1. Biochemistry and Chemical Biology
  2. Cell Biology

Peroxiredoxin promotes longevity and H2O2-resistance in yeast through redox-modulation of protein kinase A

  1. Friederike Roger
  2. Cecilia Picazo
  3. Wolfgang Reiter
  4. Marouane Libiad
  5. Chikako Asami
  6. Sarah Hanzén
  7. Chunxia Gao
  8. Gilles Lagniel
  9. Niek Welkenhuysen
  10. Jean Labarre
  11. Thomas Nyström
  12. Morten Grøtli
  13. Markus Hartl
  14. Michel B Toledano
  15. Mikael Molin  Is a corresponding author
  1. Department of Chemistry and Molecular Biology, University of Gothenburg, Sweden
  2. Department of Biology and Biological Engineering, Chalmers University of Technology, Sweden
  3. Mass Spectrometry Facility, Department of Biochemistry, Max F. Perutz Laboratories, University of Vienna, Vienna BioCenter, Austria
  4. Oxidative Stress and Cancer Laboratory, Université Paris-Saclay, CEA, CNRS, Institute for Integrative Biology of the Cell (I2BC), France
  5. Oxidative Stress and Cancer Laboratory, Integrative Biology and Molecular Genetics Unit (SBIGEM), France
  6. Department of Mathematical Sciences, Chalmers University of Technology and University of Gothenburg, Sweden
  7. Department of Microbiology and Immunology, Institute for Biomedicine, Sahlgrenska Academy, University of Gothenburg, Sweden
https://doi.org/10.7554/eLife.60346
Share this article
Cite this article
  1. Friederike Roger
  2. Cecilia Picazo
  3. Wolfgang Reiter
  4. Marouane Libiad
  5. Chikako Asami
  6. Sarah Hanzén
  7. Chunxia Gao
  8. Gilles Lagniel
  9. Niek Welkenhuysen
  10. Jean Labarre
  11. Thomas Nyström
  12. Morten Grøtli
  13. Markus Hartl
  14. Michel B Toledano
  15. Mikael Molin
(2020)
Peroxiredoxin promotes longevity and H2O2-resistance in yeast through redox-modulation of protein kinase A
eLife 9:e60346.
https://doi.org/10.7554/eLife.60346
  2. Download BibTeX
  3. Download .RIS
6 figures, 1 table and 2 additional files

Figures

Figure 1
Download asset Open asset
The 2-cys peroxiredoxin Tsa1 slows down aging via inhibiting protein kinase A signaling.

(A) Overview of the Ras-cAMP-PKA signaling pathway. In blue stimulatory components and in red inhibitory. (B) Lifespans of cells expressing an extra copy of the TSA1 gene or not (vector control) in combination with the deletion of PDE2 to induce high PKA signaling (pde2Δ). (C) Accumulation of glycogen in vector control cells or cells expressing an extra copy of the TSA1 gene as assayed by iodine vapor. (D) Expression of Hsp12 in the indicated mutant strains (n = 3). (E–F) Lifespan of cells lacking Tsa1, Ras2, Pde2 or combinations thereof.

Figure 2 with 1 supplement
Download asset Open asset
The Tsa1 catalytic cysteines affect protein kinase A dependent proliferation downstream of cAMP but not downstream of the catalytic subunits.

