1. Developmental Biology
  2. Genetics and Genomics
Download icon

Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in development

  1. Ryan J Geusz
  2. Allen Wang
  3. Joshua Chiou
  4. Joseph J Lancman
  5. Nichole Wetton
  6. Samy Kefalopoulou
  7. Jinzhao Wang
  8. Yunjiang Qiu
  9. Jian Yan
  10. Anthony Aylward
  11. Bing Ren
  12. P Duc Si Dong
  13. Kyle J Gaulton  Is a corresponding author
  14. Maike Sander  Is a corresponding author
  1. Department of Pediatrics, Pediatric Diabetes Research Center, University of California, San Diego, United States
  2. Department of Cellular & Molecular Medicine, University of California, San Diego, United States
  3. Sanford Consortium for Regenerative Medicine, United States
  4. Biomedical Graduate Studies Program, University of California, San Diego, United States
  5. Human Genetics Program, Sanford Burnham Prebys Medical Discovery Institute, United States
  6. Graduate School of Biomedical Sciences, Sanford Burnham Prebys Medical Discovery Institute, United States
  7. Ludwig Institute for Cancer Research, United States
Research Article
  • Cited 0
  • Views 456
  • Annotations
Cite this article as: eLife 2021;10:e59067 doi: 10.7554/eLife.59067

Abstract

Genetic variants associated with type 2 diabetes (T2D) risk affect gene regulation in metabolically relevant tissues, such as pancreatic islets. Here, we investigated contributions of regulatory programs active during pancreatic development to T2D risk. Generation of chromatin maps from developmental precursors throughout pancreatic differentiation of human embryonic stem cells (hESCs) identifies enrichment of T2D variants in pancreatic progenitor-specific stretch enhancers that are not active in islets. Genes associated with progenitor-specific stretch enhancers are predicted to regulate developmental processes, most notably tissue morphogenesis. Through gene editing in hESCs, we demonstrate that progenitor-specific enhancers harboring T2D-associated variants regulate cell polarity genes LAMA1 and CRB2. Knockdown of lama1 or crb2 in zebrafish embryos causes a defect in pancreas morphogenesis and impairs islet cell development. Together, our findings reveal that a subset of T2D risk variants specifically affects pancreatic developmental programs, suggesting that dysregulation of developmental processes can predispose to T2D.

Introduction

Type 2 diabetes (T2D) is a multifactorial metabolic disorder characterized by insulin insensitivity and insufficient insulin secretion by pancreatic beta cells (Halban et al., 2014). Genetic association studies have identified hundreds of loci influencing risk of T2D (Mahajan et al., 2018). However, disease-relevant target genes of T2D risk variants, the mechanisms by which these genes cause disease, and the tissues in which the genes mediate their effects remain poorly understood.

The majority of T2D risk variants map to non-coding sequence, suggesting that genetic risk of T2D is largely mediated through variants affecting transcriptional regulatory activity. Intersection of T2D risk variants with epigenomic data has uncovered enrichment of T2D risk variants in regulatory sites active in specific cell types, predominantly in pancreatic beta cells, including risk variants that affect regulatory activity directly (Chiou et al., 2019; Fuchsberger et al., 2016; Gaulton et al., 2015; Gaulton et al., 2010; Greenwald et al., 2019; Mahajan et al., 2018; Parker et al., 2013; Pasquali et al., 2014; Thurner et al., 2018; Varshney et al., 2017). T2D risk-associated variants are further enriched within large, contiguous regions of islet active chromatin, referred to as stretch or super-enhancers (Parker et al., 2013). These regions of active chromatin preferentially bind islet-cell-restricted transcription factors and drive islet-specific gene expression (Parker et al., 2013; Pasquali et al., 2014).

Many genes associated with T2D risk in islets are not uniquely expressed in differentiated islet endocrine cells, but also in pancreatic progenitor cells during embryonic development. For example, T2D risk variants map to HNF1A, HNF1B, HNF4A, MNX1, NEUROG3, PAX4, and PDX1 (Flannick et al., 2019; Mahajan et al., 2018; Steinthorsdottir et al., 2014), which are all transcription factors also expressed in pancreatic developmental precursors. Studies in model organisms and hESC-based models of pancreatic endocrine cell differentiation have shown that inactivation of these transcription factors causes defects in endocrine cell development, resulting in reduced beta cell numbers (Gaertner et al., 2019). Furthermore, heterozygous mutations for HNF1A, HNF1B, HNF4A, PAX4, and PDX1 are associated with maturity onset diabetes of the young (MODY), which is an autosomal dominant form of diabetes with features similar to T2D (Urakami, 2019). Thus, there is evidence that reduced activity of developmentally expressed transcription factors can cause diabetes later in life.

The role of these transcription factors in T2D and MODY could be explained by their functions in regulating gene expression in mature islet cells. However, it is also possible that their function during endocrine cell development could predispose to diabetes instead of, or in addition to, endocrine cell gene regulation. One conceivable mechanism is that individuals with reduced activity of these transcription factors are born with either fewer beta cells or beta cells more prone to fail under conditions of increased insulin demand. Observations showing that disturbed intrauterine metabolic conditions, such as maternal malnutrition, can lead to reduced beta cell mass and T2D predisposition in the offspring (Lumey et al., 2015; Nielsen et al., 2014; Portha et al., 2011) support the concept that compromised beta cell development could predispose to T2D. However, whether there is T2D genetic risk relevant to the regulation of endocrine cell development independent of gene regulation in mature islet cells has not been explored.

In this study, we investigated the contribution of gene regulatory programs specifically active during pancreatic development to T2D risk. First, we employed a hESC-based differentiation system to generate chromatin maps of hESCs during their stepwise differentiation into pancreatic progenitor cells. We then identified T2D-associated variants localized in active enhancers in developmental precursors but not in mature islets, used genome editing in hESCs to define target genes of pancreatic progenitor-specific enhancers harboring T2D variants, and employed zebrafish genetic models to study the role of two target genes in pancreatic and endocrine cell development.

Results

Pancreatic progenitor stretch enhancers are enriched for T2D risk variants

To determine whether there is a development-specific genetic contribution to T2D risk, we generated genome-wide chromatin maps of hESCs during their stepwise differentiation into pancreatic progenitors through four distinct developmental stages: definitive endoderm (DE), gut tube (GT), early pancreatic progenitors (PP1), and late pancreatic progenitors (PP2) (Figure 1A). We then used ChromHMM (Ernst and Kellis, 2012) to annotate chromatin states, such as active promoters and enhancers, at all stages of hESC differentiation as well as in primary islets (Figure 1—figure supplement 1A,B).

Figure 1 with 1 supplement see all
T2D-associated risk variants are enriched in stretch enhancers of pancreatic progenitors independent of islet stretch enhancers.

(A) Schematic illustrating the stepwise differentiation of human embryonic stem cells (hES) into pancreatic progenitors (solid arrows) and lineage relationship to islets (dotted arrow). Developmental intermediates include definitive endoderm (DE), gut tube (GT), early pancreatic progenitor (PP1), and late pancreatic progenitor (PP2) cells. (B) Box plots depicting length of typical enhancers (TE) and stretch enhancers (SE) at each developmental stage and in primary human islets. Plots are centered on median, with box encompassing 25–75th percentile and whiskers extending up to 1.5 interquartile range. Total numbers of enhancers are shown above each box plot. (C) Examples of stretch enhancers (denoted with red boxes) near the genes encoding the pancreatic lineage-determining transcription factors NKX6.1 and PDX1, respectively. Chromatin states are based on ChromHMM classifications: TssA, active promoter; TssFlnk, flanking transcription start site; TssBiv, bivalent promoter; Repr, repressed; EnhA, active enhancer; EnhP, poised enhancer. (D) Percentage of TE and SE overlapping with at least one ATAC-seq peak at PP2 or in islets. Enrichment analysis comparing observed and expected overlap based on random genomic regions of the same size and located on the same chromosome averaged over 10,000 iterations (***p<1 × 10−4; permutation test). ATAC-seq peaks were merged from two independent differentiations for PP2 stage cells and four donors for primary islets. (E) Genome-wide enrichment of T2D-associated variants (minor allele frequency >0.0025) in stretch enhancers, ATAC-seq peaks, and ATAC-seq peaks within stretch enhancers for all developmental stages when modeling each annotation separately. Points and lines represent log-scaled enrichment estimates and 95% confidence intervals from functional genome wide association analysis (fgwas), respectively. ATAC-seq peaks were merged from two independent differentiations for ES, DE, GT, PP1, and PP2 stage cells and from four donors for primary islets. (F) Genome-wide enrichment of T2D-associated variants (minor allele frequency >0.0025) in ATAC-seq peaks within stretch enhancers for all developmental stages and coding exons when considering all annotations in a joint model. Points and lines represent log-scaled enrichment estimates and 95% confidence intervals from fgwas, respectively. ATAC-seq peaks were merged from two independent differentiations for ES, DE, GT, PP1, and PP2 stage cells and from four donors for primary islets. See also Figure 1—figure supplement 1.

Large and contiguous regions of active enhancer chromatin, which have been termed stretch- or super-enhancers (Parker et al., 2013; Whyte et al., 2013), are highly enriched for T2D risk variants in islets (Parker et al., 2013; Pasquali et al., 2014). We therefore partitioned active enhancers from each hESC developmental stage and islets into stretch enhancers (SE) and traditional (non-stretch) enhancers (TE) (Figure 1B). Consistent with prior observations of SE features (Parker et al., 2013; Whyte et al., 2013), SE comprised a small subset of all active enhancers (7.7%, 7.8%, 8.8%, 8.1%, 8.1%, and 10.4% of active enhancers in ES, DE, GT, PP1, PP2, and islets, respectively; Figure 1B and Figure 1—figure supplement 1C) and genes proximal to SE were more highly expressed than genes proximal to TE (p=4.68 × 10−7, 4.64 × 10−11, 1.31 × 10−5, 8.85 × 10−9, 5.34 × 10−6, and <2.2 × 10−16 for expression of genes near TE vs SE in ES, DE, GT, PP1, PP2, and islets, respectively; Figure 1—figure supplement 1D). Genes near SE in pancreatic progenitors included transcription factors involved in the regulation of pancreatic cell identity, such as NKX6.1 and PDX1 (Figure 1C). Since disease-associated variants are preferentially enriched in narrow peaks of accessible chromatin within broader regions of active chromatin (Greenwald et al., 2019; Thurner et al., 2018; Varshney et al., 2017), we next used ATAC-seq to generate genome-wide maps of chromatin accessibility across all time points of differentiation. Nearly all identified SE contained at least one ATAC-seq peak (Figure 1D and Figure 1—figure supplement 1E,F). At the PP2 stage, 62.3% of SE harbored one, 32.2% two or three, and 0.7% four or more ATAC-seq peaks (Figure 1—figure supplement 1F). Similar percentages were observed in earlier developmental precursors and islets.

Having annotated accessible chromatin sites within SE, we next tested for enrichment of T2D-associated variants in SE active in mature islets and in pancreatic developmental stages. We observed strongest enrichment of T2D-associated variants in islet SE (log enrichment = 2.18, 95% CI = 1.80, 2.54) and late pancreatic progenitor SE (log enrichment = 2.17, 95% CI = 1.40, 2.74), which was more pronounced when only considering variants in accessible chromatin sites within these elements (islet log enrichment = 3.20, 95% CI = 2.74, 3.60; PP2 log enrichment = 3.18, 95% CI = 2.35, 3.79; Figure 1E). Given that a subset of pancreatic progenitor SE is also active in islets, we next determined whether pancreatic progenitor SE contribute to T2D risk independently of islet SE. Variants in accessible chromatin sites of late pancreatic progenitor SE were enriched for T2D association in a joint model including islet SE (islet log enrichment = 2.94, 95% CI = 2.47, 3.35; PP2 log enrichment = 1.27, 95% CI = 0.24, 2.00; Figure 1F). We also observed enrichment of variants in accessible chromatin sites of pancreatic progenitor SE after conditioning on islet SE (log enrichment = 0.60, 95% CI = −0.87, 1.48), as well as when excluding pancreatic progenitor SE active in islets (log enrichment = 1.62, 95% CI = <-20, 3.14). Examples of known T2D loci with T2D-associated variants in SE active in pancreatic progenitors but not in islets included LAMA1 and PROX1. These results suggest that a subset of T2D variants may affect disease risk by altering regulatory programs specifically active in pancreatic progenitors.

Pancreatic progenitor-specific stretch enhancers are near genes that regulate tissue morphogenesis

Having observed enrichment of T2D risk variants in pancreatic progenitor SE independent of islet SE, we next sought to further characterize the regulatory programs of SE with specific function in pancreatic progenitors. We therefore defined a set of pancreatic progenitor-specific stretch enhancers (PSSE) based on the following criteria: (i) annotation as a SE at the PP2 stage, (ii) no classification as a SE at the ES, DE, and GT stages, and (iii) no classification as a TE or SE in islets. Applying these criteria, we identified a total of 492 PSSE genome-wide (Figure 2A and Figure 2—source data 1).

Figure 2 with 1 supplement see all
Candidate target genes of pancreatic progenitor-specific stretch enhancers regulate developmental processes.

(A) Schematic illustrating identification of pancreatic progenitor-specific stretch enhancers (PSSE). (B) Heatmap showing density of H3K27ac ChIP-seq and ATAC-seq reads at PSSE, centered on overlapping H3K27ac and ATAC-seq peaks, respectively, and spanning 5 kb in ES, DE, GT, PP1, PP2, and islets. PSSE coordinates in Figure 2—source data 1. (C) Percentage of PSSE exhibiting indicated chromatin states at defined developmental stages and in islets. (D) Percentage of PSSE overlapping with at least one ChIP-seq peak at PP2 for the indicated transcription factors. Enrichment analysis comparing observed and expected overlap based on random genomic regions of the same size and located on the same chromosome averaged over 10,000 iterations (***p<1×10−4; permutation test). (E) Gene ontology analysis for nearest expressed genes (fragments per kilobase per million fragments mapped (FPKM) ≥1 at PP2) to the 492 PSSE. See also Figure 2—source data 2. (F) Enrichment (LD score regression coefficient z-scores) of T2D, developmental, and metabolic GWAS trait-associated variants at accessible chromatin sites in PSSE as compared with PP2 and islet stretch enhancers. Significant enrichment was identified within accessible chromatin at PP2 stretch enhancers for lean type 2 diabetes (Z = 2.06, *p=3.94 × 10−2), at PP2 stretch enhancers for type 2 diabetes (Z = 3.57, ***p=3.52 × 10−4), at islet stretch enhancers for type 2 diabetes (Z = 2.78, **p=5.46 × 10−3), at islet stretch enhancers for fasting proinsulin levels (Z = 2.83, **p=4.61 × 10−3), at islet stretch enhancers for HOMA-B (Z = 2.58, **p=9.85 × 10−3), at PP2 stretch enhancers for disposition index (Z = 2.18, *p=2.94 × 10−2), at islet stretch enhancers for acute insulin response (Z = 2.24, *p=2.51 × 10−2), at islet stretch enhancers for HbA1c (Z = 1.98, *p=4.72 × 10−2), and at islet stretch enhancers for fasting glucose levels (Z = 2.64, **p=8.31 × 10−3). See also Figure 2—source data 3 and Figure 2—figure supplement 1.

Figure 2—source data 1

Chromosomal coordinates of pancreatic progenitor-specific stretch enhancers (PSSE).

https://cdn.elifesciences.org/articles/59067/elife-59067-fig2-data1-v2.xlsx
Figure 2—source data 2

Enriched gene ontology terms for PSSE-associated genes.

https://cdn.elifesciences.org/articles/59067/elife-59067-fig2-data2-v2.xlsx
Figure 2—source data 3

Proportion of variants nominally associated with beta cell functional traits.

https://cdn.elifesciences.org/articles/59067/elife-59067-fig2-data3-v2.xlsx
Figure 2—source data 4

Tissue identity of downloaded data from ROADMAP consortium.

https://cdn.elifesciences.org/articles/59067/elife-59067-fig2-data4-v2.xlsx

As expected based on their chromatin state classification, PSSE acquired broad deposition of the active enhancer mark H3K27ac at the PP1 and PP2 stages (Figure 2B,C). Coincident with an increase in H3K27ac signal, chromatin accessibility at PSSE also increased (Figure 2B), and 93.5% of PSSE contained at least one accessible chromatin site at the PP2 stage (Figure 2—figure supplement 1A,B). Further investigation of PSSE chromatin state dynamics at earlier stages of pancreatic differentiation revealed that PSSE were often poised (defined by H3K4me1 in the absence of H3K27ac) prior to activation (42%, 48%, 63%, and 17% of PSSE in ES, DE, GT, and PP1, respectively; Figure 2C), consistent with earlier observations that a poised enhancer state frequently precedes enhancer activation during development (Rada-Iglesias et al., 2011; Wang et al., 2015). Intriguingly, a subset of PSSE was classified as TE earlier in development (13%, 23%, 29%, and 46% of PSSE in ES, DE, GT, and PP1, respectively; Figure 2C), suggesting that SE emerge from smaller regions of active chromatin seeded at prior stages of development. During differentiation into mature islet cells, PSSE lost H3K27ac but largely retained H3K4me1 signal (62% of PSSE) (Figure 2C), persisting in a poised state in terminally differentiated islet cells.

To gain insight into the transcription factors that regulate PSSE, we conducted motif enrichment analysis of accessible chromatin sites within PSSE (Figure 2—figure supplement 1C). Consistent with the activation of PSSE upon pancreas induction, motifs associated with transcription factors known to regulate pancreatic development (Conrad et al., 2014; Masui et al., 2007) were enriched, including FOXA (p=1 × 10−34), PDX1 (p=1 × 10−30), GATA (p=1 × 10−25), ONECUT (p=1 × 10−17), and RBPJ (p=1 × 10−14), suggesting that pancreatic lineage-determining transcription factors activate PSSE. Analysis of the extent of PSSE overlap with ChIP-seq binding sites for FOXA1, FOXA2, GATA4, GATA6, PDX1, HNF6, and SOX9 at the PP2 stage substantiated this prediction (p<1 × 10−4 for all transcription factors; permutation test; Figure 2D).

