To undertake an unbiased genome-wide RNAi screen for components of the germline proteostasis network, we utilized the Ahringer RNAi feeding library (Kamath et al., 2003), which targets ~87% of annotated C. elegans genes, to identify gene inhibitions that cause proteins to aggregate even in the presence of sperm; that is, in hermaphrodites. A germline-specific GFP::RHO-1 translational fusion was selected as the reporter for the screen as it forms dense patchy aggregates in female oocytes (Bohnert and Kenyon, 2017) and in unfertilized oocytes of aging hermaphrodites, which deplete their stores of sperm (David et al., 2010). Oocytes are formed in young adults, so RNAi was initiated at the beginning of the last larval stage (L4) to reduce the chance of missing genes with essential roles during development (Figure 1B). The animals were examined manually by confocal microscopy on day 2 of adulthood for the presence of GFP::RHO-1 aggregates in proximal oocytes (Figure 1A, B, Figure 1—figure supplement 1A). The primary screen identified 367 genes whose knockdown led to GFP::RHO-1 aggregation in at least 50% of the animals. To eliminate false positives, the candidates were subjected to three independent rounds of validation using a similar workflow, with at least two independent rounds from two experimentalists (Figure 1C). We note that false negatives could result from failure of an RNAi bacterial strain to grow adequately, from insufficient or excessive gene inhibition, or because of functional redundancy.

The resulting set of 88 genes represented diverse cellular processes (Supplementary file 1), with highly enriched gene ontology (GO) categories including translation, RNA processing, and cytoskeletal organization (Figure 1—figure supplement 1C). In addition, ATP-hydrolysis-coupled proton transport and lysosome acidification were both highly enriched, in agreement with our previous findings (Bohnert and Kenyon, 2017). We sorted the candidates according to relative representation in major biological processes (Figure 1D), after discarding candidates with known roles in male gonad and germ cell development (fkh-6, spe-15), in regulation of our proteostasis marker RHO-1 (cyk-4), or with potential off-target effects (adr-1 and dhs-5) (Supplementary file 1). Protein synthesis and degradation, RNA processing, protein folding, and lysosome acidification were strongly represented biological processes, as were genes involved in cytoskeletal organization, including four of the five C. elegans actin genes. Among organelle systems, multiple candidates were associated with ER homeostasis (hsp-4, spcs-1, and srpa-68) and vesicle-mediated transport (copb-2, sec-24.1, sar-1, rab-11.1, and E03H4.8). We also identified genes that could not be classified into any of the highly enriched biological process categories and were designated ‘orphans’ (Supplementary file 1 and Figure 1D).

We subjected representative candidates from each group, as well as all of the orphans, to an orthogonal screening approach, this time utilizing a different aggregation reporter, a germline-specific NMY-2::GFP fusion protein (Bohnert and Kenyon, 2017) that forms distinctive punctate aggregates in the absence of sperm (Figure 1C and Supplementary file 1). Out of the 55 candidates tested, 53 RNAi knockdowns also caused NMY-2::GFP protein-aggregate accumulation (Figure 1—figure supplement 1B). Thus, these genes are likely to have a general effect on protein-aggregate clearance rather than a specific effect on GFP::RHO-1.

We classified the RNAi phenotypes as strong, intermediate or subtle based on the degree of GFP::RHO-1 aggregation (Supplementary file 1). Typically, the phenotypically strong gene knockdowns led to sterility, whereas the subtle knockdowns generally did not, though some reduced brood size. In principle, one could imagine that aggregates accumulate in oocytes from sterile hermaphrodites because oocytes that would normally undergo ovulation and pass into the uterus do not, and instead simply ‘age in place.’ Likewise, aggregates could accumulate in normal female oocytes because in the absence of sperm they proceed much more slowly through the spermatheca and into the uterus (McCarter et al., 1999). As a consequence, proximal oocytes of females are technically older than those of age-matched hermaphrodites (Kim et al., 2013). This oocyte-age discrepancy raises the question of whether aggregates accumulate only during long-term oocyte quiescence or whether they are present in newly formed female oocytes. To address this question, we collected age-matched late L4 (‘Christmas-tree’ stage) females and hermaphrodites and followed the hermaphrodites until their first oocytes were cellularized. We found that age-matched first-proximal oocytes of young females often contained protein aggregates (Figure 1E, Figure 1—figure supplement 2). Therefore, protein-aggregate accumulation does not require prolonged oocyte quiescence; instead, it appears to be part of the normal developmental sequence of oocytes that are not exposed to sperm.