(A) Growth of cells lacking Ras2, Tsa1 or both (n = 3, error bars indicate SD). (B–C) Growth of cells overexpressing IRA2 in the indicated mutants of the Tsa1 catalytic cycle or the PKA signaling pathway on solid (B) or in liquid medium (C), n = 3–15). (D) Expression of the PKA repressed CTT1 or HSP12 genes in the indicated mutants in the Tsa1 catalytic cycle overexpressing IRA2 (mc-IRA2) or not (instead expressing the vector, control, n = 3 ± SD) sampled during mid-exponential growth. (E) Growth of Tsa1-proficient or deficient (tsa1Δ) cells overexpressing IRA2 (mc-IRA2) or PDE2 (mc-PDE2), both or the corresponding vector control plasmids (control) in liquid medium (n = 3 ± SD). (F) Spore germination in cells deficient in Ras1, Ras2, Tsa1 or combinations thereof. Spore germination was estimated in 32 tetrads where genotypes could be assigned to all spores (128 in total, 8–23 spores per genotype). (G) Total time of nuclear Msn2 localization in the indicated mutant strains for 60 min following the addition of 0.3 mM H2O2 (n = 46–82). (H–I) Ras-GTP (H) or cAMP (I) levels in the wild-type or the indicated mutant strains overexpressing IRA2 (mc-IRA2) or not (expressing the vector control, control, n = 3). (J) Phosphorylation of the ectopic AKAR4 PKA site upon H2O2 addition (0.4 mM) in wt, tsa1Δ and trx1Δtrx2Δ cells. (n = 85, 71 and 32, respectively). Error bars indicate SD.

Figure 2—figure supplement 1
Download asset Open asset
Tsa1 and the cytosolic thioredoxins Trx1 and Trx2 impact on PKA related growth signaling but lack of Tsa1 cannot overcome the requirement for a PKA catalytic subunit for spore viability.

(A-B) Growth of cells expressing the oncogenic RAS2G19V allele, overexpressing IRA2 (mc-IRA2) or both. (C) Spore viability in mutants segregating in a tsa1Δ x tpk1Δtpk2Δtpk3Δ mutant cross. The tpk1Δtpk2DΔtpk3Δ mutant was kept alive by a Tpk1-expressing plasmid (pRS313-TPK1). Spore viability was estimated in 43 tetrads where genotypes could be assigned to all spores (172 spores in total and in 8-15 spores per genotype). (D) Expression of PKA repressed Msn2/4 targets (Hasan et al., 2002; Molin et al., 2011) in wild-type, tsa1Δ or trx1Δtrx2Δ cells deficient in RAS2 (ras2Δ) or not (RAS2).

Figure 3 with 1 supplement
Download asset Open asset
Tsa1 catalytic cysteines slow down aging and increase H2O2-resistance via inhibiting protein kinase A.

(A) Life spans of wild-type or the indicated genomic tsa1 mutant strains. In brackets median life-spans and n. (B) Spot-test assay of growth in the presence and absence of 1.5 mM H2O2 in YPD plates. (C) Quantification of H2O2 resistance in (B) (n = 3). (D) H2O2 resistance (1.5 mM H2O2, YPD medium) in the indicated mutants (n = 3). (E) H2O2 resistance in cells overexpressing IRA2 (mc-IRA2 +) or vector control (-) 0.4 mM H2O2, SD medium (n = 3). (F) Culture medium H2O2 removal assay of wt (black) and tsa1Δ cells (blue) to which 200 μM was added. Inset shows average scavenging rates for cultures upon the addition of 400 μM (n = 3). Error bars indicate SD. (G) Average HyPer3 (red) or HyPer3 C199S (black) fluorescence ratio (500 nm/420 nm) in young or aged wild-type or tsa1Δ cells +/- 400 μM H2O2 for 10 min. Cells of about 10–12 generations of replicative age (aged) or young control cells (young) were assayed. Error bars indicate SEM (n = 231, 170, 319, 236 and 202, respectively). (H) Average HyPer3 (red) or HyPer3 C199S (black) fluorescence ratio (500 nm/420 nm) in young or aged wild-type (YMM130) and o/e TSA1 cells as in (G) Error bars indicate SEM (n = 404, 579, 190 and 204, respectively).

Figure 3—figure supplement 1
Download asset Open asset
Reduced Ras activity can overcome H2O2 sensitivity of cells lacking Tsa1 but not that of cell lacking the cytosolic thioredoxins Trx1 and Trx2.

(A) H2O2 resistance in the indicated mutant strains strains grown to mid exponential phase (OD 0.3) and spotted onto plates with or without the indicated amounts of H2O2. (B) H2O2 resistance in the indicated mutant strains strains grown to early (OD0.01) and mid exponential phase (OD0.5) and spotted onto plates with or without the indicated amounts of H2O2.

