Escape from neutralizing antibodies by SARS-CoV-2 spike protein variants
- Laboratory of Retrovirology, The Rockefeller University, United States
- Laboratory of Molecular Immunology The Rockefeller University, United States
- Laboratory of Virology and Infectious Disease The Rockefeller University, United States
- Lindsley F. Kimball Research Institute, New York Blood Center, United States
- Institute for Research in Biomedicine, Università della Svizzera italiana, Switzerland
- Howard Hughes Medical Institute, The Rockefeller University, United States
Figures
Figure 1
Selection of SARS-CoV-2 S mutations that confer antibody resistance.
(A) Outline of serial passage experiments with replication-competent VSV derivatives encoding the SARS-CoV-2 S envelope glycoprotein and a GFP reporter (rVSV/SARS-CoV-2/GFP) in 293T/ACE2(B) cells in the presence of neutralizing antibodies or plasma. Each passage experiment was performed twice (once each with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1.) (B) Representative images of 293T/ACE2(B) cells infected with 1 × 106 PFU of rVSV/SARS-CoV-2/GFP in the presence or absence of 10 μg/ml of the monoclonal antibody C121. (C) Expanded view of the boxed areas showing individual plaques of putatively antibody-resistant viruses.
Figure 2 with 2 supplements
Analysis of S-encoding sequences following rVSV/SARS-CoV-2/GFP replication in the presence of neutralizing monoclonal antibodies.
(A–D) Graphs depict the S codon position (X-axis) and the frequency of non-synonymous substitutions (Y-axis) following the second passage (p2) of rVSV/SARS-CoV-2/GFP on 293T/ACE2(B) cells in the absence of antibody or plasma (A), or in the presence of 10 μg/ml C121 (B), C135 (C) or C144 (D). Results are shown for both rVSV/SARS-CoV-2/GFP variants (One replicate each for rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 - the frequency of 1D7 mutations is plotted as circles and 2E1 mutations as triangles).
Figure 2—figure supplement 1
Analysis of S-encoding sequences following rVSV/SARS-CoV-2/GFP replication in the presence of convalescent plasma COV-47 and COV-72.
(A–B) Graphs depict the S codon position (X-axis) and the frequency of non-synonymous substitutions (Y-axis) following the second, third or fourth passage (p2–p4) of rVSV/SARS-CoV-2/GFP on 293T/ACE2(B) cells in the presence of COV-47 plasma (A), or COV-72 plasma (B). Results are shown for both rVSV/SARS-CoV-2/GFP variants (the frequency of 1D7 mutations is plotted as circles and 2E1 mutations as triangles).
Figure 2—figure supplement 2
Analysis of S-encoding sequences following rVSV/SARS-CoV-2/GFP replication in the presence of convalescent plasma COV-107 and COV-NY.
(A–B) Graphs depict the S codon position (X-axis) and the frequency of non-synonymous substitutions (Y-axis) following the second, third or fourth passage (p2–p4) of rVSV/SARS-CoV-2/GFP on 293T/ACE2(B) cells in the presence of COV-107 plasma (A), or second passage in the presence of COV-NY plasma (B). Results are shown for both rVSV/SARS-CoV-2/GFP variants (the frequency of 1D7 mutations is plotted as circles and 2E1 mutations as triangles).
Figure 3 with 1 supplement
Characterization of mutant rVSV/SARS-CoV-2/GFP derivatives.
(A) Replication of plaque-purified rVSV/SARS-CoV-2/GFP bearing individual S amino-acid substitutions that arose during passage with the indicated antibody or plasma. 293T/ACE2cl.22 cells were inoculated with equivalent doses of parental or mutant rVSV/SARS-CoV-2/GFP isolates. Supernatant was collected at the indicated times after inoculation and number of infectious units present therein was determined on 293T/ACE2cl.22 cells. The mean of two independent experiments is plotted. One set of WT controls run concurrently with the mutants are replotted in the upper and lower left panels, A different set of WT controls run concurrently with the mutants is shown in the lower right panel (B) Infection 293T/ACE2cl.22 cells by rVSV/SARS-CoV-2/GFP encoding the indicated S protein mutations in the presence of increasing amounts of a chimeric ACE2-Fc molecule. Infection was quantified by FACS. Mean of two independent experiments is plotted. The WT controls are replotted in each panel.
Figure 3—figure supplement 1
Example of plaque purification of individual viral mutants from populations passaged in the presence of antibodies.
The upper panels show sequence traces from amplicons obtained from viral populations following replication in the presence of monoclonal antibodies, the bottom panels show sequence traces of amplicons obtained from mutants isolated by limiting dilution of the viral populations.
Figure 4
Neutralization of rVSV/SARS-CoV-2/GFP RBD mutants by monoclonal antibodies.