Many genes we identified were associated with the ER, so we explored ER biology in more detail. The ER undergoes a major morphological rearrangement in response to oocyte maturation signals (Langerak et al., 2019). We visualized the ER in C. elegans oocytes using a germline-specific mCherry::SP12 reporter (Joseph-Strauss et al., 2012). SP12 is a signal-peptidase subunit (Poteryaev et al., 2005), and spcs-1, which encodes SP12, was identified in our screen. In hermaphrodite oocytes, the ER assumed a fine network appearance, whereas in female oocytes, the ER formed bright, distinctive patches (Figure 2A, C, Figure 2—figure supplement 1A). We also examined ER morphology in the first, newly formed female oocytes using the L4 staging procedure described above. Pristine female oocytes also exhibited ER patches, indicating that the altered ER architecture is an intrinsic property of female oocytes and not a consequence of prolonged quiescence (Figure 2B, Figure 2—figure supplement 1B). The fluorescent signal from the female ER was further enhanced as oocytes aged, possibly due to continued ER biogenesis coupled with oocyte compression caused by their packing within the gonad (Figure 2—figure supplement 1A). Using two fluorescent reporters, we visualized both the ER and GFP::RHO-1 simultaneously (Figure 1—figure supplement 2, Figure 2B, Figure 2—figure supplement 1C, Figure 2—figure supplement 2) and found that in female oocytes the ER and GFP::RHO-1 aggregates segregated spatially into mutually exclusive regions (Figure 1—figure supplement 2, Figure 2B, Figure 2—figure supplement 1C).

Figure 2 with 6 supplements see all

Download asset Open asset

We also examined oocytes from young, age-matched hermaphrodites and females by transmission electron microscopy (TEM). The ER in pristine oocytes from both sexes appeared to be associated with ribosomes, indicative of active (or poised) protein synthesis, yet the female ER was distinctively clustered into parallel stacks (Figure 2D, Figure 2—figure supplement 3).

To test whether the stacked ER architecture of female oocytes could be reversed by sperm, we visualized fluorescently tagged ER and NMY-2::GFP aggregates simultaneously over time in female oocytes after mating. The presence of sperm triggered distinctive remodeling of the ER architecture and the clearance of aggregates, although with different kinetics (Figure 2E, Figure 2—figure supplement 4). The earliest changes in the ER were detected approximately 10 min after mating, and the morphology was significantly altered by 30 min (Figure 2E). In contrast, the clearance of NMY-2 aggregates started a few minutes later, with aggregate clearance in the most proximal oocytes typically occurring between 20 and 30 min after mating (Figure 2—figure supplement 4, 5, 6A).

Next, we investigated whether the genes identified in our RNAi screen might contribute to proteostasis by influencing a process associated with ER architecture. To this end, we subjected mCherry::SP12-germline-labeled hermaphrodites to 35 RNAi treatments representing the various biological process categories as well as the individual orphans. This subset of RNAi clones, which we termed the ‘assay pool,’ was used for all subsequent large-scale phenotypic analyses (Table 1). We visualized oocyte ER morphology in young adults subjected to the gene knockdowns (Figure 2—figure supplement 6B and Table 1). Genes involved in cytoskeletal organization, protein synthesis and protein folding were required for maintaining normal ER morphology and led to an altered ER architecture when knocked down. Genes involved in RNA processing, protein degradation and trafficking comprised a mixed class, with some knockdowns appearing to affect ER morphology. We note that our analysis does not distinguish between genes with direct effects on ER morphogenesis, like the actin cytoskeleton (Poteryaev et al., 2005), and genes with indirect effects, like the proteasome, which is required for the degradation of GLD-1 (Bohnert and Kenyon, 2017; Goudeau et al., 2020; Spike et al., 2018), a translational repressor involved in oocyte cell fate determination (Francis et al., 1995; Jones et al., 1996). Notably, disrupting the mitochondrial ATP synthase, the V-ATPase complex, or ER function itself did not visibly alter the ER network, suggesting that these gene functions were not required for the sperm-induced ER morphology change, or more generally for ER morphogenesis.

Signals from sperm elicit the lysosomal acidification required for the clearance of protein aggregates, and inhibiting the V-ATPase, which acidifies lysosomes, causes proteins to aggregate in hermaphrodite oocytes (Bohnert and Kenyon, 2017). However, the mechanism by which lysosome acidification occurs in response to signals from sperm is not known (Goudeau et al., 2020; Spike et al., 2018). To address this question with minimal physiological disruption, we first attempted to fluorescently tag endogenously-expressed V-ATPase subunits using CRISPR/Cas9. We picked four different subunits, two from the membrane-embedded V₀ domain (VHA-4 and VHA-7) and two from the peripheral V₁ domain (VHA-11 and VHA-13) (Supplementary file 2). Unexpectedly, although each one of these tagged proteins was visible in somatic tissues, we were unable to detect any fluorescence in the germline in either intact animals (Figure 3—figure supplement 1) or in their dissected gonads (Figure 3—figure supplement 2A). Germline fluorescence was also undetectable when imaging with a more sensitive wide-field system or following photobleaching of the strong intestinal signal, which we reasoned might mask a faint signal from the germline (data not shown). Endogenous genes tagged with fluorescent proteins can be silenced in the germline by the process of epigenetic RNAe (Shirayama et al., 2012); however, this explanation seems unlikely since, unlike V-ATPase RNAi-treated animals, these animals produced viable embryos.