Figure 4 with 1 supplement
Download asset Open asset
Tsa1 interacts with the PKA catalytic subunit Tpk1 and stimulates Tpk1 cysteine sulfenylation by H2O2.

Tpk1 is glutathionylated at a conserved cysteine. (A) Tpk1 interacts with myc-Tsa1 in a coimmunoprecipitation assay and in a manner strongly stimulated by H2O2. (B) MS-MS spectrum showing the matching b-ion (blue) and y-ion (red) series following fragmentation of the Thr241 phosphorylated and C243 glutathionylated peptide encompassing amino acid residues Y239-K261 in Tpk1. T-P = phospho threonine, C-SSG = glutathionylated cysteine. (C) PRM-based quantification of the indicated Thr241 and Cys243 containing Y239-K261 peptides in Tpk1, in the absence or presence of the indicated amount of H2O2, respectively (n = 3). Error bars indicate SD. (D) DYn-2 assay showing Tpk1 cysteine sulfenylation in the presence and absence of TSA1 and +/- 0.5 mM H2O2 for 5 min. Tpk1-HB was immunoprecipitated from tpk2Δtpk3Δ (TSA1) and tpk2Δtpk3Δtsa1Δ (tsa1Δ) cells and analyzed in gel for cyanine5 fluorescence. (E–F) Glutathionylation of Tpk1-HB in strains in (D) as assayed by anti-glutathione immunoblot of immunoprecipitated Tpk1-HB in the absence of or 10 min following the addition of 0.4 mM H2O2. Extracts were separated under non-reducing conditions (n = 3).

Figure 4—figure supplement 1
Download asset Open asset
Tsa1 interacts with the PKA catalytic subunits Tpk1, controls Tpk1 cysteine sulfenylation independent on disulphide formation and a significant proportion of Tpk1 cysteines are glutathionylated under basal conditions.

(A) Tsa1 interacts with Tpk1 in a Ni2+-sepharose coimmunoprecipitation assay (Tpk1-HB tpk2Δtpk3Δ strain or tpk1Δtpk3Δ strain used as a negative control). An arrow indicates the Tpk1 specific band, whereas * indicates an unspecific band. (B-C) Bcy1 (B) or Tpk1 (C) redox immunoblots of protein extracts isolated from the indicated thioredoxin mutant strains in the absence of stress (H2O2 -) or following the addition of 0.4 mM H2O2 for 20 min (H2O2 +). NR = non-reducing R = reducing CS = trx2C34S SS = trx2C31SC34S. (D) Tpk1 redox immunoblots of protein extracts isolated from the indicated myc-tsa1 mutant strains in the absence of stress (Time in H2O2 = 0) or 10 or 120 min following the addition of 0.4 mM H2O2. (E, G) Mass-shifts in peptides covering the indicated Tpk1 cysteines detected using unbiased open search approaches. Tpk1-Cys195 denotes the F189-K204 peptide whereas Tpk1-Cys243 the Y239-K261 peptide. (F) PRM-based quantification of the indicated C195 containing Tpk1 peptides (n=3). Error bars indicate SD. (H) PRM-based quantification of the Thr241 phosphorylated and Cys243 sulfinic acid containing Y239-K261 peptide in Tpk1 (n=3). Error bars indicate SD. (I) DYn-2 sulfenylation assay depicting oxidation of Tpk1 following the addition of 0.5 mM of H2O2 for 5 min or not in the presence and absence of TSA1. Tpk1-HB was immunoprecipitated from tpk2Δtpk3Δ (TSA1) and tpk2Δtpk3Δ tpk2Δtsa1Δ (tsa1Δ) cells and analyzed in gel for cyanine5 fluorescence. Arrows indicate Tpk1. Coomassie staining was used to assess total protein used in the assay.

Figure 5 with 1 supplement
Download asset Open asset
Tpk1 Cys243 redox-modification and Tsa1 inhibits PKA activity by dephosphorylating and destabilizing the activation loop.

