Rdh54/Tid1 inhibits Rad51-Rad54-mediated D-loop formation and limits D-loop length
- Department of Microbiology and Molecular Genetics, University of California, Davis, United States
- Department of Molecular and Cellular Biology, University of California, Davis, United States
- CR CNRS UMR5239, Team Genome Mechanics, Laboratory of Biology and Modelling of the Cell, Ecole Normale Supérieure de Lyon 46, France
- Mammoth Biosciences, United States
Figures
Figure 1 with 1 supplement
Tid1 inhibits D-loop formation in vitro in a concentration-dependent and an ATPase-independent manner.
(A) Reaction scheme for in vitro D-loop formation assays in presence of Tid1 or the ATPase-defective Tid1-K318R. Here and in all subsequent figures, unless otherwise stated, incubations were in the …
Figure 1—figure supplement 1
Tid1 by itself stimulates Rad51-mediated D-loops, while inhibits Rad54-mediated D-loops.
(A, B) Denville-Blue-stained SDS-PAGE gel showing purified GST-Tid1 and GST-Tid1-KR, respectively. (C, D) Absolute quantitation of D-loops from the gels in Figure 1B and D, without any …
Figure 2 with 1 supplement
Tid1 competes with Rad54 activity and does not inhibit D-loops after they are formed.
(A) Reaction scheme depicting various Rad54 concentrations, along with Tid1-KR titration in an in vitro D-loop assay. (B) SYBR gold stain of gel showing D-loop reaction performed with varying Rad54 …
Figure 2—figure supplement 1
Tid1 competes with Rad54 to inhibit D-loops before they are formed and inhibits Rad54’s ATPase activity.
(A) On the left is the reaction schemes for different timings of Tid1-KR addition with respect to dsDNA and Rad54, each denoted by a colored bar (same as in Figure 2D). On the right is a …
Figure 3
Tid1 affects D-loops in vivo in a concentration dependent manner.
(A) Western blots showing staining with anti-Tid1 or anti-GAPDH antibodies. The band depicting endogenous Tid1 protein (107.9 kDa mol. wt.) is indicated by a red dot. The position of Tid1 was …
Figure 4 with 1 supplement
Single-molecule D-loop Mapping Assay to map D-loop length, position and distribution in vitro.
(A) Schematic of the D-loop Mapping Assay using D-loops formed on linear donors in vitro as described in Figure 1A as the starting input (for details, see Materials and methods; Shah et al., 2020). …
Figure 4—figure supplement 1
D-loops formed with various length substrates.
(A) Footprint map of reads from the bottom strand of dsDNA donor from the ds98-931 D-loop reaction. Lack of red lines indicates lack of D-loop footprints on the bottom strand. Since <5 reads had a …
Figure 5 with 3 supplements
Tid1-KR restricts formation of longer D-loops.
(A) Gel stained with SYBR gold depicting D-loops formed with decreasing concentrations of Rad51. (B) Quantitation of D-loops from the gel in (A), where 1 Rad51 to 3 nt (Rad51: nt = 1:3) is a …
Figure 5—figure supplement 1
Changes in Rad51 concentration does not significantly alter D-loop characteristics in the D-loop Mapping Assay.
(A) Footprint maps of D-loop footprints from the top strand reads for D-loops formed in presence of varying Rad51 concentrations. To form the D-loops, ds98-931 substrate and a linear donor were …
Figure 5—figure supplement 2
Tid1-KR limits D-loop length but does not alter the distribution of D-loop position.
(A) SYBR-gold-stained gel depicting D-loops formed in presence of Rad51: nt = 1:12, Tid1-KR titration and linear dsDNA. The same D-loop samples were used for the D-loop Mapping Assay (in Figure 5C, D…
Figure 5—figure supplement 3
Tid1 limits D-loop length.
(A) Footprint map of D-loop footprints from the top strand reads of D-loop samples formed in presence of increasing concentration of Tid1 and ds98-931 substrate. The reads were clustered based on …
Figure 6
Tid1 affects kinetics of D-loop extension and cell survival depending on the length of homology between the donor and MAT during mating type switch.
(A) Schematic of the primer extension assay adopted from Mehta et al., 2017. Homology length to the invading Z-end (green) was altered at HML to be either 148 bp or 2216 bp. Arrowhead indicates HO-cu…
Figure 7
Model: Tid1 competes with Rad54 in binding to the filament ends, limits D-loop length and may promote non-crossover outcome.