We also considered the possibility that these V-ATPase proteins did not act cell-autonomously in the gonad, though V-ATPase mRNAs previously had been identified as direct targets of the germline-specific GLD-1 translational regulator (Wright et al., 2011). To investigate cell autonomy, we carried out tissue-specific RNAi experiments using sterility as a phenotypic readout. Three hermaphrodite strains (wild type), globally RNAi-defective rde-1(mkc36) mutants DCL565, and germline-only RNAi-sensitive DCL569 animals (Zou et al., 2019) were subjected to RNAi from hatching (empty-vector, vha-12 and vha-13). Both wild-type and germline-RNAi-permissive DCL569 animals exhibited sterility when fed vha-12 and vha-13 RNAi bacteria (Figure 3—figure supplement 2B), whereas the whole-body RNAi-defective rde-1 mutant did not. Thus, these V-ATPase subunits are expressed and required in the germline, despite our inability to detect them when tagged endogenously.

As a next-best approach for visualizing germline V-ATPase subunits, we obtained a Mos1-mediated single copy insertion (MosSCI) strain of GFP::VHA-13 driven by the germline-specific pie-1 promoter. This strain expressed GFP::VHA-13 in a genetically stable fashion, though presumably at elevated levels. In these animals, we observed a striking, sperm-dependent pattern: GFP::VHA-13 formed distinct foci in hermaphrodite oocytes (Figure 3A, Figure 3—figure supplement 3A) that colocalized with foci of LysoTracker, a dye that stains acidic lysosomes (Figure 3B, Figure 3—figure supplement 4A). In contrast, the proximal oocytes of females exhibited a diffuse GFP::VHA-13 fluorescent signal (Figure 3A, Figure 3—figure supplement 3B), with a slight enrichment in the perinuclear region. Female oocytes demonstrated very weak LysoTracker staining (Bohnert and Kenyon, 2017), and there was no significant overlap in the two signals (Figure 3B, Figure 3—figure supplement 4B). To better control for effects of overexpression, we lowered the level of GFP::VHA-13 expression by serially diluting gfp RNAi bacteria. Even at the limit of fluorescence detection, hermaphrodites still exhibited GFP::VHA-13 foci, and females exhibited a diffuse distribution (Figure 3—figure supplement 2C). Thus, the germline harbors a mechanism by which VHA-13 is localized to discrete, acidic cellular locations, indicative of lysosomes, only in the presence of sperm. Notably, knocking down the vha-12 gene, which encodes another peripheral V-ATPase V₁-domain subunit, also prevented GFP::VHA-13 foci formation in hermaphrodite oocytes (Figure 3—figure supplement 2D), suggesting a coordinated assembly pathway.

Figure 3 with 4 supplements see all

Download asset Open asset

Figure 3—source data 1

Skewness of oocyte GFP::VHA-13 signal as a function of time post mating.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig3-data1-v1.xlsx

Download elife-62653-fig3-data1-v1.xlsx

We asked whether sperm signals regulate V-ATPase localization in two ways. First, we examined older, sperm-depleted hermaphrodites (day 5) and observed diffuse V-ATPase localization, similar to that of females (Figure 3—figure supplement 3C). Second, we mated GFP::VHA-13-expressing females with males and monitored their proximal oocytes. The diffuse fluorescent signal began to change approximately 10 min after mating, organizing into distinct foci within 20–30 min (Figure 3C, D). This change coincided with release from arrest and oocyte maturation, ultimately leading to ovulation and fertilization. The time scales of ER remodeling and GFP::VHA-13 relocalization (Figure 2E) were strikingly similar, suggesting a possible causal relationship. Together, these findings suggest that sperm signals lead to lysosome acidification by initiating the recruitment of V-ATPase subunits to the surface of the lysosome and enabling proton-pump assembly.

