1. Cell Biology
  2. Developmental Biology
Download icon

Coordinated crosstalk between microtubules and actin by a spectraplakin regulates lumen formation and branching

  1. Delia Ricolo
  2. Sofia J Araujo  Is a corresponding author
  1. Department of Genetics, Microbiology and Statistics, School of Biology, University of Barcelona, Spain
  2. Institute of Biomedicine University of Barcelona (IBUB), Spain
Research Article
  • Cited 2
  • Views 1,110
  • Annotations
Cite this article as: eLife 2020;9:e61111 doi: 10.7554/eLife.61111


Subcellular lumen formation by single-cells involves complex cytoskeletal remodelling. We have previously shown that centrosomes are key players in the initiation of subcellular lumen formation in Drosophila melanogaster, but not much is known on the what leads to the growth of these subcellular luminal branches or makes them progress through a particular trajectory within the cytoplasm. Here, we have identified that the spectraplakin Short-stop (Shot) promotes the crosstalk between MTs and actin, which leads to the extension and guidance of the subcellular lumen within the tracheal terminal cell (TC) cytoplasm. Shot is enriched in cells undergoing the initial steps of subcellular branching as a direct response to FGF signalling. An excess of Shot induces ectopic acentrosomal luminal branching points in the embryonic and larval tracheal TC leading to cells with extra-subcellular lumina. These data provide the first evidence for a role for spectraplakins in single-cell lumen formation and branching.


Cell shape is intrinsically connected with cell function and varies tremendously throughout nature. Tissue and organ morphogenesis rely on cellular branching mechanisms that can be multicellular or arise within a single-cell. Through extensive cellular remodelling, this so-called single-cell or subcellular branching, transforms an initially relatively symmetrical unbranched cell into an elaborate branched structure. These cellular remodelling events are triggered by widespread cytoskeletal changes and cell membrane growth, which allow these branched cells to span very large areas and accomplish their final function. Despite this clear link between morphology and function, not much is known about the signalling events that trigger the formation of these subcellular branches or what makes them choose a particular trajectory within the cytoplasm of the cell.

In Drosophila melanogaster, tracheal system terminal cells (TCs) and nervous system dendrites are models for these subcellular branching processes. During tracheal embryonic through larval development, the generation of single-cell branched structures by TCs is characterised by extensive remodelling of the MT network and actin cytoskeleton, followed by vesicular transport and membrane dynamics (Best, 2019; Gervais and Casanova, 2010; Sigurbjörnsdóttir et al., 2014). During embryonic development, TCs, as tip-cells, lead multicellular branch migration and extension in response to Bnl-Btl signalling, which induces the expression of Drosophila serum response factor (DSRF/blistered (bs)) and its downstream effectors (Affolter et al., 1994; Posern and Treisman, 2006). Although epithelial in origin, TCs do not have a canonical apical-basal polarity, and, as they migrate, extend numerous filopodia on their basolateral membrane, generating transient protrusive branches at the leading edge (Lebreton and Casanova, 2014). As a consequence, they display a polarity similar to that of a migrating mesenchymal cell (Fischer et al., 2019).

While migrating and elongating, the TC invaginates a subcellular tube from its apical membrane, at the contact site with the stalk cell (Gervais and Casanova, 2010). The generation of this de novo subcellular lumen can be considered the beginning of the single-cell branching morphogenesis of this cell, which continues throughout larval stages to generate an elaborate single-cell branched structure with many subcellular lumina (Best, 2019).

We have previously shown that centrosomes are key players in the initiation of subcellular branching events during embryogenesis. Here, they act as microtubule organising centres (MTOCs) mediating the formation of single or multiple-branched structures depending on their numbers in the TC (Ricolo et al., 2016). Centrosomes organise the growth of MT-bundles toward the elongating basolateral edge of the TC. These MTs have been suggested to serve both as trafficking mediators, guiding vesicles for delivery of membrane material, and as mechanical and structural stabilisers for the new subcellular lumen (Best, 2019). Actin filaments are present at the growing tip, the basolateral and the luminal membrane of the TC, and actin-regulating factors such as DSRF, Enabled (Ena) and Moesin (Moe) have been shown to contribute to TC morphogenesis (Gervais and Casanova, 2010; Guillemin et al., 1996; Schottenfeld-Roames et al., 2014). During TC elongation, the lumen extends along with the cell, stabilizing the elongating cell body and maintaining a more or less constant distance between its own tip and the migrating tip of the cell (Gervais and Casanova, 2010). At the TC basolateral side, a dynamic actin pool integrates the filopodia and aligns the growing subcellular tube with the elongation axis (JayaNandanan et al., 2014; Okenve-Ramos and Llimargas, 2014; Oshima et al., 2006). Together, MT-bundles and the basolateral actin pool are necessary for subcellular lumen formation (Gervais and Casanova, 2010). However, not much is known on how these two cytoskeletal structures are coordinated within the TC.

By the time the larva hatches, TCs have elongated and grown a full-length lumen, which becomes gas-filled along with the rest of the tracheal system. In the larva, terminal cells ramify extensively and form many new cytoplasmatic extensions each with a membrane-bound lumen creating tiny subcellular tubes that supply the targets with oxygen (Baer et al., 2007; Ghabrial et al., 2011; Whitten, 1957). At larval stages, sprouting and extension of new branches in response to local hypoxia is generally considered to occur by essentially the same molecular mechanisms as the initial tube invagination and cell extension in the embryo (Jarecki et al., 1999; Sigurbjörnsdóttir et al., 2014). However, not much is known about how hypoxic signalling is transduced into cytoskeletal modulation to achieve the single-cell branching morphogenesis of the TC. Also, what coordinates the crosstalk between microtubules and actin at the basolateral growing tip, how cell elongation is stabilised by lumen formation and how both processes remain coordinated is still poorly understood in both embryonic and larval TCs.

Spectraplakins are giant conserved cytoskeletal proteins with a complex multidomain architecture capable of binding MTs and actin. They have been reported to crosslink MT minus-ends to actin-networks, making MT-bundles more stable and resistant to catastrophe (Dogterom and Koenderink, 2019). Loss of spectraplakins has been shown in vivo to have remarkable effects on microtubule organisation, cell polarity, cell morphology, and cell adhesion (Röper et al., 2002; Suozzi et al., 2012). Drosophila has a single spectraplakin, encoded by short-stop (shot) (Gregory and Brown, 1998; Lee et al., 2000; Röper et al., 2002). shot mutants display pleiotropic phenotypes in wing adhesion, axon and dendrite outgrowth, tracheal fusion, muscle-tendon junction, dorsal closure, oocyte specification and patterning, photoreceptor polarity and perinuclear microtubule network formation (Gregory and Brown, 1998; Khanal et al., 2016; Lee and Kolodziej, 2002a, Lee and Kolodziej, 2002b; Mui et al., 2011; Subramanian et al., 2003; Sun et al., 2019). Shot has been shown to bind both the microtubule plus-end-binding EB1 and the microtubule minus-end-binding protein Patronin, required for the establishment of acentrosomal microtubule networks (Khanal et al., 2016; Nashchekin et al., 2016; Subramanian et al., 2003). It also has been shown to bind actin and to crosslink MTs and actin contributing to cytoskeletal organisation and dynamics (Applewhite et al., 2010; Booth et al., 2014; Lee and Kolodziej, 2002b).

In the present study, we uncover a novel role for the spectraplakin Shot in subcellular lumen formation and branching. Our results show that shot loss-of-function (LOF) leads to cells deficient in de novo subcellular lumen formation at embryonic stages. We show that Shot promotes the crosstalk between microtubules and actin, which leads to the extension and guidance of the subcellular lumen within the TC cytoplasm. We observe that Shot levels are enriched in cells undergoing the initial steps of subcellular branching as a direct response to FGF signalling. And an excess of Shot induces ectopic acentrosomal branching points in the embryonic and larval tracheal TC leading to cells with extra-subcellular lumina. Furthermore, we find that Tau protein can functionally replace Shot in subcellular lumen formation and branching.


Loss of shot causes defects in de novo subcellular lumen formation

Shot is expressed during Drosophila development in several tissues such as the epidermis, the midgut primordia, the trachea and the nervous system (Lee and Kolodziej, 2002a; Röper and Brown, 2003). We began by analysing the effect of shot LOF during TC subcellular lumen formation. To do so, we analysed dorsal (DB) and ganglionic branch (GB) TCs at late stages of embryogenesis (st.15/16) (Figure 1A,B).

Figure 1 with 1 supplement see all
shot loss-of-function induces defects in subcellular lumen formation.

(A–B) Representation of dorsal and ganglionic TCs from embryonic st.15 to st.16 (DB and GB in grey, TC in pink). At st.15, the TC (cytoplasm in pink, nucleus in yellow, basal membrane in grey, apical membrane in blue and lumen in white) emits filopodia in the direction of cell elongation; apical membrane grows in the same direction giving rise to the outline of the subcellular lumen. At the same time the subcellular lumen is filled of chitin (white). At the end of st.16 the TC is elongated and the subcellular lumen is formed. (C–D) DBs at st.15 of btl >srcGFP (control) and shot3; btl >srcGFP fixed embryos stained with GFP to visualise tracheal cells, green in C and D, grey in C’’ and D’’, CBP to visualise the lumen, white in C and D black in C’ and D’ and DSRF in magenta. Anterior side is on the left and dorsal is up, scale bars 5 μm. (E) Quantification of total defective TCs in btl >shotRNAi (60%), shot3 (62.5%) and wt (2.25%) n = 20 embryos, 400TCs. Error bars are ± SEM and asterisks represent a p-value<0001. Statistics by two-tailed Student’s t-test. (F–K) DBs (F-J dorsal view) and GBs (G-K ventral view) of fixed embryos stained with anti-Gasp antibody at st.16 of wt (F and G), shot3 (H and I) and btl >shotRNAi (J and K) (L) Quantification of total TCs (genotype indicated) without subcellular lumen (wt 1.34% n = 400, shot3 25% n = 400, btl >shotRNAi 20%n = 300). *** p-value<0001. Statistics by two-tailed Student’s t-test. Scale bars 10 µm. (M–N) Different types of TC mutant phenotypes were produced in absence of Shot as observed in detail by confocal microscopy. (M) Dorsal branches of btl >srcGFP control and shot3 embryos stained with GFP (grey) to visualise membrane and CBP (in magenta) to visualise the lumen. Anterior side is on the left and dorsal side is up. Scale bars 5 μm. (I) TC partially elongated with formed lumen but with wrong directionality (52%); (II) the elongation was stopped prematurely and a primordium of subcellular lumen was formed (12%); (III) the cell elongated partially but the lumen was completely absent (16%); and (IV) the cell was not able to elongate and the lumen was completely absent (20%). Types III and IV were quantified in L as TCs without lumen. (E) Detailed quantification, by confocal microscopy, of the different types of TC mutant phenotypes reported as I-IV (n = 25 TCs).

Figure 1—source data 1

Quantification of shot loss-of-function defects in subcellular lumen formation.


The shot3 null mutant TC phenotype consisted in subcellular lumen elongation defects with a penetrance of 100% per embryo (n = 40) and 62.5% per TC (n = 400) (Figure 1C,D and F–I and E). Of the total mutant TCs analysed, 25% did not develop a subcellular lumen (n = 600, Figure 1L). This phenotype resembled the previously reported for blistered (bs) mutants (Guillemin et al., 1996). bs encodes the transcription factor DSRF that regulates TC fate induction in response to Branchless-Breathless (Bnl-Btl) signalling (Gervais and Casanova, 2011; Guillemin et al., 1996). However, we observed that DSRF was properly accumulated in shot3 TC nuclei (Figure 1D), discarding a possible effect of Shot in TC fate induction.

To analyse if the shot phenotype was tissue autonomous, we expressed shot-RNAi to knock-down Shot in all tracheal cells and found that, like in null mutant conditions, 60% of TCs analysed (n = 300) at the tip of the DBs (n = 150) or GBs (n = 150) were affected in subcellular lumen formation (Figure 1E and J,K). Of these, 20% did not develop a terminal lumen at all (Figure 1L).

shot3 embryonic TC lumen phenotypes range in expressivity from complete absence of subcellular lumen to different lengths of shorter lumina (Figure 1M,N). When quantified in detail, out of the 62.5% TCs that showed a luminal phenotype, 36% of TCs did not elongate a subcellular lumen at all (types III and IV) and 64% failed to accomplish a full-length lumen (types I and II) (n = 25) (Figure 1M,N).

Recently, it has been reported that endocytosis is involved in subcellular lumen formation (Mathew et al., 2020). Bazooka (Baz), the Drosophila Par3, which is mainly associated with the apical membrane, has been shown to accumulate at the tip of the TC during lumen formation (Gervais and Casanova, 2010; Mathew et al., 2020). When we analysed this Baz accumulation in shot3 mutants, we could detect that it was very disrupted and no longer localised at the TC tip (Figure 1—figure supplement 1).

Taken together, these results indicated that Shot is involved in de novo subcellular lumen formation and elongation.