(A) Examples of neutralization resistance of rVSV/SARS-CoV-2/GFP mutants that were isolated following passage in the presence of antibodies. 293T/ACE2cl.22 cells were inoculated with WT or mutant rVSV/SARS-CoV-2/GFP in the presence of increasing amount of each monoclonal antibody, and infection quantified by FACS 16 hr later. Mean and SD from two technical replicates, representative of two independent experiments. (B) Neutralization sensitivity/resistance of rVSV/SARS-CoV-2/GFP mutants isolated following replication in the presence of antibodies. Mean IC50 values were calculated for each virus-monoclonal antibody combination in two independent experiments. (C) Position of neutralization resistance-conferring substitutions. Structure of the RBD (from PDB 6M17 Yan et al., 2020) with positions that are occupied by amino acids where mutations were acquired during replication in the presence of each monoclonal antibody or COV-NY plasma indicated.
Figure 5
Loss of binding to monoclonal antibodies by neutralization escape mutants.
(A) Schematic representation of the binding assay in which NanoLuc luciferase is appended to the C-termini of a conformationally stabilized S-trimer. The fusion protein is incubated with antibodies and complexes captured using protein G magnetic beads (B) Bound Nanoluc luciferase quantified following incubation of the indicated WT or mutant Nanoluc-S fusion proteins with the indicated antibodies and Protein G magnetic beads. Mean of three technical replicates at each S-Nanoluc concentration.
Figure 6
Neutralization of rVSV/SARS-CoV-2/GFP RBD mutants by convalescent plasma.
(A, B) Neutralization of rVSV/SARS-CoV-2/GFP mutants isolated following replication in the presence COV-47 plasma (A) or COV-NY plasma (B). 293T/ACE2cl.22 cells were inoculated with WT or mutant rVSV/SARS-CoV-2/GFP in the presence of increasing amounts of the indicated plasma, and infection quantified by flow cytometry, 16 hr later. Mean of two technical replicates, representative of two independent experiments (C) Plasma neutralization sensitivity/resistance of rVSV/SARS-CoV-2/GFP mutants isolated following replication in the presence of monoclonal antibodies or convalescent plasma. Mean NT50 values were calculated for each virus-plasma combination from two independent experiments.
Figure 7
Effects of naturally occurring RBD amino-acid substitutions on S sensitivity to neutralizing monoclonal antibodies.
(A–C) Neutralization of HIV-based reporter viruses pseudotyped with SARS-CoV-2 S proteins harboring the indicated naturally occurring substitutions. 293T/ACE2cl.22 cells were inoculated with equivalent doses of each pseudotyped virus in the presence of increasing amount of C121 (A) C135 (B) or C144 (C). Mean IC50 values were calculated for each virus-antibody combination from two independent experiments. (D) Position of substitutions conferring neutralization resistance relative to the amino acids close to the ACE2 binding site whose identity varies in global SARS-CoV-2 sequences. The RBD structure (from PDB 6M17 Yan et al., 2020) is depicted with naturally varying amino acids close to the ACE2 binding site colored in yellow. Amino acids whose substitution confers partial or complete (IC50 > 10 μg/ml) resistance to each monoclonal antibody in the HIV-pseudotype assays are indicated for C121 (red) C135 (green) and C144 (purple). (E) Binding of S-NanoLuc fusion protein in relative light units (RLU) to 293T or 293T/ACE2cl.22 cells after preincubation in the absence or presence of C121, C135, and C144 monoclonal antibodies. Each symbol represents a technical replicate.
Figure 8
Position and frequency of S amino-acid substitutions in SARS-CoV-2 S.
Global variant frequency reported by CoV-Glue in the SARS-CoV-2 S protein. Each individual variant is indicated by a symbol whose position in the S sequence is indicated on the X-axis and frequency reported by COV-Glue is indicated on the Y-axis. Individual substitutions at positions where mutations conferring resistance to neutralizing antibodies or plasma were found herein are indicated by enlarged and colored symbols: red for C121 and C144, green for C135, purple for COV-47 plasma and orange for COV-NY plasma. The common D/G614 variant is indicated.
Figure 9
Suppression of antibody resistance through the use of antibody combinations.
(A) Representative images of 293T/ACE2 (B) cells infected with the equivalent doses of rVSV/SARS-CoV-2/GFP in the absence or presence of 10 μg/ml of one (C144) or 5 μg/ml of each of two (C144 +C135) neutralizing monoclonal antibodies. (B) Expanded view of the boxed areas containing individual plaques from the culture infected in the presence of 10 μg/ml C144. (C) Expanded view of the boxed areas in A containing infected cells from the culture infected in the presence of 5 μg/ml each of (C144 and C135). (D) Infectious virus yield following two passages of rVSV/SARS-CoV-2/GFP in the absence or presence of individual neutralizing antibodies or combinations of two antibodies. Titers were determined on 293T/ACE2cl.22 cells. Each symbol represents a technical replicate and results from two independent experiments using rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 are shown.