Annotation of biological functions of predicted target genes for PSSE (nearest gene with FPKM ≥1 at PP2 stage) revealed gene ontology terms related to developmental processes, such as tissue morphogenesis (p=1 × 10−7) and vascular development (p=1 × 10−8), as well as developmental signaling pathways, including BMP (p=1 × 10−5), NOTCH (p=1 × 10−4), and canonical Wnt signaling (p=1 × 10−4; Figure 2E and Figure 2—source data 2), which have demonstrated roles in pancreas morphogenesis and cell lineage allocation (Ahnfelt-Rønne et al., 2010; Li et al., 2015; Murtaugh, 2008; Sharon et al., 2019; Sui et al., 2013). Consistent with the temporal pattern of H3K27ac deposition at PSSE, transcript levels of PSSE-associated genes increased upon pancreatic lineage induction and peaked at the PP2 stage (p=1.8 × 10−8; Figure 2—figure supplement 1D). Notably, expression of these genes sharply decreased in islets (p<2.2 × 10−16), underscoring the likely role of these genes in regulating pancreatic development but not mature islet function.

Pancreatic progenitor-specific stretch enhancers are highly specific across T2D-relevant tissues and cell types

We next sought to understand the phenotypic consequences of PSSE activity in the context of T2D pathophysiology. Variants in accessible chromatin sites of PSSE genome-wide were enriched for T2D association (log enrichment = 2.85, 95% CI = <-20, 4.09). We determined enrichment of genetic variants for T2D-related quantitative endophenotypes within accessible chromatin sites of PSSE, as well as all pancreatic progenitor SE (not just progenitor-specific) and islet SE, using LD score regression (Bulik-Sullivan et al., 2015; Finucane et al., 2015). As expected based on prior observations (Parker et al., 2013; Pasquali et al., 2014), we observed enrichment (Z > 1.96) of variants associated with quantitative traits related to insulin secretion and beta cell function within islet SE, exemplified by fasting proinsulin levels, HOMA-B, and acute insulin response (Z = 2.8, Z = 2.6, and Z = 2.2, respectively; Figure 2F). Conversely, PSSE showed a trend toward depletion for these traits, although the estimates were not significant. We further tested for enrichment in the proportion of variants in PSSE and islet SE nominally associated (p<0.05) with beta cell function traits compared to background variants. There was significant enrichment of beta cell trait association among islet SE variants (χ2 test; p<0.05 for all beta cell functional traits except for insulin secretion rate), but no corresponding enrichment for PSSE (Figure 2—source data 3).

A prior study found that variants at the LAMA1 locus had stronger effects on T2D risk among lean relative to obese cases (Perry et al., 2012). Since we identified a PSSE at the LAMA1 locus, we postulated that variants in PSSE collectively might have differing impact on T2D risk in cases segregated by BMI. We therefore tested PSSE, as well as pancreatic progenitor SE and islet SE, for enrichment of T2D association using GWAS of lean and obese T2D (Perry et al., 2012), using LD score regression (Bulik-Sullivan et al., 2015; Finucane et al., 2015). We observed nominally significant enrichment of variants in pancreatic progenitor SE for T2D among lean cases (Z = 2.1). Variants in PSSE were mildly enriched for T2D among lean (Z = 1.1) and depleted among obese (Z = −0.70) cases, although neither estimate was significant. By comparison, islet SE showed positive enrichment for T2D among both lean (Z = 1.9) and obese cases (Z = 1.3; Figure 2F). Together, these results suggest that PSSE may affect T2D risk in a manner distinct from islet SE function.

Having observed little evidence for enrichment of PSSE variants for traits related to beta cell function, we asked whether the enrichment of PSSE for T2D-associated variants could be explained by PSSE activity in T2D-relevant tissues and cell types outside the pancreas. We assessed PSSE activity by measuring H3K27ac signal in 95 representative tissues and cell lines from the ENCODE and Epigenome Roadmap projects (Kundaje et al., 2015). Interestingly, there was group-wide specificity of PSSE to pancreatic progenitors relative to other cells and tissues including those relevant to T2D, such as adipose tissue, skeletal muscle, and liver (Figure 2—figure supplement 1E and Figure 2—source data 4). Since gene regulation in adipocyte precursors also contributes to T2D risk (Claussnitzer et al., 2014), we further examined PSSE specificity with respect to chromatin states during adipogenesis, using data from human adipose stromal cell differentiation stages (hASC1-4) (Mikkelsen et al., 2010; Varshney et al., 2017). PSSE exhibited virtually no active chromatin during adipogenesis (9, 8, 6, and 8 out of the 492 PSSE were active enhancers in hACS-1, hASC-2, hASC-3, and hASC-4, respectively; Figure 2—figure supplement 1F). These findings identify PSSE as highly pancreatic progenitor-specific across T2D-relevant tissues and cell types.

Identification of pancreatic progenitor-specific stretch enhancers harboring T2D-associated variants

Given the relative specificity of PSSE to pancreatic progenitors, we next sought to identify T2D-associated variants in PSSE at specific loci which may affect pancreatic development. We therefore identified variants in PSSE with evidence of T2D association (at p=4.7 × 10−6) after correcting for the total number of variants in PSSE genome-wide (n = 10,738). In total there were 49 variants in PSSE with T2D association exceeding this threshold mapping to 11 loci (Figure 3A). This included variants at nine loci with known genome-wide significant T2D association (PROX1, ST6GAL1, SMARCAD1, XKR6, INS-IGF2, HMGA2, SMEK1, HMG20A, and LAMA1), as well as at two previously unreported loci with sub-genome-wide significant association, CRB2 and PGM1. To identify candidate target genes of the T2D-associated PSSE in pancreatic progenitors, we analyzed the expression of all genes within the same topologically associated domain (TAD) as the PSSE in PP2 cells and in primary human embryonic pancreas tissue (Figure 3B and Figure 3—figure supplement 1A). These expressed genes are candidate effector transcripts of T2D-associated variants in pancreatic progenitors.

Figure 3 with 1 supplement see all
Identification of T2D risk variants associated with pancreatic progenitor-specific stretch enhancers.

(A) Manhattan plot showing T2D association p-values (from Mahajan et al., 2018) for 10,738 variants mapping within PSSE. The dotted line shows the threshold for Bonferroni correction (p=4.66 × 10−6). Novel loci identified with this threshold and mapping at least 500 kb away from a known locus are highlighted in blue. Chromosomal coordinates of T2D-associated PSSE are indicated. (B) mRNA levels (measured in fragments per kilobase per million fragments mapped [FPKM]) at PP2 (blue) and in human embryonic pancreas (54 and 58 days gestation, gold) of nearest expressed (FPMK ≥1) gene at PP2 for PSSE harboring T2D variants identified in A. (C) PP2 specificity of H3K27ac signal at PSSE harboring T2D variants identified in A. Z-score comparing H3K27ac signal at PP2 to H3K27ac signal in tissues and cell lines from the ENCODE and Epigenome Roadmap projects. See also Figure 3—figure supplement 1.

As many pancreatic progenitor SE remain poised in mature islets (Figure 2C), we considered whether T2D-associated variants in PSSE could have gene regulatory function in islets that is re-activated in the disease state. We therefore assessed overlap of PSSE variants with accessible chromatin of islets from T2D donors (Khetan et al., 2018). None of the strongly T2D-associated variants in PSSE (p=4.7 × 10−6) overlapped an islet accessible chromatin site in T2D islets, arguing against the relevance of PSSE in broadly regulating islet gene activity during T2D.

A pancreatic progenitor-specific stretch enhancer at LAMA1 harbors T2D risk variants and regulates LAMA1 expression selectively in pancreatic progenitors

Variants in a PSSE at the LAMA1 locus were associated with T2D at genome-wide significance (Figure 3A), and LAMA1 was highly expressed in the human embryonic pancreas (Figure 3B). Furthermore, the activity of the PSSE at the LAMA1 locus was almost exclusively restricted to pancreatic progenitors (Figure 3—figure supplement 1B,C), and was further among the most progenitor-specific across all PSSE harboring T2D risk variants (Figure 3C). In addition, reporter gene assays in zebrafish embryos have shown that this enhancer drives gene expression specific to pancreatic progenitors in vivo (Cebola et al., 2015). We therefore postulated that the activity of T2D-associated variants within the LAMA1 PSSE is relevant for gene regulation in pancreatic progenitors, and we sought to characterize the LAMA1 PSSE in greater depth.

Multiple T2D-associated variants mapped within the LAMA1 PSSE, and these variants were further in the 99% credible set in fine-mapping data from the DIAMANTE consortium (Mahajan et al., 2018; Figure 4A). No other variants in the 99% credible set mapped in an accessible chromatin site active in islets from either non-diabetic or T2D samples. The PSSE is intronic to the LAMA1 gene and contains regions of poised chromatin and TE at prior developmental stages (Figure 4A). Consistent with its stepwise genesis as a SE throughout development, regions of open chromatin within the LAMA1 PSSE were already present at the DE and GT stages. Furthermore, pancreatic lineage-determining transcription factors, such as FOXA1, FOXA2, GATA4, GATA6, HNF6, SOX9, and PDX1, were all bound to the PSSE at the PP2 stage (Figure 4B). Among credible set variants in the LAMA1 PSSE, rs10502347 overlapped an ATAC-seq peak as well as ChIP-seq sites for multiple pancreatic lineage-determining transcription factors. Additionally, rs10502347 directly coincided with a SOX9 footprint identified in ATAC-seq data from PP2 cells, and the T2D risk allele C is predicted to disrupt SOX9 binding (Figure 4B). Consistent with the collective endophenotype association patterns of PSSE (Figure 2F), rs10502347 showed no association with beta cell function (p=0.81, 0.23, 0.46 for fasting proinsulin levels, HOMA-B, and acute insulin response, respectively; Figure 4—figure supplement 1A). Thus, T2D variant rs10502347 is predicted to affect the binding of pancreatic transcription factors and does not appear to affect beta cell function.

Figure 4 with 2 supplements see all
A T2D risk-associated LAMA1 pancreatic progenitor-specific stretch enhancer regulates LAMA1 expression specifically in pancreatic progenitors.

(A) (Top) Locus plots showing T2D association p-values for variants in a 35 kb window (hg19 chr18:7,050,000–7,085,000) at the LAMA1 locus and LAMA1 PSSE (red box). Fine mapped variants within the 99% credible set for the LAMA1 locus are colored black. All other variants are colored light gray. (Bottom) Chromatin states and ATAC-seq signal in ES, DE, GT, PP1, and PP2. TssA, active promoter; TssFlnk, flanking transcription start site; TssBiv, bivalent promoter; Repr, repressed; EnhA, active enhancer; EnhP, poised enhancer. (B) FOXA1, FOXA2, GATA4, GATA6, HNF6, SOX9, and PDX1 ChIP-seq profiles at the LAMA1 PSSE in PP2. The variant rs10502347 (red) overlaps transcription factor binding sites and a predicted ATAC-seq footprint for the SOX9 sequence motif. Purple dotted lines indicate the core binding profile of the average SOX9 footprint genome-wide and the blue dotted line indicates the position of rs10502347 within the SOX9 motif. (C) LAMA1 mRNA expression at each developmental stage determined by RNA-seq, measured in fragments per kilobase per million fragments mapped (FPKM). Data shown as mean ± S.E.M. (n = 3 replicates from independent differentiations). Light blue and purple indicate classification of the LAMA1 PSSE as typical enhancer (TE) and stretch enhancer (SE), respectively. (D) LAMA1 mRNA expression at each developmental stage determined by qPCR in control and ∆LAMA1Enh cells. Data are shown as mean ± S.E.M. (n = 3 replicates from independent differentiations for control cells. ∆LAMA1Enh cells represent combined data from two clonal lines with three replicates for each line from independent differentiations. n = 3 technical replicates for each sample; p=0.319, 0.594, 0.945, 0.290, and <1 × 10−6 for comparisons in ES, DE, GT, PP1, and PP2, respectively; student’s t-test, two sided; ***p<0.001, n.s., not significant). Light blue and purple indicate classification of the LAMA1 PSSE as TE and SE, respectively. Each plotted point represents the average of technical replicates for each differentiation. (E) mRNA expression determined by RNA-seq at PP2 of genes expressed in either control or ∆LAMA1Enh cells (FPKM ≥ 1 at PP2) and located within the same topologically associated domain as LAMA1. Data are shown as mean FPKM ± S.E.M. (n = 2 replicates from independent differentiations for control cells. ∆LAMA1Enh cells represent combined data from two clonal lines with two replicates for each line from independent differentiations. p adj. = 0.389 and 8.11 × 10−3 for ARHGAP28 and LAMA1, respectively; DESeq2). See also Figure 4—figure supplements 1 and 2.

Figure 4—source data 1

Genes downregulated in ∆LAMA1Enh PP2 stage cells compared to control cells (p adj. <0.05).

https://cdn.elifesciences.org/articles/59067/elife-59067-fig4-data1-v2.xlsx
Figure 4—source data 2

Genes upregulated in ∆LAMA1Enh PP2 stage cells compared to control cells (p adj. <0.05).

https://cdn.elifesciences.org/articles/59067/elife-59067-fig4-data2-v2.xlsx

Enhancers can control gene expression over large genomic distances, and therefore their target genes cannot be predicted based on proximity alone. To directly assess the function of the LAMA1 PSSE in regulating gene activity, we utilized CRIPSR-Cas9-mediated genome editing to generate two independent clonal human hESC lines harboring homozygous deletions of the LAMA1 PSSE (hereafter referred to as ∆LAMA1Enh; Figure 4—figure supplement 1B). We examined LAMA1 expression in ∆LAMA1Enh compared to control cells throughout stages of pancreatic differentiation. Consistent with the broad expression of LAMA1 across developmental and mature tissues, control cells expressed LAMA1 at all stages (Figure 4C). LAMA1 was expressed at similar levels in ∆LAMA1Enh and control cells at early developmental stages, but was significantly reduced in PP2 cells derived from ∆LAMA1Enh clones (p=0.319, 0.594, 0.945, 0.290, and <1 × 10−6 for comparisons in ES, DE, GT, PP1, and PP2, respectively; Figure 4D). To next investigate whether the LAMA1 PSSE regulates other genes at this locus, we utilized Hi-C datasets from PP2 cells to identify topologically associated domains (TADs). We then examined expression of genes mapping in the same TAD as the LAMA1 PSSE. ARHGAP28 was the only other expressed gene within the TAD, and albeit not significantly different from controls (p.adj >0.05), showed a trend toward lower expression in ∆LAMA1Enh PP2 cells (Figure 4E), raising the possibility that ARHGAP28 is an additional target gene of the LAMA1 PSSE. Together, these results demonstrate that while LAMA1 itself is broadly expressed across developmental stages, the T2D-associated PSSE regulates LAMA1 expression specifically in pancreatic progenitors.

To determine whether deletion of the LAMA1 PSSE affects pancreatic development, we generated PP2 stage cells from ∆LAMA1Enh and control hESC lines and analyzed pancreatic cell fate commitment by flow cytometry and immunofluorescence staining for PDX1 and NKX6.1 (Figure 4—figure supplement 1C,D). At the PP2 stage, ∆LAMA1Enh and control cultures contained similar percentages of PDX1- and NKX6.1-positive cells. Furthermore, mRNA expression of PDX1, NKX6.1, PROX1, PTF1A, and SOX9 was either unaffected or only minimally reduced (p adj. = 3.56 × 10−2, 0.224, 0.829, 8.14 × 10−2, and 0.142, for comparisons of PDX1, NKX6.1, PROX1, PTF1A, and SOX9 expression, respectively; Figure 4—figure supplement 1E), and the overall gene expression profiles as determined by RNA-seq were similar in ∆LAMA1Enh and control PP2 cells (Figure 4—figure supplement 1F and Figure 4—source datas 1 and 2). To examine effects of complete LAMA1 loss-of-function, we additionally generated a hESC line harboring a deletion of the LAMA1 coding sequences (hereafter referred to as ∆LAMA1; Figure 4—figure supplement 2A,B), and produced PP2 stage cells. Similar to ∆LAMA1Enh cultures, ∆LAMA1 and control PP2 stage cultures contained similar numbers of PDX1- and NKX6.1-positive cells (Figure 4—figure supplement 2C,D). Likewise, mRNA expression of PDX1, NKX6.1, PROX1, PTF1A, and SOX9 was similar in ∆LAMA1 and control PP2 cells (p=4.3 × 10−2, 0.19, 0.16, 0.17, and 8.7 × 10−2, respectively; Figure 4—figure supplement 2E). These findings indicate that in vitro pancreatic lineage induction is unperturbed in both ∆LAMA1Enh cells exhibiting reduced LAMA1 expression, as well as ∆LAMA1 cells where LAMA1 coding sequences are disrupted.

Pancreatic progenitor-specific stretch enhancers at the CRB2 and PGM1 loci harbor T2D-associated variants

Multiple variants with evidence for T2D association in PSSE mapped outside of known risk loci, such as those mapping to CRB2 and PGM1 (Figure 3A). As with the LAMA1 PSSE, PSSE harboring variants at CRB2 and PGM1 were intronic to their respective genes, contained ATAC-seq peaks, and bound pancreatic lineage-determining transcription factors FOXA1, FOXA2, GATA4, GATA6, HNF6, SOX9, and PDX1 (Figure 5A,B and Figure 5—figure supplement 1A,B). Compared to the LAMA1 PSSE, CRB2 and PGM1 PSSE were less specific to pancreatic progenitors and exhibited significant H3K27ac signal in several other tissues and cell types, most notably brain, liver, and the digestive tract (Figure 5—figure supplement 1C,D).

Figure 5 with 3 supplements see all
A T2D risk-associated CRB2 pancreatic progenitor-specific stretch enhancer regulates CRB2 expression specifically in pancreatic progenitors.