(A) Model depicts Tid1 competing with Rad54 for binding to Rad51 filament ends either at pre-synaptic or post-synaptic stage. Since Rad51 is not as cooperative as its bacterial homolog, RecA (Gallett…
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae) | See Supplementary file 1 | |||
| Antibody | Tid1 antibody (rabbit polyclonal) | Heyer laboratory | 1:200 | |
| Antibody | GAPDH antibody (mouse monoclonal) | Invitrogen | Catalog: #MA5-15738 | 1:5000 |
| Recombinant DNA reagent | pWDH597 | Wright and Heyer, 2014 | Amp, URA3 markers | Plasmid for overexpression of S. cerevisiae Tid1/Tid1-KR N-terminally tagged with GST, removable by cleavage with PreScission protease. |
| Recombinant DNA reagent | pUC19 | Addgene | Catalog: #50005 | Plasmid used to test topoisomerase contamination of purified protein |
| Recombinant DNA reagent | pBSphix1200 | Wright and Heyer, 2014 | Amp | Plasmid used as dsDNA donor in D-loop assay in supercoiled or linear form |
| Sequence-based reagent | 100-mer | Wright and Heyer, 2014 | ctggtcataatcatggtggcgaataagtacgcgttcttgcaaatcaccagaaggcggttcctgaatgaatgggaagccttcaagaaggtgataagcagga | |
| Sequence-based reagent | ds98-197-78ss | Wright and Heyer, 2014 | Homologous sequence, 197 nt: ctggtcataatcatggtggcgaataagtacgcgttcttgcaaatcaccagaaggcggttcctgaatgaatgggaagccttcaagaaggtgataagcaggagaaacatacgaaggcgcataacgataccactgaccctcagcaatcttaaacttcttagacgaatcaccagaacggaaaacatccttcatagaaattt | |
| Sequence-based reagent | ds98-607 | Wright and Heyer, 2014 | Homologous sequence, 607 nt: gaagtcatgattgaatcgcgagtggtcggcagattgcgataaacggtcacattaaatttaacctgactattccactgcaacaactgaacggactggaaacactggtcataatcatggtggcgaataagtacgcgttcttgcaaatcaccagaaggcggttcctgaatgaatgggaagccttcaagaaggtgataagcaggagaaacatacgaaggcgcataacgataccactgaccctcagcaatcttaaacttcttagacgaatcaccagaacggaaaacatccttcatagaaatttcacgcggcggcaagttgccatacaaaacagggtcgccagcaatatcggtataagtcaaagcacctttagcgttaaggtactgaatctctttagtcgcagtaggcggaaaacgaacaagcgcaagagtaaacatagtgccatgctcaggaacaaagaaacgcggcacagaatgtttataggtctgttgaacacgaccagaaaactggcctaacgacgtttggtcagttccatcaacatcatagccagatgcccagagattagagcgcatgacaagtaaaggacggttgtcagcgtcataagaggttttac | |
| Sequence-based reagent | ds98-931 | Heyer laboratory | Homologous sequence, 931 nt: gaacggaaaacatccttcatagaaatttcacgcggcggcaagttgccatacaaaacagggtcgccagcaatatcggtataagtcaaagcacctttagcgttaaggtactgaatctctttagtcgcagtaggcggaaaacgaacaagcgcaagagtaaacatagtgccatgctcaggaacaaagaaacgcggcacagaatgtttataggtctgttgaacacgaccagaaaactggcctaacgacgtttggtcagttccatcaacatcatagccagatgcccagagattagagcgcatgacaagtaaaggacggttgtcagcgtcataagaggttttacctccaaatgaagaaataacatcatggtaacgctgcatgaagtaatcacgttcttggtcagtatgcaaattagcataagcagcttgcagacccataatgtcaatagatgtggtagaagtcgtcatttggcgagaaagctcagtctcaggaggaagcggagcagtccaaatgtttttgagatggcagcaacggaaaccataacgagcatcatcttgattaagctcattagggttagcctcggtacggtcaggcatccacggcgctttaaaatagttgttatagatattcaaataaccctgaaacaaatgcttagggattttattggtatcagggttaatcgtgccaagaaaagcggcatggtcaatataaccagtagtgttaacagtcgggagaggagtggcattaacaccatccttcatgaacttaatccactgttcaccataaacgtgacgatgagggacataaaaagtaaaaatgtctacagtagagtcaatagcaaggccacgacgcaatggagaaagacggagagcgccaacggcgtccatctcgaaggagtcgccagcgataaccggagtagttgaaatggtaataagac | |
| Sequence-based reagent | ds98-915 | Heyer laboratory | Homologous sequence, 915 nt: gaagtcatgattgaatcgcgagtggtcggcagattgcgataaacggtcacattaaatttaacctgactattccactgcaacaactgaacggactggaaacactggtcataatcatggtggcgaataagtacgcgttcttgcaaatcaccagaaggcggttcctgaatgaatgggaagccttcaagaaggtgataagcaggagaaacatacgaaggcgcataacgataccactgaccctcagcaatcttaaacttcttagacgaatcaccagaacggaaaacatccttcatagaaatttcacgcggcggcaagttgccatacaaaacagggtcgccagcaatatcggtataagtcaaagcacctttagcgttaaggtactgaatctctttagtcgcagtaggcggaaaacgaacaagcgcaagagtaaacatagtgccatgctcaggaacaaagaaacgcggcacagaatgtttataggtctgttgaacacgaccagaaaactggcctaacgacgtttggtcagttccatcaacatcatagccagatgcccagagattagagcgcatgacaagtaaaggacggttgtcagcgtcataagaggttttacctccaaatgaagaaataacatcatggtaacgctgcatgaagtaatcacgttcttggtcagtatgcaaattagcataagcagcttgcagacccataatgtcaatagatgtggtagaagtcgtcatttggcgagaaagctcagtctcaggaggaagcggagcagtccaaatgtttttgagatggcagcaacggaaaccataacgagcatcatcttgattaagctcattagggttagcctcggtacggtcaggcatccacggcgctttaaaatagttgttatagatattcaaataaccctgaaacaaatgc | |