Shot overexpression induces extra-subcellular branching independently of the centrosome

Having observed that Shot was necessary for subcellular lumen formation and extension, we hypothesised that Shot overexpression (ShotOE) would induce extra-subcellular branching events. Indeed, analysis of long-isoform ShotOE (shotA-GFP) in tracheal cells revealed that increasing Shot concentrations induced extra-subcellular lumina (ESL) in GB and DB TCs (Figure 2A–C,J). Since MTs and actin are essential for subcellular lumen formation (Gervais and Casanova, 2010), we then asked whether supernumerary luminal branching was due to the MT- or the actin-binding domains present in the Shot molecule (Bottenberg et al., 2009; Voelzmann et al., 2017). To this end, we overexpressed an isoform of Shot (ShotC-GFP) with a deletion of the first calponin domain (Figure 2K,L), resulting in a shorter actin-binding domain (ABD), which binds actin very weakly or not at all (Lee and Kolodziej, 2002a; Lee and Kolodziej, 2002a). The tracheal overexpression of shotA induced phenotypes in 95% of the embryos (n = 20), with an average of two TC bifurcations per embryo (n = 400). shotC overexpression induced phenotypes in 90% of the embryos (n = 20), with an average of two TC bifurcations per embryo (n = 400) (Figure 2D–F and G). In both cases approximately 15% of all TCs analysed displayed an ESL phenotype (Figure 2J). In all cases, we could detect more MT-bundles in TCs, associated with the ESLs (Figure 2A–F and Figure 2—figure supplement 1). ShotA-GFP and ShotC-GFP displayed different localisations within the TC. Full-length ShotA-GFP localisation can be detected at the cell-junctions, around the crescent lumen, in MT-bundles, and throughout the cytoplasm, whereas ShotC-GFP localised more to the MT/lumen region, in agreement with the lack of actin-binding capability of ShotC isoform (Figure 2—figure supplement 1). Interestingly, we observed a highly ramified subcellular lumen when higher amounts of ShotC were expressed in tracheal cells (Figure 2G) suggesting that the effect of ShotOE in subcellular lumen branching was dosage dependent.

Figure 2 with 1 supplement see all
ShotOE induces luminal branching through its microtubule-binding domain.

Lateral view of DB tip cells from st.14 to st.16, of btl >shotA-GFP embryos (A–C) and btl >shotCGFP (D–F). Embryos were stained with GFP (green in A-F and grey A’’-F’’) to visualise Shot-GFP, DSRF to mark the TC nuclei (in magenta) and CBP to stain the chitinous lumen (blue in A-F and white A’-F’). Both overexpressing conditions induced ESLs (white stars). Note the GFP was more diffuse in the cytoplasm of the TCs of embryos overexpressing shotA, and more organised in bundles in the TCs overexpressing shotC. Anterior side of embryo is on the left and dorsal side up. Scale bars 5 μm. (G) ESL induction by ShotOE is dosage sensitive. Example of dorsal TC of an embryo overexpressing two copies of btl >shotC-GFP, stained with anti-GFP (green) and CBP (white in G, black in G’). Red arrows indicate extra-subcellular lumen branching. Note that the extra-subcellular lumina are very thin and they follow Shot positive bundles detected with GFP. Anterior side is on the left, dorsal midline is on the top. Scale bars 5 μm. (H, I) Tips of GB TCs from btl >shotΔCtail embryos with a single subcellular lumen each (H) and btl >C-tail (I) in which one TC is bifurcated; stained with anti-Gasp (ventral view, anterior side of the embryo is on the left). Scale bars 10 µm. (J) The C-tail domain is involved in ESL formation. Percentage of TCs displaying ESLs in embryos overexpressing GFP, shotA, shotC, C-tail, and shotΔCtail in the tracheal system (n = 400 TCs all genotypes except btl >shotC where n = 800). *** p-value<0.001; ns refers to a p-value>0.1. Statistics by two-tailed Student’s t-test. There was no significant difference between overexpression of shotΔCtail and GFP alone. (K) Schematic representation of spectraplakin protein domains and (L) the different Shot constructs used in this study.

Figure 2—source data 1

Quantification of ShotOE phenotypes in subcellular lumen formation.


Tracheal overexpression of shotC phenocopied that of shotA in inducing ESLs (14.63% and 15.5% ESL respectively, Figure 2D–F and J), suggesting that the ABD is not necessary for the induction of additional luminal branching events. In order to clarify this, we used two other isoforms of Shot: shot∆Ctail, lacking the C-terminal MT-binding domain, and shotCtail, a truncated form containing only the C-terminal MT-binding domain (Alves-Silva et al., 2012Figure 2K,L). Whereas overexpressing shotΔ-Ctail in TCs we could only detect a branching phenotype in 1,5% of TCs analysed (n = 400), (Figure 2K), overexpression the C-tail domain alone induced TCs with extra branching in 9.5% of TCs (n = 400) (Figure 2I), indicating that the C-tail alone was sufficient to induce ESLs in TCs. Taken together these results using different Shot isoforms, lead us to conclude that the Shot MT-binding domain alone is sufficient for the extra branching events observed in ShotOE TCs.

ESLs were previously observed when higher numbers of centrosomes were present in TCs (Ricolo et al., 2016). We therefore asked if the observed extra branching phenotypes could be due to supernumerary centrosomes induced by ShotOE in TCs. Consequently, we quantified the number of centrosomes in the TCs of ShotOE embryos. In wt TCs we detected an average of 2.3 ± 0.5 (n = 33) centrosomes per TC, and in ShotOE 2.2 ± 0.2 centrosomes per TC (n = 33) (Figure 3A–C). In both conditions, and as previously described (Ricolo et al., 2016), this centrosome pair was detected at the apical side of the TCs (Figure 3A,B). Besides, analysing ShotOE TCs at embryonic st.15, (n = 16) we could detect that the ESL arose from the pre-existing subcellular lumen, distally from the centrosome pair (Figure 3B’ arrow). These data indicate that ShotOE did not change TC centrosome number and induced ESL by a distinct mechanism from centrosome duplication.

ESL induction by ShotOE is not associated with centrosome amplification.

(A,B) GB TC of a st.14 embryo (A), prior to lumen extension, and st.15 when a bifurcated lumen can be detected in ShotOE conditions. (A,B) btl >shotC-GFP embryos stained with CBP to mark lumen (white), anti-GFP to visualise Shot (green) and anti-CP309 antibody to mark centrosomes (magenta); the outline of TCs is drawn in yellow. The box in A is a magnification of the apical side, showing the TC centrosome pair (in magenta) and GFP positive Shot bundles (in grey) emanating from centrosomes. White stars indicate centrosomes apically localised. Note in B’ the subcellular lumen (magenta arrow) bifurcated in a point downstream from the centrosome pair. Anti-CP309 antibody stains all centrosomes throughout the embryo and not just in TCs and cross-reacts with an unidentified antigen at the subcellular lumen. (C) Quantification of centrosome number in wt, btl >shotC and Rca1 embryos ± SEM. (D) GB tips from Rca1; btl >shotC-GFP embryos at st.15, stained with CBP (in white) to visualise the lumen and E-cadherin (magenta) to recognise the TC apical junction. Anterior side of the embryo is on the left and ventral is down. Scale bar 2 μm. In these cases, it is possible to detect two types of luminal bifurcations: one from the apical junction (white arrow), caused by Rca1 mutant supernumerary centrosomes, and another one arising from a pre-existing lumen, induced by ShotOE. (E–H) Details of GB TCs at st.16 from embryos stained with anti-Gasp antibody to mark the lumen. (E) wt TCs with a single lumen each; (F) btl >shotC showing subcellular lumen bifurcations; (G) Rca1 showing subcellular lumen bifurcations; (H) Rca1; btl >shotC showing a multi-branched subcellular lumen. Anterior side of the embryo is on the left ventral midline is down. Scale bars 5 μm. (I) Quantification of the number of bifurcations (GB TCs) per embryo of the indicated genotype. ‘n bifurcations’ is the number of ESL per TC.

Figure 3—source data 1

Quantification of centrosome number and luminal phenotypes.


Regulator of cyclin A1 (Rca1) is the Drosophila ortholog of vertebrate Emi1 and a regulator of APC/C activity at various stages of the cell cycle (Grosskortenhaus and Sprenger, 2002). Rca1 mutants have supernumerary centrosomes at the TCs and develop ESLs at embryonic stages (Ricolo et al., 2016). In contrast with ShotOE alone (Figure 3B’), in Rca1 mutants the bifurcated subcellular lumen arose from the apical junction and continued to extend during TC development (Ricolo et al., 2016). When we analysed the luminal origins in Rca1, ShotOE conditions, both types of ESL where detected in the same TC in 25% of the cases (n = 12). In the same TCs two types of ESL were generated, one from the apical junction and another sprouted from the pre-existing lumen distally from the junction (Figure 3D, asterisks). In addition, the effect of Rca1 LOF and ShotOE was additive in producing TCs with a multiple-branched subcellular lumen (Figure 3I). These morphological ESL differences suggested that Rca1 and shot operate in different ways in the de novo formation and branching of the subcellular lumen.

Shot associates with stable microtubules and actin

Spectraplakin expression is critical in cells that require extensive and dynamic cytoskeleton reorganisation, such as epithelial, neural, and migrating cells. Loss of spectraplakin function leads to a variety of cellular defects due to disorganised cytoskeletal networks (Hahn et al., 2016). In a plethora of tissues and in cultured S2 cells, Shot can physically interact with different cytoskeletal components (Applewhite et al., 2010; Lee and Kolodziej, 2002b; Sanchez-Soriano et al., 2009). Therefore, we investigated Shot localisation and its interaction with MTs and actin in control TCs.

We analysed live embryos using time-lapse imaging and observed that Shot localisation was extremely dynamic throughout subcellular lumen formation. We could detect Shot in the apical TC junction as well as extending together with the growing subcellular lumen (Video 1 and Figure 4—figure supplement 1A). It was apparent that Shot localised dynamically with the growing luminal structures, showing a strong localisation at the middle/tip of the extending TC (Video 1 and Figure 4—figure supplement 1A).

Video 1
Shot localisation within the TCs is dynamic and accompanies the growing subcellular lumen.

In vivo Shot localisation during lumen formation in two wild-type ganglionic branch (GB) TCs. Time-lapse images of a wt embryo expressing btlGAL4UASShotC-GFP visualised from a dorsal view. Note the accumulation of Shot at the apical junction of the TC and subsequently in association with subcellular lumen extension. Frames were taken every minute for 3.5 hr.

In control conditions actin concentrated strongly at the tip of the TC, but was also detected in the TC cytoplasm, and these different actin populations have been shown to be important for subcellular lumen formation and extension (Gervais and Casanova, 2010; Oshima et al., 2006). During TC elongation, MTs polymerise from the centrosome pair at the apical junction toward the tip of the cell, reaching the area of high actin accumulation at the migrating tip of the TC (Gervais and Casanova, 2010; Ricolo et al., 2016). So, we next analysed ShotA and ShotC localisation in relation to the dynamically localised actin core present in the cytoplasm and at the tip of the migrating TC in live embryos (Videos 2, 3, and 4 and Figure 4—figure supplement 1). In both GB and DB TCs we could detect a dynamic interaction between the long Shot isoform (ShotA) and actin as detected by Moe::RFP (the ABD of moesin fused to RFP, thereby labelling the actin cytoskeleton of these cells, Video 4) or Life-actRFP (Video 3 and Figure 4—figure supplement 1C). ShotA dynamically interacted with different actin populations, namely the actin core and basal, filopodial actin (Videos 3 and 4 and Figure 4—figure supplement 1C). However, as the lumen extended, ShotC fibres extended with the cell, surrounding the growing luminal area, like Shot A, but no strong interaction was detected with the dynamic actin core and with the basal, filopodial actin (Video 2 and Figure 4—figure supplement 1B).

Video 2
Shot localises with the extending subcellular lumen in TCs during subcellular lumen extension.

In vivo Shot colocalisation with actin during lumen formation in a wild-type dorsal branch (DB) TC. Time-lapse images of a wt embryo expressing btlGAL4UASShotC-GFP; btl::moeRFP visualised from a dorsal view. Note the colocalisation of Shot with actin the apical junction of the TC. As the cell extends, ShotC localises to the growing lumen and there is no detectable strong association with the actin core and filopodial actin. Frames were taken every 2 min for 3.3 hr.

Video 3
Shot localises with actin in TCs during the early steps of subcellular lumen extension.

In vivo Shot long-isoform colocalisation with actin during lumen formation in a wild-type dorsal branch (DB) TC. Time-lapse images of a wt embryo expressing btlGAL4UASShot-A-GFPUASlifeActRFP visualised from a dorsal view. Note the colocalisation of Shot with actin at the apical junction of the TC and subsequent association with the actin core and filopodial actin during subcellular lumen extension. Frames were taken every 40 s for 32 min.

Video 4
Shot localises with actin in TCs during later steps of subcellular lumen extension.

In vivo Shot long-isoform colocalisation with actin during lumen formation in a wild-type dorsal branch (DB) TC. Time-lapse images of a wt embryo expressing btlGAL4UASShotA-GFP; btl::moeRFP visualised from a dorsal view. Note the colocalisation of Shot with filopodial actin during subcellular lumen extension. Frames were taken every 30 s for 36 min.

We followed these analyses, observing endogenous Shot in fixed and antibody stained embryos. At early stages, when TCs started to elongate, we detected Shot co-localizing with actin at the tip of the TC (Figure 4A). The overlap between Shot and actin was maintained until late st.15 (Figure 4B). Then, we examined Shot localisation in relation to MTs. Shot was strongly detected in the TC from early stages of lumen extension and until the end of TC elongation (Figure 4D–E). At the beginning of de novo lumen formation, when MTs emanated from the junction/centrosome pair, Shot co-localised with the first sprouting stable MTs (Figure 4C–D). The overlap between Shot and stable MTs was strongly observed also at embryonic st.15 when a MT track preceded subcellular lumen detection (Figure 4D). At st.16, both Shot and stable MTs localised to the apical side of the TCs in the area surrounding the subcellular lumen (Figure 4E).