(A) (Top) Locus plots showing T2D association p-values for variants in a 35 kb window (hg19 chr9:126,112,000–126,147,000) at the CRB2 locus and CRB2 PSSE (red box). Fine mapped variants within the 99% credible set for the novel CRB2 locus are colored black. All other variants are colored light gray. (Bottom) Chromatin states and ATAC-seq signal in ES, DE, GT, PP1, and PP2. TssA, active promoter; TssFlnk, flanking transcription start site; TssBiv, bivalent promoter; Repr, repressed; EnhA, active enhancer; EnhP, poised enhancer. (B) FOXA1, FOXA2, GATA4, GATA6, HNF6, SOX9, and PDX1 ChIP-seq profiles at the CRB2 PSSE in PP2. The variant rs2491353 (black) overlaps with transcription factor binding sites. (C) CRB2 mRNA expression at each developmental stage determined by RNA-seq, measured in fragments per kilobase per million fragments mapped (FPKM). Data shown as mean ± S.E.M. (n = 3 replicates from independent differentiations). Light blue and purple indicate classification of the CRB2 PSSE as typical enhancer (TE) and stretch enhancer (SE), respectively. Plotted points represent average of technical replicates for each differentiation. (D) CRB2 mRNA expression at each developmental stage determined by qPCR in control and ∆CRB2Enh cells. Data are shown as mean ± S.E.M. (n = 3 replicates from independent differentiations for control cells. ∆CRB2Enh cells represent combined data from two clonal lines with three replicates for each line from independent differentiations. n = 3 technical replicates for each sample; p=7.03 × 10−4,<1 × 10−6,<1 × 10−6, 1.46 × 10−2, and <1 × 10−6 for comparisons in ES, DE, GT, PP1, and PP2, respectively; student’s t-test, two sided; ***p<0.001 **p<0.01). Light blue and purple indicate classification of the CRB2 PSSE as TE and SE, respectively. Each plotted point represents the average of technical replicates for each differentiation. (E) mRNA expression determined by RNA-seq at PP2 of genes expressed in either control or ∆CRB2Enh cells (FPKM ≥ 1 at PP2) and located within the same topologically associated domain as CRB2. Data are shown as mean FPKM ± S.E.M. (n = 2 replicates from independent differentiations for control cells. ∆CRB2Enh cells represent combined data from two clonal lines with two replicates for each line from independent differentiations. p adj. = 0.158, 1.00, and 3.51 × 10−3, for MIR600HG, STRBP, and CRB2, respectively; DESeq2; **p<0.01, n.s., not significant). See also Figure 5—figure supplements 13.

Figure 5—source data 1

Genes downregulated in ∆CRB2Enh PP2 stage cells compared to control cells (p adj. <0.05).

https://cdn.elifesciences.org/articles/59067/elife-59067-fig5-data1-v2.xlsx

CRB2 is a component of the Crumbs protein complex involved in the regulation of cell polarity and neuronal, heart, retinal, and kidney development (Alves et al., 2013; Bulgakova and Knust, 2009; Dudok et al., 2016; Jiménez-Amilburu and Stainier, 2019; Slavotinek et al., 2015). However, its role in pancreatic development is unknown. To determine whether the CRB2 PSSE regulates CRB2 expression in pancreatic progenitors, we generated two independent hESC clones with homozygous deletions of the CRB2 PSSE (hereafter referred to as ∆CRB2Enh; Figure 5—figure supplement 2A) and performed pancreatic differentiation of ∆CRB2Enh and control hESC lines. In control cells, CRB2 was first expressed at the GT stage and increased markedly at the PP1 stage (Figure 5C). This pattern of CRB2 expression is consistent with H3K27ac deposition at the CRB2 PSSE in GT stage cells and classification as a SE at the PP1 and PP2 stages (Figure 5A and Figure 5—figure supplement 1C). In ∆CRB2Enh cells, we observed upregulation of CRB2 expression at earlier developmental stages, in particular at the DE and GT stages (p<1 × 10−6 at both stages; Figure 5D), suggesting that the CRB2 PSSE may be associated with repressive transcriptional complexes prior to pancreas induction. At the PP2 stage, CRB2 expression was significantly reduced in ∆CRB2Enh cells (p adj. = 3.51 × 10−3; Figure 5D), whereas the expression of other genes in the same TAD was not affected (p adj. ≥0.05; Figure 5E). Thus, the CRB2 PSSE specifically regulates CRB2 and is required for CRB2 expression in pancreatic progenitors.

Phenotypic characterization of PP2 stage ∆CRB2Enh cultures revealed similar percentages of PDX1- and NKX6.1-positive cells as in control cultures (Figure 5—figure supplement 2B,C). The expression of pancreatic transcription factors and global gene expression profiles were also similar in ∆CRB2Enh and control PP2 cells (Figure 5—figure supplement 2D,E and Figure 5—source data 1). Likewise, CRB2 deletion hESCs (∆CRB2) differentiated to the PP2 stage (Figure 5—figure supplement 3A,B) produced similar numbers of PDX1- and NKX6.1-positive cells and expressed pancreatic transcription factors at levels similar to control cells (Figure 5—figure supplement 3C–E). Thus, neither deletion of the CRB2 PSSE nor the CRB2 gene overtly impairs pancreatic lineage induction in the in vitro hESC differentiation system.

lama1 and crb2 zebrafish morphants display annular pancreas and decreased beta cell mass

Based on their classification as extracellular matrix and cell polarity proteins, respectively, Laminin (encoded by LAMA1) and CRB2 are predicted to regulate processes related to tissue morphogenesis, such as cell migration, tissue growth, and cell allocation within the developing organ. Furthermore, PSSE in general were enriched for proximity to genes involved in tissue morphogenesis (Figure 2E), suggesting that T2D risk variants acting within PSSE could have roles in pancreas morphogenesis. Since cell migratory processes and niche-specific signaling events are not fully modeled during hESC differentiation, we reasoned that the in vitro pancreatic differentiation system might not be suitable for studying Laminin and CRB2 function in pancreatic development.

To circumvent these limitations, we employed zebrafish as an in vivo vertebrate model to study the effects of reduced lama1 and crb2 levels on pancreatic development. The basic organization and cell types in the pancreas as well as the genes regulating endocrine and exocrine pancreas development are highly conserved between zebrafish and mammals (Dong et al., 2008; Field et al., 2003; Kimmel et al., 2015). To analyze pancreatic expression of Laminin and Crb proteins, we used Tg(ptf1a:eGFP)jh1 embryos to visualize pancreatic progenitor cells and the acinar pancreas by eGFP expression. At 48 hr post-fertilization (hpf), both Laminin and Crb proteins were detected in the eGFP and Nkx6.1 co-positive pancreatic progenitor cell domain (Figure 6—figure supplement 1A,B).

To determine the respective functions of lama1 and crb2 in pancreatic development, we performed knockdown experiments using anti-sense morpholinos directed against lama1 and the two zebrafish crb2 genes, crb2a and crb2b (Omori and Malicki, 2006; Pollard et al., 2006). Knockdown efficiency of each morpholino was validated using whole-mount immunohistochemistry. We observed significant reduction of Laminin staining throughout the pancreatic progenitor cell domain in embryos treated with morpholinos targeting lama1 (Figure 6—figure supplement 2A–D). In embryos treated with morpholinos targeting crb2a or crb2a and crb2b, we observed loss of staining in the pancreatic progenitor cell domain using antibodies specific to Crb2a or antibodies detecting all Crb proteins, respectively (Figure 6—figure supplement 3A–H) Residual panCrb protein signal was observed in the dorsal pancreas, which may be the result of expression of Crb proteins other than Crb2a and Crb2b in this region.

Consistent with prior studies (Pollard et al., 2006), lama1 morphants exhibited reduced body size and other gross anatomical defects at 78 hpf, whereas crb2a/b morphants appeared grossly normal. Both lama1 and crb2a/b morphants displayed an annular pancreas (15 out of 34 lama1 and 27 out of 69 crb2a/b morphants) characterized by pancreatic tissue partially or completely encircling the duodenum (Figure 6A–D), a phenotype indicative of impaired migration of pancreatic progenitors during pancreas formation. These findings suggest that both lama1 and crb2a/b control cell migratory processes during early pancreatic development and that reduced levels of lama1 or crb2a/b impair pancreas morphogenesis.

Figure 6 with 4 supplements see all
lama1 and crb2 regulate pancreas morphogenesis and beta cell differentiation.

(A,B) Representative 3D renderings of Tg(ptf1a:eGFP)jh1 control zebrafish embryos (A,A’) and lama1 morphants (B,B’) stained with DAPI (nuclei, blue) and antibody against insulin (red); n ≥ 15 embryos per condition. To account for reduced acinar pancreas size in lama1 morphants, control embryos were imaged at 50 hr post fertilization (hpf) and lama1 morphants at 78 hpf. 15 out of 34 lama1 morphants displayed an annular pancreas with two acinar pancreas domains (green) connected behind the presumptive intestine (B’, white arrow). Scale bar, 40 µM. (C,D) Representative 3D renderings of 78 hpf Tg(ptf1a:eGFP)jh1 control zebrafish embryos (C,C’) and crb2a/b morphants (D,D’) stained with DAPI (nuclei, blue) and antibodies against insulin (red); n ≥ 15 embryos per condition. Twenty-seven out of 69 crb2a/b morphants displayed an annular pancreas with the acinar pancreas (green) completely surrounding the presumptive intestine. Scale bar, 40 µM. (E) Representative 3D renderings of Tg(ptf1a:eGFP)jh1 control zebrafish embryos and crb2a/b, lama1, or crb2a/b + lama1 morphants stained with DAPI (nuclei, blue) and antibody against insulin (red). All embryos were imaged at 78 hpf except for controls to lama1 and crb2a/b + lama1 morphants, which were imaged at 50 hpf to account for reduced acinar pancreas size of lama1 morphants. Scale bar, 20 µM. (F) Quantification of beta (insulin+) cell nuclei per embryo from experiment in (E). p adj. = 4.0 × 10−3, 8.0 × 10−3, and 2.0 × 10−4 for comparison of hfp 78 control (n = 7 embryos) to hfp 78 crb2a/b (n = 8), hpf 50 control (n = 12) to hpf 78 lama1 (n = 10), or crb2a/b + lama1 (n = 12) morphants, respectively; ANOVA-Dunnett’s multiple comparison test; ***p<0.001 **p<0.01. 5 out of 8 crb2a/b, 3 out of 10 lama1, and 9 out of 12 crb2a/b + lama1 morphants displayed an annular pancreas. MO, morpholino; Control, standard control morpholino. See also Figure 6—figure supplements 14.

To gain insight into the effects of lama1 and crb2a/b knockdown on pancreatic endocrine cell development, we examined beta cell numbers (insulin+ cells) at 78 hpf. We also evaluated potential synergistic effects of combined lama1 and crb2a/b knockdown. To account for the reduction in body and pancreas size in lama1 morphants, we compared cell numbers in 78 hpf lama1 morphants with 50 hpf control embryos, which have a similarly sized acinar compartment as 78 hpf lama1 morphants. Beta cell numbers were significantly reduced in both lama1 and crb2a/b morphants (p=8.0 × 10−3 and 4.0 × 10−3 for comparisons of lama1 and crb2a/b morphants, respectively; Figure 6E,F), as well as in morphants with a combined knockdown of lama1 and crb2a/b (p=2.0 × 10−4; Figure 6F), showing that reduced lama1 and crb2a/b levels, both individually and in combination, impair beta cell development. Furthermore, we found that nearly all lama1, crb2a/b, and combined lama1 and crb2a/b morphants without an annular pancreas had reduced beta cell numbers, indicating independent roles of lama1 and crb2 in pancreas morphogenesis and beta cell differentiation. Finally, to investigate the contributions of individual crb2 genes to the observed phenotype, we performed knockdown experiments using morpholinos against crb2a and crb2b alone. Only crb2b morphants showed a significant reduction in beta cell numbers (p=4.4 × 10−2; Figure 6—figure supplement 4), suggesting that crb2b is the predominant crb2 gene required for beta cell development. Combined, these findings demonstrate that lama1 and crb2 are regulators of pancreas morphogenesis and beta cell development in vivo.

Discussion

In this study, we identify T2D-associated variants localized within chromatin active in pancreatic progenitors but not islets or other T2D-relevant tissues, suggesting a novel mechanism whereby a subset of T2D risk variants specifically alters pancreatic developmental processes. We link T2D-associated enhancers active in pancreatic progenitors to the regulation of LAMA1 and CRB2 and demonstrate a functional requirement in zebrafish for lama1 and crb2 in pancreas morphogenesis and endocrine cell formation. Furthermore, we provide a curated list of T2D risk-associated enhancers and candidate effector genes for further exploration of how the regulation of developmental processes in the pancreas can predispose to T2D.

Our analysis identified 11 loci where T2D-associated variants mapped in SE specifically active in pancreatic progenitors. Among these loci was LAMA1, which has stronger effects on T2D risk in lean compared to obese individuals (Perry et al., 2012). We also found evidence that variants in PSSE collectively have stronger enrichment for T2D in lean individuals, although the small number of PSSE and limited sample size of the BMI-stratified T2D genetic data prohibits a more robust comparison. There was also a notable lack of enrichment among PSSE variants for association with traits related to insulin secretion and beta cell function. If T2D-associated variants in PSSE indeed confer diabetes susceptibility by affecting beta cell development, the question arises as to why variants associated with traits related to beta cell function are not enriched within PSSE. As genetic association studies of endophenotypes are based on data from non-diabetic subjects, a possible explanation is that variants affecting beta cell developmental processes have no overt phenotypic effect under physiological conditions and contribute to T2D pathogenesis only during the disease process.

Since the genomic position of enhancers and transcription factor binding sites is not well conserved between species (Villar et al., 2015), a human cell model is necessary to identify target genes of enhancers associated with disease risk. By employing enhancer deletion in hESCs, we demonstrate that T2D-associated PSSE at the LAMA1 and CRB2 loci regulate LAMA1 and CRB2, respectively, and establish LAMA1 and CRB2 as the predominant target gene of their corresponding PSSE within TAD boundaries. By analyzing LAMA1 and CRB2 expression throughout the pancreatic differentiation time course, we show that the identified PSSE control LAMA1 and CRB2 expression in a temporal manner consistent with the activation pattern of their associated PSSE. While the specific T2D-relevant target genes of the majority of T2D-associated PSSE remain to be identified, it is notable that several are localized within TADs containing genes encoding transcriptional regulators. These include PROX1 and GATA4, which are known to regulate pancreatic development (Shi et al., 2017; Tiyaboonchai et al., 2017; Westmoreland et al., 2012), as well as HMGA2 and BCL6 with unknown functions in the pancreas. Our catalogue of T2D-associated PSSE provides a resource to fully characterize the gene regulatory program associated with developmentally mediated T2D risk in the pancreas. Our finding that predicted target genes of PSSE are similarly expressed in hESC-derived pancreatic progenitors and primary human embryonic pancreas (Figure 3B and Figure 3—figure supplement 1A) further underscores the utility of the hESC-based system for these studies.

In the embryo, endocrine cells differentiate by delaminating from a polarized epithelium of progenitors governed by local cell-cell and cell-matrix signaling events (Mamidi et al., 2018). These processes are not well-recapitulated in the hESC-based pancreatic differentiation system, highlighting a limitation of this system for studying the function of Laminin and CRB2, which are mediators of mechanical signals within an epithelium. Therefore, we analyzed their function in zebrafish as an in vivo model. We show that lama1 or crb2 knockdown leads to an annular pancreas and reduced beta cell numbers. The beta cell differentiation defect was also evident in embryos not displaying an annular pancreas, suggesting independent mechanisms.

Consistent with our findings in lama1 morphants, culture of pancreatic progenitors on Laminin-based substrates promotes endocrine cell differentiation (Mamidi et al., 2018). During in vivo pancreatic development, endothelial cells are an important albeit not the only source of Laminin in the pancreas (Heymans et al., 2019; Mamidi et al., 2018; Nikolova et al., 2006). While we do not know the respective contributions of endothelial cell- and pancreatic progenitor cell-derived Laminin to the phenotype of lama1 morphants, the T2D-associated LAMA1 PSSE is not active in endothelial cells (Figure 3—figure supplement 1C). Furthermore, we found no other T2D-associated variants at the LAMA1 locus mapping in endothelial cell enhancers or accessible chromatin sites in islets, suggesting that T2D risk is linked to LAMA1 regulation in pancreatic progenitors.

Similar to Laminin, CRB2 has been shown to regulate mechanosignaling (Varelas et al., 2010). Our observation that pancreatic progenitor cells express Crb proteins is consistent with the phenotype of crb2 morphants reflecting a progenitor-autonomous role of Crb2. Furthermore, the similarity in pancreatic phenotype between lama1 or crb2 morphants raises the possibility that signals from Laminin and Crb2 could converge on the same intracellular pathways in pancreatic progenitors.

Our findings suggest that variation in gene regulation during pancreatic development can predispose to T2D later in life. Several lines of evidence support the concept of a developmental impact on T2D risk. First, human genetic studies have shown a strong correlation between birth weight and adult cardiometabolic traits and disease (Horikoshi et al., 2016). Second, epidemiological studies provide evidence that offspring of mothers who were pregnant during a famine have a higher prevalence of T2D (Lumey et al., 2015). This phenomenon has been experimentally reproduced in rodents, where maternal malnutrition has been shown to cause reduced beta cell mass at birth and to render beta cells more prone to failure under stress (Nielsen et al., 2014). Together, our results provide a strong rationale for further exploration of how genetic variants affecting developmental gene regulation in the pancreas contribute to T2D risk.