To ask which gene inhibitions blocked lysosome acidification, we subjected LysoTracker-stained hermaphrodites to knockdowns of the ‘assay pool’ genes (Table 1). In wild-type hermaphrodites, lysosomes are acidified only in proximal oocytes (Bohnert and Kenyon, 2017). Therefore, to internally control for variations in dye uptake, we analyzed the ratios of staining intensities between proximal oocytes and distal germline regions. LysoTracker staining of hermaphrodites, females, and animals subjected to empty-vector RNAi were used as controls, and the simultaneous presence of GFP::RHO-1 aggregates confirmed successful gene knockdown. Unexpectedly, we found that the great majority of gene inhibitions prevented lysosome acidification (Figure 4A, Figure 4—figure supplement 1A). The ATP synthase genes atp-2 and atp-3 were the only exceptions, consistent with previous observations suggesting that mitochondrial ATP-synthase activity acts downstream of lysosome acidification to prevent protein aggregation (Bohnert and Kenyon, 2017).

Figure 4 with 1 supplement see all

Download asset Open asset

Figure 4—source data 1

LysoTracker signal intensity ratios (maturing oocytes/distal germline) in assay pool knockdowns.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig4-data1-v1.xlsx

Download elife-62653-fig4-data1-v1.xlsx

Figure 4—source data 2

Skewness of oocyte GFP::VHA-13 signal in assay pool knockdowns.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig4-data2-v1.xlsx

Download elife-62653-fig4-data2-v1.xlsx

Next, we asked whether reduced lysosomal acidification in the RNAi-treated hermaphrodites might be caused by an inability to localize the V-ATPase subunits to lysosomes, as occurs in females. To test this, we subjected GFP::VHA-13-expressing animals to assay pool RNAi and screened for the presence of GFP::VHA-13 puncta (Figure 4—figure supplement 1C). The extent of puncta formation was quantified by measuring the skewness (non-homogeneity) of the GFP::VHA-13 signal at multiple locations within the most proximal oocyte. Hermaphrodites and the empty-vector RNAi-treated animals demonstrated significantly higher skewness values than did female oocytes, which exhibited diffuse GFP::VHA-13 localization (Figure 4B). All of the knockdowns that blocked lysosome acidification showed reduced GFP::VHA-13 skewness, albeit to varying degrees. While most knockdowns resulted in a marked reduction in GFP::VHA-13 skewness, similar to the female, knockdown in some genes involved in protein folding (cct-1, cct-5), RNA processing (ess-2, let-711), and calcium ion transport (itr-1, sca-1) demonstrated intermediate values of skewness, indicative of at least a partial reduction of GFP::VHA-13 puncta (Figure 4B). Similarly, the orphan-gene inhibitions demonstrated reduced GFP skewness, with several candidates showing only intermediate effects (kin-2, par-5, xpo-1, rmd-2, lgc-46, aco2, imb-1) (Figure 4—figure supplement 1B). As anticipated, neither of the two ATP synthase gene knockdowns affected GFP::VHA-13 puncta formation (Figure 4B). Together, these data support the model that the failure of the gene knockdowns to acidify lysosomes is due, at least in part, to a failure to assemble the lysosomal V-ATPase.

Mitochondria undergo a morphological and metabolic shift in response to signals from sperm, a shift that is required for aggregate removal (Bohnert and Kenyon, 2017). Unfertilized female oocytes exhibit a high mitochondrial membrane potential (ΔΨ) relative to hermaphrodite oocytes or to female oocytes exposed to sperm by mating. Loss of the mitochondrial ATP synthase, which discharges the proton gradient during the generation of ATP, elevates ΔΨ in hermaphrodites and causes protein aggregates to accumulate (Bohnert and Kenyon, 2017). As expected, subunits from the mitochondrial ATP synthase complex (atp-2, atp-3) emerged from the screen. Previously, we found that lysosomal V-ATPase activity was required for the shift in mitochondrial membrane potential (Bohnert and Kenyon, 2017). To test the prediction that our screen hits, which all inhibited lysosome acidification, would also block the ΔΨ switch, we stained hermaphrodites with the dye DiOC6(3), whose signal is sensitive to ΔΨ. Again, to control for dye uptake, we measured the ratio of DiOC6(3) staining intensities between proximal oocytes and the distal syncytial germline. As predicted, all of the knockdowns prevented the ΔΨ decrease in proximal hermaphrodite oocytes. Unexpectedly, in many cases the mitochondria exhibited ΔΨ ratios even higher than those of females (Figure 5A, Figure 5—figure supplement 1A), suggesting that the female oocyte ΔΨ is not the default state, but potentially an optimal point within a broader range of possibilities.