Figure 4 with 1 supplement see all
Shot colocalises with TC cytoskeletal components.

(A–B) Endogenous Shot, detected by an antibody in btl::moeRFP embryos, colocalised with actin during TC development. Tip of dorsal branches from st. 14 to late st. 15 of btl::moeRFP embryos stained with RFP (magenta) and Shot (green). In the magnification of the tip of the TCs (A’–B’) note Shot and RFP co-localisation in both embryonic stages. (C–E) Endogenous Shot accumulated around stable microtubules during subcellular lumen formation. The whole TC morphology changes overtime. This is a developing structure and both cell-shape and the cytoskeleton are changing throughout its development. Here we provide snapshots of different stages showing the beginning, middle and final stages of TC lumen formation. Dorsal TCs from fixed embryos btl >srcGFP stained with Shot and acetylated-tubulin antibodies and fluostain to detect chitin, from st.14 to st.16. GFP staining is showed in grey and cell contour in yellow (C–E), endogenous Shot is shown in grey in panels C’- E ‘’ (C’’- E’’ are magnification of C’- E’) and green C’’’’- E’’’’. Acetylated tubulin is in grey in C’’’- E’’’ and magenta in C’’’’ -E’’’’. The chitinous lumen was detected with fluostain, represented in cyan (C– E’’’). Acetylated tubulin and Shot are both accumulated ahead of the subcellular lumen at earliest stages (st. 14–15) and around the subcellular lumen at later stages (st.16). Note that co-localisation between acetylated tubulin and Shot is detected in the TCs. Anterior side is on the left, dorsal midline is up. Scale bar 5 μm. (F) Schematic representation of dorsal TC development from st.15 to st.16. Basal membrane in grey, apical membrane in light blue, subcellular lumen in white, the actin network in red and MTs are in green. Between st.14 and st.15 actin dots mature in an actin core in front of the tip of the subcellular lumen in formation that is surrounded by microtubules. Shot (represented on the bottom of the figure) was detected both inside the actin core and surrounding the lumen where stable MTs are organised.

Shot localisation within the TC suggested that the spectraplakin localised with stable MTs all around the nascent lumen and with the actin at the tip of the TC, during the time of cell elongation and subcellular lumen formation. This suggests that Shot mediates the crosstalk between these two cytoskeletal components, helping their stabilisation and organisation during subcellular lumen formation and growth (Figure 4F).

Absence of shot leads to disorganised microtubules and actin

We then asked how actin and MTs were localised and organised in shot3 mutant embryos. We analysed the different types of TC mutant phenotypes ranging from cases in which the TC did not elongate and the subcellular lumen was not formed, to cases in which the TC was able to elongate and form the lumen albeit not to the levels in control embryos (Figure 5). In all cases, we found defects in both MTs and actin accumulation in mutant TCs.

Shot LOF lead to disorganised MT-bundles and actin.

(A–D) Asymmetric actin accumulation in extended TCs was affected in shot3 mutant embryos. Dorsal TC from fixed shot3/+; btl::moeRFP controls (A) and shot3; btl::moeRFP mutant embryos (B–D), stained with RFP (Magenta in A-D or in a colour scale in which blue is low, green is middle and red high intensity in A’- D’) and CBP (in white). In shot mutant TCs actin appeared affected in its accumulation (B–D). (A) control; (B) when the cell was not elongated and the lumen was not formed; (C) when the cell was partially elongated and the lumen was not formed; (D) when the cell elongated and the lumen was partially formed (D). Note that actin was affected even when the cell was elongated and a lumen was partially formed. (E–H) TC MT-bundles in shot3. Dorsal TC from embryo at st.16 control (A) and shot3 mutant embryos (B–D) stained with GFP (green) acetylated tubulin (in magenta in E-H and in grey in E’’-H’’) and CBP (in blue in E-H and grey in E’’’-H’’’). The border of TC was drawn in cyan (E–H’’). In all cases, the organisation and the amount of stable MTs was strongly affected, in (F) MT-bundles were observed to be disorganised along the cytoplasmatic protrusion without subcellular lumen and in G and H only a thin track of MTs surrounds the subcellular lumen. Anterior side is on the left and dorsal midline is up. Scale bars 5 μm.

Considering actin localisation, in control embryos at early st.16, Moe::RFP detecting actin was strongly localised at the tip of the TC, in front of the tip of the growing lumen (86% of TCs analysed, n = 21). Moreover, a few spots of actin were detectable in the cytoplasm, around the subcellular lumen (Figure 5A and Video 2). In shot3, we observed reduced actin accumulation at the TC-tip and an increase of scattered spots into the cytoplasm (86% of TCs analysed, n = 23) (Figure 5B–D), indicating that Shot contributed to TC actin organisation.

Regarding MT-bundles, we observed stable MTs organised in longitudinal bundles around the subcellular lumen in control TCs (Figure 5E). In shot3 TCs (n = 20), we detected MT-bundle defects. In particular, we observed that when the TC was not elongated, MT-bundles no longer localised to the apical region and seemed to be fewer than in wt (Figure 5F). A general disorganisation in MT-bundles in respect to the control was also observed in TCs partially able to elongate a subcellular lumen (Figure 5G,H).

These analyses, taken together with the previous analysis of Shot localisation in control TCs, suggested a spectraplakin role in organizing/stabilizing both MTs and Actin accumulation in the TC.

Subcellular branching depends on both actin and microtubule-binding domains of shot

In order to analyse how the different domains of Shot affected luminal development and branching, we expressed different isoforms of Shot in shot3 mutant TCs. As described previously, shot3 embryos displayed a variable expressivity in TC phenotypes. To simplify the quantification of the rescue experiments, we took in consideration the most severe luminal phenotype: the complete absence of a subcellular lumen. In shot3, we quantified that 22% of TCs (at the tip of GBs and DBs) did not develop a subcellular lumen at all (Figure 1H,I and Figure 6B,J). Targeted expression of full-length ShotA in the trachea of shot3 mutant embryos was able to rescue the subcellular lumen phenotype to the level of only 6% of the TCs analysed (n = 200) not developing a subcellular lumen (Figure 6C).

Figure 6 with 1 supplement see all
Shot Actin- and MT-binding domains are necessary for proper subcellular lumen formation.

(A–I) Dorsal branches of st.16 embryos, stained with anti-GASP to visualise the lumen. Genotype is indicated above each panel. Null allele, shot3, rescue experiments (B–F) indicate that both the actin-binding domain (ABD) and the microtubule-binding domain are involved in subcellular lumen formation since the only construct able to rescue the null allele phenotype is the UASShotA (B and J). Both functional domains are needed in the same molecule since mutants affected only in the ABD (shotKakP2) or in the microtubule-binding domain (shotΔEGD) and the transheterozygous shot KakP2/ΔEGD display the same phenotype as shot3. Scale bars are 10 µm. (J) Quantification of TCs without lumen: wt (n = 820); shot3 (n = 600); shotKakP2 (n = 400); shotΔEGD (n = 400); shot KakP2/ΔEGD (n = 320 TCs); shot3, btl >shotA (n = 240); shot3; btl >shotC (n = 240); shot3; btl >shotCtail (n = 240); shot3; btl >shotΔCtail (n = 240). *** p-value<0.001; ns refers to a p-value>0.1. Statistics by two-tailed Student’s t-test. Only ShotA significantly rescued the shot3 TC luminal phenotype.

Figure 6—source data 1

Quantification of rescue experiments and different shot mutant phentotypes and transheterozygous combinations.


We then proceeded to molecular dissect the function of Shot in TCs. To do so, we used the three different constructs Shot: ShotC, Shot∆Ctail and ShotCtail (Figure 2L). When we expressed ShotC in the tracheal TCs we found that 20% of TCs analysed (n = 200), had TCs with no lumen (Figure 6D and J), suggesting that the ABD domain is necessary for the correct de novo luminal morphogenesis.

We next expressed shotC-tail in order to address whether the Shot MT-binding domain alone could restore subcellular lumen formation. We observed that 24% of TCs analysed at the tip of GBs and DBs (n = 250) were still not able to form a subcellular lumen (Figure 6E and J), suggesting that the tracheal expression of shotC-tail was not enough to rescue the null phenotype. Finally, we expressed shot-∆C-tail to test whether Shot without the MT-binding domain could restore subcellular lumen formation. We observed that 16% of TCs analysed at the tip of GBs and DBs (n = 250) were still unable to form a subcellular lumen (Figure 6F and J). Taken together, these analyses suggested that full-length isoform A, allowing Actin-MT crosslinking is necessary for correct de novo subcellular lumen formation.

In order to further test the hypothesis that full-length Shot is needed to correctly form a subcellular lumen, we analysed shotkakP2 mutant phenotype. This allele carries an insertion of a transposable element into the intron between the second and the third transcriptional start site of shot abolishing all isoforms containing the first Calponin domain (CH1) and interfering with Shot actin-binding activity (Bottenberg et al., 2009). The penetrance and expressivity of the phenotype observed in shotkakP2 TCs was very similar to shot3 null allele with 18% of these (n = 600; 300 ganglionic and 300 dorsal TCs) not forming a subcellular lumen at all (Figure 6G,J). In addition, shotkakP2 TCs display the same MT and actin disorganisation phenotypes as shot3 TCs (Figure 6—figure supplement 1B–D). Phenotypic data from shotkakP2 together with data from transgenic rescues with the ShotC construct, lacking the CH1 domain, indicate that Shot full length is required for de novo subcellular lumen formation.

Since the actin and MT-binding domains were shown to be necessary for the proper formation of a subcellular lumen, we asked whether it was necessary to have both domains in the same protein or if simply the independent presence of these domains was enough to generate a subcellular lumen. To do so, we generated transheterozygous flies expressing two different Shot isoforms, ShotkakP2 and Shot∆EGC. Shot∆EGC is a truncated protein, lacking the EF-hand, the Gas2 and the C-tail domains of Shot, leading to complete loss of the MT-binding activity (Takács et al., 2017). The analysis of shot∆EGC mutant TC phenotypes revealed that 18% of TCs (n = 400; 200 ganglionic and 200 dorsal TCs) did not develop a TC lumen at all (Figure 6H,L) and that shot∆EGC mutant TCs display the same MT and actin disorganisation phenotypes as shot3 TCs (Figure 6—figure supplement 1E–G).

In shot∆EGC/shotkakP2 transheterozygous embryos, Shot molecules contained exclusively either the CH1 or the C-tail, but neither molecule had actin- and MT-binding activity simultaneously. These embryos displayed the same phenotype as either homozygous mutant (18% TCs with no lumen, n = 400) (Figure 6I), indicating that both the actin- and the MT-binding domains need to be present in the same Shot molecule for proper TC subcellular lumen formation.

Taken together these results indicate that Shot is able to mediate the crosstalk between MTs and actin during subcellular lumen formation, via its MT and actin-binding domains and that these have to be present in the same molecule for proper subcellular lumen formation.

Increased levels of shot are induced in TCs by DSRF

The TC-specific transcription factor bs/DSRF is important for TC specification and growth, and has been suggested to regulate the transcription of genes that modify the cytoskeleton (Guillemin et al., 1996; Olson and Nordheim, 2010). Considering the luminal phenotypes associated with bs LOF in TCs and the role of MTs in subcellular luminal formation, we asked whether shot expression in TCs could be regulated by DSRF.

In order to test this, we searched in silico for DSRF binding sites in the promoter regions of all shot isoforms using the Matscan software (Blanco et al., 2006) and the reported position weight matrix (PWM) corresponding to SRF (Khan et al., 2018Supplementary file 1). We found seven regions with at least one putative binding site (binding score larger than 70% of maximum value) within 2000 bases of the shot annotated TSS (Figure 7F and Supplementary file 1). These regions mapped to the locations of known Shot promoters (Figure 7FHahn et al., 2016). We then asked if lower Shot protein levels could be detected in bs mutant TCs. Indeed, when analysing bs in comparison to bs/+ TCs, we could detect lower levels of endogenous Shot protein and shot mRNA (Figure 7A,B and E). To rule out the possibility of DSRF regulating Shot protein levels, we analysed Shot mRNA in control and bs embryos by fluorescent in-situ hybridisation. We found that in bs TCs Shot mRNA levels were lower than in bs/+ embryos (Figure 7C,D). To confirm that the luminal phenotype observed in bs TCs was due to lower Shot levels, we analysed the TC phenotype of bs embryos upon tracheal expression of shot in these cells. We observed that increasing shot expression in TCs resulted in rescue of de novo lumen formation in bs TCs (Figure 7G–M) and recovery of cytoskeletal organisation (Figure 7—figure supplement 1). Taken together these results indicate that at least part of the luminal phenotypes associated with bs LOF in TCs are due to lower levels of Shot.

Figure 7 with 1 supplement see all
Shot expression is regulated by DSRF in TCs GB TC at st.15 from bs heterozygous controls.