Materials and methods

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
AntibodyAPC Mouse monoclonal IgG1, κ Isotype ControlBD PharmingenCat# 555751, RRID:AB_398613Flow cytometry (1:100)
AntibodyChicken polyclonal anti-GFPAves LabsCat# GFP-1020, RRID:AB_10000240Immunohistochemistry (1:200)
AntibodyCy3-conjugated donkey polyclonal anti-mouseJackson ImmunoResearch LabsCat# 715-165-150, RRID:AB_2340813Immunofluorescence (1:1000)
AntibodyDyLight 488-conjugated donkey polyconal anti-goatJackson ImmunoResearch LabsCat# 705-545-003, RRID:AB_2340428Immunofluorescence (1:500)
AntibodyGoat polyclonal anti-CTCFSanta Cruz BiotechnologyCat# SC-15914X, RRID:AB_2086899ChIP-seq (4 ug)
AntibodyGoat polyclonal anti-FOXA1AbcamCat# ab5089, RRID:AB_304744ChIP-seq (4 ug)
AntibodyGoat polyclonal anti-FOXA2Santa Cruz BiotechnologyCat# sc-6554, RRID:AB_2262810ChIP-seq (4 ug)
AntibodyGoat polyclonal anti-GATA4Santa Cruz BiotechnologyCat# sc-1237, RRID:AB_2108747ChIP-seq (4 ug)
AntibodyGoat polyclonal anti-PDX1AbcamCat# ab47383, RRID:AB_2162359Immunofluorescence (1:500)
AntibodyGuinea pig polyclonal anti-InsulinBiomedaCat# v2024Immunohistochemistry (1:200)
AntibodyMouse monoclonal anti-Crb2aZIRCCat# Zs-4Immunohistochemistry (1:100)
AntibodyMouse polyclonal anti-GATA6Santa Cruz BiotechnologyCat# sc-9055, RRID:AB_2108768ChIP-seq (4 ug)
AntibodyMouse monoclonal anti-NKX6.1Developmental Studies Hybridoma BankCat# F64A6B4, RRID:AB_532380Immunofluorescence (1:300)
AntibodyMouse monoclonal anti-NKX6.1-Alexa Fluor 647BD BiosciencesCat# 563338, RRID:AB_2738144Flow cytometry (1:5)
AntibodyMouse monoclonal anti-NKX6.1Developmental Studies Hybridoma BankCat# F55A10, RRID:AB_532378Immunohistochemistry (1:10)
AntibodyMouse monoclonal anti-PDX1-PEBD BiosciencesCat# 562161, RRID:AB_10893589Flow cytometry (1:10)
AntibodyPE Mouse monoclonal IgG1, κ Isotype ControlBD PharmingenCat# 555749, RRID:AB_396091Flow cytometry (1:100)
AntibodyRabbit polyclonal anti-CRB2SigmaCat # SAB1301340Immunofluorescence (1:500)
AntibodyRabbit polyclonal anti-H3K27acActive MotifCat# 39133, RRID:AB_2561016ChIP-seq (4 ug)
AntibodyRabbit polyclonal anti-H3K4me1AbcamCat# ab8895, RRID:AB_306847ChIP-seq (4 ug)
AntibodyRabbit polyclonal anti-HNF6Santa Cruz BiotechnologyCat# sc-13050, RRID:AB_2251852ChIP-seq (4 ug)
AntibodyRabbit polyclonal anti-lamininSigmaCat# L9393, RRID:AB_477163Immunohistochemistry (1:100)
Immunofluorescence (1:30)
AntibodyRabbit monoclonal anti-panCrbJensen Laboratory, University of Massachusetts, AmherstN/AImmunohistochemistry (1:100)
AntibodyRabbit polyclonal anti-PDX1Beta Cell Biology ConsortiumAB1068ChIP-seq (4 ug)
AntibodyRabbit polyclonal anti-SOX9ChemiconCat# 5535, RRID:AB_2239761ChIP-seq (4 ug)
Cell line (Homo-sapiens)CyT49ViaCyte, IncNIHhESC-10–0041,
RRID:CVCL_B850
Male
Cell line (Homo-sapiens)H1WiCell Research
Institute
NIHhESC-10–0043,
RRID:CVCL_9771
Male
Chemical compound, drug2-MercaptoethanolThermo Fisher ScientificCat# 21985023
Chemical compound, drugAccutaseThermo Fisher ScientificCat# 00-4555-56
Chemical compound, drugB-27 supplementThermo Fisher ScientificCat# 17504044
Chemical compound, drugBovine Albumin Fraction VLife TechnologiesCat# 15260037
Chemical compound, drugD-(+)-Glucose Solution, 45%Sigma-AldrichCat# G8769
Chemical compound, drugDAPIInvitrogenCat# D1306Immunohistochemistry (1:200)
Chemical compound, drugDMEM High GlucoseVWRCat# 16750–082
Chemical compound, drugDMEM/F12 [-] L-glutamineVWRCat# 15–090-CV
Chemical compound, drugDMEM/F12 with L-Glutamine, HEPESCorningCat# 45000–350
Chemical compound, drugDMFEMD MilliporeCat# DX1730
Chemical compound, drugDPBSThermo Fisher ScientificCat# 21–031-CV
Chemical compound, drugDTTSigmaCat# D9779
Chemical compound, drugFetal Bovine SerumThermo Fisher ScientificCat# MT35011CV
Chemical compound, drugGlutamaxThermo Fisher ScientificCat# 35050–079
Chemical compound, drugGlutaMAXThermo Fisher ScientificCat# 35050061
Chemical compound, drugHoechst 33342Thermo Fisher ScientificCat# H3570
Chemical compound, drugHyClone Dulbecco’s Modified Eagles MediumThermo Fisher
Scientific
Cat# SH30081.FS
Chemical compound, drugIGEPAL-CA630SigmaCat# I8896
Chemical compound, drugIllumina tagmentation enzymeIlluminaCat# FC-121–1030
Chemical compound, drugInsulin-Transferrin-Selenium (ITS)Thermo Fisher ScientificCat# 41400045
Chemical compound, drugInsulin-Transferrin-Selenium-Ethanolamine (ITS-X)Thermo Fisher
Scientific
Cat# 51500–056
Chemical compound, drugKAAD-CyclopamineToronto Research ChemicalsCat# K171000
Chemical compound, drugK-acetateSigmaCat# P5708
Chemical compound, drugKnockOut SR XenoFreeThermo Fisher ScientificCat# A1099202
Chemical compound, drugLDN-193189StemgentCat# 04–0074
Chemical compound, drugMatrigelCorningCat# 356231
Chemical compound, drugMCDB 131Thermo Fisher
Scientific
Cat# 10372–019
Chemical compound, drugMg-acetateSigmaCat# M2545
Chemical compound, drugmTeSR1 Complete Kit - GMPSTEMCELL
Technologies
Cat# 85850
Chemical compound, drugNEBNext High-Fidelity 2X PCR Master MixNEBCat# M0541
Chemical compound, drugNon-Essential Amino AcidsThermo Fisher ScientificCat# 11140050
Chemical compound, drugO.C.T. CompoundSakura Finetek USACat# 25608–930
Chemical compound, drugPenicillin-StreptomycinThermo Fisher ScientificCat# 15140122
Chemical compound, drugPolyethylenimine (PEI)PolysciencesCat# 23966–1
Chemical compound, drugProtease inhibitorRocheCat# 05056489001
Chemical compound, drugRetinoic acidSigma-AldrichCat# R2625
Chemical compound, drugRNA ScreenTape Sample BufferAgilent TechnologiesCat# 5067–5577
Chemical compound, drugROCK Inhibitor Y-27632STEMCELL
Technologies
Cat# 72305
Chemical compound, drugRPMI 1640 [-] L-glutamineVWRCat# 15–040-CV
Chemical compound, drugSANT-1Sigma-AldrichCat# S4572
Chemical compound, drugSodium BicarbonateSigma-AldrichCat# NC0564699
Chemical compound, drugTamoxifenSigmaCat# T5648
Chemical compound, drugTGF-β RI Kinase Inhibitor IVCalbiochemCat# 616454
Chemical compound, drugTPBCalbiochemCat# 565740
Chemical compound, drugTranylcypromineCayman ChemicalCat# 10010494
Chemical compound, drugTris-acetateThermo Fisher ScientificCat# BP-152
Chemical compound, drugTTNPBEnzo Life SciencesCat# BML-GR105
Chemical compound, drugVectashield Antifade Mounting MediumVector LaboratoriesCat# H-1000
Chemical compound, drugXtremeGene 9RocheCat# 6365787001
Commercial assayHigh Sensitivity D1000 ScreenTapeAgilent TechnologiesCat# 5067–5584
Commercial assay, kitRNA ScreenTapeAgilent TechnologiesCat# 5067–5576
Commercial assay, kitRNA ScreenTape LadderAgilent TechnologiesCat# 5067–5578
Commercial assay, kitBD Cytofix/Cytoperm Plus Fixation/Permeabilization Solution KitBD BiosciencesCat# 554715
Commercial assay, kitChIP-IT High Sensitivity KitActive MotifCat# 53040
Commercial assay, kitiQ SYBR Green SupermixBio-RadCat# 1708884
Commercial assay, kitiScript cDNA Synthesis KitBio-RadCat# 1708891
Commercial assay, kitKAPA Library Preparation Kit (Illumina)Kapa BiosystemsCat# KK8234
Commercial assay, kitKAPA Stranded mRNA-Seq KitsKapa BiosystemsCat# KK8401
Commercial assay, kitMinElute PCR purification kitQIAGENCat# 28004
Commercial assay, kitQubit ssDNA assay kitThermo Fisher ScientificCat# Q10212
Commercial assay, kitRNeasy Micro KitQIAGENCat# 74004
Genetic reagent (D. rerio)Tg(ptf1a:eGFP)jh1PMID:16258076N/A
OtherSPRIselect beadBeckman CoulterCat# B23317
Recombinant proteinActivin AR and D SystemsCat# 338-AC/CF
Recombinant proteinHuman AB SerumValley BiomedicalCat# HP1022
Recombinant proteinRecombinant EGFR and D SystemsCat# 236-EG
Recombinant proteinRecombinant Heregulinβ−1PeprotechCat# 100–03
Recombinant proteinRecombinant KGF/FGF7R and D SystemsCat# 251 KG
Recombinant proteinRecombinant Mouse Wnt3AR and D SystemsCat# 1324-WN/CF
Recombinant proteinRecombinant NogginR and D SystemsCat# 3344 NG
Sequence-based reagentPx333 Plasmidhttp://www.addgene.org/64073/RRID:Addgene_64073
Sequence-based reagentLAMA1 ForwardThis paperqPCR primersGTG ATG GCA ACA GCG CAA A
Sequence-based reagentLAMA1 ReverseThis paperqPCR primersGAC CCA GTG ATA TTC TCT CCC A
Sequence-based reagentCRB2 ForwardThis paperqPCR primersACC ACT GTG CTT GTC CTG AG
Sequence-based reagentCRB2 ReverseThis paperqPCR primersTCC AGG GTC GCT AGA TGG AG
Sequence-based reagentTBP ForwardThis paperqPCR primersTGT GCA CAG GAG CCA AGA GT
Sequence-based reagentTBP ReverseThis paperqPCR primersATT TTC TTG CTG CCA GTC TGG
Sequence-based reagentLAMA1Enh Upstream GuideThis paperCRISPR sgRNAGTC AAA TTG CTA TAA CAC GG
Sequence-based reagentLAMA1Enh Downstream GuideThis paperCRISPR sgRNACCA CTT TAA GTA TCT CAG CA
Sequence-based reagentCRB2Enh Upstream GuideThis paperCRISPR sgRNAATA CAA AGC ACG TGA GA
Sequence-based reagentCRB2Enh Downstream GuideThis paperCRISPR sgRNAGAA TGC GGA TGA CGC CTG AG
Sequence-based reagentlama1-ATGPMID:16321372MorpholinoTCA TCC TCA TCT CCA TCA TCG CTC A
Obtained from GeneTools, LLC
Sequence-based reagentcrb2a-SPPMID:16713951MorpholinoACG TTG CCA GTA CCT GTG TAT CCT G
Obtained from GeneTools, LLC
Sequence-based reagentcrb2b-SPPMID:16713951MorpholinoTAA AGA TGT CCT ACC CAG CTT GAA C
Obtained from GeneTools, LLC
Sequence-based reagentstandard control MON/AMorpholinoCCT CTT ACC TCA GTT ACA ATT TAT A
Obtained from GeneTools, LLC
Software, algorithmAdobe Illustrator v 5.1http://www.adobe.com/products/illustrator.htmlRRID:SCR_014198
Software, algorithmAdobe Photoshop v 5.1http://www.adobe.com/products/photoshop.htmlRRID:SCR_014199
Software, algorithmBEDtools v 2.26.0https://github.com/arq5x/bedtools2RRID:SCR_006646
Software, algorithmBioconductorhttps://www.bioconductor.org/RRID: SCR_006442
Software, algorithmBurrows-Wheeler Aligner v 0.7.13http://bio-bwa.sourceforge.net/RRID:SCR_010910
Software, algorithmCENTIPEDE v 1.2http://centipede.uchicago.edu/N/A
Software, algorithmCufflinks v 2.2.1http://cole-trapnell-lab.github.io/cufflinks/RRID:SCR_014597
Software, algorithmdeepTools2 v 3.1.3https://deeptools.readthedocs.io/en/develop/content/installation.htmlN/A
Software, algorithmDESeq2 v 3.10https://bioconductor.org/packages/release/bioc/html/DESeq2.htmlRRID:SCR_015687
Software, algorithmFlowJo v10 softwarehttps://www.flowjo.com/solutions/flowjoRRID: SCR_008520
Software, algorithmGraphPad Prism v 8.1.2https://www.graphpad.com/scientific-software/prism/RRID: SCR_002798
Software, algorithmHOMER v 4.10.4http://homer.ucsd.edu/homer/RRID: SCR_010881
Software, algorithmJuicebox Tools v 1.4https://github.com/aidenlab/Juicebox/wiki/Juicebox-Assembly-ToolsN/A
Software, algorithmMACS2 v 2.1.4http://liulab.dfci.harvard.edu/MACS/RRID:SCR_013291
Software, algorithmMEME suite v 5.1.1http://meme-suite.org/RRID:SCR_001783
Software, algorithmMetascapehttp://metscape.ncibi.orgRRID:SCR_014687
Software, algorithmPicard Tools v 1.131http://broadinstitute.github.io/picard/RRID:SCR_006525
Software, algorithmR Project for Statistical Computing v 3.6.1http://www.r-project.org/RRID:SCR_001905
Software, algorithmSAMtools v 1.5http://samtools.sourceforge.netRRID:SCR_002105
Software, algorithmSTAR v 2.4https://github.com/alexdobin/STARN/A
Software, algorithmUCSC Genome Browserhttp://genome.ucsc.edu/RRID:SCR_005780
Software, algorithmvcf2diploid v 0.2.6ahttps://github.com/abyzovlab/vcf2diploidN/A
Software, algorithmZEISS ZEN Digital Imaging for Light Microscopyhttp://www.zeiss.com/microscopy/en_us/products/microscope-software/zen.html#introductionRRID:SCR_013672

Maintenance and differentiation of CyT49 hESCs

Request a detailed protocol

Genomic and gene expression analyses (ChIP-seq, ATAC-seq, RNA-seq) for generation of chromatin maps and target gene identification were performed in CyT49 hESCs (male). Propagation of CyT49 hESCs was carried out by passing cells every 3 to 4 days using Accutase (eBioscience) for enzymatic cell dissociation, and with 10% (v/v) human AB serum (Valley Biomedical) included in the hESC media the day of passage. hESCs were seeded into tissue culture flasks at a density of 50,000 cells/cm2. hESC research was approved by the University of California, San Diego, Institutional Review Board and Embryonic Stem Cell Research oversight committee.

Pancreatic differentiation was performed as previously described (Schulz et al., 2012; Wang et al., 2015; Xie et al., 2013). Briefly, a suspension-based culture format was used to differentiate cells in aggregate form. Undifferentiated aggregates of hESCs were formed by re-suspending dissociated cells in hESC maintenance medium at a concentration of 1 × 106 cells/mL and plating 5.5 mL per well of the cell suspension in 6-well ultra-low attachment plates (Costar). The cells were cultured overnight on an orbital rotator (Innova2000, New Brunswick Scientific) at 95 rpm. After 24 hr the undifferentiated aggregates were washed once with RPMI medium and supplied with 5.5 mL of day 0 differentiation medium. Thereafter, cells were supplied with the fresh medium for the appropriate day of differentiation (see below). Cells were continually rotated at 95 rpm, or 105 rpm on days 4 through 8, and no media change was performed on day 10. Both RPMI (Mediatech) and DMEM High Glucose (HyClone) medium were supplemented with 1X GlutaMAX and 1% penicillin/streptomycin. Human activin A, mouse Wnt3a, human KGF, human noggin, and human EGF were purchased from R and D systems. Other added components included FBS (HyClone), B-27 supplement (Life Technologies), Insulin-Transferrin-Selenium (ITS; Life Technologies), TGFβ R1 kinase inhibitor IV (EMD Bioscience), KAAD-Cyclopamine (KC; Toronto Research Chemicals), and the retinoic receptor agonist TTNPB (RA; Sigma Aldrich). Day-specific differentiation media formulations were as follows:

  • Days 0 and 1: RPMI + 0.2% (v/v) FBS, 100 ng/mL Activin, 50 ng/mL mouse Wnt3a, 1:5000 ITS. Days 1 and 2: RPMI + 0.2% (v/v) FBS, 100 ng/mL Activin, 1:5000 ITS

  • Days 2 and 3: RPMI + 0.2% (v/v) FBS, 2.5 mM TGFβ R1 kinase inhibitor IV, 25 ng/mL KGF, 1:1000 ITS

  • Days 3–5: RPMI + 0.2% (v/v) FBS, 25 ng/mL KGF, 1:1000 ITS

  • Days 5–8: DMEM + 0.5X B-27 Supplement, 3 nM TTNPB, 0.25 mM KAAD-Cyclopamine, 50 ng/mL Noggin

  • Days 8–10: DMEM/B-27, 50 ng/mL KGF, 50 ng/mL EGF

Cells at D0 correspond to the embryonic stem cell (ES) stage, cells at D2 correspond to the definitive endoderm (DE) stage, cells at D5 correspond to the gut tube (GT) stage, cells at D7 correspond to the early pancreatic progenitor (PP1) stage, and cells at D10 correspond to the late pancreatic progenitor (PP2) stage.

Maintenance and differentiation of H1 hESCs

Request a detailed protocol

∆LAMA1Enh and ∆CRB2Enh clonal lines were derived by targeting H1 hESCs (male). Cells were maintained and differentiated as described with some modifications (Jin et al., 2019; Rezania et al., 2014). In brief, hESCs were cultured in mTeSR1 media (Stem Cell Technologies) and propagated by passaging cells every 3–4 days using Accutase (eBioscience) for enzymatic cell dissociation. hESC research was approved by the University of California, San Diego, Institutional Review Board and Embryonic Stem Cell Research Oversight Committee.