(A–B) H2O2 resistance of the wild-type vector control (A, pRS313 or B, pRS403) or the indicated tsa1- or tpk-mutant strains in SD medium, 0.6 mM H2O2. Strains in (B) carry pRS316-TPK1 or pRS316-tpk1C243A as the only PKA catalytic subunit peroxiredoxin Tsa1 slows down (genomic tpk1Δtpk2Δtpk3Δ deletions, n = 3). (C) H2O2 resistance of tpk1Δtpk2Δtpk3Δ and tpk1Δtpk2Δtpk3Δtsa1Δ cells transformed with pRS313-TPK1 or pRS313-tpk1T241A as indicated in SD medium 0.6 mM H2O2 (n = 3). (D–E) Structural homology model of yeast Tpk1 (D) based on the structure of mouse type II PKA holoenzyme (E) [PDB ID 3TNP, (Zhang et al., 2012). (F–I) Amino acids in the activation loop (in red) of Tpk1 in the Thr241 phosphorylated Cys243 non-modified (F), Thr241 non-phosphorylated Cys243 non-modified (G), Thr241 non-modified Cys243 glutathionylated (H) and Thr241 phosphorylated Cys243 glutathionylated (I) states in the Tpk1 structural homology model. The backbones are colored in light blue, carbon atoms in yellow, nitrogen atoms in blue, oxygen atoms in red and phosphor atoms in scarlet. The distance between Lys233 and phosphorylated Thr241 is 9.55 Å (F) whereas Lys233 and non-phosphorylated Thr241 reside 10.88 Å apart (G). (J) Overview of mechanisms by which glucose and H2O2 control PKA activity. In blue activators and in red inhibitors. See also Figure 5—figure supplement 1.

Figure 5—figure supplement 1
Download asset Open asset
Substitution of Cys195, Thr241 and Cys243 by alanine in the yeast.

PKA catalytic subunit Tpk1 neither affects viability nor growth, whereas in silico simulation suggest that glutathionylation, but not sulfenylation, of Tpk1Cys243 significantly impacts on Tpk1 structure.

(A) Growth of tpk1Δtpk2Δtpk3Δ cells transformed with the vector (vector) or the indicated pRS313-TPK1 plasmids and pRS316-TPK1 (pTPK1-URA3) on solid synthetic defined (-HIS, 5-FOA) medium to counterselect pTPK1-URA3. (B) Growth of the strains in (A) on solid synthetic defined selective (-HIS, URA) medium. Cells in A) and B) were left to grow for 3 days before photographed. (C) Doubling time of the indicated tpk-mutant strains in synthetic defined -HIS medium. (D) Tpk1 levels are not significantly altered in Tpk1 substitution mutants neither with nor without H2O2 (0.4 mM. 10 min). Pgk1 levels were used to indicate protein loading. (E) H2O2 resistance of TPK1 tpk2Δ tpk3Δ and tpk1C195A tpk2Δ tpk3Δ-mutants as indicated. (F) Alignment of cysteine (green), aspartate (blue), methylthiolated (pink) or glutathionylated cysteine (grey) in position 243 in the Tpk1 homology model. (G) Root-mean-square deviation of the C-alpha distances in C243-SH (orange), Cys243Asp (blue), Cys243 methylthiolated (yellow) and C243 glutathionylated enzyme (Cys243-SSG, grey) upon molecular dynamic simulation.

Figure 6
Download asset Open asset
Model of the mechanisms by which altered peroxiredoxin levels impacts on aging.

In the first mechanism peroxiredoxin-dependent redox-signaling impacts in an unconventional manner on the PKA nutrient signaling kinase (this study) and in the other on proteostasis (Hanzén et al., 2016). (A) In wild-type cells Tsa1 catalytic cycling maintains longevity by decreasing PKA-dependent nutrient signaling leading to the stimulation of maintenance but at the expense of growth. (B) In cells lacking Tsa1, nutrient signaling is aberrantly increased leading to reduced maintenance and increased growth. (C) Enforced expression of the peroxiredoxin Tsa1 slows down aging both by repressing nutrient signaling (this study) and by stimulating protein quality control mechanisms to reduce the levels of damaged and aggregated protein (Hanzén et al., 2016).