(A) and homozygous (B) mutant embryos, stained with Shot (magenta in A and B, grey in A’ and B’), DSRF (green) antibodies and CBP (grey). In yellow, the outline of the TCs. Shot protein was less accumulated in TCs from homozygous bs embryos (B, B’ and E) n = 9 TCs. Scale bars are 5 µm. (C,D) DB TCs from bs heterozygous (C) control and homozygous (D) mutant embryos from wholemount FISH with a ribo-shot probe (magenta), stained with anti-betagal (green, to detect the DSRF enhancer trap lacZ expression) and CBP (blue) to mark the lumen. LacZ expression is higher in mutant embryos, homozygous for the lacZ P-element insertion (D). The yellow line marks the TC outline. Lower levels of shot mRNA were detected in bs mutant TCs when compared to control TCs (n = 8). Scale bars are 5 µm. (E) Quantification of Shot protein in control and mutant TCs and stalk cells (SC). Quantification of raw integrated pixel density in arbitrary units measured in Fiji in the TC and attached SC in each embryo. **p<0.01; ns refers to a p-value>0.1. Statistics by two-tailed Student’s t-test. (F) P1, P2 and P3 transcription start sites of the shot locus together with the specific sequences recognised by the DSRF transcription factor (squares in magenta) (adapted from Hahn et al., 2016). Dorsal and ventral TCs from control (G and J) bs (H and K) mutant embryos. The tracheal overexpression of Shot is sufficient to restore the growth of TC subcellular lumina in bs mutant background (I, L). (M) Quantification of TCs with an extended lumen: bs/+ (n = 350); bs/bs (n = 280) and bs/bs;btl >Shot (n = 210). *** p-value<0001. Statistics by two-tailed Student’s t-test.

Figure 7—source data 1

Quantification of blistered mutant phenotypes and rescue by Shot.


Shot and tau functionally overlap during subcellular lumen formation and branching

Previous Drosophila work suggested that Shot could display potential functional overlap with Tau in microtubule stabilisation (Alves-Silva et al., 2012; Voelzmann et al., 2016). To assess this functional overlap during TC subcellular branching, we started by overexpressing Tau-GFP in TCs using GAL4 induced expression (Murray et al., 1998). Upon overexpression of Tau in otherwise wt TCs, we detected ESLs in 93% of TCs, which is comparable to the ShotOE phenotype (Figure 8A–C). Like in ShotOE, this effect was dosage dependent, with more TCs with ESLs when more Tau copies were expressed (Figure 8C). We then tried to rescue the shot LOF phenotype by targeted expression of Tau in TCs. Again, this effect was dosage dependent. We achieved a 64% rescue of the shot mutant phenotype with two copies of Tau expressed, indicating that Tau can execute a similar function to Shot in de novo subcellular lumen formation (Figure 8D,J and Figure 8—figure supplements 1 and 2). We then analysed TCs double mutant for shot3 and tauMR22 null alleles (shot-tau). These double mutants showed higher numbers of TCs without lumen (85%) than TCs from shot3 (22%) or tau MR22 (3%) alone, or a mere sum of these phenotypes, indicating a synergistic genetic effect between shot and tau (Figure 8D–H). These effects were not due to differences in tracheal cell number or fate (Figure 8—figure supplement 3). Furthermore, using a mouse Tau antibody, we could detect Tau colocalizing with the growing lumen in TCs (Figure 8K). These results indicate that, as seen in neurons (Voelzmann et al., 2016), in tracheal TCs Shot and Tau functionally overlap in subcellular lumen formation and branching.

Figure 8 with 3 supplements see all
Shot and Tau functionally overlap during subcellular lumen formation.

(A–B) DB (A) and GB (B) embryonic TCs expressing tauGFP in the tracheal system, stained with GFP (green), CBP (white) and DSRF (magenta), showing the ESL phenotype induced by Tau overexpression. In A’ in B’ lumen and TC nuclei are shown, anterior side on the left, dorsal side is up; scale bar 5 μm. (C) Quantification of TCs with ESL in embryos overexpressing GFP (n = 240); ShotA (n = 400); one copy of btl >tauGFP (n = 440) or two copies of btl >tauGFP (n = 300). ***p-value<0.001; ns refers to a p-value>0.1. Statistics by two-tailed Student’s t-test. (D) Quantification of TCs without subcellular lumen in control (n = 820), shot3(n = 600), tau[MR22] (n = 180), shot3; tau[MR22](n = 180), shot3; btl >Tau (n = 440) and shot3; btl >Tau btl >Tau (n = 260) embryos. ***p-value<0.001; ns refers to a p-value>0.1. Statistics by two-tailed Student’s t-test. (E–J) Dorsal view of TCs from st. 16 embryos (genotype indicated) stained with anti-Gasp. tau deletion mutant does not display a subcellular lumen phenotype (D and F) but enhances the effect of shot mutation in the double mutant shot3; tau[MR22]. One copy of Tau is not sufficient to rescue shot3 (D and I, n = 400) but two copies rescues the shot LOF TC phenotype (D and J n = 260). Scale bars 10 µm. (K) Tau is detected in embryonic TCs. Embryonic shot::GFP dorsal TC stained with GFP (green in K, grey in K’), anti-Tau antibody (magenta in K, grey in K’) and CBP (blue in K grey in K’). Scale bar 5 μm.

Figure 8—source data 1

Quantification of tau mutant and overrexpression phenotypes and rescues.


Shot is required for subcellular luminal branching at larval stages

During larval stages, TCs ramify extensively to form many branches from the same cell body, long cytoplasmic extensions that form one cytoplasmatic membrane-bound lumen each (Best, 2019; Ghabrial et al., 2011). We questioned if Shot was also necessary for the subcellular branching and lumen extension in these larval cells. To answer this, we expressed different isoforms of Shot, Shot-RNAi and Tau in TCs from embryonic stages with a TC-specific driver (DSRF-GAL4) and analysed the phenotypes on branching and ESL formation at the end of the larval stages (Figure 9). Downregulation of Shot induced TCs with lower levels of branching and fewer lumina (Figure 9B,G,I). Whereas in control TCs each branch is filled by a subcellular lumen, in Shot-RNAi TCs these were reduced to 37% of the TCs and even so absent in most branches (Figure 9B and G). Also, on average, each control TC develops 16.9 ± 1.4 branch points (n = 10), but Shot-RNAi TCs only developed an average of 6.5 ± 0.6 branch points each (n = 8) (Figure 9B and I). We then overexpressed the long isoform of Shot (ShotA-GFP aka ShotOE condition) and could not detect extra branching points in TCs, suggesting that more than just an increased Actin-MT crosstalk is needed for the induction of TCs with supernumerary cytoplasmatic extensions (Figure 9C). Nonetheless, overexpression of ShotA, ShotCtail and Tau induced ESL in TCs, with two or more lumina in all TCs analysed (n = 10) (Figure 9C–E and H). Like in embryos, targeted expression of Shot-∆C-tail did not induce ESL in larval TCs (Figure 9F and H). Taken together, these results indicate that Shot is necessary for larval lumen formation and branching and that Actin-MT crosstalk by Shot or Tau is sufficient for ESL formation within each TC cytoplasmatic extension.

Shot and Tau modulate luminal branching in larval TCs.

Wandering larval (L3) TCs expressing only GFP (A) and different Shot and Tau constructs (B, C, D, E, F) under the control of a tracheal DSRFGAL4 driver (all except A and E where the driver used was btlGAL4). (A, A’) UASGFP (n = 8) (B, B’) UASshotRNAi, UASGFP (n = 8); (C, C’) UASShotA-GFP (n = 10); (D, D’) UASshotCtail-GFP (n = 8); (E, E’) UASTauGFP (n = 8); (F,F’) UASshot∆Ctail-GFP (n = 8). Scale bars 50 μm. (G) Quantification of the percentage of TCs with subcellular lumen; (H) quantification of the number of ESL per TC; (I) quantification of the number of branches per larval TC. *** represent a p-value<0.001; ns refers to a p-value>0.1. Statistics by two-tailed Student’s t-test.


In this study, we analysed the importance of MT-actin crosstalk through Shot and Tau in subcellular lumen formation in Drosophila embryonic and larval tracheal cells. Our work reveals novel insights into the formation of lumina by single-cells. First, that a spectraplakin in involved in the crosstalk between actin and MTs in tracheal TCs and that this crosstalk is necessary for de novo lumen formation. Absence of Shot leads to defects in MT and actin organisation and a profound alteration of the cytoskeleton in TCs (Figure 10A,C). Consequently, membrane delivery is disrupted and a novel subcellular lumen cannot be formed. Second, that once a primary lumen is formed de novo in TCs, neither actin-MT crosstalk, nor supernumerary centrosomes, are necessary for the formation of new supernumerary lumina (ESLs). New lumina can arise from branching points along the length of the pre-existing lumen, only by MT stabilisation by isoforms of Shot lacking entirely the ABD (Figure 10B,D). In these cases, we can form ESLs acentrosomally, perhaps from the MTOC activity provided by the gamma-tubulin present along the crescent lumen (Gervais and Casanova, 2010) or by other types of MTOCs. Third, spectraplakin activity is necessary to organise MTs and actin in TCs; without Shot TCs exhibit a disrupted MT and actin cytoskeleton, which can be restored by tissue specific expression of this spectraplakin. Fourth, increased levels of Shot are induced in TCs by DSRF, and Shot can rescue the subcellular lumen formation phenotypes in bs mutants. This agrees with previous observations in other systems where bs and shot mutants display similar phenotypes (Prout et al., 1997). And fifth, high-levels of Tau can replace Shot in subcellular lumen formation and branching.

Shot and Tau dynamically modulate the cytoskeleton during subcellular lumen formation.

Schematic representation of st.16 embryonic (A, B, C) and third instar larval (D) TCs; cytoplasm is in pink and luminal space in white. (A) Cytoskeletal components in a wt embryo with the actin-network (dark pink) and MTs (green). Shot and Tau are able to organise the cytoskeleton by crosslinking MTs and actin; Shot (represented with the actin domain in red and the MT-binding domain in green) mediates the crosstalk between actin and MTs as the longer isoform (ShotA), but shorter isoforms lacking part of the ABD were reported not to bind/or very weakly bind actin (ShotC). Tau is represented in blue. (B) ESLs are formed by overexpressing shot or tau by an excess of MT stabilisation from the pre-existing lumen, which probably acts as a MTOC in this case. ESLs can be induced by Shot isoforms with affected (ShotC) or without ABD (ShotC-tail). (C) In the absence of the longer isoform of Shot (ShotA) proper cytoskeletal organisation, is not established, by defective MT-actin crosslinking, and cell elongation and lumen formation fail to occur. (D) Schematic representation of larval TCs in wt, in shotOE (or tauOE) where ESLs are formed without concomitant single-cell branching and in shot KD, where both single-cell and luminal branching are reduced.

Shot promotes subcellular branching by organizing and mediating the crosstalk between microtubules and actin

Previously, it was shown that Shot was involved in tracheal fusion cell anastomosis during embryonic development (Lee and Kolodziej, 2002a). It was observed that Shot accumulates at E-cadherin-dependent contacts between fusion cells and shot LOF disrupts this contact leading to cell-fusion phenotypes. In these cells, interactions of Shot with F-actin and microtubules are functionally redundant and both targeted expression of ShotC or ShotA is sufficient to rescue the cell-fusion phenotype (Lee and Kolodziej, 2002a). Our results are more akin to what has been reported in neuronal growth cones, and both actin and MT-binding domains of Shot are required for TC extension and subcellular lumen formation (Figure 10A). In neurons, like in tracheal cells, ShotC is unable to rescue the phenotype caused by shot LOF, which is only rescued by expression of the full-length ShotA isoform (Lee and Kolodziej, 2002b). Shot has also been shown to be required for sealing epithelial sheets during dorsal closure (Takács et al., 2017). In these epithelial cells, Shot acts as a MT-actin crosslinker to regulate proper formation of the MT network. As in the case of tracheal TCs presented here, the actin- and microtubule-binding activities of Shot are simultaneously required in the same molecule, indicating that like in TCs Shot is engaged as a physical crosslinker also during dorsal closure (Takács et al., 2017).

MTs and the actin cytoskeleton perform many functions in tracheal TCs that are regulated by different actin- and MT-binding proteins. While mediators of actin function, such as Ena (Gervais and Casanova, 2010), and of MT function, like D-Lissencephaly-1 (DLis-1), have been identified previously, we show here that Shot is able to mediate crosstalk between MTs and actin during subcellular lumen formation. In Shot LOF conditions, MTs and actin are disorganised. Consequently, this Shot crosslinking function is essential for de novo lumen formation and extension. It has been previously described that in TCs of mutants affected in MT organisation, the actin-network is not perturbed (Gervais and Casanova, 2010), so the ‘actin phenotype’ observed in shot LOF cannot be a consequence of defects in the MT network. This observation indicates a possible spectraplakin function in organizing TC actin in agreement with previous observations that Shot and ACF7 can promote filopodia formation (Lee et al., 2007; Sanchez-Soriano et al., 2009).

Shot expression is regulated by DSRF in TCs

Our results show that molecular levels of Shot are important for cytoskeletal rearrangements, indicating that there is a dosage dependent effect in lumen formation and extension as well as in luminal branching events. Shot is present in many cells during development but Shot level regulation is likely to be more important in cells such as neurons and tracheal terminal cells, due to their morphology (Voelzmann et al., 2017). bs/DSRF is a TC-specific transcription factor, whose expression is triggered by Bnl signalling (Guillemin et al., 1996; Sutherland et al., 1996), and is required for TC cytoskeletal organisation (Gervais and Casanova, 2010). DSRF has also been shown to be necessary not just for the establishment of TC fate, but to ensure the progression of TC elongation (Gervais and Casanova, 2011). Cytoskeletal organisation and remodelling as well as TC elongation are tightly coupled during subcellular lumen formation and in bs mutants actin accumulation was impaired at the TC tip (Gervais and Casanova, 2010). We observe a similar actin phenotype in Shot mutants (Figure 5A–D) suggesting that the actin defects observed in DSRF mutants may be due to a lower expression of Shot in these cells.