Tables
Table 1
Plasma and monoclonal antibodies used in this study.
| Donor | Plasma NT50 (rVSV-SARSCoV2/GFP) | Plasma NT50 HIV/CCNGnLuc | Monoclonal antibody | ||
|---|---|---|---|---|---|
| COV-47 | 6622 | 8016 | C144 | ||
| COV-72 | 6274 | 7982 | C135 | ||
| COV-107 | 122 | 334 | C121 | ||
| COV-NY | 12614 | 7505 | ND | ||
Table 2
Mutations occurring at high frequency during rVSV/SARS-CoV-2 passage in the presence of neutralizing antibodies or plasma.
| Mutant frequency | ||||
|---|---|---|---|---|
| Mutation | p2 | p3 | p4 | |
| Monoclonal antibodies | ||||
| C121 | E484K* | 0.50, 0.39 | –† | – |
| F490L | 0.23 | |||
| Q493K | 0.12, 0.45 | |||
| C135 | N440K | 0.31, 0.30 | – | – |
| R346S | 0.30, 0.17 | |||
| R346K | 0.22, 0.53 | |||
| R346M | 0.16 | |||
| C144 | E484K | 0.44, 0.18 | – | – |
| Q493K | 0.31, 0.39 | |||
| Q493R | 0.17, 0.37 | |||
| Plasmas | ||||
| COV47 | N148S | 0.16, 0.14 | 0.29, 0.30 | 0.72, 0.14 |
| K150R | 0.10 | 0.18 | ||
| K150E | 0.04 | 0.16 | 0.4 | |
| K150T | 0.22 | |||
| K150Q | 0.16 | 0.22 | ||
| S151P | 0.1 | 0.18 | 0.2 | |
| COV-NY | K444R | 0.20,0.19 | – | – |
| K444N | 0.14 | |||
| K444Q | 0.33 | |||
| V445E | 0.18 | |||
-
*Values represent the decimal frequency with which each mutation occurs ass assessed by NGS, two values indicate occurrences in both rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 cultures, single values indicate occurrence in only one culture.
† –, not done.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Vesicular Stomatitis Virus) | VSV/SARS-CoV-2/GFP1D7; WT1D7 | Schmidt et al., 2020 | Recombinant chimeric VSV/SARS-CoV-2 reporter virus | |
| Strain, strain background (Vesicular Stomatitis Virus) | rVSV/SARS-CoV-2/GFP2E1; WT2E1 | Schmidt et al., 2020 | Recombinant chimeric VSV/SARS-CoV-2 reporter virus | |
| Strain, strain background (Vesicular Stomatitis Virus) | E484K2E1 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | Q493R1D7 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | R346S1D7 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | R3462E1 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | N440K2E1 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | K444N1D7 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | K444T2E1 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | V445G2E1 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | V445E1D7 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | V445L2E1 | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | N148S | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | K150R | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | K150E | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Strain, strain background (Vesicular Stomatitis Virus) | S151P | Schmidt et al., 2020, and this paper | mutant rVSV/SARS-CoV-2/GFP derivative Inquiries should be addressed to P.Bieniasz | |
| Cell line (Homo sapiens) | Expi293F Cells | Thermo Fisher Scientific | Cat# A14527 | |
| Cell line (H. sapiens) | 293T (embryonic, kidney) | ATCC | CRL-3216 | |
| Cell line (H. sapiens) | 293T/ACE2(B) | Schmidt et al., 2020 | 293 T cells expressing human ACE2 (bulk population) | |
| Cell line (H. sapiens) | 293T/ACE2cl.22 | Schmidt et al., 2020 | 293 T cells expressing human ACE2 (single cell clone) | |
| Biological sample (H. sapiens) | COV-47 | Robbiani et al., 2020 | Human plasma sample | |
| Biological sample (H. sapiens) | COV-72 | Robbiani et al., 2020 | Human plasma sample | |
| Biological sample (H. sapiens) | COV-107 | Robbiani et al., 2020 | Human plasma sample | |
| Biological sample (H. sapiens) | COV-NY | Luchsinger et al., 2020 | Human plasma sample | |
| Antibody | C121 (Human monoclonal) | Robbiani et al., 2020 | Selection experiments (10 μg/ml, 5 μg/ml) | |
| Antibody | C135 (Human monoclonal) | Robbiani et al., 2020 | Selection experiments (10 μg/ml, 5 μg/ml) | |
| Antibody | C144 (Human monoclonal) | Robbiani et al., 2020 | Selection experiments (10 μg/ml, 5 μg/ml) | |
| Recombinant DNA reagent | CSIB(ACE2) | Schmidt et al., 2020 | ||
| Recombinant DNA reagent | pHIVNLGagPol | Schmidt et al., 2020 | ||
| Recombinant DNA reagent | pCCNanoLuc2AEGFP | Schmidt et al., 2020 | ||
| Recombinant DNA reagent | pSARS-CoV-2Δ19 | Schmidt et al., 2020 | Epression plasmid containing a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19) containing a synthetic human-codon-optimized cDNA (Geneart) | |