Figure 5 with 3 supplements see all

Download asset Open asset

Figure 5—source data 1

DiOC6(3) signal intensity ratios (maturing oocytes/distal germline) in assay pool knockdowns.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig5-data1-v1.xlsx

Download elife-62653-fig5-data1-v1.xlsx

Figure 5—source data 2

LysoTracker signal intensity ratios (maturing oocytes/distal germline) in ESCRT subunit knockdowns.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig5-data2-v1.xlsx

Download elife-62653-fig5-data2-v1.xlsx

Figure 5—source data 3

BioTracker ATP-Red staining of oocytes.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig5-data3-v1.xlsx

Download elife-62653-fig5-data3-v1.xlsx

Figure 5—source data 4

Skewness of oocyte GFP::VHA-13 signal in ESCRT subunit knockdowns.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig5-data4-v1.xlsx

Download elife-62653-fig5-data4-v1.xlsx

The observation that gene knockdowns from all the functional categories caused a relatively high oocyte ΔΨ value prompted us to question whether a high mitochondrial membrane potential might be necessary for protein-aggregate accumulation. To test this, we asked whether exposing females expressing germline GFP::RHO-1 to conditions that lower ΔΨ, namely, to electron transport chain (ETC) RNAi knockdowns, might reduce protein aggregation. However, neither cyc-1 nor nuo-2 RNAi prevented females from accumulating aggregates, even though ΔΨ was reduced (Figure 5B, Figure 5—figure supplement 1B, C). Thus, a high mitochondrial membrane potential is not a prerequisite for protein aggregation.

RNAi inhibition of ATP synthase has been shown to reduce ATP levels in worms, as does RNAi inhibition of electron transport (Dillin et al., 2002; Lee et al., 2003). To ask whether inhibiting ATP synthase was likely to cause protein aggregation in hermaphrodites by limiting ATP levels, we analyzed hermaphrodites subjected to ETC RNAi. The treatments reduced oocyte ATP levels (Figure 5—figure supplement 2) and reduced body size and growth rate (Figure 5B), two known correlates of reduced ATP levels. However, these perturbations did not cause protein aggregation in hermaphrodite oocytes (Figure 5B). This finding suggests the interesting hypothesis that loss of ATP synthase causes aggregates to accumulate in hermaphrodites not because it limits ATP levels, but for a different reason (see Discussion).

Given the striking change in mitochondrial dynamics that takes place during oocyte maturation, we were surprised that in our screen we recovered only one additional gene encoding a mitochondrial-localized protein, aco-2 (Krebs cycle aconitase). We tested several additional Krebs cycle gene knockdowns (pdha-1, idhg-1, ogdh-1, sucl-1, and sdhd-1) and found that α-ketoglutarate dehydrogenase (ogdh-1) and succinate dehydrogenase (sdhd-1) RNAi also led to oocyte GFP::RHO-1 aggregation (Figure 5—figure supplement 1D). Notably, unlike ATP synthase inhibition, aco-2 inhibition prevented lysosome acidification (Figure 4—figure supplement 1A), indicating that the Krebs cycle and ATP synthase likely have distinct roles in the protein-aggregation pathway.

The direct mechanism by which protein aggregates are removed during oocyte maturation is not known with certainty, although morphologically, the process resembles lysosomal microautophagy (Bohnert and Kenyon, 2017). Microautophagy has not been described previously in C. elegans; however, orthologs of genes encoding components of the ESCRT machinery, which mediates microautophagy in yeast and mammals, are present (Sahu et al., 2011; Williams and Urbé, 2007). We identified two ESCRT subunits (vps-37 and vps-54) in our primary screen, but they did not pass our initial validation cutoff (Supplementary file 3). To explore the possibility that these were false negatives, we retested these RNAi clones along with RNAi clones inhibiting additional ESCRT subunits (tsg-101, vps-20, and vps-28). In these experiments, the ESCRT subunits vps-20, vps-28, vps-37, and vps-54 tested positive with subtle aggregation phenotypes (although not observed in all animals tested) (Figure 5—figure supplement 3A), supporting the model that aggregates are removed via microautophagy. Importantly, the degree of GFP::VHA-13 localization to puncta in these knockdowns was comparable to that of hermaphrodites (Figure 5—figure supplement 3B, C), and they also permitted acidification of oocyte lysosomes (Figure 5C, Figure 5—figure supplement 3C). Taken together, these findings suggest that the ESCRT machinery operates downstream of V-ATPase assembly and lysosome acidification to prevent aggregate accumulation.

Widespread proteostasis collapse is an inherent part of aging in C. elegans (Ben-Zvi et al., 2009; David et al., 2010; Taylor and Dillin, 2011; Walther et al., 2017), and mechanisms that extend lifespan invariably enhance cellular proteostasis. Understanding how the immortal germ lineage maintains cellular quality and proteostasis across the generations could suggest new ways to enhance proteostasis in the soma and delay organismal aging. Our lab and others have shown that many endogenous proteins become insoluble with age and can form visible aggregates when overexpressed with fluorescent tags (David et al., 2010; Huang et al., 2019; Reis-Rodrigues et al., 2012; Roux et al., 2016). To visualize age-related protein aggregation, we monitored the casein kinase subunit KIN-19, which forms insoluble aggregates in an age-dependent manner in wild-type somatic tissues (David et al., 2010). To do this, we fluorescently tagged the endogenous kin-19 gene specifically in the soma using split-wrmScarlet (Goudeau et al., 2021; Supplementary file 2). To avoid interference from the bright intestinal autofluorescence, we examined KIN-19::split-wrmScarlet in the head. The signal was mainly diffuse in young day 1 adults but began to exhibit a striking punctate appearance as early as day 4 of adulthood (Figure 6A, B, Figure 6—figure supplement 1). To the best of our knowledge, this tool is the first used to visualize age-dependent aggregation of an endogenously expressed protein in C. elegans.