Shot and Tau functionally overlap in subcellular lumen formation and branching

It has been suggested that spectraplakins functionally overlap with structural microtubule-associated-proteins (MAPs). Shot displays a strong functional overlap with Tau in MT stabilisation leading to the adequate delivery of synaptic proteins in Drosophila axons (Voelzmann et al., 2016). In addition, it has been proposed that a loss of MAP function in mammals results in a relatively mild phenotype due to a functional compensation accomplished by spectraplakins (Morris et al., 2011; Riederer, 2007). Furthermore, the effect of the complete lack of Shot function during dorsal closure is very subtle (Takács et al., 2017), hinting that in another Drosophila organ, Shot function might have overlaps with other MAPs.

Our overexpression and genetic data suggest that also in the context of subcellular lumen formation these two proteins functionally overlap. When we tested the tracheal overexpression of Tau in wt background, we observed extra-subcellular lumina with morphology very similar to the one caused by ShotOE. Moreover, Tau overexpression in tracheal cells was able to rescue the shot LOF phenotype similarly to ShotA expression. We propose that Tau’s rescuing capability does not depend only on its classical MT-stabilisation activity, since expression of ShotC and ShotC-tail in tracheal cells was not able to restore subcellular lumen formation. Tau MT-binding is probably just one of its functions in TCs. In fact, Tau has been shown to co-organise dynamic MTs and the actin-network in cell-free systems and growth cones (Biswas and Kalil, 2018; Cabrales Fontela et al., 2017; Elie et al., 2015). Our rescue and double mutant analyses suggest that in TCs, Shot and Tau functionally overlap in organizing the coordination between MT-bundling and actin cytoskeleton crosstalk (Figure 10A,B).

Larval lumen formation and branching

TC subcellular lumen formation starts at embryonic stages but most of its elongation and branching occurs during the extensive body growth of the third instar larva (L3). Some mutants have been reported to generate larger TCs with higher numbers of branches. Such mutants included the Hippo pathway member warts/lats1 (aka miracle-gro), and the TOR pathway inhibitor, Tsc1 (aka jolly green giant) (Ghabrial et al., 2011). In addition, activation of the FGF Receptor (Btl) pathway in TCs gives rise to ectopic branches (Jarecki et al., 1999; Lee et al., 1996). Interestingly, in all these cases, mutant TCs develop a higher number of branches but no reported ESL per branch. In larvae, as in embryonic TCs, actin is present at the basal plasma membrane and at the luminal/apical membrane. The connection between the basal actin network and the outer plasma membrane is made through Talin, which links the network to the extracellular matrix (ECM) via the integrin complex (Levi et al., 2006). Regulation of the luminal actin is done by Bitesise (Btsz), a Moe interacting protein (JayaNandanan et al., 2014). These interactions with actin are required for proper TC morphology, and mutations in either the Drosophila Talin gene rhea or btsz induce multiple convoluted lumina per TC branch (JayaNandanan et al., 2014; Levi et al., 2006). rhea and btsz ESLs seem to be misguided within the TC and present a series of U-turns and loops we did not observe in shot mutants. Also, mutations in rhea and btsz do not induce embryonic TC luminal phenotypes, suggesting that despite their interactions with actin, the mechanism of action during subcellular lumen formation and stabilisation is different. They do not seem to interact with MTs and they might have a more structural/less dynamic role in larval subcellular lumen formation. Our results suggest that Shot is able to induce larval ESLs by the same mechanism as in embryos. By modulating a dynamic crosstalk between MTs and actin that induces acentrosomal luminal branching. However, albeit necessary for larval luminal branching excess Shot alone is not sufficient to induce extra branching in TCs. Perhaps ShotOE TCs are able branch their subcellular lumen but lack a specific spatial cue to induce single-cell branching. This cue could be such as the one provided by a hypoxic tissue secreting the FGFR ligand, Bnl, which would allow for the cytoplasmic extensions needed to increase single-cell TC branching.

Spectraplakins and lumen formation in other organisms

The spectraplakin protein family of cytoskeletal regulators is present throughout the animal kingdom. In the most commonly studied model organisms we find VAB-10 in the worm Caenorhabditis elegans, and, in vertebrates, dystonin (also known as Bullous Pemphigoid Antigen 1/BPAG1) and Microtubule-Actin Crosslinking Fac- tor 1 (MACF1; also known as Actin Crosslinking Family 7/ACF7, Macrophin, Magellan) (Voelzmann et al., 2017). They are usually strongly expressed in the nervous system and most of their functions have been unraveled by studying nervous system development and axonal cell biology (Zhang et al., 2017). Spectraplakin roles have also been reported in cell-cell adhesion and cell migration (Röper and Brown, 2003). Recently, attention has gone into the role of spectraplakins not only during normal cellular processes but also in human disease, from neurodegeneration to infection and cancer (Zhang et al., 2017). However, not much is known about a role for spectraplakins neither during lumen formation nor during subcellular branching events. Here, we provide evidence for the involvement of the Drosophila spectraplakin Shot in subcellular lumen formation and luminal branching. Through its actin- and MT- binding domains, Shot is necessary for subcellular lumen formation and branching (Figure 10). This function can be functionally replaced by Tau, another microtubule- associated protein which has been shown to be able to crosslink MTs and actin (Biswas and Kalil, 2018). A similar crosslink between MTs and actin may in place during vertebrate lumen formation and in other subcellular branching events.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Genetic reagent
(D. melanogaster)
shot3Bloomington Drosophila Stock CenterBSDC:2282
Lee et al., 2000
Genetic reagent
(D. melanogaster)
shotkakP2Bloomington Drosophila Stock CenterBSDC:29034
Gregory and Brown, 1998
Genetic reagent
(D. melanogaster)
shotΔEGCF. Jankovics-Takács et al., 2017
Genetic reagent
(D. melanogaster)
Rca1G012S.J. Araújo-Ricolo et al., 2016
Genetic reagent
(D. melanogaster)
tau[MR22]Bloomington Drosophila Stock CenterBDSC:9530
Doerflinger et al., 2003
Genetic reagent
(D. melanogaster)
Guillemin et al., 1996
Genetic reagent
(D. melanogaster)
btl::moeRFPM. Affolter-Ribeiro et al., 2004
Genetic reagent
(D. melanogaster)
btl-Gal4M. Affolter--
Genetic reagent
(D. melanogaster)
M. Metzstein
Genetic reagent
(D. melanogaster)
UAS-shot L(A) GFPBloomington Drosophila Stock CenterBDSC:29044
Lee and Kolodziej, 2002a
Genetic reagent
(D. melanogaster)
UAS-shot L(C)-GFPBloomington Stock CenterBDSC:29042
Lee and Kolodziej, 2002a
Genetic reagent
(D. melanogaster)
UAS-shot L(C)-GFPBloomington Stock CenterBDSC:29043
Lee and Kolodziej, 2002a
Genetic reagent
(D. melanogaster)
UAS-shot-LA-ΔCtail-GFPN. Sanchez-Soriano-Alves-Silva et al., 2012
Genetic reagent
(D. melanogaster)
UAS-shot-LA-Ctail-GFPN. Sanchez-Soriano-Alves-Silva et al., 2012
Genetic reagent
(D. melanogaster)
UAS-TauGFPM. Llimargas-Llimargas et al., 2004
Genetic reagent
(D. melanogaster)
UAS-bazooka YFPJ. Casanova-Gervais and Casanova, 2010
Genetic reagent
(D. melanogaster)
UAS-srcGFPBloomington Stock CenterBDSC 5432
Kaltschmidt et al., 2000
Genetic reagent
(D. melanogaster)
UAS-shot RNAiBloomington Stock CenterBSSC_64041
Perkins et al., 2015
Genetic reagent
(D. melanogaster)
UAS-lifeActRFPBloomington Stock CenterBDSC:58715
Genetic reagent
(D. melanogaster)
shot::GFPJ.Pastor-Pareja-Sun et al., 2019
Antibodymouse anti GASPDSHBID: AB_528492
Antibodyrat anti DE-cadDSHBID:AB528120
Antibodyguinea Pig anti CP309V. Brodu-1:1000
Antibodyrabbit and rat anti DSRFJ. Casanova-1:500
Antibodygoat anti-GFPAbcamCatalog # AB66731:500
Antibodyrabbit anti-GFPInvitrogenCatalog # A111221:500
Antibodychicken anti-βgalAbcamCatalog # AB1344351:500
Antibodymouse anti-βgalPromegaCatalog # 237831:500
Antibodymouse antiacetylated tubulinMilliporeCatalog # 34081:100
Antibodyguinea pig anti ShotK. Röper-1:1000
Antibodymouse anti-Tau-1Sigma-AldrichCatalog # MAB3420
Clone PC1C6
Antibodymouse anti-ActinMP BiomedicalsCatalog # 6910011:500
Antibodyanti-dig POD fragmentsRocheCatalog # 11 207 733 9101:1000
AntibodyGoat Anti-Mouse Cy3
Catalog # 115-165-0031:500
AntibodyGoat anti-Mouse Alexa555
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-214241:500
AntibodyGoat anti-mouse Alexa488 (Polyclonal)LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A110291:500
AntibodyDonkey anti mouse Alexa647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A315711:500
AntibodyGoat anti-chicken Alexa555
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-214371:500
AntibodyGoat anti-chicken
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-110391:500
AntibodyGoat anti-chicken Alexa Fluor 647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-214491:500
AntibodyGoat anti-rabbit Alexa 555
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-214291:500
AntibodyGoat anti-rabbit Alexa488
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A110081:500
Antibodygoat anti-rabbit Alexa647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-212441:500
AntibodyGoat anti-guinea pig Cy2
Catalog # 706-225-1481:500
AntibodyGoat anti-guinea pig 647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-212441:500
AntibodyDonkey anti- mouse Alexa 555
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A315701:500
AntibodyDonkey anti- mouse Alexa488
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-212021:500
AntibodyDonkey anti- mouse Alexa647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A315711:500
AntibodyDonkey anti- rabbit Alexa555
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A315721:500
AntibodyDonkey anti- rabbit Alexa488
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-212061:500
AntibodyDonkey anti- rabbit Alexa647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog #A315731:500
AntibodyDonkey anti-goat Alexa 555
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog #A214321:500
AntibodyDonkey anti-goat Alexa 488
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A328141:500
AntibodyDonkey anti-rat Cy3
Catalog #712-165-1501:500
AntibodyGoat Anti-rat Alexa 488
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A110061:500
AntibodyGoat anti-Rat Alexa Fluor647
LIFE TECHNOLOGIES/Thermofisher ScientificCatalog # A-212471:500
AntibodyBiotinylated goat anti-mouse IgM
Thermo Fischer ScientificCatalog #318041:500
Sequence-based reagentShot mRNA probeThis work-1:100
OtherCBPJ. Casanova-1:500
OtherVectastain-ABC kitVector
OtherTSA Cy3Akoya BioNEL744001KT1:100

D. melanogaster strains and genetics

Request a detailed protocol

shot3 (Lee et al., 2000), shotkakP2 (Gregory and Brown, 1998), shotΔEGC (Takács et al., 2017), Rca1G012 (Ricolo et al., 2016), tau[MR22] (Doerflinger et al., 2003), bs03267 (Guillemin et al., 1996), btl::moeRFP (Ribeiro et al., 2004), btl-Gal4 (Shiga Y., 1996), DSRF4x-Gal4 (gift from A. Ghabrial) UAS-shot L(A) and GFP and UAS-shot L(C)-GFP (Lee and Kolodziej, 2002a), UAS-shot-L(A)-ΔCtail-GFP and UAS-shot-L(A)-Ctail-GFP (Alves-Silva et al., 2012), UAS-TauGFP (Murray et al., 1998 and Llimargas et al., 2004), UAS-srcGFP (Kaltschmidt et al., 2000), UAS-shot-RNAi (TRiP.HMJ23381, BDSC), shot::GFP (Sun., T., 2019), UASlifeActRFP (BDSC), UAS-bazYFP (Gervais and Casanova, 2010). Chromosomes were balanced over LacZ or GFP-labelled balancer chromosomes (BDSC). Overexpression and rescue experiments were carried out either with btl-GAL4 (BDSC) or DSRF4X-GAL4 (M. Metzstein) at 25°C.

Immunohistochemistry, image acquisition, and processing

Request a detailed protocol

All stage embryos, collected on agar plates overnight (O/N), were dechorionated with bleach and fixed for 20 min (or 10 min for MT staining) in 4% formaldehyde, PBS (0.1 M NaCl 10 mM phosphate buffer, pH 7.4)/Heptane 1:1. Washes were done with PBT (PBS, 0.1% Tween). Primary antibody incubation was performed in fresh PBT-BSA o/n at 4°C. Secondary antibody incubation was done in PBT-BSA at room temperature (RT) in the dark for 2 hr.