For differentiation, cells were dissociated using Accutase for 10 min, then reaggregated by plating the cells at a concentration of ~5.5 e6 cells/well in a low attachment six-well plate on an orbital shaker (100 rpm) in a 37°C incubator. The following day, undifferentiated cells were washed in base media (see below) and then differentiated using a multi-step protocol with stage-specific media and daily media changes.

All stage-specific base media were comprised of MCDB 131 medium (Thermo Fisher Scientific) supplemented with NaHCO3, GlutaMAX, D-Glucose, and BSA using the following concentrations:

  • Stage 1/2 medium: MCDB 131 medium, 1.5 g/L NaHCO3, 1X GlutaMAX, 10 mM D-Glucose, 0.5% BSA

  • Stage 3/4 medium: MCDB 131 medium, 2.5 g/L NaHCO3, 1X GlutaMAX, 10 mM D-glucose, 2% BSA

Media compositions for each stage were as follows:

  • Stage 1 (day 0–2): base medium, 100 ng/ml Activin A, 25 ng/ml Wnt3a (day 0). Day 1–2: base medium, 100 ng/ml Activin A

  • Stage 2 (day 3–5): base medium, 0.25 mM L-Ascorbic Acid (Vitamin C), 50 ng/mL FGF7

  • Stage 3 (day 6–7): base medium, 0.25 mM L-Ascorbic Acid, 50 ng/mL FGF7, 0.25 µM SANT-1, 1 µM Retinoic Acid, 100 nM LDN193189, 1:200 ITS-X, 200 nM TPB

  • Stage 4 (day 8–10): base medium, 0.25 mM L-Ascorbic Acid, 2 ng/mL FGF7, 0.25 µM SANT-1, 0.1 µM Retinoic Acid, 200 nM LDN193189, 1:200 ITS-X, 100 nM TPB

Cells at D0 correspond to the embryonic stem cell (ES) stage, cells at D3 correspond to the definitive endoderm (DE) stage, cells at D6 correspond to the gut tube (GT) stage, cells at D8 correspond to the early pancreatic progenitor (PP1) stage, and cells at D11 correspond to the late pancreatic progenitor (PP2) stage.

Generation of ∆LAMA1Enh, ∆CRB2Enh, ∆LAMA1, and ∆CRB2 hESC lines

Request a detailed protocol

To generate clonal homozygous LAMA1Enh and CRB2Enh deletion hESC lines, sgRNAs targeting each relevant enhancer were designed and cloned into Px333-GFP, a modified version of Px333 (Addgene, #64073). To generate clonal homozygous LAMA1 and CRB2 deletion hESC lines, sgRNAs targeting the second exon of each gene were designed and cloned into Px458 (Addgene, #48138). Plasmids expressing the sgRNAs were transfected into H1 hESCs with XtremeGene 9 (Roche). Twenty-four hr later, 8000 GFP+ cells were sorted into a well of six-well plate. Individual colonies that emerged within 5–7 days after transfection were subsequently transferred manually into 48-well plates for expansion, genomic DNA extraction, PCR genotyping, and Sanger sequencing. sgRNA oligos are listed below.

  • LAMA1Enh Upstream Guide: GTCAAATTGCTATAACACGG

  • LAMA1Enh Downstream Guide: CCACTTTAAGTATCTCAGCA

  • CRB2Enh Upstream Guide: ATACAAAGCACGTGAGA

  • CRB2Enh Downstream Guide: GAATGCGGATGACGCCTGAG

  • LAMA1 Exon 2 Guide: ATCAGCACCAATGCCACCTG

  • CRB2 Exon 2 Guide: TCGATGTCCAGCTCGCAGCG

Human tissue

Request a detailed protocol

Human embryonic pancreas tissue was obtained from the Birth Defects Research Laboratory of the University of Washington. Studies for use of embryonic human tissue were approved by the Institutional Review Board of the University of California, San Diego. A pancreas from a 54- and 58-day gestation embryo each were pooled for RNA-seq analysis.

Zebrafish husbandry

Request a detailed protocol

Adult zebrafish and embryos were cared for and maintained under standard conditions. All research activity involving zebrafish was reviewed and approved by SBP Medical Discovery Institute Institutional Animal Care and Use Committee. The following transgenic lines were used: Tg(ptf1a:eGFP)jh1 (Godinho et al., 2005).

Morpholino injections in zebrafish

Request a detailed protocol

The following previously validated morpholinos were injected into the yolk at the one-cell stage in a final volume of either 0.5 or 1 nl: 0.75 ng lama1-ATG (5’- TCATCCT CATCTCCATCATCGCTCA −3’); 3 ng crb2a-SP, (5’-ACGTTGCCAGTACCTGTGTATCCTG-3’) (Omori and Malicki, 2006; Watanabe et al., 2010); 3 ng crb2b-SP, (5’-TAAAGATGTCCTACCCAGCTTGAAC-3’) (Omori and Malicki, 2006); 6.75 ng standard control MO (5’- CCTCTTACCTCAGTTACAATTTATA −3’). All morpholinos were obtained from GeneTools, LLC.

Chromatin immunoprecipitation sequencing (ChIP-seq)

Request a detailed protocol

ChIP-seq was performed using the ChIP-IT High-Sensitivity kit (Active Motif) according to the manufacturer’s instructions. Briefly, for each cell stage and condition analyzed, 5–10 × 106 cells were harvested and fixed for 15 min in an 11.1% formaldehyde solution. Cells were lysed and homogenized using a Dounce homogenizer and the lysate was sonicated in a Bioruptor Plus (Diagenode), on high for 3 × 5 min (30 s on, 30 s off). Between 10 and 30 µg of the resulting sheared chromatin was used for each immunoprecipitation. Equal quantities of sheared chromatin from each sample were used for immunoprecipitations carried out at the same time. A total of 4 µg of antibody were used for each ChIP-seq assay. Chromatin was incubated with primary antibodies overnight at 4°C on a rotator followed by incubation with Protein G agarose beads for 3 hr at 4°C on a rotator. Antibodies used were rabbit anti-H3K27ac (Active Motif 39133), rabbit anti-H3K4me1 (Abcam ab8895), rabbit anti-H3K4me3 (Millipore 04–745), rabbit anti-H3K27me3 (Millipore 07–499), goat anti-CTCF (Santa Cruz Biotechnology SC-15914X), goat anti-GATA4 (Santa Cruz SC-1237), rabbit anti-GATA6 (Santa Cruz SC-9055), goat anti-FOXA1 (Abcam Ab5089), goat-anti-FOXA2 (Santa Cruz SC-6554), rabbit anti-PDX1 (BCBC AB1068), rabbit anti-HNF6 (Santa Cruz SC-13050), and rabbit anti-SOX9 (Chemicon AB5535). Reversal of crosslinks and DNA purification were performed according to the ChIP-IT High-Sensitivity instructions, with the modification of incubation at 65°C for 2–3 hr, rather than at 80°C for 2 hr. Sequencing libraries were constructed using KAPA DNA Library Preparation Kits for Illumina (Kapa Biosystems) and library sequencing was performed on either a HiSeq 4000 System (Illumina) or NovaSeq 6000 System (Illumina) with single-end reads of either 50 or 75 base pairs (bp). Sequencing was performed by the Institute for Genomic Medicine (IGM) core research facility at the University of California at San Diego (UCSD). Two replicates from independent hESC differentiations were generated for each ChIP-seq experiment.

ChIP-seq data analysis

Request a detailed protocol

ChIP-seq reads were mapped to the human genome consensus build (hg19/GRCh37) and visualized using the UCSC Genome Browser (Kent et al., 2002). Burrows-Wheeler Aligner (BWA) (Li and Durbin, 2009) version 0.7.13 was used to map data to the genome. Unmapped and low-quality (q < 15) reads were discarded. SAMtools (Li et al., 2009) was used to remove duplicate sequences and HOMER (Heinz et al., 2010) was used to call peaks using default parameters and to generate tag density plots. Stage- and condition-matched input DNA controls were used as background when calling peaks. The BEDtools suite of programs (Quinlan and Hall, 2010) was used to perform genomic algebra operations. For all ChIP-seq experiments, replicates from two independent hESC differentiations were generated. Tag directories were created for each replicate using HOMER. Directories from each replicate were then combined, and peaks were called from the combined replicates. For histone modifications and CTCF peaks, pearson correlations between each pair of replicates were calculated over the called peaks using the command multiBamSummary from the deepTools2 package (Ramírez et al., 2016). For pancreatic lineage-determining transcription factors (GATA4, GATA6, FOXA1, FOXA2, HNF6, PDX1, SOX9), correlations were calculated for peaks overlapping PSSE. Calculated Pearson correlations are as follow:

H3K4me1H3K27acCTCFH3K4me3H3K27me3
ES0.900.910.870.811.00
DE0.970.840.860.990.99
GT0.970.870.890.970.99
PP10.970.850.890.960.99
PP20.980.870.870.971.00
GATA4GATA6FOXA1FOXA2HNF6PDX1SOX9
PP20.860.820.870.800.950.640.86

RNA isolation and sequencing (RNA-seq) and qRT-PCR

Request a detailed protocol

RNA was isolated from cell samples using the RNeasy Micro Kit (Qiagen) according to the manufacturer instructions. For each cell stage and condition analyzed between 0.1 and 1 × 106 cells were collected for RNA extraction. For qRT-PCR, cDNA synthesis was first performed using the iScript cDNA Synthesis Kit (Bio-Rad) and 500 ng of isolated RNA per reaction. qRT-PCR reactions were performed in triplicate with 10 ng of template cDNA per reaction using a CFX96 Real-Time PCR Detection System and the iQ SYBR Green Supermix (Bio-Rad). PCR of the TATA binding protein (TBP) coding sequence was used as an internal control and relative expression was quantified via double delta CT analysis. For RNA-seq, stranded, single-end sequencing libraries were constructed from isolated RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina) and library sequencing was performed on either a HiSeq 4000 System (Illumina) or NovaSeq 6000 System (Illumina) with single-end reads of either 50 or 75 base pairs (bp). Sequencing was performed by the Institute for Genomic Medicine (IGM) core research facility at the University of California at San Diego. A complete list of RT-qPCR primer sequences can be found below.

LAMA1 forwardGTG ATG GCA ACA GCG CAA A
LAMA1 reverseGAC CCA GTG ATA TTC TCT CCC A
CRB2 forwardACC ACT GTG CTT GTC CTG AG
CRB2 reverseTCC AGG GTC GCT AGA TGG AG
PDX1 forwardAAG TCT ACC AAA GCT CAC GCG
PDX1 reverseGTA GGC GCC GCC TGC
NKX6.1 forwardCTG GCC TGT ACC CCT CAT CA
NKX6.1 reverseCTT CCC GTC TTT GTC CAA CA
PROX1 forwardAAC ATG CAC TAC AAT AAA GCA AAT GAC
PROX1 reverseCAG GAA TCT CTC TGG AAC CTC AAA
PTF1A forwardGAA GGT CAT CAT CTG CCA TC
PTF1A reverseGGC CAT AAT CAG GGT CGC T
SOX9 forwardAGT ACC CGC ACT TGC ACA AC
SOX9 reverseACT TGT AAT CCG GGT GGT CCT T
TBP forwardTGT GCA CAG GAG CCA AGA GT
TBP reverseATT TTC TTG CTG CCA GTC TGG

RNA-seq data analysis

Request a detailed protocol

Reads were mapped to the human genome consensus build (hg19/GRCh37) using the Spliced Transcripts Alignment to a Reference (STAR) aligner v2.4 (Dobin et al., 2013). Normalized gene expression (fragments per kilobase per million mapped reads; FPKM) for each sequence file was determined using Cufflinks v2.2.1 (Trapnell et al., 2010) with the parameters: --library-type fr-firststrand --max-bundle-frags 10000000. For all RNA-Seq experiments, replicates from two independent hESC differentiations were generated. Pearson correlations between bam files corresponding to each pair of replicates were calculated, and are as follow:

LAMA1Enh clone 1 PP21.00
LAMA1Enh clone 2 PP20.99
CRB2Enh clone 1 PP20.98
CRB2Enh clone 2 PP20.90
LAMA1Enh control PP20.92
CRB2Enh control PP20.99

Assay for transposase accessible chromatin sequencing (ATAC-seq)

Request a detailed protocol

ATAC-seq (Buenrostro et al., 2013) was performed on approximately 50,000 nuclei. The samples were permeabilized in cold permeabilization buffer 0.2% IGEPAL-CA630 (I8896, Sigma), 1 mM DTT (D9779, Sigma), Protease inhibitor (05056489001, Roche), 5% BSA (A7906, Sigma) in PBS (10010–23, Thermo Fisher Scientific) for 10 min on the rotator in the cold room and centrifuged for 5 min at 500 × g at 4°C. The pellet was resuspended in cold tagmentation buffer (33 mM Tris-acetate (pH = 7.8) (BP-152, Thermo Fisher Scientific), 66 mM K-acetate (P5708, Sigma), 11 mM Mg-acetate (M2545, Sigma), 16% DMF (DX1730, EMD Millipore) in Molecular biology water (46000 CM, Corning)) and incubated with tagmentation enzyme (FC-121–1030; Illumina) at 37°C for 30 min with shaking at 500 rpm. The tagmented DNA was purified using MinElute PCR purification kit (28004, QIAGEN). Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 min, denaturation at 98°C for 30 s, followed by 8 cycles of denaturation at 98°C for 10 s, annealing at 63°C for 30 s and extension at 72°C for 60 s. After the purification of amplified libraries using MinElute PCR purification kit (28004, QIAGEN), double size selection was performed using SPRIselect bead (B23317, Beckman Coulter) with 0.55X beads and 1.5X to sample volume. Finally, libraries were sequenced on HiSeq4000 (Paired-end 50 cycles, Illumina).

ATAC-seq data analysis

Request a detailed protocol

ATAC-seq reads were mapped to the human genome (hg19/GRCh37) using Burrows-Wheeler Aligner (BWA) version 0.7.13 (Li and Durbin, 2009), and visualized using the UCSC Genome Browser (Kent et al., 2002). SAMtools (Li et al., 2009) was used to remove unmapped, low-quality (q < 15), and duplicate reads. MACS2 (Zhang et al., 2008) was used to call peaks, with parameters ‘shift set to 100 bps, smoothing window of 200 bps’ and with ‘nolambda’ and ‘nomodel’ flags on. MACS2 was also used to call ATAC-Seq summits, using the same parameters combined with the ‘call-summits’ flag.

For all ATAC-Seq experiments, replicates from two independent hESC differentiations were generated. Bam files for each pair of replicates were merged for downstream analysis using SAMtools, and Pearson correlations between bam files for each individual replicate were calculated over a set of peaks called from the merged bam file. Correlations were performed using the command multiBamSummary from the deepTools2 package (Ramírez et al., 2016) with the ‘—removeOutliers’ flag and are as follow:

ES0.95
DE0.83
GT1.00
PP11.00
PP21.00

For downstream analysis, ATAC-seq peaks were merged from two independent differentiations for ES, DE, GT, PP1, and PP2 stage cells and from four donors for primary islets. Primary islet ATAC-seq data was obtained from previously published datasets (Greenwald et al., 2019).

Hi-C data analysis

Request a detailed protocol

Hi-C data were processed as previously described with some modifications (Dixon et al., 2015). Read pairs were aligned to the hg19 reference genome separately using BWA-MEM with default parameters (Li and Durbin, 2009). Specifically, chimeric reads were processed to keep only the 5’ position and reads with low mapping quality (<10) were filtered out. Read pairs were then paired using custom scripts. Picard tools were then used to remove PCR duplicates. Bam files with alignments were further processed into text format as required by Juicebox tools (Durand et al., 2016). Juicebox tools were then applied to generate hic files containing normalized contact matrices. All downstream analysis was based on 10 Kb resolution KR normalized matrices.

Chromatin loops were identified by comparing each pixel with its local background, as described previously (Rao et al., 2014) with some modifications. Specifically, only the donut region around the pixel was compared to model the expected count. Briefly, the KR-normalized contact matrices at 10 Kb resolution were used as input for loop calling. For each pixel, distance-corrected contact frequencies were calculated for each surrounding bin and the average of all surrounding bins. The expected counts were then transformed to raw counts by multiplying the counts with the raw-to-KR normalization factor. The probability of observing raw expected counts was calculated using Poisson distribution. All pixels with p-value<0.01 and distance less than 10 Kb were selected as candidate pixels. Candidate pixels were then filtered to remove pixels without any neighboring candidate pixels since they were likely false positives. Finally, pixels within 20 Kb of each other were collapsed and only the most significant pixel was selected. The collapsed pixels with p-value<1e-5 were used as the final list of chromatin loops.

A full set of scripts used for processing Hi-C data (Qiu, 2021) is available at https://github.com/MSanderlab/Pancreatic-progenitor-epigenome-maps-prioritize-type-2-diabetes-risk-genes-with-roles-in-development/tree/master (copy archived at swh:1:rev:ba79c687523c2696ea0ef30d8476e28a0d860f18).

Definition of chromatin states

Request a detailed protocol

We collected or generated H3K4me1, H3K27ac, H3K4me1, H3K4me3, H3K27me3, and CTCF ChIP-seq data at each developmental stage and in mature islets. Data corresponding to mature islets was downloaded from previously published studies (Bhandare et al., 2010; Parker et al., 2013; Pasquali et al., 2014). Sequence reads were mapped to the human genome hg19 using bwa (version 0.7.12) (Li and Durbin, 2009), and low quality and duplicate reads were filtered using samtools (version 1.3) (Li et al., 2009). Using these reads, we then called chromatin states jointly across all data using chromHMM (version 1.12) (Ernst and Kellis, 2012) and used a 10-state model and 200 bp bin size, as models with larger state numbers did not empirically resolve any additional informative states. We then assigned state names based on patterns defined by the NIH Epigenome Roadmap (Kundaje et al., 2015), which included active promoter/TssA (high H3K4me3, high H3K27ac), flanking TSS/TssFlnk1 (high H3K4me3), flanking TSS/TssFlnk 2 (high H3K4me3, high H3K27ac, high H3K4me1), bivalent Tss/TssBiv (high H3K27me3, high H3K4me3), poised enhancer/EnhP (high H3K4me1), insulator/CTCF (high CTCF), active enhancer/EnhA (high H3K27ac, high H3K4me1), repressor (high H3K27me3), and two quiescent (low signal for all assays) states. The state map with assigned names is shown in Figure 1—figure supplement 1A.