Figure 6 with 4 supplements see all

Download asset Open asset

Figure 6—source data 1

Number of KIN-19 aggregates per animal.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig6-data1-v1.xlsx

Download elife-62653-fig6-data1-v1.xlsx

Figure 6—source data 2

Skewness of intestinal LysoTracker signal.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig6-data2-v1.xlsx

Download elife-62653-fig6-data2-v1.xlsx

Figure 6—source data 3

Quantitative RT‐PCR analysis of mRNA levels in ESCRT subunit knockdowns.

https://cdn.elifesciences.org/articles/62653/elife-62653-fig6-data3-v1.xlsx

Download elife-62653-fig6-data3-v1.xlsx

To ask whether the germline proteostasis genes we identified in our screen might also affect somatic protein aggregation, we screened our germline aggregation ‘assay pool’ for gene knockdowns that caused KIN-19 to aggregate prematurely in head tissues. We found that multiple RNAi knockdowns that impaired lysosomal acidification in the germline-induced premature KIN-19::split-wrmScarlet aggregation in the soma, most notably RNAi of genes encoding lysosomal V-ATPase subunits (vha-12, vha-13, vha-16, and vha-19), but also genes that, in the germline, were required for V-ATPase assembly (the actin gene act-5 and the vesicle-mediated ER-to-Golgi transport gene copb-2) (Figure 6C, D). We were not able to visualize lysosome acidification in the head using LysoTracker, but these knockdowns did affect lysosome acidification in the intestine, where the RNAi treatment led to fewer discrete acidic lysosome-related organelles, thereby reducing the skewness of the LysoTracker signal (Figure 6E, Figure 6—figure supplement 2). We also recovered the proteasome subunits pbs-7 and rpn-6.1, indicating a direct or indirect role for proteasome function to maintain KIN-19 solubility in the aging soma (Figure 6C, D).

We also tested a second somatic-aggregation reporter, the polyQ protein Q35::YFP expressed in body wall muscles (Morley et al., 2002). Similar to KIN-19::split-wrmScarlet, vha-12 and vha-19 knockdowns accelerated the timing of age-related Q35::YFP aggregation, as did copb-2 and rpn-6.1 RNAi (Figure 6—figure supplement 3). Interestingly, a few additional genes were identified that were not hits in the KIN-19::split-wrmScarlet screen. These included the cytosolic chaperones cct-1 and cct-5, another trafficking component rab-11.1, and three orphans with diverse cellular function, imb-1, itr-1, and let-711 (Figure 6—figure supplement 3 and Supplementary file 1). Further, knocking down one of the four ESCRT-complex subunits we tested, vps-37, also led to Q35::YFP aggregation (Figure 6—figure supplement 3). In contrast, none of the ESCRT gene knockdowns accelerated the KIN-19::split-wrmScarlet somatic aggregation, even in animals exposed to RNAi from the first larval stage, despite a significant decrease in mRNA levels in the two subunits measured (Figure 6—figure supplement 4). Together, these findings suggest that lysosomal microautophagy may prevent the accumulation of Q35::YFP aggregates, but future studies will be required for certainty.

To identify additional genes and processes involved in protein-aggregate metabolism in oocytes, we carried out a genome-wide screen for RNA inhibitions that cause proteins to aggregate even in the presence of sperm, namely, in hermaphrodites. We expected to identify genes and processes that are directly involved in the sperm-dependent proteostasis switch, as well as genes that function more indirectly in protein homeostasis and cellular quality control. Many of the genes we recovered affected large multiprotein complexes, such as the ribosome and proteasome, making a compelling argument for these complexes influencing protein aggregation, directly or indirectly. However, we may have missed processes carried out by only one or a few genes if the corresponding RNAi bacteria were missing from the RNAi library or otherwise problematic; or if their inhibition produced milder protein-aggregation phenotypes, like the ESCRT genes that failed our initial, stringent validation tests (Supplementary file 3).