For DAB histochemistry (used to recognise 2A12/anti-Gasp antibody) after incubation with secondary antibody (mouse IgM biotinylated antibody) embryos were treated with AB solution for 30 min at R/T (Avidin-Biotinylated Horseradish Peroxidase from Vectastain-ABC KIT of Vector Laboratories 1:200 in PBT).

Embryos were incubated with the DAB solution (DAB 0.12% Nickel-Sulphate-Cobalt Chloride, 0.3 % H202) until black colour was achieved, usually 2–5 min.

The primary antibodies used were: mouse anti-Gasp (2A12) 1:5, rat anti-DE-cad (DCAD2) 1:100, from Developmental Studies Hybridoma Bank (DSHB), guinea pig anti-CP309 (from V. Brodu) 1:1000, rabbit and rat anti-DSRF 1:500 (both produced by N. Martín in J. Casanova Lab), goat and rabbit anti-GFP 1:500 (From Roche and Jackson), chicken, rabbit and mouse anti-βgal 1:500 (Cappel, Promega, Abcam), mouse anti acetylated tubulin 1:100 (Millipore), mouse anti-actin 1:500 (MP Biomedicals) guinea pig anti-Shot 1:1000 (K. Röper), mouse anti-Tau-1 1:200 (Sigma Aldrich). Cy3, Cy2, or Cy5 conjugated secondary antibody (Jackson Immuno Research) or Alexa 488, Alexa 647 and Alexa 555 conjugated secondary antibody (Thermo Fischer Scientific) from donkey and/or goat were used 1:500 in PBT 0.5% BSA. Two probes, to label luminal chitin were used: Fluostain 1:200 (FB28, Sigma), and chitin binding protein CBP 1:500 (produced by N. Martín in J. Casanova Lab). Bright field photographs were taken using a Nikon Eclipse 80i microscope with a 20X or 40X objective. Photoshop 21.2.4 and Fiji (ImageJ 2.1.0) were used for measurements, adjustments and to assemble figures. Fluorescence confocal images of fixed embryos where obtained with Leica TCS-SPE system using 20X and 63X (1.40–0.60 oil) objectives (Leica). Fiji (ImageJ 2.1.0) (Schindelin et al., 2012) was used for measurements and adjustments. The images shown are, otherwise stated in the text, max-intensity projection of Z-stack section.

Fluorescent in-situ hybridisation (FISH) shot mRNA probe was synthesised using a PCR-based technique. The GAS-2 region was selected as target for the probe. The forward (TAATACGACTCACTATAGGGAGAAATTCGATACATCTGGCTTG) and reverse (ATTTAGGTGACACTATAGAAGAGTCTGTACTTGCCCTCGCC) primers were used. The gene region of interest, flanked by the T7 and Sp6 sequences, was amplified from previously isolated genomic DNA via PCR under standard PCR conditions. After RNA synthesis, the newly synthesised RNA probe was then purified by precipitation, resuspended in hybridisation buffer, and stored at −20°C.

Freshly fixed embryos were washed and kept at 56°C in Hybridisation Buffer for 3 hr for pre-hybridisation. In the last 10 min of pre-hybridisation, probes (1:100 in hybridisation buffer) were prepared for hybridisation. The probes were hybridised with the embryos at 56°C overnight. The next day the embryos were washed and incubated in POD-conjugated anti-Dig (in PBT) for 1 hr. The fluorescent signal was developed by the addition of Cy3 Amplification Reagent (1:100) diluted in TSA Amplification Diluent and incubation at room temperature in the dark for 10 min. Afterwards, the embryos were antibody stained and then mounted in Fluoromount medium and analysed.

Quantification and statistics

Request a detailed protocol

Total number of embryos and TCs quantified (n) are provided in the figure legends. Measurements were imported and treated in Microsoft Excel, where graphics were generated. Error bars in bar graphics and ±in text denote Standard Error of the Mean (SEM).

Box Plot description: within each box, horizontal central line shows the median; box limits indicate the 25th (bottom) and 75th (top) percentiles as determined by Excel software. Whiskers extend vertically 1.5 times the interquartile range, from the 25th and 75th percentiles. The black x in the box represents the mean and the black dots denote observations outside the range (outliers). Statistical analyses were performed applying the T-test. Differences were considered significant when p<0.05. In graphics; **p<0.01, ***p<0.001.

Time-lapse imaging

Request a detailed protocol

Dechorionated embryos were immobilised with heptane glue on a coverslip and covered with Oil 10 s Voltalef (VWR). To visualise tracheal Shot in vivo, btlGAL4UASShotC-GFP was used in the indicated backgrounds. Actin in tracheal cells was visualised with btl::moeRFP or btlGAL4UASlifeActRFP where indicated. Imaging was done with a spectral confocal microscope Leica TCS SP5. The images were acquired for the times specified over 50–75 µm from st. 15 embryos; Z-projections and videos were assembled using Fiji (Schindelin et al., 2012).


  1. 1
    The Drosophila SRF homolog is expressed in a subset of tracheal cells and maps within a genomic region required for tracheal development
    1. M Affolter
    2. J Montagne
    3. U Walldorf
    4. J Groppe
    5. U Kloter
    6. M LaRosa
    7. WJ Gehring
    Development 120:743–753.
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
    The pruned gene encodes the Drosophila serum response factor and regulates cytoplasmic outgrowth during terminal branching of the tracheal system
    1. K Guillemin
    2. J Groppe
    3. K Ducker
    4. R Treisman
    5. E Hafen
    6. M Affolter
    7. MA Krasnow
    Development 122:1353–1362.
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
    The plakin short stop and the RhoA GTPase are required for E-cadherin-dependent apical surface remodeling during tracheal tube fusion
    1. S Lee
    2. PA Kolodziej
    Development 129:1509–1520.
  32. 32
    Short stop provides an essential link between F-actin and microtubules during axon extension
    1. S Lee
    2. PA Kolodziej
    Development 129:1195–1204.
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
    Autosomal mutations affecting adhesion between wing surfaces in Drosophila melanogaster
    1. M Prout
    2. Z Damania
    3. J Soong
    4. D Fristrom
    5. JW Fristrom
    Genetics 146:275–285.
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
    The post-embryonic development of the tracheal system in Drosophila melanogaster
    1. JM Whitten
    Journal of Cell Science 1:123–150.
  63. 63

Decision letter

  1. Derek Applewhite
    Reviewing Editor; Reed College, United States
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

Acceptance summary:

This work is significant because it demonstrates the importance of actin-microtubule cross-linking in de novo lumen formation in single cells and reveals interesting molecular details of this process. The authors focus on the developing tracheal system of Drosophila, however, the results have implications for different developmental processes and disease pathologies that involve branching morphogenesis.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for choosing to send your work, "Coordinated crosstalk between microtubules and actin by a spectraplakin regulates lumen formation and branching", for consideration at eLife. Your initial submission has been assessed by a Senior Editor in consultation with a member of the Board of Reviewing Editors and three reviewers. Although the work is of interest, we regret to inform you that the findings at this stage are too preliminary for further consideration at eLife.

Specifically, the reviewers felt that this manuscript was well-done, characterizing the requirement for the Shot gene product in an interesting experimental setting and adds a new piece of information to this important protein. The findings presented here definitely progress the field of Drosophila tracheal development. However, this manuscript does not sufficiently address how Shot links leading-edge protrusions and centrosomes, how it is organized into pre-lumen tract, and how it contributes to further assembly of luminal membrane and directed secretion. Without clues to these fundamental questions, it appears that this paper is most appropriate for expert readers interested in Drosophila cell biology and tracheal development but is less well suited for the broad readership of eLife.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for choosing to send your work entitled "Coordinated crosstalk between microtubules and actin by a spectraplakin regulates lumen formation and branching" for consideration at eLife. Your letter of appeal has been considered by a Senior Editor and a Reviewing editor, and we are prepared to consider a revised submission with no guarantees of acceptance.

The major concern of the reviewers was that this manuscript does not provide sufficient novel insight into how the tracheal terminal branch is formed, or how Shot coordinates actin filament and microtubule to organize the lumen membrane organization. Therefore, in the revised version of your paper, please make the conceptual advances achieved by your study more clear.

Furthermore, we expect that you will address the comments of the reviewers from Review Commons to the best of your ability and provide a detailed point-by-point response outlining your revisions.

Please also find below the list of concerns that the Reviewing Editor has emphasized, based on the discussion with the three reviewers:

1) The use of bar plots throughout the manuscript is highly undesirable as bar plots can obscure patterns in the data and hide the full spread of the data.

2) Comments on specific figures/staining procedures.

a) It is hard to distinguish the centrosome staining in Figure 3 from what appears to be background puncta/cross-reactivity (in particular B').

b) Similarly, the acetylated tubulin staining in Figure 4C may require attention. It appears that the morphology of the entire microtubule network changes over time. If this is indeed the case it may warrant an explanation.

c) Paraformaldehyde fixation is generally unable to capture dynamic microtubules and given that Shot is an EB1-dependent plus-end tracking protein this fixation protocol is likely missing this population of microtubules (Figure 2). Methanol fixation has been successfully used in fly embryos before (see: Clohisey, SMR, Dzhindzhev NS, Ohkura H (2014) Kank Is an EB1 Interacting Protein that Localises to Muscle-Tendon Attachment Sites in Drosophila. PLoS ONE 9(9): e106112; Shuoshuo Wang, Adriana Reuveny, Talila Volk; Nesprin provides elastic properties to muscle nuclei by cooperating with spectraplakin and EB1. J Cell Biol 25 May 2015; 209 (4): 529-538; G.H. Thomas, D.P. Kiehart; Β heavy-spectrin has a restricted tissue and subcellular distribution during Drosophila embryogenesis. Development 1994 120: 2039-2050).

d) Figure 7: A more appropriate comparison would be Shot protein level in TC compared to that in the stalk cell (SC) and fusion cell (FC) and how DSRF mutation influences the relative Shot level in TC compared to SC and FC. It seems odd that the example in Figure 7B shows Shot level in TC appearing much lower than in SC. Since Shot is widely expressed in many cell types, presumably DSRF mutation may reduce Shot level to the level of other tracheal cell types. The data could be improved by including TC, FC, and SC in the same confocal view and measuring Shot levels.

Please note that Shot staining in Figure 4A and B appears more concentrated to growing lumen, compared to Figure 7A and B where the lumen is not included in the picture. Perhaps variation in TC shape gives different impressions of Shot localization in various stages and angles of cell images.


Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Specifically, the reviewers felt that this manuscript was well-done, characterizing the requirement for the Shot gene product in an interesting experimental setting and adds a new piece of information to this important protein. The findings presented here definitely progress the field of Drosophila tracheal development. However, this manuscript does not sufficiently address how Shot links leading-edge protrusions and centrosomes, how it is organized into pre-lumen tract, and how it contributes to further assembly of luminal membrane and directed secretion. Without clues to these fundamental questions, it appears that this paper is most appropriate for expert readers interested in Drosophila cell biology and tracheal development but is less well suited for the broad readership of eLife.

Our work on single-cell branching mechanisms is well integrated within the fields of Cell and Developmental Biology, both subject areas in your journal. Specifically, we believe we provide a solid and novel study on cytoskeletal dynamics during lumen formation and branching, important events during vascular development and remodelling. Furthermore, branching abnormalities inflict greatly in development and disease, making these mechanisms interesting to the wide community of life scientists.

Other points offered as a justification for the denial to publish our work are described in the decision letter and we also do not agree with these. Here is a point by point answer to them:

1) "this manuscript does not sufficiently address how Shot links leading-edge protrusions and centrosomes”. We totally disagree with this statement. We show Shot provides the connection between MT bundles stemming from the centrosome and the actin at the tip of the tracheal terminal cell. We show this in vivo (by live imaging), using different genetic conditions and by analysing cells in fixed embryos. We also dissect which Shot domains are necessary for this crosstalk, the MT binding domain and the actin-binding domain. Furthermore, we show that Shot can stabilize MT bundles and create new branching events leading to extra lumina in terminal cells in embryos and larvae.

2) We do not show "how it is organized into pre-lumen tract”. We not sure what is meant by this statement. Shot is organized into prelumen tracts together with MTs as we show repeatedly throughout our reported work.

3) "and how it contributes to further assembly of luminal membrane and directed secretion” We think this is beyond the scope of this work. We know this is very interesting and, of course, we are very interested on how directed secretion is regulated (by Shot or by other molecules), but the whole question is material for another article.

4) Last but not least, judging by the above-mentioned reasons for rejection, it seems this manuscript only reports an involvement of Shot in cytoskeletal dynamics. However, we also show that Shot is transcriptionally regulated by the Drosophila SRF transcription factor (blistered), a novel finding with implications in the transcriptional regulation of cytoskeletal dynamics and epithelial adhesion. And we show that Tau can provide an akin MT-actin crosslinking activity during single-cell branching and lumen formation, another novel finding with broad implications in development and ageing.

[Editors’ note: what follows is the authors’ response to the second round of review.]

The major concern of the reviewers was that this manuscript does not provide sufficient novel insight into how the tracheal terminal branch is formed, or how Shot coordinates actin filament and microtubule to organize the lumen membrane organization. Therefore, in the revised version of your paper, please make the conceptual advances achieved by your study more clear.

We provide solid evidence for the involvement of a spectraplakin in lumen formation, a crosslinking event shown for the first time to be important in tubulogenesis. Our work focuses on the cytoskeleton and we show that Shot helps organize the MT and actin during lumen formation. We think directed membrane secretion is the next step in this work, but we also believe this is beyond the scope of this work and a matter for another paper altogether.