Tables

Key resources table
Reagent type
(species) or
resource		DesignationSource or
reference		IdentifiersAdditional
information
Strain, strain background (Escherichia coli)E. coli BL21 strain expressing pGEX2T-1-GST-RBDThis paper, 10.1038/s41467-017-01019-zTo purify GST-RBD for Ras-GTP assays
Strain, strain background (Saccharomyces cerevisiae)wt control10.1016/j.cell.2016.05.006YMM130MAT alpha his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0
Strain, strain background (Saccharomyces cerevisiae)o/e TSA110.1016/j.cell.2016.05.006o/e TSA1MAT alpha his3Δ1::pRS403-Myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0
Strain, strain background (Saccharomyces cerevisiae)pde2Δ controlThis paperYMM175MAT alpha his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 pde2Δ::kanMX4
Strain, strain background (Saccharomyces cerevisiae)pde2Δ o/e TSA1This paperYMM176MAT alpha his3Δ1::pRS403-Myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 pde2Δ::kanMX4
Strain, strain background (Saccharomyces cerevisiae)wt10.1002/(SICI)1097-0061(19980130)14:2<115::AID-YEA204>3.0.CO;2–2.BY4742MAT alpha his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0
Strain, strain background (Saccharomyces cerevisiae)tsa1Δ10.1016/j.molcel.2011.07.027YMM114BY4742 tsa1Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)ras2Δ10.1016/j.molcel.2011.07.027YMM113BY4742 ras2Δ::kanMX4
Strain, strain background (Saccharomyces cerevisiae)ras2Δtsa1ΔThis paperYMM170BY4742 ras2Δ::kanMX4 tsa1Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)pde2ΔResearch Genetics, 10.1038/nature00935.pde2ΔBY4742 pde2Δ::kanMX4
Strain, strain background (Saccharomyces cerevisiae)ras2Δpde2ΔThis paperYMM171BY4742 ras2Δ::kanMX4 pde2Δ::hphMX4
Strain, strain background (Saccharomyces cerevisiae)pde2Δtsa1ΔThis paperYMM172BY4742 pde2Δ::kanMX4 tsa1Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)ras2Δpde2Δtsa1ΔThis paperYMM173BY4742 ras2Δ::kanMX4 pde2Δ::hphMX4 tsa1Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)tsa1C48S10.1038/ncomms14791YMM145BY4742 tsa1C48S
Strain, strain background (Saccharomyces cerevisiae)tsa1C171S10.1038/ncomms14791YMM146BY4742 tsa1C171S
Strain, strain background (Saccharomyces cerevisiae)tsa1ΔYF10.1038/ncomms14791YMM147BY4742 tsa1(1-184)
Strain, strain background (Saccharomyces cerevisiae)tsa1C171SΔYF10.1038/ncomms14791YMM148BY4742 tsa1(1-184)C171S
Strain, strain background (Saccharomyces cerevisiae)trx1Δtrx2Δ10.1038/ncomms14791YMM143BY4742 trx1Δ::hphMX4 trx2Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)msn2Δmsn4ΔThis paperYMM174BY4742 msn2Δ::hphMX4 msn4Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)ras1Δ::hphMX4This paperYMM177MAT a, his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ras1Δ::hphMX4
Strain, strain background (Saccharomyces cerevisiae)This paperYMM178BY-2n met15Δ0/MET15 lys2Δ0/LYS2 tpk1Δ::kanMX4/TPK1 tpk2Δ::natMX4/TPK2 tpk3Δ::hphMX4/TPK3
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk3ΔThis paperYMM179BY4742 tpk1Δ::kanMX4 tpk3Δ::hphMX4
Strain, strain background (Saccharomyces cerevisiae)tpk2Δtpk3ΔThis paperYMM180BY4742 tpk2Δ::natMX4 tpk3Δ::hphMX4
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URAThis paperYMM181BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-TPK1
