals/ condition, Figure 4I)." should be removed. There is no effect.

We agree and removed the phrase from the Results section of manuscript.

Reviewer #3:

1) In the loss-of-function experiment in Figure 2, it would be helpful if the authors could show how efficiently Vax1 expression is suppressed in the targeted tdTomato positive cells by using in situ hybridization.

To address the efficiency of CRE mediated recombination we expressed the recombinase by in vivo electroporation in control and Vax1/Ai14 double mutants and isolated transfected tdTomato-positive cells by FACS. The quantitative RT-PCR results, now shown in Figure 2—figure supplement 1, clearly show a massive reduction in Vax1 mRNA levels after CRE expression, demonstrating efficient recombination.

This approach was necessary as in light of the relatively small number of transfected cells after in vivo electroporation – and facing the cellular complexity of the postnatal SVZ- in situ hybridization is not suited to give a quantitative notion of gene-knockout.

2) Also in the gain-of-function experiment in Figure 3, the levels of Vax1 derived from the electroporated vector DNA should be shown for the GFP-positive cells, by in situ hybridization.

As for the knockout, we combined electroporation, here of an overexpression plasmid, with FACS and qRT-PCR. We found the expected large increase in Vax1 mRNA levels in the GFP positive fraction. This control is shown in Figure 5B.

3) In this manuscript, the authors analyzed regulatory interactions among Vax1, Pax6, and miR-7 only in neonates. Since interneurons are constantly regenerated during adulthood, it would be helpful, if the authors could demonstrate the data showing that the same regulatory cross-talk can be seen in the adult neurogenesis of interneurons.

In previous work we demonstrated that the dorsoventral Pax6 and the ventrodorsally oriented miR-7 gradients are maintained in adult stages (de Chevigny et al., 2012b, Supplemental Figures 1 and 4). Here, we show now, as the new

Figure 3—figure supplement 1, that the postnatal ventrodorsally oriented Vax1 gradient is also maintained in the adult, allowing to speculate that the mechanism remains active. This new data on adult Vax1 expression is now mentioned and discussed in the manuscript.

It would of course be tempting to test the validity of the Vax1/Pax6/miR-7 interactions in adults. However, in vivo electroporation in adults is far less efficient than in the postnatal, leading only to low amounts of transfected cells in the OB. As our analyses depend on precise quantification of large numbers of cells in gain- and loss of-function experiments, meaningful data cannot be expected from such approaches.

Viral transduction, that is normally used in adults, cannot be targeted to specific subregions of the SVZ. It appears conceivable to design complex transgenic approaches to target specific SVZ compartments with CRE, but such experiments, if possible, would represent a long-term project on its own that exceeds what can be done here. We hope this is acceptable.

4) What is the mechanism of Vax1-mediated miR-7 enhancement? Do they directly interact with each other? Is there any binding site for Vax1 within the promoter region of the miR-7 gene?

Following the reviewer’s suggestion, we investigated the presence of Vax1 binding sites in the miR-7 regulatory regions. Indeed, we found such sites in all three miR-7 promoters, in agreement with a potential direct regulation. This new data are now presented in Figure 5D.

5) Cross-regulatory interactions for Vax1, Pax6, and miR-7 are nicely shown in this study. It would be helpful if the authors could discuss this regulation strategy in the context of neurogenesis during brain development in order for the paper to attract a wider research audience other than those investigating transcription factors.

To place our results in a wider context, we discuss now the OLIG2/Irx3/miR-17-3p regulatory network, that is used to define progenitor domains in the developing spinal cord.

Article and author information

Author details

  1. Nathalie Coré

    Aix Marseille Univ, CNRS, IBDM, Campus de Luminy, Marseille, France
    Conceptualization, Formal analysis, Validation, Investigation, Visualization, Writing - original draft, Writing - review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3865-4539
  2. Andrea Erni

    Aix Marseille Univ, CNRS, IBDM, Campus de Luminy, Marseille, France
    Competing interests
    No competing interests declared
  3. Hanne M Hoffmann

    Department of Obstetrics, Gynecology, and Reproductive Sciences and the Center for Reproductive Science and Medicine, University of California, San Diego, San Diego, United States
    Competing interests
    No competing interests declared
  4. Pamela L Mellon

    Department of Obstetrics, Gynecology, and Reproductive Sciences and the Center for Reproductive Science and Medicine, University of California, San Diego, San Diego, United States
    Competing interests
    No competing interests declared
  5. Andrew J Saurin

    Aix Marseille Univ, CNRS, IBDM, Campus de Luminy, Marseille, France
    Competing interests
    No competing interests declared
  6. Christophe Beclin

    Aix Marseille Univ, CNRS, IBDM, Campus de Luminy, Marseille, France
    Supervision, Funding acquisition, Investigation, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
  7. Harold Cremer

    Aix Marseille Univ, CNRS, IBDM, Campus de Luminy, Marseille, France
    Supervision, Funding acquisition, Writing - original draft, Writing - review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8673-5176


Agence Nationale de la Recherche (13-BSV4-0013)

  • Nathalie Coré
  • Christophe Béclin
  • Harold Cremer

Agence Nationale de la Recherche (17-CE16-0025)

  • Nathalie Coré
  • Christophe Béclin
  • Harold Cremer

Fondation de France (FDF70959)

  • Nathalie Coré
  • Christophe Béclin
  • Harold Cremer

Fondation pour la Recherche Médicale (EQU201903007806)