To place the genes into a proteostasis pathway, we asked which hallmarks of the sperm-triggered aggregate-clearance pathway (lysosome acidification, mitochondrial membrane-potential shift, etc.) were blocked by the knockdowns (Figure 7). An intrinsic limitation of this strategy is that it only identifies the first role of a gene that acts in multiple steps in the process. For example, because inhibiting the proteasome prevents degradation of the proximal oocyte cell-fate determinant GLD-1 (Bohnert and Kenyon, 2017; Kisielnicka et al., 2018) and inhibiting various other chaperones prevents lysosome acidification, we cannot determine whether these proteins also play a direct role in the process of aggregate clearance itself. Finally, we note that perturbations that prevent sperm from producing the MSP oocyte maturation signal would also cause protein aggregation in hermaphrodites. The fact that the great majority of the knockdowns did not replicate female oocyte morphology exactly (Figure 5A, Figure 5—figure supplement 1A) argues against this possibility, but we have not ruled it out definitively.

Figure 7

Download asset Open asset

Many of the genes we identified affected the ER (Figure 7 and Table 1). All of these gene inhibitions prevented lysosome acidification, arguing that ER function influences aggregate formation indirectly, acting at a relatively early step in the proteostasis pathway (though ER function could be required again, at later stages, as well). Using TEM and fluorescent reporters, we validated and extended previous observations of ER reorganization during C. elegans oocyte maturation (Langerak et al., 2019). We found that the ER assumes a stacked arrangement, spatially distinct from GFP::RHO-1 protein aggregates, in the proximal oocytes of females. Importantly, we found that neither the ER stacking nor protein-aggregate accumulation were a consequence of long-term oocyte quiescence (‘oocyte aging’) as both were present as soon as female oocytes appeared during development. When oocyte maturation was triggered by mating, the ER underwent a rapid reorganization that preceded aggregate removal, consistent with a model that ER activity might be a precondition for aggregate clearance.

The ER-gene inhibitions fell into two classes. First was a set of genes with known ER functions that did not appear to affect ER morphology: hsp-4 (BIP), spcs-1 (signal peptidase complex subunit), and srpa-68 (signal recognition particle). This finding argues that ER reorganization does not require ER function itself. The second class did affect ER morphology, generally causing the ER from hermaphrodites to exhibit a bright patchy appearance characteristic of (though not necessarily identical to) that seen in female oocytes. Some of these gene knockdowns, such as that of itr-1, which encodes the channel that releases calcium stored in the ER, likely cause hermaphrodites to adopt a female-specific, stacked ER morphology. In C. elegans, the major wave of oocyte calcium release occurs after fertilization; this finding suggests that ER-dependent calcium metabolism plays an important earlier role as well. Other RNAi knockdowns may simply disrupt ER morphology more generally and might not identify genes that play an active role in the oocyte proteostasis switch. For example, the actin cytoskeleton is known to influence ER morphogenesis (Poteryaev et al., 2005), and we recovered a number of cytoskeletal gene hits. Notably, TRiC-complex chaperonin genes fell into this class as well. The TRiC-complex chaperonin can counteract protein aggregation directly; for example, by promoting correct protein folding during protein synthesis. However, TRiC is known to assist in folding cytoskeletal components including actin and tubulin (Llorca et al., 2000), and it was interesting to find that the TRiC-complex genes we recovered, cct-1 and cct-5, acted indirectly by affecting ER morphology and lysosome acidification. As mentioned above, the proteasome too affects aggregate clearance indirectly. In general, it might be valuable to assay lysosome acidification when analyzing the functions of these chaperone/chaperonin systems on the accumulation of protein aggregates in other cellular systems to test for the possibility of indirect effects. That said, it is also possible that TRiC-complex and other chaperones act at multiple points in the proteostasis pathway, with both indirect and direct effects on protein aggregation.

Finally, we identified several genes that, to our knowledge, were not previously known to influence ER morphology; namely, dlg-1, kin-2 and ttr-14 (Table 1). How these genes act, directly or indirectly, to influence the ER could be interesting to explore in the future.

Lysosome acidification may be a conserved aspect of oocyte maturation as it takes place in Xenopus as well as C. elegans (Bohnert and Kenyon, 2017). A central goal of this study was to better understand how this lysosome acidification is regulated in worms. To this end, we first generated functional, fluorescently tagged V-ATPase subunits expressed from their own loci. However, for reasons that we do not understand, none of these proteins was visible in the germline. We then obtained a stable, single-copy MosSCI strain in which gfp::vha-13 was expressed from a germline-specific promoter. In these animals, GFP::VHA-13 was visible, and we observed a striking sperm-dependent localization pattern. In the presence of sperm (in hermaphrodites), GFP::VHA-13 was located on lysosomes; that is, it assumed a punctate appearance that colocalized with LysoTracker signal. In the absence of sperm (in unmated females), the protein was distributed throughout the cytoplasm (Figure 7). The simplest interpretation of these findings is that signals from sperm trigger the localization of GFP::VHA-13 to lysosomes, and that this localization enables lysosome acidification. In principle, additional levels of control, such as translational repression of V-ATPase synthesis, could operate as well since our overexpressed construct could potentially override negative regulators, though we observed no evidence of this with serially diluted gfp RNAi treatments that progressively reduced visible GFP::VHA-13 protein levels.