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA vector controlThis paperYMM182BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313 pTPK1-URA3
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA pTPK1This paperYMM183BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-TPK1 pTPK1-URA3
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA3 ptpk1C243AThis paperYMM184BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243A pTPK1-URA3
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA3 ptpk1C243DThis paperYMM185BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243D pTPK1-URA3
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA3 ptpk1T241AThis paperYMM186BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1T241A pTPK1-URA3
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1This paperYMM187BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-TPK1
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ ptpk1C243AThis paperYMM188BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243A
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ ptpk1C243DThis paperYMM189BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1C243D
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ ptpk1T241AThis paperYMM190BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS313-tpk1T241A
Strain, strain background (Saccharomyces cerevisiae)ras2Δtrx1Δtrx2ΔThis paperYMM191BY4742 ras2Δ::kanMX4 trx1Δ::hphMX4 trx2Δ::natMX4
Strain, strain background (Saccharomyces cerevisiae)tsa1Δ::bleMX4This paperYMM192BY4741 tsa1Δ::bleMX4
Strain, strain background (Saccharomyces cerevisiae)tpk2Δtpk3Δtsa1ΔThis paperYMM193BY4741 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4
Strain, strain background (Saccharomyces
cerevisiae)		TPK1-HBH tpk2Δtpk3ΔThis paperWR1832BY4742 TPK1-HBH::TRP1 tpk2Δ::natMX4 tpk3Δ::hphMX4 trp1Δ::kanMX4
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA vector controlThis paperyCP101MAT a his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-TPK1
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ ptpk1C243A-URA vector controlThis paperyCP102MAT alpha his3Δ1::pRS403, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-tpk1C243A
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ pTPK1-URA o/e TSA1This paperyCP103MAT alpha his3Δ1::pRS403-myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-TPK1
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δ ptpk1C243A-URA o/e TSA1This paperyCP104MAT alpha his3Δ1::pRS403-myc-TSA1, leu2Δ0 lys2Δ0 ura3Δ0 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 pRS316-tpk1C243A
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δtsa1Δ pTPK1This paperyCP105BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 pRS313-TPK1
Strain, strain background (Saccharomyces cerevisiae)tpk1Δtpk2Δtpk3Δtsa1Δ ptpk1T241AThis paperyCP106BY4742 tpk1Δ::kanMX4 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 pRS313-tpk1T241A
Strain, strain background (Saccharomyces cerevisiae)TPK1-HBH tpk2Δtpk3Δtsa1ΔThis paperyCP107BY4742 TPK1-HBH::TRP1 tpk2Δ::natMX4 tpk3Δ::hphMX4 tsa1Δ::bleMX4 trp1Δ::kanMX4 tsa1Δ::bleMX4
Antibody(mouse monoclonal) anti-Tpk1Santa Cruz BiotechnologySc-374592, RRID:AB_10990730(1:1000)