  • Nathalie Coré
  • Christophe Béclin
  • Harold Cremer

National Institutes of Health (P50 HD12303)

  • Pamela L Mellon

National Institutes of Health (R01 HD072754)

  • Pamela L Mellon

National Institutes of Health (R01 HD082567)

  • Pamela L Mellon

National Institutes of Health (P30 CA23100)

  • Pamela L Mellon

National Institutes of Health (P30 DK063491)

  • Pamela L Mellon

National Institutes of Health (P42 ES010337)

  • Pamela L Mellon

National Institutes of Health (K99 HD084759)

  • Hanne M Hoffmann

Swiss National Science Foundation (P2BSP3_175013)

  • Andrea Erni

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank the members of the Cremer lab for support and critical reading of the manuscript. We are grateful to S Wild and A Bosio from Miltenyi Biotec for providing CRE-mRNA. We thank Kapil Bharti (NIH, Bethesda, USA) for sharing Vax1 cDNA. We thank the local PiCSL-FBI core facility (IBDM, AMU-Marseille) supported by the French National Research Agency through the « Investments for the Future’ program (France-BioImaging, ANR-10-INBS-04) as well as the IBDM animal facility. We are grateful to AMUTICYT Cytometry and Cell Sorting Core facility, AMU, UMR-S 1076. This work was supported by the Agence National pour la Recherche (grants ANR- 13-BSV4-0013 and ANR- 17-CE16-0025), Fondation pour la Recherche Medicale (FRM) ‘Label Equipe FRM’ and Fondation de France (FDF) grant FDF70959 to HC. AE was supported for a postdoctoral fellowship from the Swiss National Funds. NIH grants to PLM in support of this work are P50 HD12303, R01 HD072754, R01 HD082567, P30 CA23100, P30 DK063491, and P42 ES010337. HMH was supported by NIH K99 HD084759.


Animal experimentation: All animal procedures were carried out in accordance to the European Communities Council Directie 2010/63/EU and approved by French ethical committees (Comité d'Ethique pour l'expérimentation animale no. 14; permission numbers: 00967.03; 2017112111116881v2).

Senior Editor

  1. Gary L Westbrook, Oregon Health and Science University, United States

Reviewing Editor

  1. Stephen Liberles, Harvard Medical School, United States

Publication history

  1. Received: April 24, 2020
  2. Accepted: August 6, 2020
  3. Accepted Manuscript published: August 7, 2020 (version 1)
  4. Version of Record published: August 20, 2020 (version 2)


© 2020, Coré et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,038
    Page views
  • 192
  • 6

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Nathalie Coré
  2. Andrea Erni
  3. Hanne M Hoffmann
  4. Pamela L Mellon
  5. Andrew J Saurin
  6. Christophe Beclin
  7. Harold Cremer
Stem cell regionalization during olfactory bulb neurogenesis depends on regulatory interactions between Vax1 and Pax6
eLife 9:e58215.

Further reading

    1. Developmental Biology
    Marianne E Emmert, Parul Aggarwal ... Roger Cornwall
    Research Article Updated

    Neonatal brachial plexus injury (NBPI) causes disabling and incurable muscle contractures that result from impaired longitudinal growth of denervated muscles. This deficit in muscle growth is driven by increased proteasome-mediated protein degradation, suggesting a dysregulation of muscle proteostasis. The myostatin (MSTN) pathway, a prominent muscle-specific regulator of proteostasis, is a putative signaling mechanism by which neonatal denervation could impair longitudinal muscle growth, and thus a potential target to prevent NBPI-induced contractures. Through a mouse model of NBPI, our present study revealed that pharmacologic inhibition of MSTN signaling induces hypertrophy, restores longitudinal growth, and prevents contractures in denervated muscles of female but not male mice, despite inducing hypertrophy of normally innervated muscles in both sexes. Additionally, the MSTN-dependent impairment of longitudinal muscle growth after NBPI in female mice is associated with perturbation of 20S proteasome activity, but not through alterations in canonical MSTN signaling pathways. These findings reveal a sex dimorphism in the regulation of neonatal longitudinal muscle growth and contractures, thereby providing insights into contracture pathophysiology, identifying a potential muscle-specific therapeutic target for contracture prevention, and underscoring the importance of sex as a biological variable in the pathophysiology of neuromuscular disorders.

    1. Developmental Biology
    2. Genetics and Genomics
    Ankit Sabharwal, Mark D Wishman ... Stephen C Ekker
    Research Advance Updated

    The clinical and largely unpredictable heterogeneity of phenotypes in patients with mitochondrial disorders demonstrates the ongoing challenges in the understanding of this semi-autonomous organelle in biology and disease. Previously, we used the gene-breaking transposon to create 1200 transgenic zebrafish strains tagging protein-coding genes (Ichino et al., 2020), including the lrpprc locus. Here, we present and characterize a new genetic revertible animal model that recapitulates components of Leigh Syndrome French Canadian Type (LSFC), a mitochondrial disorder that includes diagnostic liver dysfunction. LSFC is caused by allelic variations in the LRPPRC gene, involved in mitochondrial mRNA polyadenylation and translation. lrpprc zebrafish homozygous mutants displayed biochemical and mitochondrial phenotypes similar to clinical manifestations observed in patients, including dysfunction in lipid homeostasis. We were able to rescue these phenotypes in the disease model using a liver-specific genetic model therapy, functionally demonstrating a previously under-recognized critical role for the liver in the pathophysiology of this disease.