| Recombinant DNA reagent | R346S | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | R346K | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V367F | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | N439K | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| rRcombinant DNA reagent | N440K | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | K444Q | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | K444R | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | K444N | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V445I | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V445E | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V445L | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V445K | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | G446V | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | G446S | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | L455R | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | L455I | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | L455F | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | F456V | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | A475V | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | A475D | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | G476A | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | G476S | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | T487I | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V483I | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V483A | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V483F | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | E484Q | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | E484A | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | E484D | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | F490S | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | F490L | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | Q493K | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | Q493R | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | S494P | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | N501Y | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Recombinant DNA reagent | V503F | Schmidt et al., 2020, and this paper | pSARS-CoV-2Δ19 containing the indicated mutation. Inquiries should be addressed to P.Bieniasz | |
| Sequence-based reagent | endof_M_for | This paper | PCR and sequencing primer | CTATCGGCCACTTCAAATGAGCTAG |
| Sequence-based reagent | L_begin_rev | This paper | PCR and sequencing primer | TCATGGAAGTCCACGATTTTGAGAC |
| Sequence-based reagent | VSV-RBD-F primer | This paper | PCR and sequencing primer | CTGGCTCTGCACAGGTCCTACCTGACA |
| Sequence-based reagent | VSV-RBD-R primer | This paper | PCR and sequencing primer | CAGAGACATTGTGTAGGCAATGATG |
| Peptide, recombinant protein | ACE2-Fc fusion protein | This paper | Recombinant ACE2 extracellular domain fused to IgG1 Fc see Materials and Methods Inquiries should be addressed to P.Bieniasz | |
| Peptide, recombinant protein | S-6P-NanoLuc | This paper | A conformationally stabilized (6P) version of the SARS-CoV-2 S protein fused to Nanoluciferase See materials and methods Inquiries should be addressed to P.Bieniasz | |
| Commercial assay or kit | Trizol-LS | Thermo Fisher | Cat# 10296028 | |
| Commercial assay or kit | Superscript III reverse transcriptase | Thermo Fisher | Cat# 18080093 | |
| Commercial assay or kit | Nextera TDE1 Tagment DNA enzyme | Illumina | Cat# 15027865 | 0.25 µl |
| Commercial assay or kit | TD Tagment DNA buffer | Illumina | Cat# 15027866 | 1.25 µl |
| commercial assay or kit | Nextera XT Index Kit v2 | Illumina | Cat# FC-131–2001 | |
| Commercial assay or kit | KAPA HiFi HotStart ReadyMix | KAPA Biosystems | Cat# KK2601 | |
| Commercial assay or kit | AmPure Beads XP | Agencourt | Cat# A63881 | |
| Commercial assay or kit | Expi293 Expression System Kit | Thermo Fisher Scientific | Cat# A14635 | |
| Commercial assay or kit | Ni-NTA Agarose | Qiagen | Cat# 30210 | |
| Commercial assay or kit | HRV 3C Protease | TaKaRa | Cat# 7360 | |
| Commercial assay or kit | LI-COR Intercept blocking buffer | Licor | P/N 927–70001 | |
| Commercial assay or kit | Dynabeads Protein G | Thermo Fisher Scientific | Cat# 10004D | |
| Commercial assay or kit | Passive Lysis 5X Buffer | Promega | Cat# E1941 | |
| Commercial assay or kit | Nano-Glo Luciferase Assay System | Promega | Cat# N1150 | |
| Software, algorithm | Geneious Prime | https://www.geneious.com/ | RRID:SCR_010519 | Version 2020.1.2 |
| Software, algorithm | Python programming language | https://www.python.org/ | RRID:SCR_008394 | version 3.7 |
| Software, algorithm | pandas | 10.5281/zenodo.3509134 | RRID:SCR_018214 | Version 1.0.5 |
| Software, algorithm | numpy | 10.1038/s41586-020-2649-2 | RRID:SCR_008633 | Version 1.18.5 |
| Software, algorithm | matplotlib | 10.1109/MCSE.2007.55 | RRID:SCR_008624 | Version 3.2.2 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Escape from neutralizing antibodies by SARS-CoV-2 spike protein variants
eLife 9:e61312.
https://doi.org/10.7554/eLife.61312