Antibody(goat polyclonal) anti-Bcy1Santa Cruz BiotechnologySc-6734, RRID:AB_671758(1:2000)
Antibody(rabbit) IgG; anti-Protein ASigma AldrichI5006, RRID:AB_11636591 μg/ml
Antibody(goat polyclonal) anti-Ras2Santa Cruz BiotechnologySc-6759, RRID:AB_672465(1:2000)
Antibody(mouse monoclonal) anti-Glutathione (D8)Abcamab19534, RRID:AB_880243(1:1000)
Antibody(mouse monoclonal) anti-Pgk1 (22C5D8)Thermo Fisher459250, RRID:AB_2532235(1:500)
Antibody(mouse monoclonal) anti-2 Cys Prx (6E5); (anti-Tsa1)Abcamab16765, RRID:AB_443456(1:1000)
Recombinant DNA reagentyEP2410.1016/0378-1119(79)90004-0yeast 2μ, URA3 vector plasmid
Recombinant DNA reagentpKF5610.1128/mcb.10.8.4303.IRA2 in yEP24
Recombinant DNA reagentpRS42510.1016/0378-1119(92)90454w.yeast 2μ, LEU2 vector plasmid
Recombinant DNA reagentyEP13-PDE210.1093/emboj/cdg314.PDE2 in yeast 2μ, LEU2 plasmid
Recombinant DNA reagentyEPlac19510.1016/0378-1119(88)90185-0.yeast 2μ, URA3 vector plasmid
Recombinant DNA reagentpXP110.1128/mcb.19.7.4874.BCY1 in yEPlac195
Recombinant DNA reagentpRS315PMID:2659436yeast CEN/ARS, LEU2 empty vector plasmid
Recombinant DNA reagentB561 (pRS315-RAS2G19V)10.1128/mcb.19.10.6775.RAS2G19V in pRS315
Recombinant DNA reagentpHyPer3C199S (pRS416-GPD-HyPer3C199S)This paper, 10.1021/cb300625gHyPer3C199S
Recombinant DNA reagentpRS416-GPD-AKAR4Molin et al., 2020AKAR4 in pRS416-GPD [CEN/ARS, pGPD promotor, URA3]
Recombinant DNA reagentpRS316PMID:2659436yeast CEN/ARS, URA3 empty vector plasmid
Recombinant DNA reagentpRS316- myc-TSA110.1038/nature02075.Myc-TSA1 in pRS316
Recombinant DNA reagentpRS316- myc-tsa1C48S10.1016/j.molcel.2011.07.027Myc-tsa1C48S in pRS316
Recombinant DNA reagentpRS316- myc-tsa1C171S10.1016/j.molcel.2011.07.027Myc-tsa1C171S in pRS316
Recombinant DNA reagentpRS315-ProtAThis paperProteinA in pRS315
Recombinant DNA reagentpRS315-TRX2-ProteinA10.1038/ncomms14791TRX2-ProtA in pRS315
Recombinant DNA reagentpRS315-trx2C34S-ProteinAThis papertrx2C34S-ProtA in pRS315
Recombinant DNA reagentpRS315-trx2C31SC34S-ProteinAThis papertrx2C31SC34S-ProtA in pRS315trx2C31SC34S-ProtA in pRS315
Recombinant DNA reagentpRS313PMID:2659436yeast CEN/ARS, HIS3 empty vectoryeast CEN/ARS, HIS3 empty vector
Recombinant DNA reagentpRS313-TPK110.1074/jbc.M110.200071.TPK1 in pRS313TPK1 in pRS313
Recombinant DNA reagentpRS313-tpk1C243AThis papertpk1C243A in pRS313tpk1C243A in pRS313
Recombinant DNA reagentpRS313-tpk1C243DThis papertpk1C243D in pRS313tpk1C243D in pRS313
Recombinant DNA reagentpRS313-tpk1T241AThis papertpk1T241A in pRS313tpk1T241A in pRS313
Recombinant DNA reagentpTPK1-URA3 (pRS316-TPK1)Karin VoordeckersTPK1 in pRS316TPK1 in pRS316
Recombinant DNA reagentptpk1C243A-URA3This papertpk1C243A in pRS316tpk1C243A in pRS316
Sequence-based reagentACT1F10.1016/j.molcel.2011.03.021For Q-PCR of ACT1CTGCCGGTATTGACCAAACT
Sequence-based reagentACT1R10.1016/j.molcel.2011.03.021For Q-PCR of ACT1CGGTGAATTTCCTTTTGCATT
Sequence-based reagentCTT1FThis paperFor Q-PCR of CTT1GCTTCTCAATACTCAAGACCAG
Sequence-based reagentCTT1RThis paperFor Q-PCR of CTT1GCGGCGTATGTAATATCACTC
Sequence-based reagentHSP12F10.1016/j.molcel.2011.03.021For Q-PCR of HSP12AGGTCGCTGGTAAGGTTC