| Sequence-based reagent | ds98-915-78ss | Heyer laboratory | Homologous sequence, 915 nt: gaagtcatgattgaatcgcgagtggtcggcagattgcgataaacggtcacattaaatttaacctgactattccactgcaacaactgaacggactggaaacactggtcataatcatggtggcgaataagtacgcgttcttgcaaatcaccagaaggcggttcctgaatgaatgggaagccttcaagaaggtgataagcaggagaaacatacgaaggcgcataacgataccactgaccctcagcaatcttaaacttcttagacgaatcaccagaacggaaaacatccttcatagaaatttcacgcggcggcaagttgccatacaaaacagggtcgccagcaatatcggtataagtcaaagcacctttagcgttaaggtactgaatctctttagtcgcagtaggcggaaaacgaacaagcgcaagagtaaacatagtgccatgctcaggaacaaagaaacgcggcacagaatgtttataggtctgttgaacacgaccagaaaactggcctaacgacgtttggtcagttccatcaacatcatagccagatgcccagagattagagcgcatgacaagtaaaggacggttgtcagcgtcataagaggttttacctccaaatgaagaaataacatcatggtaacgctgcatgaagtaatcacgttcttggtcagtatgcaaattagcataagcagcttgcagacccataatgtcaatagatgtggtagaagtcgtcatttggcgagaaagctcagtctcaggaggaagcggagcagtccaaatgtttttgagatggcagcaacggaaaccataacgagcatcatcttgattaagctcattagggttagcctcggtacggtcaggcatccacggcgctttaaaatagttgttatagatattcaaataaccctgaaacaaatgc | |
| Sequence-based reagent | HOCSp3; MATp13 | Mehta et al., 2017 | Primer pair for measuring extension of D-loops. HOCsp3: GACAAAATGCAGCACGGAAT MATp13: GTTAAGATAAGAACAAAGAAgGATGCT | |
| Sequence-based reagent | olWDH1760 olWDH1761 | Piazza et al., 2019 | Primer pair for reference locus ARG4 on Ch. VIII. olWDH1760: AGACAGAATTGGCAAAGATCC olWDH1761: GGCCAATTAGTTCACCAAGACG | |
| Sequence-based reagent | olWDH1766 olWDH1767 | Piazza et al., 2019 | Primer pair for measuring dsDNA integrity at the HOcs. olWDH1766: GTTTCAGCTTTCCGCAACAG olWDH1767: GGCGAGGTATTGGATAGTTCC | |
| Peptide, recombinant protein | GST-Tid1 | Nimonkar et al., 2007 | ||
| Peptide, recombinant protein | GST-Tid1-K318R | Nimonkar et al., 2007 | ||
| Peptide, recombinant protein | Rad54 | Wright and Heyer, 2014 | ||
| Peptide, recombinant protein | Rad51 | Van Komen et al., 2006 | ||
| Peptide, recombinant protein | RPA | Binz et al., 2006 | ||
| Peptide, recombinant protein | Bsa1 | New England Biolabs | Catalog: #R0535S | To linearize pBSphix1200 |
| Peptide, recombinant protein | T4 Polynucleotide kinase | New England Biolabs | Catalog: #M0201S | |
| Peptide, recombinant protein | Phusion-U polymerase | Thermo Fischer | Catalog: #PN-F555S | |
| Chemical compound, drug | NADH | Sigma | Catalog: #606-68-6 | ATPase assay |
| Chemical compound, drug | Sera-Mag SpeedBead Carboxylate-Modified Magnetic particles, hydrophobic | Sigma | Catalog: #PN-65152105050250 | DMA |
| Chemical compound, drug | AMPure PB | Pacific Biosciences | Catalog: #100-265-900 | DMA |
| Commercial assay or kit | Baker Flex, Cellulose PEI-F | Fischer Scientific | Catalog: #9004-34-6 | ATPase assay |
| Commercial assay or kit | Epitect Bisulfite kit | Qiagen | Catalog: #59104 | DMA |
| Commercial assay or kit | SMRTbell Template Prep Kit 1.0 | Pacific Biosciences | Catalog: #100-259-100 | DMA |
Additional files
-
Source data 1
Source data for all the figures.
- https://cdn.elifesciences.org/articles/59112/elife-59112-data1-v2.xlsx
-
Supplementary file 1
Saccharomyces cerevisiae strains used in this work.
1 W303 strain background. 2 S288c strain background. 3 Obtained from Mehta et al., 2017.
- https://cdn.elifesciences.org/articles/59112/elife-59112-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/59112/elife-59112-transrepform-v2.docx