However, we have revised the manuscript to make these cytoskeletal advances more clear. In addition, we provide new evidence that membrane delivery is disrupted in shot3 mutants, as expected by the general disruption of the cytoskeleton induce by the lack of MT-actin crosslinking by Shot (Figure 1—figure supplement 1).

Furthermore, we expect that you will address the comments of the reviewers from Review Commons to the best of your ability and provide a detailed point-by-point response outlining your revisions.

Please also find below the list of concerns that the Reviewing Editor has emphasized, based on the discussion with the three reviewers:

1) The use of bar plots throughout the manuscript is highly undesirable as bar plots can obscure patterns in the data and hide the full spread of the data.

We thank you for this comment, and we agree that that is the case. Where possible, we have redone all plots to Box and whisker plots to fully show the full spread of the data. Our conclusions remain the same in all cases.

2) Comments on specific figures/staining procedures.

a) It is hard to distinguish the centrosome staining in Figure 3 from what appears to be background puncta/cross-reactivity (in particular B').

We use an antibody anti-CP309 to detect centrosomes in Figure 3. Because this is an antibody staining, it detects all centrosomes in all cells in the embryo. Therefore, what can be seen as puncta, is not background but centrosomes in other tissues surrounding the tracheal TCs. Regarding cross-reactivity, we agree that when there is a subcellular lumen sometimes antibodies cross-react with an unidentified antigen at the luminal surface and in Figure 3B this was what was detected (note that Figure 3A is from an embryo in stages before lumen formation). However, we would like to state that this does not interfere with centrosomal detection.

b) Similarly, the acetylated tubulin staining in Figure 4C may require attention. It appears that the morphology of the entire microtubule network changes over time. If this is indeed the case it may warrant an explanation.

We agree the whole TC morphology changes overtime. This is a developing structure and both shape and the cytoskeleton are changing constantly. This is the reason why, in some instances, we provide snapshots of different stages as is the case of Figure 4 C-E which shows the beginning, middle and final stages of cellular extension. In addition, detection is done in wholemount embryos, using antibodies, which detect MTs in tracheal cells and all other cells in the embryo.

c) Paraformaldehyde fixation is generally unable to capture dynamic microtubules and given that Shot is an EB1-dependent plus-end tracking protein this fixation protocol is likely missing this population of microtubules (Figure 2). Methanol fixation has been successfully used in fly embryos before (see: Clohisey, SMR, Dzhindzhev NS, Ohkura H (2014) Kank Is an EB1 Interacting Protein that Localises to Muscle-Tendon Attachment Sites in Drosophila. PLoS ONE 9(9): e106112; Shuoshuo Wang, Adriana Reuveny, Talila Volk; Nesprin provides elastic properties to muscle nuclei by cooperating with spectraplakin and EB1. J Cell Biol 25 May 2015; 209 (4): 529-538; G.H. Thomas, D.P. Kiehart; Β heavy-spectrin has a restricted tissue and subcellular distribution during Drosophila embryogenesis. Development 1994 120: 2039-2050).

We apologise if there was not enough detail regarding our fixing protocols. We do not fix with paraformaldehyde, but formaldehyde as stated in the Materials and methods. We have tested many different conditions in order to better detect both microtubules and actin in the same cell, within the whole embryo. During our studies on the influence of centrosomes in subcellular lumen formation we tested methanol fixation, cold fixation, boiling fixation and the rapid fixing protocol we use in this work and we could conclude that rapid fixing gives us the best results for all structures we need to detect. Some of these fixation methods are better for MTs, others for centrosomes, others for actin and luminal structures, but to detect them all, according to our data, rapid formaldehyde fixation is the best (“Fluorescent Analysis of Drosophila Embryos,” Chapter 9, in Drosophila protocols (eds. Sullivan et al.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2000 and Ricolo et al., 2016).

In addition, regarding Shot, as in Figure 2, we also present time-lapse microscopy videos, where Shot can be analysed without any fixation protocol.

d) Figure 7: A more appropriate comparison would be Shot protein level in TC compared to that in the stalk cell (SC) and fusion cell (FC) and how DSRF mutation influences the relative Shot level in TC compared to SC and FC. It seems odd that the example in Figure 7B shows Shot level in TC appearing much lower than in SC. Since Shot is widely expressed in many cell types, presumably DSRF mutation may reduce Shot level to the level of other tracheal cell types. The data could be improved by including TC, FC, and SC in the same confocal view and measuring Shot levels.

Please note that Shot staining in Figure 4A and B appears more concentrated to growing lumen, compared to Figure 7A and B where the lumen is not included in the picture. Perhaps variation in TC shape gives different impressions of Shot localization in various stages and angles of cell images.

We have measured Shot protein accumulation in TCs and stalk cells (SCs) and have added these quantifications to the manuscript. According to our results, in a bs mutant background Shot levels in SCs are similar, to controls. However, in TCs they are much lower. We conclude and discuss in the manuscript, that Shot levels in TCs need to be higher than in SCs in order to allow the formation of a subcellular lumen. Regulation of Shot expression in SCs is independent of DSRF and most likely regulated by other transcription factors like on other, non-tracheal cells in the embryo. TC fate and subcellular lumen formation are regulated by DSRF and one of its outcomes is the higher expression of Shot in these cells. These protein data are now backed up by our in situ hybridization experiments (requested by Review Commons reviewers), which show that control TCs display higher levels of Shot mRNA compared to shot mutant TCs (Figure 7C).

We would also like to emphasize that quantifications are always done taking into account the whole TCs, taking all the confocal Z-sections. Quantification of Shot protein accumulation (as all other quantifications in our manuscript) is done comparing control and shot mutant TCs at the same stages of development. In the case of figure / AB, there is no lumen because this is an early stage 15 embryo (when lumen has not yet been formed) in the control and in bs mutant. Since bs mutants do not develop a subcellular lumen in most TCs, it is more accurate to measure Shot protein levels in stages before lumen formation. Otherwise, these would not be comparable.

Reviewer #1 (Evidence, reproducibility and clarity):

This study provides solid evidences showing a role for the spectraplakin Short-stop (Shot) in subcellular lumen formation in the Drosophila embryonic and larval trachea. This subcellular morphogenetic process relies on an inward membrane growth that depends on the proper organization of actin and microtubules (MTs) in terminal cells (TCs). Shot depletion leads to a defective or absent lumen while conversely, Shot overexpression promotes excessive branching, independently on the regulation of centrosome numbers previously shown to be important for the regulation of the lumen formation process (Ricolo et al., 2016). Shot is rather important to regulate the organization of the cytoskeleton by crosslinking MTs and actin. Shot expression in TCs is controlled by the Drosophila Serum Response Factor (DSRF) transcription factor. Finally Shot functionally overlaps with the MT-stabilizing protein Tau to promote lumen morphogenesis.

The figures are clear, and the questions well addressed with carefully designed and controlled experiments. However, I would have few suggestions that will hopefully make some points clearer.

Major comments:

– Statistical analyses should be added for comparisons of proportions, including Figure 1E, 1L, Figure 2G-I, Figure 6L, Figure 7K, Figure 8C-D and Figure 9G.

We agree with this and have now redone all graphs and revised all quantifications. We have added error bars in all bar graphs, changed many to box plots (to provide a better grasp of the value-ranges) and have provided statistical analysis where appropriate. We have also redone all graphics and phenotype reporting in relation to total terminal cells (rather than embryos or GBs and DBs TCs), because this is a more stringent and comparable way of quantifying all our results.

– It is not always clear what genotype has been used as the "wt" genotype, as in Figure S2 or Figure 3 for example, this should be added to figure legends.

We have now clarified which flies are used as controls in each experiment throughout the paper. We have left wt where flies were wt and changed all other cases to either the genotype or “control”.

– Live imaging of Shot has been performed with ShotC-GFP, that cannot bind actin. Don't the authors think ShotA-GFP would reflect more accurately Shot endogenous behavior as it interacts both with actin and MTs? It would be better to show this, even if the results shown here tend to be consistent with Shot endogenous localization shown with Shot antibody staining.

We agree and we apologise about this. We have realized there was a mistake in the figure legend of Video 3, which stated the stock we used to do time-lapse was UASShotCGFP when in fact it was ShotAGFP. We would not have drawn the conclusions without analysing live UASShotA embryos. With this new version of the manuscript, we have corrected the figure legend and provide a new video (Video 4) of a time lapse experiment using UASShotAGFP and btl::moeRFP to detect ShotA and actin in live embryos over time.

– It is of course not possible to generate CRISPR mutant flies with mutations in putative DSRF binding sites in a reasonable amount of time, to confirm that Shot transcription is controlled by DSRF. It would thus be nice to reveal shot mRNA expression with in situ hybridization experiments in wt vs. bs embryos. This would confirm that Shot mRNA is downregulated upon DSRF inhibition and rule out a possible indirect effect on Shot protein stability for example.

We believe the presented 3-way approach (in silico, protein quantification and phenotype rescue) is sufficient to show that Shot expression is regulated by DSRF. It is unlikely that we are dealing with protein stability or other issues, because we can rescue the lumen elongation phenotype by solely expressing Shot in TCs. However, we agree that an in situ hybridization experiment provides data to confirm this, and we now provide a conclusive one. Here, it is clear that Shot expression is higher in control TCs and lower in bs TCs (Figure 7, C, D).

– In the same figure, it would also be interesting to show what happens to actin and MTs in bs TCs and to which extent their organization is rescued by Shot overexpression.

We have analysed MTs and actin in bs TCs as well as in Shot-rescued TCs. We provide these results in Figure 7—figure supplement 1.

– UAS-EB1GFP does not seem to be an appropriate control in Figure 9 (A and B) since it can affect MT dynamics (Vitre, B. et al. EB1 regulates microtubule dynamics and tubulin sheet closure in vitro. Nat. Cell Biol. 10, 415-421 (2008)). Why not simply use an UAS-GFP?

We have not detected any notorious larval TC phenotypes by overexpressing UASEB1GFP in TCs. Their branching is comparable to that in previous studies (for example, Schotenfeld-Roames, et al., 2014) and there were no detectable luminal branching phenotypes. However, we agree it is more correct to analyse cells with a plain GFP and have repeated the controls for this experiment using DSRFGAL4UASGFP. This is now shown in Figure 9A.

– Shot and probably Tau crosslinking activities are important for lumen morphogenesis with a striking increase in the number of embryos without lumen in shot3 and shot3 tauMR22 mutant embryos. The rescue experiments clearly show that Shot binding to both MT and actin is essential for efficient rescue. The same might apply to Tau since it is able to crosslink actin and MTs (Elie et al., 2015). I believe showing actin and MTs organization in these rescue experiments would be necessary.

We have analysed MTs and actin in tau-rescued shot mutant TCs. We provide these results in 2 new Figures: Figure 8—figure supplement 1 and 2.

Second, the overexpression experiments indicate that Shot is able to induce extra lumen formation even when unable to bind actin as shown with the increase in the number of supernumerary lumina (ESLs) under overexpression of ShotC and ShotCtail to a lesser extent. This phenotype is also observed under Tau overexpression. This suggest that not crosslinking anymore but rather making MTs more stable could be sufficient to promote extra lumen formation in a wt context. Stabilising MTs by treatment with Taxol might thus be sufficient to promote ESL formation. I am fully aware of the difficulty of treating Drosophila embryos with drugs, making this experiment hard to do, but I think this dual function of Shot and Tau (crosslinking actin and MTs to promote branching vs. stabilizing MTs leading to excessive branching) should be discussed.

In Figure 2 we show not just that UASShotC is able to induce ESL but also that UAS-ShotCtail containing only the MT binding domain of Shot is enough to induce ESLs in TCs as the reviewer noted, but we also show that UAS-∆Ctail, which has been reported to bind actin but not MTs is not able to induce ESL (Figure 2 H and J).

We agree Taxol treatment would be a nice experiment to do, however we believe we provide enough evidence that MT stability is enough for ESL induction whereas de novo lumen formation requires crosslinking of MTs to actin. As advised, we have discussed better both Shot and Tau dual function in ESL generation and de novo lumen formation.

Reviewer #1 (Significance):

The findings shown in this manuscript shed an important light on the way subcellular morphogenesis occurs. It was known that both actin and MTs were required in this process, particularly during the formation of Drosophila trachea (Jayanandanan et al., 2019; Gervais and Casanova, 2010). This work provides additional molecular insights into the way branching morphogenesis from a single cell occurs in vivo, clearly demonstrating a requirement for actin-MT crosslinking mediated by Shot and Tau.

This could be of great interest in the field of branching morphogenesis and lumen formation, not only in invertebrates but also in vertebrates where such a crosslinking might occur in the vasculature, the lung, the kidney or the mammary gland for example (Ochoa-Espinosa, A. & Affolter, M. Branching Morphogenesis: From Cells to Organs and Back. Cold Spring Harb Perspect Biol 4, a008243-a008243 (2012)).

Reviewer #2 (Evidence, reproducibility and clarity):


The development of branched structures with intracellular lumen is widely observed in single cells of circulatory systems. However, the molecular and cellular mechanisms of this complex morphogenesis are largely unknown. In previous study, the authors revealed that centrosome as a microtubule organizing center (MTOC) located at the apical junction contributes subcellular lumen formation in the terminal cells of Drosophila tracheal system. The microtubule bundles organized by MTOC are suggested to serve as trafficking mediators and structural stabilizers for the newly elongated lumen.