We next defined stretch enhancer elements at each developmental stage and in mature islets. For each active enhancer (EnhA) element, we determined the number of consecutive 200 bp bins covered by the enhancer. We then modeled the resulting bin counts for enhancers in each cell type using a Poisson distribution. Enhancers with a p-value less than. 001 were labeled as stretch enhancers and otherwise labeled as traditional enhancers.

Permutation-based significance

Request a detailed protocol

A random sampling approach (10,000 iterations) was used to obtain null distributions for enrichment analyses, in order to obtain p-values. Null distributions for enrichments were obtained by randomly shuffling enhancer regions using BEDTools (Quinlan and Hall, 2010) and overlapping with ATAC-seq peaks. p-values<0.05 were considered significant.

Assignment of enhancer target genes

Request a detailed protocol

Transcriptomes were filtered for genes expressed (FPKM ≥1) at each relevant stage, and BEDTools (Quinlan and Hall, 2010) was used to assign each enhancer to the nearest annotated TSS.

Gene ontology

Request a detailed protocol

All gene ontology analyses were performed using Metascape (Zhou et al., 2019) with default parameters.

Motif enrichment analysis

Request a detailed protocol

The findMotifsGenome.pl. command in HOMER (Heinz et al., 2010) was used to identify enriched transcription factor binding motifs. de novo motifs were assigned to transcription factors based on suggestions generated by HOMER.

T2D-relevant trait enrichment analysis

Request a detailed protocol

GWAS summary statistics for T2D (Mahajan et al., 2018; Perry et al., 2012), metabolic traits (HOMA-B, HOMA-IR [Dupuis et al., 2010], fasting glucose, fasting insulin [Manning et al., 2012], fasting proinsulin [Strawbridge et al., 2011], 2 hr glucose adjusted for BMI [Saxena et al., 2010], HbA1c, insulin secretion rate, disposition index, acute insulin response, peak insulin response [Wood et al., 2017]), and developmental traits (head circumference [Taal et al., 2012], birth length [van der Valk et al., 2015], birth weight [Horikoshi et al., 2016]) conducted with individuals of European ancestry were obtained from various sources including the MAGIC consortium, EGG consortium, and authors of the studies. Custom LD score annotation files were created for PSSE, PP2 stretch enhancers, and islet stretch enhancers using LD score regression version 1.0.1 (Bulik-Sullivan et al., 2015). Enrichments for GWAS trait-associated variants within PSSE, PP2 stretch enhancers, and islet stretch enhancers were estimated with stratified LD score regression (Finucane et al., 2015). We next determined enrichment in the proportion of variants in accessible chromatin sites within islet SE and PSSE with nominal association to beta cell-related glycemic traits. For each trait, we calculated a 2 × 2 table of variants mapping in and outside of islet SE or PSSE and with or without nominal association and then determined significance using a chi-square test.

Adipocyte differentiation analysis

Request a detailed protocol

Chromatin states for human adipose stromal cell (hASC) differentiation stages (1-4) were obtained from a published study (Varshney et al., 2017). PSSE were intersected with hASC chromatin states using BEDTools intersect (version 2.26.0) (Quinlan and Hall, 2010) with default parameters.

Identification of T2D risk loci intersecting PSSE

Request a detailed protocol

T2D GWAS summary statistics were obtained from the DIAMANTE consortium (Mahajan et al., 2018). Intersection of variants and PSSE was performed using BEDTools intersect (version 2.26.0) (Quinlan and Hall, 2010) with default parameters. The adjusted significance threshold was set at p<4.66 × 10−6 (Bonferroni correction for 10,738 variants mapping in PSSE). Putative novel loci were defined as those with (1) at least one variant in a PSSE reaching the adjusted significance threshold and (2) mapping at least 500 kb away from a known T2D locus.

ATAC-seq footprinting analysis

Request a detailed protocol

ATAC-seq footprinting was performed as previously described (Aylward et al., 2018). In brief, diploid genomes for CyT49 were created using vcf2diploid (version 0.2.6a) (Rozowsky et al., 2011) and genotypes called from whole genome sequencing and scanned for a compiled database of TF sequence motifs from JASPAR (Mathelier et al., 2016) and ENCODE (ENCODE Project Consortium, 2012) with FIMO (version 4.12.0) (Grant et al., 2011) using default parameters for p-value threshold and a 40.9% GC content based on the hg19 human reference genome. Footprints within ATAC-seq peaks were discovered with CENTIPEDE (version 1.2) (Pique-Regi et al., 2011) using cut-site matrices containing Tn5 integration counts within a ± 100 bp window around each motif occurrence. Footprints were defined as those with a posterior probability ≥0.99.

Generation of similarity matrices for total transcriptomes

Request a detailed protocol

For each replicate, FPKM values corresponding to total transcriptome were filtered for genes expressed (FPKM ≥1) in ≥1 replicate. For expressed genes, log(FPKM+1) values were used to calculate Pearson correlations.

Immunofluorescence analysis

Request a detailed protocol

Cell aggregates derived from hESCs were allowed to settle in microcentrifuge tubes and washed twice with PBS before fixation with 4% paraformaldehyde (PFA) for 30 min at room temperature. Fixed samples were washed twice with PBS and incubated overnight at 4°C in 30% (w/v) sucrose in PBS. Samples were then loaded into disposable embedding molds (VWR), covered in Tissue-Tek O.C.T. Sakura Finetek compound (VWR) and flash frozen on dry ice to prepare frozen blocks. The blocks were sectioned at 10 µm and sections were placed on Superfrost Plus (Thermo Fisher) microscope slides and washed with PBS for 10 min. Slide-mounted cell sections were permeabilized and blocked with blocking buffer, consisting of 0.15% (v/v) Triton X-100 (Sigma) and 1% (v/v) normal donkey serum (Jackson Immuno Research Laboratories) in PBS, for 1 hr at room temperature. Slides were then incubated overnight at 4°C with primary antibody solutions. The following day slides were washed five times with PBS and incubated for 1 hr at room temperature with secondary antibody solutions. Cells were washed five times with PBS before coverslips were applied.

All antibodies were diluted in blocking buffer at the ratios indicated below. Primary antibodies used were goat anti-PDX1 (1:500 dilution, Abcam ab47383), mouse anti-NKX6.1 (1:300 dilution, Developmental Studies Hybridoma Bank F64A6B4), rabbit anti-Laminin (1:30, Sigma L-9393), and rabbit anti-CRB2 (1:500, Sigma SAB1301340). Secondary antibodies against goat and mouse were Alexa488- and Cy3-conjugated donkey antibodies, respectively (Jackson Immuno Research Laboratories 705-545-003 and 715-165-150, respectively), and were used at dilutions of 1:500 (anti-goat Alexa488) or 1:1000 (anti-mouse Cy3). Cell nuclei were stained with Hoechst 33342 (1:3000, Invitrogen). Representative images were obtained with a Zeiss Axio-Observer-Z1 microscope equipped with a Zeiss ApoTome and AxioCam digital camera. Figures were prepared in Adobe Creative Suite 5.

Flow cytometry analysis

Request a detailed protocol

Cell aggregates derived from hESCs were allowed to settle in microcentrifuge tubes and washed with PBS. Cell aggregates were incubated with Accutase at room temperature until a single-cell suspension was obtained. Cells were washed with 1 mL ice-cold flow buffer comprised of 0.2% BSA in PBS and centrifuged at 200 g for 5 min. BD Cytofix/Cytoperm Plus Fixation/Permeabilization Solution Kit was used to fix and stain cells for flow cytometry according to the manufacturer's instructions. Briefly, cell pellets were re-suspended in ice-cold BD Fixation/Permeabilization solution (300 µL per microcentrifuge tube). Cells were incubated for 20 min at 4°C. Cells were washed twice with 1 mL ice-cold 1 × BD Perm/Wash Buffer and centrifuged at 10°C and 200 × g for 5 min. Cells were re-suspended in 50 µL ice-cold 1 × BD Perm/Wash Buffer containing diluted antibodies, for each staining performed. Cells were incubated at 4°C in the dark for 1–3 hr. Cells were washed with 1.25 mL ice-cold 1X BD Wash Buffer and centrifuged at 200 × g for 5 min. Cell pellets were re-suspended in 300 µL ice-cold flow buffer and analyzed in a FACSCanto II (BD Biosciences). Antibodies used were PE-conjugated anti-PDX1 (1:10 dilution, BD Biosciences); and AlexaFluor 647-conjugated anti-NKX6.1 (1:5 dilution, BD Biosciences). Data were processed using FlowJo software v10.

Whole mount immunohistochemistry

Request a detailed protocol

Zebrafish larvae were fixed and stained according to published protocols (Lancman et al., 2013) using the following antibodies: chicken anti-GFP (1:200; Aves Labs; GFP-1020), guinea pig anti-insulin (1:200; Biomeda; v2024), mouse anti-Crb2a (1:100; ZIRC; zs-4), rabbit anti-panCrb (1:100; provided by Dr. Abbie M. Jensen at University of Massachusetts, Amherst; Hsu and Jensen, 2010), rabbit anti-Laminin (1:100; Sigma;L9393), mouse anti-Nkx6.1 (1:10; DSHB; F55A10), and DAPI (1:200; 500 mg/ml, Invitrogen; D1306).

Imaging and quantification of beta cell numbers in zebrafish

Request a detailed protocol

To quantify beta cell numbers, 50 and 78 hpf zebrafish larvae were stained for confocal imaging using DAPI and guinea pig anti-insulin antibody (1:200; Biomeda; v2024). Whole mount fluorescent confocal Z-stacks (0.9 μm steps) images were collected for the entire islet with optical slices captured at a focal depth of 1.8 μm. Samples were imaged using a Zeiss 710 confocal microscope running Zen 2010 (Black) software. Final images were generated using Adobe Photoshop CS6 and/or ImageJ64 (vs.1.48b).

Data sources

Request a detailed protocol

The following datasets used in this study were downloaded from the GEO and ArrayExpress repositories:

RNA-seq: Pancreatic differentiation of CyT49 hESC line (E-MTAB-1086); primary islet data (GSE115327).

ChIP-seq: H3K27ac data in primary islets (E-MTAB-1919 and GSE51311); H3K27ac data in pancreatic differentiation of CyT49 hESC line (GSE54471); H3K4me1 data in pancreatic differentiation of CyT49 hESC line (GSE54471); H3K4me1 data in primary islets (E-MTAB-1919 and E-MTAB 189); H3K27me3 and H3K4me3 in pancreatic differentiation of CyT49 hESC line (E-MTAB-1086); H3K4me3 and H3K27me3 in primary islets (E-MTAB-189); CTCF in primary islets (E-MTAB-1919); PDX1 in CyT49 PP2 (GSE54471); samples from ROADMAP consortium: http://ncbi.nlm.nih.gov/geo/roadmap/epigenomics.

ATAC-seq: primary islet data (PRJN527099); CyT49 PP2 (GSE115327).

Hi-C datasets were generated in collaboration with the Ren laboratory at University of California, San Diego as a component of the 4D Nucleome Project (Dekker et al., 2017) under accession number 4DNES0LVRKBM.

Quantification and statistical analyses

Request a detailed protocol

Statistical analyses were performed using GraphPad Prism (v8.1.2), and R (v3.6.1). Statistical parameters, such as the value of n, mean, standard deviation (SD), standard error of the mean (SEM), significance level (*p<0.05, **p<0.01, and ***p<0.001), and the statistical tests used, are reported in the figures and figure legends. The ‘n’ refers to the number of independent pancreatic differentiation experiments analyzed (biological replicates).

Statistically significant gene expression changes were determined with DESeq2 (Love et al., 2014).