Sequence-based reagentHSP12R10.1016/j.molcel.2011.03.021For Q-PCR of HSP12ATCGTTCAACTTGGACTTGG
Peptide, recombinant proteinGlutathione-S-Transferase-Raf1-Binding-Domain (GST-RBD)This paper, 10.1038/s41467-017-01019-zFor Ras-GTP assayPurified from E. coli strain BL21 expressing pGEX2T-1-GST-RBD
Commercial assay or kitPureLink RNA Mini kitThermo-FisherCat #: 12183025
Commercial assay or kitQuantiTect Reverse Transcription KitQiagenCat #: 205313
Commercial assay or kitiQ SYBR Green SupermixBioRadCat #: 170–8882
Commercial assay or kitLANCE cAMP 384 kitPerkin ElmerCat #: AD0262
Chemical compound, drugG418Acros OrganicsCat #: 329400050
Chemical compound, drugClonNATWerner BioagentsCat #: 5.005.000
Chemical compound, drugHygromycin BFormediumCat #: HYG5000
Chemical compound, drugPhleomycinSigma AldrichP9564
Chemical compound, drug5-fluoroorotic acidSigma AldrichF5013
Chemical compound, drugEZ-Link Sulfo-NHS-LC BiotinThermo FisherCat #: 21335
Chemical compound, drugTrichloroacetic acidSigma AldrichCat #: T6399
Chemical compound, drugKSCNSigma AldrichCat #: P2713
Chemical compound, drug(NH4)2Fe(SO4)2 • 6 H2OSigma AldrichCat #: 215406
Chemical compound, drugTRIzol ReagentThermo FisherCat #: 15596026
Chemical compound, drugDNase, RNase-free setQiagenCat #: 79254
Chemical compound, drugcOmplete Mini EDTA-free protease inhibitorRoche Applied ScienceCat #: 11873580001
Chemical compound, drugGlutathione Sepharose beadsGE HealthcareCat #: 17-0756-01
Chemical compound, drug12% Bis-Tris NUPAGE gelsThermo FisherArch Biochem BiophysCat #: NP0349BOX
Chemical compound, drugMOPS running bufferThermo FisherCat #: NP0001
Chemical compound, drugImmobilon-FL PVDF membraneMilliporeCat #: IPFL00010
Chemical compound, drugNi2+-Sepharose beadsGE HealthcareCat #: 17-5318-06
Chemical compound, drugAnti-c-myc, agarose conjugatedSigma-AldrichCat #: A7470
Chemical compound, drugTrypsin Gold, mass spectrometry gradePromegaCat #: V5280
Chemical compound, drugN-ethylmaleimideSigma-AldrichCat #: E3876
Chemical compound, drugDYn-2Cayman ChemicalCat #: 11220
Chemical compound, drug10% Criterion TGX Precast Midi Protein GelBio-RadCat #: 5671034
Chemical compound, drugPeptide Retention Time Calibration MixturePierce, Thermo FisherCat #: 88320
Software, algorithmMATLABMathworksversion 2016b
Software, algorithmCellX10.1002/0471142727.mb1422s101
Software, algorithmScrödinger SuiteSchrödinger LLC
Software, algorithmGROMACS10.1016/j.softx.2015.06.001
Software, algorithmAmber tools10.1002/wcms.1121

Additional files

Supplementary file 1

Mass spectrometry data.

https://cdn.elifesciences.org/articles/60346/elife-60346-supp1-v3.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/60346/elife-60346-transrepform-v3.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Friederike Roger
  2. Cecilia Picazo
  3. Wolfgang Reiter
  4. Marouane Libiad
  5. Chikako Asami
  6. Sarah Hanzén
  7. Chunxia Gao
  8. Gilles Lagniel
  9. Niek Welkenhuysen
  10. Jean Labarre
  11. Thomas Nyström
  12. Morten Grøtli
  13. Markus Hartl
  14. Michel B Toledano
  15. Mikael Molin
(2020)
Peroxiredoxin promotes longevity and H2O2-resistance in yeast through redox-modulation of protein kinase A
eLife 9:e60346.
https://doi.org/10.7554/eLife.60346