In this manuscript, they focused on a Drosophila spectraplakin, Shot, which have been reported to crosslink MT minus-ends to actin network, in the subcellular lumen formation. The paper started by description of lumen elongation defect of the tracheal terminal cells in the shot3 null mutant. The overexpression of full-length and series of truncated form of shot exhibited extra-subcellular lumina (ESL) in TCs, suggesting that Shot is required for the lumen formation in dose dependent manner. They next addressed whether Shot overexpression induces ESL through the supernumerary centrosomes as in Rca1 mutant, however the number of centrosomes was not affected. Moreover, the ESL were sprouted distally from the apical junction, suggesting that Shot operate in different way from the Rca1-dependent microtubule organization. To get mechanistic insight of Shot in the luminal formation, they checked localization of the Shot and found it localized with stable MTs around the nascent lumen and with the F-actin at the tip of the cell during the cell elongation and subcellular lumen formation. In shot3 mutant, the MT-bundles were no longer localized to apical region and the actin accumulation at the tip of the cell was also reduced. The rescue experiments using several truncated forms of Shot, and well-designed genetic analysis using various shot mutants revealed that both MT binding domain and actin binding domains are needed to develop the lumen. The expression of shot was under the regulation by terminal cell-specific transcription factor bs/DSRF, and the overexpression of shot in bs LOF mutant suppressed its phenotype, indicated that part of the luminal phenotype of bs mutant in terminal cells are due to lower levels of the activity of shot. Finally, they checked whether Tau can compensate the function of shot in the subcellular lumen formation. The lumen elongation defect in shot mutant was suppressed by tau expression, and tau overexpression phenocopied the shot overexpression-induced ESL. Although tau mutant did not show the lumen formation defects, the double mutant of shot and tau exhibited synergistic effect. Shot was also required for subcellular luminal branching at larval stages.

Overall, this work highlighted the importance of Shot as a crosslinker between MT and actin that acts in downstream of the FGF signaling-induced bs/DSRF expression for the subcellular lumen formation. An excess of Shot is sufficient for ESL formation from ectopic acentrosomal branching points. Furthermore, the Tau protein can functionally replace Shot in this context.

Major comments:

The conclusions were basically supported by the set of data presented in this article, but following points need to be clarified.

The truncated form ShotC lacks only half of calponin domain that are essential for the actin binding, thus it is still possible to bind actin to some extent. Although the actin binding activity is reported as "very weak" in the cited references, the quantitative analysis has not been done. Thus, the interpretation and claims based on the experiments using ShotC should be reviewed carefully.

We agree with the reviewer and will revise all the text for resubmission in order to make this unambiguous. However, we would like to remark that our claims are not only based on UAS-ShotC but also in the shotkakP2 allele, which does not contain one of the calponin domains and, more clearly, in isoforms such UAS-Shot C-tail which do not have any ABD (in fact, only have the C-tail part of Shot).

Data set in some places seems fragmented. For example, overexpression study of shot constructs (Figure 2) lacks phenotypic comparison of control (btl Gal4 driven control FP) to compare if phenotypes of shot constructs expression are different from control. Different methods of phenotypic quantification are employed. One was counting embryo number with at least one abnormality among 20 TCs of DB or GB, or the other counting every TC for the presence of lumen/branching conditions. The latter is more stringent measure and is more appropriate for the study of single cell morphogenesis.

We totally agree with the reviewer. We have now revised all quantifications and graphs:

1) We have used btl>GFP as control to all overexpression experiments in embryos and DSRFGAL4UASGFP in control larvae.

2) We have made the paper uniform regarding quantifications, which are now all done in relation to total TCs and not embryos.

For this reason, many of the graphs, figure legends and quantification values in the manuscript text are now changed.

– Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

The all videos were using ShotC isoform which lacks half of the actin binding domain. The truncated isoform is not suitable to observe the localization, especially the colocalization with actin. The videos need to be retaken using full-length Shot at the dosage that does not interfere with normal TC development.

Two videos were done with ShotC and one with ShotA (we have submitted a new Video 4, with ShotA).

Some statements on Moesin and Tau localization sound as if the authors studied Shot interaction with nascent Moe and Tau molecules. This is confusing because fragments of Moe and Tau, but not functional full-length proteins, were used.

We have revised the text to make this unambiguous.

Because the transgenic fly is already present, we assume it would be done in 4 weeks. However, it would be influnced under social circumstances whether the lab facilities are able to access or not.

The methods provided seem to be sufficient for reproducing the data by competent researchers, and most of the data are solid and the sample numbers are sufficient for the claims. However, the criteria for phenotypic evaluation differs among graphs and figures, that possibly confuse the readers. Standardized measurement methods are desirable.

Reviewer #2 (Significance):

In blood capillary and insect trachea, the branching process of single vessel cells involves sprouting of cell protrusions, followed by the lumen extension from the main vessels. The lumen formation involves assembly of plasma membrane components inside of the cytoplasm. Since the luminal membrane is associated with protein complexes common to apical cell membrane, lumen formation is believed to involve redirection of apical trafficking of membranes to intracellular sites (Sigurbjörnsdóttir, Mathew and Leptin, 2014). The authors previously demonstrated that centrosome is an important link of pre-existing lumen to de novo lumen formation, leading to the hypothesis that centrosome-derived microtubules organize lumen membrane assembly.

In this manuscript, the authors addressed this issue by looking at the function of Shot/Plakin that has both microtubule and actin binding activities. Shot is an ideal candidate for linking actin-rich cell protrusions in the leading edge to centrosome-associated lumen tip. Indeed, the authors clearly showed that shot is required for lumen extension and overexpressed shot protein associates with intracellular tract rich in microtubules and F-actin. Their findings are definitely a progress in the field of Drosophila tracheal development. Having said that, how Shot links leading edge protrusions and centrosomes, how it is organized into pre-lumen tract, and how it contributes to further assembly of luminal membrane and directed secretion, are not well understood yet. Without clues to those fundamental questions, I believe this paper is most appropriate for expert readers of Drosophila cell biology and tracheal development.

Finally, I feel that the paper includes many data sets and some pictures are not easy to grasp essential points, such as three videos showing localization of overexpressed shot-C, RFP-moesin, and Lifeact.

Reviewer #3 (Evidence, reproducibility and clarity):


In their manuscript entitled "Coordinated crosstalk between microtubules and actin by a spectraplakin regulates lumen formation and branching" Ricolo and Araujo characterize the requirement for Short Stop (Shot) in the formation of subcellular tubes in tracheal terminal cells.

The authors examined embryos homozygous for shot3, a presumed null allele of shot. They found an 80% penetrant defect in seamless tube formation or growth. The phenotype resembles that reported for mutations in blistered, which encodes the Drosophila SRF ortholog. The authors find that expression of SRF is not blocked by mutations in shot and later find that bs mutants have decreased levels of shot expression and that shot overexpression can partly suppress the bs tube formation defects.

The authors then examine whether the requirement for shot is autonomous to the trachea and find that it is, as pan-tracheal shot RNAi replicates the seamless tube defects.

The authors find that overexpression of various Shot isoforms results in the formation of ectopic seamless tubes within terminal cells. Using the various transgenic constructs available for shot, the authors show that the overexpression phenotype is dependent upon the interaction between Shot and microtubules and is dose-dependent.

Previous work had shown that ectopic terminal cell tubes also can arise due to increased centrosome number; the authors show that centrosome number is not altered in shot mutants.

Shot has well characterized actin and microtubule binding functions, and the authors show that Shot localization overlaps both with microtubules and with actin, and that both cytoskeletal elements are aberrant in shot mutant cells. In a series of experiments utilizing various shot mutant backgrounds and shot transgenes, the authors identify requirements for both Shot-cytoskeleton interactions in the formation and branching of seamless tubes in terminal cells.

Finally, the authors examine the requirement for Tau in the same processes. Tau and Shot had previously been found to work together in neurons, and this seems to be true in terminal cells as well. Tau overexpression induces ectopic seamless tubes and can partially suppress shot loss of function. Embryos mutant for tau showed seamless tube directionality defects, but not lumen formation or branching. Embryos doubly mutant for tau and shot showed a more severe seamless tube defect than shot mutants alone – an increase in terminal cells with no lumen from 22% to 85%.

Authors also examined terminal cells in larval stages using

DSRF-GAL4 to knockdown shot in terminal cells (rather than pan-tracheal knockdown with breathless).

The authors conclude from their studies that Shot, through its interactions with microtubules and the actin cytoskeleton coordinate the outgrowth and branching of subcellular tubes. Overlapping function of Tau and possibly other additional MAPs also act in these processes.

The work is largely well done, and the conclusions are supported by the data.

Reviewer #3 (Significance):

The findings will be of interest to a broad cell biology community as they provide a conceptual advance and may help to focus future work on seamless tubulogenesis. The authors do a good job of placing the results in the context of previous studies.


Article and author information

Author details

  1. Delia Ricolo

    1. Department of Genetics, Microbiology and Statistics, School of Biology, University of Barcelona, Barcelona, Spain
    2. Institute of Biomedicine University of Barcelona (IBUB), Barcelona, Spain
    Formal analysis, Investigation, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
  2. Sofia J Araujo

    1. Department of Genetics, Microbiology and Statistics, School of Biology, University of Barcelona, Barcelona, Spain
    2. Institute of Biomedicine University of Barcelona (IBUB), Barcelona, Spain
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4749-8913


Ministerio de Ciencia, Innovación y Universidades (PGC2018-099465-B-I00)

  • Delia Ricolo
  • Sofia J Araujo

Generalitat de Catalunya (2017 SGR 1455)

  • Delia Ricolo
  • Sofia J Araujo

Ministerio de Ciencia, Innovación y Universidades (FJCI201732443)

  • Delia Ricolo

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We are grateful to M Llimargas, J Casanova, V Brodu and our lab colleagues for comments on the manuscript. We thank J Casanova and F Serras for the support given throughout this study. We thank M Affolter, M Llimargas, J Casanova, A Prokop, N Sanchez-Soriano, K Roeper, V Brodu, A Ghabrial, F Jankovics, J Pastor-Pareja and the Bloomington Drosophila Stock Center (BDSC) for fly stocks and reagents. Thanks also go to L Bardia, A Lladó, N Giakoumakis, S Tosi and J Colombelli from the IRB-ADMF for assistance and advice with confocal microscopy and software; C Stephan-Otto Attolini from the IRB Bioinformatics/Biostatistics Facility; E Fuentes, R Mendez and M Lledós for assistance in some of the experiments. S.J.A. is an IRB Barcelona Alumni and acknowledges the programme for support. D.R. is the recipient of a Juan de la Cierva post-doctoral fellowship from the Spanish Ministerio de Ciencia, Innovación y Universidades (FJCI201732443) and was previously funded by an FPU fellowship (FPU12/05765). This work was supported by the Universitat de Barcelona, Generalitat de Catalunya (2017 SGR 1455) and a grant from the Spanish Ministerio de Ciencia, Innovación y Universidades (PGC2018-099465-B-I00).

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Derek Applewhite, Reed College, United States

Publication history

  1. Received: July 15, 2020
  2. Accepted: October 27, 2020
  3. Accepted Manuscript published: October 28, 2020 (version 1)
  4. Version of Record published: November 12, 2020 (version 2)


© 2020, Ricolo and Araujo

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,110
    Page views
  • 176
  • 2

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    Zherui Xiong et al.
    Tools and Resources Updated

    Protein interaction networks are crucial for complex cellular processes. However, the elucidation of protein interactions occurring within highly specialised cells and tissues is challenging. Here, we describe the development, and application, of a new method for proximity-dependent biotin labelling in whole zebrafish. Using a conditionally stabilised GFP-binding nanobody to target a biotin ligase to GFP-labelled proteins of interest, we show tissue-specific proteomic profiling using existing GFP-tagged transgenic zebrafish lines. We demonstrate the applicability of this approach, termed BLITZ (Biotin Labelling In Tagged Zebrafish), in diverse cell types such as neurons and vascular endothelial cells. We applied this methodology to identify interactors of caveolar coat protein, cavins, in skeletal muscle. Using this system, we defined specific interaction networks within in vivo muscle cells for the closely related but functionally distinct Cavin4 and Cavin1 proteins.

    1. Cell Biology
    2. Chromosomes and Gene Expression
    Lorraine De Jesus Kim et al.
    Research Article

    The committed step of eukaryotic DNA replication occurs when the pairs of Mcm2-7 replicative helicases that license each replication origin are activated. Helicase activation requires the recruitment of Cdc45 and GINS to Mcm2-7, forming Cdc45-Mcm2-7-GINS complexes (CMGs). Using single-molecule biochemical assays to monitor CMG formation, we found that Cdc45 and GINS are recruited to loaded Mcm2-7 in two stages. Initially, Cdc45, GINS, and likely additional proteins are recruited to unstructured Mcm2-7 N-terminal tails in a Dbf4-dependent kinase (DDK)-dependent manner, forming Cdc45-tail-GINS intermediates (CtGs). DDK phosphorylation of multiple phosphorylation sites on the Mcm2‑7 tails modulates the number of CtGs formed per Mcm2-7. In a second, inefficient event, a subset of CtGs transfer their Cdc45 and GINS components to form CMGs. Importantly, higher CtG multiplicity increases the frequency of CMG formation. Our findings reveal molecular mechanisms sensitizing helicase activation to DDK levels with implications for control of replication origin efficiency and timing.