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
    New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk
    1. J Dupuis
    2. C Langenberg
    3. I Prokopenko
    4. R Saxena
    5. N Soranzo
    6. AU Jackson
    7. E Wheeler
    8. NL Glazer
    9. N Bouatia-Naji
    10. AL Gloyn
    11. CM Lindgren
    12. R Mägi
    13. AP Morris
    14. J Randall
    15. T Johnson
    16. P Elliott
    17. D Rybin
    18. G Thorleifsson
    19. V Steinthorsdottir
    20. P Henneman
    21. H Grallert
    22. A Dehghan
    23. JJ Hottenga
    24. CS Franklin
    25. P Navarro
    26. K Song
    27. A Goel
    28. JR Perry
    29. JM Egan
    30. T Lajunen
    31. N Grarup
    32. T Sparsø
    33. A Doney
    34. BF Voight
    35. HM Stringham
    36. M Li
    37. S Kanoni
    38. P Shrader
    39. C Cavalcanti-Proença
    40. M Kumari
    41. L Qi
    42. NJ Timpson
    43. C Gieger
    44. C Zabena
    45. G Rocheleau
    46. E Ingelsson
    47. P An
    48. J O'Connell
    49. J Luan
    50. A Elliott
    51. SA McCarroll
    52. F Payne
    53. RM Roccasecca
    54. F Pattou
    55. P Sethupathy
    56. K Ardlie
    57. Y Ariyurek
    58. B Balkau
    59. P Barter
    60. JP Beilby
    61. Y Ben-Shlomo
    62. R Benediktsson
    63. AJ Bennett
    64. S Bergmann
    65. M Bochud
    66. E Boerwinkle
    67. A Bonnefond
    68. LL Bonnycastle
    69. K Borch-Johnsen
    70. Y Böttcher
    71. E Brunner
    72. SJ Bumpstead
    73. G Charpentier
    74. YD Chen
    75. P Chines
    76. R Clarke
    77. LJ Coin
    78. MN Cooper
    79. M Cornelis
    80. G Crawford
    81. L Crisponi
    82. IN Day
    83. EJ de Geus
    84. J Delplanque
    85. C Dina
    86. MR Erdos
    87. AC Fedson
    88. A Fischer-Rosinsky
    89. NG Forouhi
    90. CS Fox
    91. R Frants
    92. MG Franzosi
    93. P Galan
    94. MO Goodarzi
    95. J Graessler
    96. CJ Groves
    97. S Grundy
    98. R Gwilliam
    99. U Gyllensten
    100. S Hadjadj
    101. G Hallmans
    102. N Hammond
    103. X Han
    104. AL Hartikainen
    105. N Hassanali
    106. C Hayward
    107. SC Heath
    108. S Hercberg
    109. C Herder
    110. AA Hicks
    111. DR Hillman
    112. AD Hingorani
    113. A Hofman
    114. J Hui
    115. J Hung
    116. B Isomaa
    117. PR Johnson
    118. T Jørgensen
    119. A Jula
    120. M Kaakinen
    121. J Kaprio
    122. YA Kesaniemi
    123. M Kivimaki
    124. B Knight
    125. S Koskinen
    126. P Kovacs
    127. KO Kyvik
    128. GM Lathrop
    129. DA Lawlor
    130. O Le Bacquer
    131. C Lecoeur
    132. Y Li
    133. V Lyssenko
    134. R Mahley
    135. M Mangino
    136. AK Manning
    137. MT Martínez-Larrad
    138. JB McAteer
    139. LJ McCulloch
    140. R McPherson
    141. C Meisinger
    142. D Melzer
    143. D Meyre
    144. BD Mitchell
    145. MA Morken
    146. S Mukherjee
    147. S Naitza
    148. N Narisu
    149. MJ Neville
    150. BA Oostra
    151. M Orrù
    152. R Pakyz
    153. CN Palmer
    154. G Paolisso
    155. C Pattaro
    156. D Pearson
    157. JF Peden
    158. NL Pedersen
    159. M Perola
    160. AF Pfeiffer
    161. I Pichler
    162. O Polasek
    163. D Posthuma
    164. SC Potter
    165. A Pouta
    166. MA Province
    167. BM Psaty
    168. W Rathmann
    169. NW Rayner
    170. K Rice
    171. S Ripatti
    172. F Rivadeneira
    173. M Roden
    174. O Rolandsson
    175. A Sandbaek
    176. M Sandhu
    177. S Sanna
    178. AA Sayer
    179. P Scheet
    180. LJ Scott
    181. U Seedorf
    182. SJ Sharp
    183. B Shields
    184. G Sigurethsson
    185. EJ Sijbrands
    186. A Silveira
    187. L Simpson
    188. A Singleton
    189. NL Smith
    190. U Sovio
    191. A Swift
    192. H Syddall
    193. AC Syvänen
    194. T Tanaka
    195. B Thorand
    196. J Tichet
    197. A Tönjes
    198. T Tuomi
    199. AG Uitterlinden
    200. KW van Dijk
    201. M van Hoek
    202. D Varma
    203. S Visvikis-Siest
    204. V Vitart
    205. N Vogelzangs
    206. G Waeber
    207. PJ Wagner
    208. A Walley
    209. GB Walters
    210. KL Ward
    211. H Watkins
    212. MN Weedon
    213. SH Wild
    214. G Willemsen
    215. JC Witteman
    216. JW Yarnell
    217. E Zeggini
    218. D Zelenika
    219. B Zethelius
    220. G Zhai
    221. JH Zhao
    222. MC Zillikens
    223. IB Borecki
    224. RJ Loos
    225. P Meneton
    226. PK Magnusson
    227. DM Nathan
    228. GH Williams
    229. AT Hattersley
    230. K Silander
    231. V Salomaa
    232. GD Smith
    233. SR Bornstein
    234. P Schwarz
    235. J Spranger
    236. F Karpe
    237. AR Shuldiner
    238. C Cooper
    239. GV Dedoussis
    240. M Serrano-Ríos
    241. AD Morris
    242. L Lind
    243. LJ Palmer
    244. FB Hu
    245. PW Franks
    246. S Ebrahim
    247. M Marmot
    248. WH Kao
    249. JS Pankow
    250. MJ Sampson
    251. J Kuusisto
    252. M Laakso
    253. T Hansen
    254. O Pedersen
    255. PP Pramstaller
    256. HE Wichmann
    257. T Illig
    258. I Rudan
    259. AF Wright
    260. M Stumvoll
    261. H Campbell
    262. JF Wilson
    263. RN Bergman
    264. TA Buchanan
    265. FS Collins
    266. KL Mohlke
    267. J Tuomilehto
    268. TT Valle
    269. D Altshuler
    270. JI Rotter
    271. DS Siscovick
    272. BW Penninx
    273. DI Boomsma
    274. P Deloukas
    275. TD Spector
    276. TM Frayling
    277. L Ferrucci
    278. A Kong
    279. U Thorsteinsdottir
    280. K Stefansson
    281. CM van Duijn
    282. YS Aulchenko
    283. A Cao
    284. A Scuteri
    285. D Schlessinger
    286. M Uda
    287. A Ruokonen
    288. MR Jarvelin
    289. DM Waterworth
    290. P Vollenweider
    291. L Peltonen
    292. V Mooser
    293. GR Abecasis
    294. NJ Wareham
    295. R Sladek
    296. P Froguel
    297. RM Watanabe
    298. JB Meigs
    299. L Groop
    300. M Boehnke
    301. MI McCarthy
    302. JC Florez
    303. I Barroso
    304. DIAGRAM Consortium
    305. GIANT Consortium
    306. Global BPgen Consortium
    307. Anders Hamsten on behalf of Procardis Consortium
    308. MAGIC investigators
    (2010)
    Nature Genetics 42:105–116.
    https://doi.org/10.1038/ng.520
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
    Exome sequencing of 20,791 cases of type 2 diabetes and 24,440 controls
    1. J Flannick
    2. JM Mercader
    3. C Fuchsberger
    4. MS Udler
    5. A Mahajan
    6. J Wessel
    7. TM Teslovich
    8. L Caulkins
    9. R Koesterer
    10. F Barajas-Olmos
    11. TW Blackwell
    12. E Boerwinkle
    13. JA Brody
    14. F Centeno-Cruz
    15. L Chen
    16. S Chen
    17. C Contreras-Cubas
    18. E Córdova
    19. A Correa
    20. M Cortes
    21. RA DeFronzo
    22. L Dolan
    23. KL Drews
    24. A Elliott
    25. JS Floyd
    26. S Gabriel
    27. ME Garay-Sevilla
    28. H García-Ortiz
    29. M Gross
    30. S Han
    31. NL Heard-Costa
    32. AU Jackson
    33. ME Jørgensen
    34. HM Kang
    35. M Kelsey
    36. BJ Kim
    37. HA Koistinen
    38. J Kuusisto
    39. JB Leader
    40. A Linneberg
    41. CT Liu
    42. J Liu
    43. V Lyssenko
    44. AK Manning
    45. A Marcketta
    46. JM Malacara-Hernandez
    47. A Martínez-Hernández
    48. K Matsuo
    49. E Mayer-Davis
    50. E Mendoza-Caamal
    51. KL Mohlke
    52. AC Morrison
    53. A Ndungu
    54. MCY Ng
    55. C O'Dushlaine
    56. AJ Payne
    57. C Pihoker
    58. WS Post
    59. M Preuss
    60. BM Psaty
    61. RS Vasan
    62. NW Rayner
    63. AP Reiner
    64. C Revilla-Monsalve
    65. NR Robertson
    66. N Santoro
    67. C Schurmann
    68. WY So
    69. X Soberón
    70. HM Stringham
    71. TM Strom
    72. CHT Tam
    73. F Thameem
    74. B Tomlinson
    75. JM Torres
    76. RP Tracy
    77. RM van Dam
    78. M Vujkovic
    79. S Wang
    80. RP Welch
    81. DR Witte
    82. TY Wong
    83. G Atzmon
    84. N Barzilai
    85. J Blangero
    86. LL Bonnycastle
    87. DW Bowden
    88. JC Chambers
    89. E Chan
    90. CY Cheng
    91. YS Cho
    92. FS Collins
    93. PS de Vries
    94. R Duggirala
    95. B Glaser
    96. C Gonzalez
    97. ME Gonzalez
    98. L Groop
    99. JS Kooner
    100. SH Kwak
    101. M Laakso
    102. DM Lehman
    103. P Nilsson
    104. TD Spector
    105. ES Tai
    106. T Tuomi
    107. J Tuomilehto
    108. JG Wilson
    109. CA Aguilar-Salinas
    110. E Bottinger
    111. B Burke
    112. DJ Carey
    113. JCN Chan
    114. J Dupuis
    115. P Frossard
    116. SR Heckbert
    117. MY Hwang
    118. YJ Kim
    119. HL Kirchner
    120. JY Lee
    121. J Lee
    122. RJF Loos
    123. RCW Ma
    124. AD Morris
    125. CJ O'Donnell
    126. CNA Palmer
    127. J Pankow
    128. KS Park
    129. A Rasheed
    130. D Saleheen
    131. X Sim
    132. KS Small
    133. YY Teo
    134. C Haiman
    135. CL Hanis
    136. BE Henderson
    137. L Orozco
    138. T Tusié-Luna
    139. FE Dewey
    140. A Baras
    141. C Gieger
    142. T Meitinger
    143. K Strauch
    144. L Lange
    145. N Grarup
    146. T Hansen
    147. O Pedersen
    148. P Zeitler
    149. D Dabelea
    150. G Abecasis
    151. GI Bell
    152. NJ Cox
    153. M Seielstad
    154. R Sladek
    155. JB Meigs
    156. SS Rich
    157. JI Rotter
    158. D Altshuler
    159. NP Burtt
    160. LJ Scott
    161. AP Morris
    162. JC Florez
    163. MI McCarthy
    164. M Boehnke
    165. Broad Genomics Platform
    166. DiscovEHR Collaboration
    167. CHARGE
    168. LuCamp
    169. ProDiGY
    170. GoT2D
    171. ESP
    172. SIGMA-T2D
    173. T2D-GENES
    174. AMP-T2D-GENES
    (2019)
    Nature 570:71–76.
    https://doi.org/10.1038/s41586-019-1231-2
  24. 24
    The genetic architecture of type 2 diabetes
    1. C Fuchsberger
    2. J Flannick
    3. TM Teslovich
    4. A Mahajan
    5. V Agarwala
    6. KJ Gaulton
    7. C Ma
    8. P Fontanillas
    9. L Moutsianas
    10. DJ McCarthy
    11. MA Rivas
    12. JRB Perry
    13. X Sim
    14. TW Blackwell
    15. NR Robertson
    16. NW Rayner
    17. P Cingolani
    18. AE Locke
    19. JF Tajes
    20. HM Highland
    21. J Dupuis
    22. PS Chines
    23. CM Lindgren
    24. C Hartl
    25. AU Jackson
    26. H Chen
    27. JR Huyghe
    28. M van de Bunt
    29. RD Pearson
    30. A Kumar
    31. M Müller-Nurasyid
    32. N Grarup
    33. HM Stringham
    34. ER Gamazon
    35. J Lee
    36. Y Chen
    37. RA Scott
    38. JE Below
    39. P Chen
    40. J Huang
    41. MJ Go
    42. ML Stitzel
    43. D Pasko
    44. SCJ Parker
    45. TV Varga
    46. T Green
    47. NL Beer
    48. AG Day-Williams
    49. T Ferreira
    50. T Fingerlin
    51. M Horikoshi
    52. C Hu
    53. I Huh
    54. MK Ikram
    55. BJ Kim
    56. Y Kim
    57. YJ Kim
    58. MS Kwon
    59. J Lee
    60. S Lee
    61. KH Lin
    62. TJ Maxwell
    63. Y Nagai
    64. X Wang
    65. RP Welch
    66. J Yoon
    67. W Zhang
    68. N Barzilai
    69. BF Voight
    70. BG Han
    71. CP Jenkinson
    72. T Kuulasmaa
    73. J Kuusisto
    74. A Manning
    75. MCY Ng
    76. ND Palmer
    77. B Balkau
    78. A Stančáková
    79. HE Abboud
    80. H Boeing
    81. V Giedraitis
    82. D Prabhakaran
    83. O Gottesman
    84. J Scott
    85. J Carey
    86. P Kwan
    87. G Grant
    88. JD Smith
    89. BM Neale
    90. S Purcell
    91. AS Butterworth
    92. JMM Howson
    93. HM Lee
    94. Y Lu
    95. SH Kwak
    96. W Zhao
    97. J Danesh
    98. VKL Lam
    99. KS Park
    100. D Saleheen
    101. WY So
    102. CHT Tam
    103. U Afzal
    104. D Aguilar
    105. R Arya
    106. T Aung
    107. E Chan
    108. C Navarro
    109. CY Cheng
    110. D Palli
    111. A Correa
    112. JE Curran
    113. D Rybin
    114. VS Farook
    115. SP Fowler
    116. BI Freedman
    117. M Griswold
    118. DE Hale
    119. PJ Hicks
    120. CC Khor
    121. S Kumar
    122. B Lehne
    123. D Thuillier
    124. WY Lim
    125. J Liu
    126. YT van der Schouw
    127. M Loh
    128. SK Musani
    129. S Puppala
    130. WR Scott
    131. L Yengo
    132. ST Tan
    133. HA Taylor
    134. F Thameem
    135. G Wilson
    136. TY Wong
    137. PR Njølstad
    138. JC Levy
    139. M Mangino
    140. LL Bonnycastle
    141. T Schwarzmayr
    142. J Fadista
    143. GL Surdulescu
    144. C Herder
    145. CJ Groves
    146. T Wieland
    147. J Bork-Jensen
    148. I Brandslund
    149. C Christensen
    150. HA Koistinen
    151. ASF Doney
    152. L Kinnunen
    153. T Esko
    154. AJ Farmer
    155. L Hakaste
    156. D Hodgkiss
    157. J Kravic
    158. V Lyssenko
    159. M Hollensted
    160. ME Jørgensen
    161. T Jørgensen
    162. C Ladenvall
    163. JM Justesen
    164. A Käräjämäki
    165. J Kriebel
    166. W Rathmann
    167. L Lannfelt
    168. T Lauritzen
    169. N Narisu
    170. A Linneberg
    171. O Melander
    172. L Milani
    173. M Neville
    174. M Orho-Melander
    175. L Qi
    176. Q Qi
    177. M Roden
    178. O Rolandsson
    179. A Swift
    180. AH Rosengren
    181. K Stirrups
    182. AR Wood
    183. E Mihailov
    184. C Blancher
    185. MO Carneiro
    186. J Maguire
    187. R Poplin
    188. K Shakir
    189. T Fennell
    190. M DePristo
    191. MH de Angelis
    192. P Deloukas
    193. AP Gjesing
    194. G Jun
    195. P Nilsson
    196. J Murphy
    197. R Onofrio
    198. B Thorand
    199. T Hansen
    200. C Meisinger
    201. FB Hu
    202. B Isomaa
    203. F Karpe
    204. L Liang
    205. A Peters
    206. C Huth
    207. SP O'Rahilly
    208. CNA Palmer
    209. O Pedersen
    210. R Rauramaa
    211. J Tuomilehto
    212. V Salomaa
    213. RM Watanabe
    214. AC Syvänen
    215. RN Bergman
    216. D Bharadwaj
    217. EP Bottinger
    218. YS Cho
    219. GR Chandak
    220. JCN Chan
    221. KS Chia
    222. MJ Daly
    223. SB Ebrahim
    224. C Langenberg
    225. P Elliott
    226. KA Jablonski
    227. DM Lehman
    228. W Jia
    229. RCW Ma
    230. TI Pollin
    231. M Sandhu
    232. N Tandon
    233. P Froguel
    234. I Barroso
    235. YY Teo
    236. E Zeggini
    237. RJF Loos
    238. KS Small
    239. JS Ried
    240. RA DeFronzo
    241. H Grallert
    242. B Glaser
    243. A Metspalu
    244. NJ Wareham
    245. M Walker
    246. E Banks
    247. C Gieger
    248. E Ingelsson
    249. HK Im
    250. T Illig
    251. PW Franks
    252. G Buck
    253. J Trakalo
    254. D Buck
    255. I Prokopenko
    256. R Mägi
    257. L Lind
    258. Y Farjoun
    259. KR Owen
    260. AL Gloyn
    261. K Strauch
    262. T Tuomi
    263. JS Kooner
    264. JY Lee
    265. T Park
    266. P Donnelly
    267. AD Morris
    268. AT Hattersley
    269. DW Bowden
    270. FS Collins
    271. G Atzmon
    272. JC Chambers
    273. TD Spector
    274. M Laakso
    275. TM Strom
    276. GI Bell
    277. J Blangero
    278. R Duggirala
    279. ES Tai
    280. G McVean
    281. CL Hanis
    282. JG Wilson
    283. M Seielstad
    284. TM Frayling
    285. JB Meigs
    286. NJ Cox
    287. R Sladek
    288. ES Lander
    289. S Gabriel
    290. NP Burtt
    291. KL Mohlke
    292. T Meitinger
    293. L Groop
    294. G Abecasis
    295. JC Florez
    296. LJ Scott
    297. AP Morris
    298. HM Kang
    299. M Boehnke
    300. D Altshuler
    301. MI McCarthy
    (2016)
    Nature 536:41–47.
    https://doi.org/10.1038/nature18642
  25. 25
  26. 26
  27. 27
    Genetic fine mapping and genomic annotation defines causal mechanisms at type 2 diabetes susceptibility loci
    1. KJ Gaulton
    2. T Ferreira
    3. Y Lee
    4. A Raimondo
    5. R Mägi
    6. ME Reschen
    7. A Mahajan
    8. A Locke
    9. NW Rayner
    10. N Robertson
    11. RA Scott
    12. I Prokopenko
    13. LJ Scott
    14. T Green
    15. T Sparso
    16. D Thuillier
    17. L Yengo
    18. H Grallert
    19. S Wahl
    20. M Frånberg
    21. RJ Strawbridge
    22. H Kestler
    23. H Chheda
    24. L Eisele
    25. S Gustafsson
    26. V Steinthorsdottir
    27. G Thorleifsson
    28. L Qi
    29. LC Karssen
    30. EM van Leeuwen
    31. SM Willems
    32. M Li
    33. H Chen
    34. C Fuchsberger
    35. P Kwan
    36. C Ma
    37. M Linderman
    38. Y Lu
    39. SK Thomsen
    40. JK Rundle
    41. NL Beer
    42. M van de Bunt
    43. A Chalisey
    44. HM Kang
    45. BF Voight
    46. GR Abecasis
    47. P Almgren
    48. D Baldassarre
    49. B Balkau
    50. R Benediktsson
    51. M Blüher
    52. H Boeing
    53. LL Bonnycastle
    54. EP Bottinger
    55. NP Burtt
    56. J Carey
    57. G Charpentier
    58. PS Chines
    59. MC Cornelis
    60. DJ Couper
    61. AT Crenshaw
    62. RM van Dam
    63. AS Doney
    64. M Dorkhan
    65. S Edkins
    66. JG Eriksson
    67. T Esko
    68. E Eury
    69. J Fadista
    70. J Flannick
    71. P Fontanillas
    72. C Fox
    73. PW Franks
    74. K Gertow
    75. C Gieger
    76. B Gigante
    77. O Gottesman
    78. GB Grant
    79. N Grarup
    80. CJ Groves
    81. M Hassinen
    82. CT Have
    83. C Herder
    84. OL Holmen
    85. AB Hreidarsson
    86. SE Humphries
    87. DJ Hunter
    88. AU Jackson
    89. A Jonsson
    90. ME Jørgensen
    91. T Jørgensen
    92. WH Kao
    93. ND Kerrison
    94. L Kinnunen
    95. N Klopp
    96. A Kong
    97. P Kovacs
    98. P Kraft
    99. J Kravic
    100. C Langford
    101. K Leander
    102. L Liang
    103. P Lichtner
    104. CM Lindgren
    105. E Lindholm
    106. A Linneberg
    107. CT Liu
    108. S Lobbens
    109. J Luan
    110. V Lyssenko
    111. S Männistö
    112. O McLeod
    113. J Meyer
    114. E Mihailov
    115. G Mirza
    116. TW Mühleisen
    117. M Müller-Nurasyid
    118. C Navarro
    119. MM Nöthen
    120. NN Oskolkov
    121. KR Owen
    122. D Palli
    123. S Pechlivanis
    124. L Peltonen
    125. JR Perry
    126. CG Platou
    127. M Roden
    128. D Ruderfer
    129. D Rybin
    130. YT van der Schouw
    131. B Sennblad
    132. G Sigurðsson
    133. A Stančáková
    134. G Steinbach
    135. P Storm
    136. K Strauch
    137. HM Stringham
    138. Q Sun
    139. B Thorand
    140. E Tikkanen
    141. A Tonjes
    142. J Trakalo
    143. E Tremoli
    144. T Tuomi
    145. R Wennauer
    146. S Wiltshire
    147. AR Wood
    148. E Zeggini
    149. I Dunham
    150. E Birney
    151. L Pasquali
    152. J Ferrer
    153. RJ Loos
    154. J Dupuis
    155. JC Florez
    156. E Boerwinkle
    157. JS Pankow
    158. C van Duijn
    159. E Sijbrands
    160. JB Meigs
    161. FB Hu
    162. U Thorsteinsdottir
    163. K Stefansson
    164. TA Lakka
    165. R Rauramaa
    166. M Stumvoll
    167. NL Pedersen
    168. L Lind
    169. SM Keinanen-Kiukaanniemi
    170. E Korpi-Hyövälti
    171. TE Saaristo
    172. J Saltevo
    173. J Kuusisto
    174. M Laakso
    175. A Metspalu
    176. R Erbel
    177. KH Jöcke
    178. S Moebus
    179. S Ripatti
    180. V Salomaa
    181. E Ingelsson
    182. BO Boehm
    183. RN Bergman
    184. FS Collins
    185. KL Mohlke
    186. H Koistinen
    187. J Tuomilehto
    188. K Hveem
    189. I Njølstad
    190. P Deloukas
    191. PJ Donnelly
    192. TM Frayling
    193. AT Hattersley
    194. U de Faire
    195. A Hamsten
    196. T Illig
    197. A Peters
    198. S Cauchi
    199. R Sladek
    200. P Froguel
    201. T Hansen
    202. O Pedersen
    203. AD Morris
    204. CN Palmer
    205. S Kathiresan
    206. O Melander
    207. PM Nilsson
    208. LC Groop
    209. I Barroso
    210. C Langenberg
    211. NJ Wareham
    212. CA O'Callaghan
    213. AL Gloyn
    214. D Altshuler
    215. M Boehnke
    216. TM Teslovich
    217. MI McCarthy
    218. AP Morris
    219. DIAbetes Genetics Replication And Meta-analysis (DIAGRAM) Consortium
    (2015)
    Nature Genetics 47:1415–1425.
    https://doi.org/10.1038/ng.3437
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
    Genome-wide associations for birth weight and correlations with adult disease
    1. M Horikoshi
    2. RN Beaumont
    3. FR Day
    4. NM Warrington
    5. MN Kooijman
    6. J Fernandez-Tajes
    7. B Feenstra
    8. NR van Zuydam
    9. KJ Gaulton
    10. N Grarup
    11. JP Bradfield
    12. DP Strachan
    13. R Li-Gao
    14. TS Ahluwalia
    15. E Kreiner
    16. R Rueedi
    17. LP Lyytikäinen
    18. DL Cousminer
    19. Y Wu
    20. E Thiering
    21. CA Wang
    22. CT Have
    23. JJ Hottenga
    24. N Vilor-Tejedor
    25. PK Joshi
    26. ETH Boh
    27. I Ntalla
    28. N Pitkänen
    29. A Mahajan
    30. EM van Leeuwen
    31. R Joro
    32. V Lagou
    33. M Nodzenski
    34. LA Diver
    35. KT Zondervan
    36. M Bustamante
    37. P Marques-Vidal
    38. JM Mercader
    39. AJ Bennett
    40. N Rahmioglu
    41. DR Nyholt
    42. RCW Ma
    43. CHT Tam
    44. WH Tam
    45. SK Ganesh
    46. FJ van Rooij
    47. SE Jones
    48. PR Loh
    49. KS Ruth
    50. MA Tuke
    51. J Tyrrell
    52. AR Wood
    53. H Yaghootkar
    54. DM Scholtens
    55. L Paternoster
    56. I Prokopenko
    57. P Kovacs
    58. M Atalay
    59. SM Willems
    60. K Panoutsopoulou
    61. X Wang
    62. L Carstensen
    63. F Geller
    64. KE Schraut
    65. M Murcia
    66. CE van Beijsterveldt
    67. G Willemsen
    68. EVR Appel
    69. CE Fonvig
    70. C Trier
    71. CM Tiesler
    72. M Standl
    73. Z Kutalik
    74. S Bonas-Guarch
    75. DM Hougaard
    76. F Sánchez
    77. D Torrents
    78. J Waage
    79. MV Hollegaard
    80. HG de Haan
    81. FR Rosendaal
    82. C Medina-Gomez
    83. SM Ring
    84. G Hemani
    85. G McMahon
    86. NR Robertson
    87. CJ Groves
    88. C Langenberg
    89. J Luan
    90. RA Scott
    91. JH Zhao
    92. FD Mentch
    93. SM MacKenzie
    94. RM Reynolds
    95. WL Lowe
    96. A Tönjes
    97. M Stumvoll
    98. V Lindi
    99. TA Lakka
    100. CM van Duijn
    101. W Kiess
    102. A Körner
    103. TI Sørensen
    104. H Niinikoski
    105. K Pahkala
    106. OT Raitakari
    107. E Zeggini
    108. GV Dedoussis
    109. YY Teo
    110. SM Saw
    111. M Melbye
    112. H Campbell
    113. JF Wilson
    114. M Vrijheid
    115. EJ de Geus
    116. DI Boomsma
    117. HN Kadarmideen
    118. JC Holm
    119. T Hansen
    120. S Sebert
    121. AT Hattersley
    122. LJ Beilin
    123. JP Newnham
    124. CE Pennell
    125. J Heinrich
    126. LS Adair
    127. JB Borja
    128. KL Mohlke
    129. JG Eriksson
    130. EE Widén
    131. M Kähönen
    132. JS Viikari
    133. T Lehtimäki
    134. P Vollenweider
    135. K Bønnelykke
    136. H Bisgaard
    137. DO Mook-Kanamori
    138. A Hofman
    139. F Rivadeneira
    140. AG Uitterlinden
    141. C Pisinger
    142. O Pedersen
    143. C Power
    144. E Hyppönen
    145. NJ Wareham
    146. H Hakonarson
    147. E Davies
    148. BR Walker
    149. VW Jaddoe
    150. MR Jarvelin
    151. SF Grant
    152. AA Vaag
    153. DA Lawlor
    154. TM Frayling
    155. G Davey Smith
    156. AP Morris
    157. KK Ong
    158. JF Felix
    159. NJ Timpson
    160. JR Perry
    161. DM Evans
    162. MI McCarthy
    163. RM Freathy
    164. CHARGE Consortium Hematology Working Group
    165. Early Growth Genetics (EGG) Consortium
    (2016)
    Nature 538:248–252.
    https://doi.org/10.1038/nature19806
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
    A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance
    1. AK Manning
    2. MF Hivert
    3. RA Scott
    4. JL Grimsby
    5. N Bouatia-Naji
    6. H Chen
    7. D Rybin
    8. CT Liu
    9. LF Bielak
    10. I Prokopenko
    11. N Amin
    12. D Barnes
    13. G Cadby
    14. JJ Hottenga
    15. E Ingelsson
    16. AU Jackson
    17. T Johnson
    18. S Kanoni
    19. C Ladenvall
    20. V Lagou
    21. J Lahti
    22. C Lecoeur
    23. Y Liu
    24. MT Martinez-Larrad
    25. ME Montasser
    26. P Navarro
    27. JR Perry
    28. LJ Rasmussen-Torvik
    29. P Salo
    30. N Sattar
    31. D Shungin
    32. RJ Strawbridge
    33. T Tanaka
    34. CM van Duijn
    35. P An
    36. M de Andrade
    37. JS Andrews
    38. T Aspelund
    39. M Atalay
    40. Y Aulchenko
    41. B Balkau
    42. S Bandinelli
    43. JS Beckmann
    44. JP Beilby
    45. C Bellis
    46. RN Bergman
    47. J Blangero
    48. M Boban
    49. M Boehnke
    50. E Boerwinkle
    51. LL Bonnycastle
    52. DI Boomsma
    53. IB Borecki
    54. Y Böttcher
    55. C Bouchard
    56. E Brunner
    57. D Budimir
    58. H Campbell
    59. O Carlson
    60. PS Chines
    61. R Clarke
    62. FS Collins
    63. A Corbatón-Anchuelo
    64. D Couper
    65. U de Faire
    66. GV Dedoussis
    67. P Deloukas
    68. M Dimitriou
    69. JM Egan
    70. G Eiriksdottir
    71. MR Erdos
    72. JG Eriksson
    73. E Eury
    74. L Ferrucci
    75. I Ford
    76. NG Forouhi
    77. CS Fox
    78. MG Franzosi
    79. PW Franks
    80. TM Frayling
    81. P Froguel
    82. P Galan
    83. E de Geus
    84. B Gigante
    85. NL Glazer
    86. A Goel
    87. L Groop
    88. V Gudnason
    89. G Hallmans
    90. A Hamsten
    91. O Hansson
    92. TB Harris
    93. C Hayward
    94. S Heath
    95. S Hercberg
    96. AA Hicks
    97. A Hingorani
    98. A Hofman
    99. J Hui
    100. J Hung
    101. MR Jarvelin
    102. MA Jhun
    103. PC Johnson
    104. JW Jukema
    105. A Jula
    106. WH Kao
    107. J Kaprio
    108. SL Kardia
    109. S Keinanen-Kiukaanniemi
    110. M Kivimaki
    111. I Kolcic
    112. P Kovacs
    113. M Kumari
    114. J Kuusisto
    115. KO Kyvik
    116. M Laakso
    117. T Lakka
    118. L Lannfelt
    119. GM Lathrop
    120. LJ Launer
    121. K Leander
    122. G Li
    123. L Lind
    124. J Lindstrom
    125. S Lobbens
    126. RJ Loos
    127. J Luan
    128. V Lyssenko
    129. R Mägi
    130. PK Magnusson
    131. M Marmot
    132. P Meneton
    133. KL Mohlke
    134. V Mooser
    135. MA Morken
    136. I Miljkovic
    137. N Narisu
    138. J O'Connell
    139. KK Ong
    140. BA Oostra
    141. LJ Palmer
    142. A Palotie
    143. JS Pankow
    144. JF Peden
    145. NL Pedersen
    146. M Pehlic
    147. L Peltonen
    148. B Penninx
    149. M Pericic
    150. M Perola
    151. L Perusse
    152. PA Peyser
    153. O Polasek
    154. PP Pramstaller
    155. MA Province
    156. K Räikkönen
    157. R Rauramaa
    158. E Rehnberg
    159. K Rice
    160. JI Rotter
    161. I Rudan
    162. A Ruokonen
    163. T Saaristo
    164. M Sabater-Lleal
    165. V Salomaa
    166. DB Savage
    167. R Saxena
    168. P Schwarz
    169. U Seedorf
    170. B Sennblad
    171. M Serrano-Rios
    172. AR Shuldiner
    173. EJ Sijbrands
    174. DS Siscovick
    175. JH Smit
    176. KS Small
    177. NL Smith
    178. AV Smith
    179. A Stančáková
    180. K Stirrups
    181. M Stumvoll
    182. YV Sun
    183. AJ Swift
    184. A Tönjes
    185. J Tuomilehto
    186. S Trompet
    187. AG Uitterlinden
    188. M Uusitupa
    189. M Vikström
    190. V Vitart
    191. MC Vohl
    192. BF Voight
    193. P Vollenweider
    194. G Waeber
    195. DM Waterworth
    196. H Watkins
    197. E Wheeler
    198. E Widen
    199. SH Wild
    200. SM Willems
    201. G Willemsen
    202. JF Wilson
    203. JC Witteman
    204. AF Wright
    205. H Yaghootkar
    206. D Zelenika
    207. T Zemunik
    208. L Zgaga
    209. NJ Wareham
    210. MI McCarthy
    211. I Barroso
    212. RM Watanabe
    213. JC Florez
    214. J Dupuis
    215. JB Meigs
    216. C Langenberg
    217. DIAbetes Genetics Replication And Meta-analysis (DIAGRAM) Consortium
    218. Multiple Tissue Human Expression Resource (MUTHER) Consortium
    (2012)
    Nature Genetics 44:659–669.
    https://doi.org/10.1038/ng.2274
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
    Genetic variation in GIPR influences the glucose and insulin responses to an oral glucose challenge
    1. R Saxena
    2. MF Hivert
    3. C Langenberg
    4. T Tanaka
    5. JS Pankow
    6. P Vollenweider
    7. V Lyssenko
    8. N Bouatia-Naji
    9. J Dupuis
    10. AU Jackson
    11. WH Kao
    12. M Li
    13. NL Glazer
    14. AK Manning
    15. J Luan
    16. HM Stringham
    17. I Prokopenko
    18. T Johnson
    19. N Grarup
    20. TW Boesgaard
    21. C Lecoeur
    22. P Shrader
    23. J O'Connell
    24. E Ingelsson
    25. DJ Couper
    26. K Rice
    27. K Song
    28. CH Andreasen
    29. C Dina
    30. A Köttgen
    31. O Le Bacquer
    32. F Pattou
    33. J Taneera
    34. V Steinthorsdottir
    35. D Rybin
    36. K Ardlie
    37. M Sampson
    38. L Qi
    39. M van Hoek
    40. MN Weedon
    41. YS Aulchenko
    42. BF Voight
    43. H Grallert
    44. B Balkau
    45. RN Bergman
    46. SJ Bielinski
    47. A Bonnefond
    48. LL Bonnycastle
    49. K Borch-Johnsen
    50. Y Böttcher
    51. E Brunner
    52. TA Buchanan
    53. SJ Bumpstead
    54. C Cavalcanti-Proença
    55. G Charpentier
    56. YD Chen
    57. PS Chines
    58. FS Collins
    59. M Cornelis
    60. G J Crawford
    61. J Delplanque
    62. A Doney
    63. JM Egan
    64. MR Erdos
    65. M Firmann
    66. NG Forouhi
    67. CS Fox
    68. MO Goodarzi
    69. J Graessler
    70. A Hingorani
    71. B Isomaa
    72. T Jørgensen
    73. M Kivimaki
    74. P Kovacs
    75. K Krohn
    76. M Kumari
    77. T Lauritzen
    78. C Lévy-Marchal
    79. V Mayor
    80. JB McAteer
    81. D Meyre
    82. BD Mitchell
    83. KL Mohlke
    84. MA Morken
    85. N Narisu
    86. CN Palmer
    87. R Pakyz
    88. L Pascoe
    89. F Payne
    90. D Pearson
    91. W Rathmann
    92. A Sandbaek
    93. AA Sayer
    94. LJ Scott
    95. SJ Sharp
    96. E Sijbrands
    97. A Singleton
    98. DS Siscovick
    99. NL Smith
    100. T Sparsø
    101. AJ Swift
    102. H Syddall
    103. G Thorleifsson
    104. A Tönjes
    105. T Tuomi
    106. J Tuomilehto
    107. TT Valle
    108. G Waeber
    109. A Walley
    110. DM Waterworth
    111. E Zeggini
    112. JH Zhao
    113. T Illig
    114. HE Wichmann
    115. JF Wilson
    116. C van Duijn
    117. FB Hu
    118. AD Morris
    119. TM Frayling
    120. AT Hattersley
    121. U Thorsteinsdottir
    122. K Stefansson
    123. P Nilsson
    124. AC Syvänen
    125. AR Shuldiner
    126. M Walker
    127. SR Bornstein
    128. P Schwarz
    129. GH Williams
    130. DM Nathan
    131. J Kuusisto
    132. M Laakso
    133. C Cooper
    134. M Marmot
    135. L Ferrucci
    136. V Mooser
    137. M Stumvoll
    138. RJ Loos
    139. D Altshuler
    140. BM Psaty
    141. JI Rotter
    142. E Boerwinkle
    143. T Hansen
    144. O Pedersen
    145. JC Florez
    146. MI McCarthy
    147. M Boehnke
    148. I Barroso
    149. R Sladek
    150. P Froguel
    151. JB Meigs
    152. L Groop
    153. NJ Wareham
    154. RM Watanabe
    155. GIANT consortium
    156. MAGIC investigators
    (2010)
    Nature Genetics 42:142–148.
    https://doi.org/10.1038/ng.521
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
    A novel common variant in DCST2 is associated with length in early life and height in adulthood
    1. RJ van der Valk
    2. E Kreiner-Møller
    3. MN Kooijman
    4. M Guxens
    5. E Stergiakouli
    6. A Sääf
    7. JP Bradfield
    8. F Geller
    9. MG Hayes
    10. DL Cousminer
    11. A Körner
    12. E Thiering
    13. JA Curtin
    14. R Myhre
    15. V Huikari
    16. R Joro
    17. M Kerkhof
    18. NM Warrington
    19. N Pitkänen
    20. I Ntalla
    21. M Horikoshi
    22. R Veijola
    23. RM Freathy
    24. YY Teo
    25. SJ Barton
    26. DM Evans
    27. JP Kemp
    28. B St Pourcain
    29. SM Ring
    30. G Davey Smith
    31. A Bergström
    32. I Kull
    33. H Hakonarson
    34. FD Mentch
    35. H Bisgaard
    36. B Chawes
    37. J Stokholm
    38. J Waage
    39. P Eriksen
    40. A Sevelsted
    41. M Melbye
    42. CM van Duijn
    43. C Medina-Gomez
    44. A Hofman
    45. JC de Jongste
    46. HR Taal
    47. AG Uitterlinden
    48. LL Armstrong
    49. J Eriksson
    50. A Palotie
    51. M Bustamante
    52. X Estivill
    53. JR Gonzalez
    54. S Llop
    55. W Kiess
    56. A Mahajan
    57. C Flexeder
    58. CM Tiesler
    59. CS Murray
    60. A Simpson
    61. P Magnus
    62. V Sengpiel
    63. AL Hartikainen
    64. S Keinanen-Kiukaanniemi
    65. A Lewin
    66. A Da Silva Couto Alves
    67. AI Blakemore
    68. JL Buxton
    69. M Kaakinen
    70. A Rodriguez
    71. S Sebert
    72. M Vaarasmaki
    73. T Lakka
    74. V Lindi
    75. U Gehring
    76. DS Postma
    77. W Ang
    78. JP Newnham
    79. LP Lyytikäinen
    80. K Pahkala
    81. OT Raitakari
    82. K Panoutsopoulou
    83. E Zeggini
    84. DI Boomsma
    85. M Groen-Blokhuis
    86. J Ilonen
    87. L Franke
    88. JN Hirschhorn
    89. TH Pers
    90. L Liang
    91. J Huang
    92. B Hocher
    93. M Knip
    94. SM Saw
    95. JW Holloway
    96. E Melén
    97. SF Grant
    98. B Feenstra
    99. WL Lowe
    100. E Widén
    101. E Sergeyev
    102. H Grallert
    103. A Custovic
    104. B Jacobsson
    105. MR Jarvelin
    106. M Atalay
    107. GH Koppelman
    108. CE Pennell
    109. H Niinikoski
    110. GV Dedoussis
    111. MI Mccarthy
    112. TM Frayling
    113. J Sunyer
    114. NJ Timpson
    115. F Rivadeneira
    116. K Bønnelykke
    117. VW Jaddoe
    118. Early Genetics and Lifecourse Epidemiology (EAGLE) Consortium
    119. Genetic Investigation of ANthropometric Traits (GIANT) Consortium
    120. Early Growth Genetics (EGG) Consortium
    (2015)
    Human Molecular Genetics 24:1155–1168.
    https://doi.org/10.1093/hmg/ddu510
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90