In yeast, peripheral, cytoplasmic V₁ subunits of the V-ATPase (such as the VHA-13 ortholog VMA1) localize to lysosomes when the membrane-localized V₀ sector is trafficked there from the ER, where it is assembled (Graham et al., 1998). Thus, we propose that the extensive rearrangement in ER morphology triggered by sperm in C. elegans oocytes is coupled to movement of either preexisting or newly synthesized membrane-localized V₀ subunits of the V-ATPase from the ER to lysosomes, where they create docking sites for cytoplasmic, peripheral V₁ subunits. Consistent with this idea, RNAi of the ER genes, as well as each of the three genes required for vesicle trafficking from the ER to lysosomes, prevented GFP::VHA-13 localization to lysosomes, as did inhibiting genes encoding the membrane-localized V-ATPase V₀ subunits. Unfortunately, our efforts to observe the predicted sperm-activated movement of V₀ subunits from the ER to lysosomes were thwarted by our inability to visualize either of two functional wrmScarlet-tagged V₀ subunits, even when overexpressed using MosSCI technology. In the future, immuno-gold EM labeling of endogenous V₀ subunits might enable this model to be tested more directly.

We note that an interesting puzzle remains unexplained: If the multi-subunit lysosomal V-ATPase complexes are present in such low amounts in mature oocytes that they cannot be seen when we fluorescently tag the endogenous vha-13 gene, then why do they appear when the tagged VHA-13 protein is overexpressed? How does the excess GFP::VHA-13 protein dock onto lysosomes? Perhaps the ER supplies lysosomes with alternative docking sites for unassembled V-ATPase subunits or perhaps the stoichiometry change due to the excess GFP::VHA-13 subunits triggers the production of entirely new V-ATPase complexes that incorporate the overexpressed GFP::VHA-13 subunits. This remains an unexplained but intriguing mystery (Hughes and Gottschling, 2012).

The gene knockdowns identified by the screen nearly all prevented lysosomal acidification, reinforcing the central role of acidified lysosomes in clearing oocyte protein aggregates (Figure 7). Moreover, none of the knockdowns that failed to acidify lysosomes exhibited a punctate, lysosomal GFP::VHA-13 pattern (Table 1). This finding suggests that V-ATPase activity may not only be necessary but also sufficient for lysosome acidification; however, this interpretation remains tentative since we may simply have failed to identify the relevant genes in our screen. Finally, several of the knockdowns from our screen did not appear to affect ER morphology (and have not been reported to affect ER function), but did prevent V-ATPase localization, for example, srab-17, a chemosensory gene of the serpentine receptor class ab, and lgc-46, involved in chloride ion transport (Table 1). How, directly or indirectly, these proteins might influence V-ATPase localization and assembly is an interesting question to pursue in the future.

Like the ER and lysosomes, mitochondria undergo morphological and functional changes during C. elegans oocyte maturation. In response to sperm, the mitochondria of proximal oocytes reduce their relatively high membrane potential and shift from a fragmented to a tubular structure. Inhibiting mitochondrial ATP synthase preserves this high membrane potential even when sperm are present and causes aggregates to accumulate. Injecting ADP, whose levels would be expected to rise as maturing oocytes initiate protein synthesis and acidify lysosomes, reduces the mitochondrial membrane potential in female oocytes, in an ATP synthase-dependent fashion. Together, these findings suggested the model that in the absence of sperm, mitochondria are held in a quiescent, poised state that relaxes as metabolic activity and ATP synthesis commence (Bohnert and Kenyon, 2017).

Whether C. elegans oocyte maturation is powered primarily by glycolysis or respiration is unknown; however, in principle, the accumulation of protein aggregates caused by inhibiting mitochondrial ATP synthase could reflect ATP limitation. However, if this were the case, then inhibiting components of the ETC should also cause protein aggregates to accumulate in hermaphrodites since this too limits ATP levels. However, although these knockdowns reduced oocyte ATP levels, body size, growth rates, and brood size, this was not the case; ETC knockdowns had no effect on protein aggregation. This unexpected finding suggests that ATP synthase knockdown prevents aggregate clearance not because of changes in ATP levels, but instead either because a continuously high mitochondrial membrane potential acts like a checkpoint to inhibit aggregate clearance (Figure 7) or because of another, unknown role of ATP synthase in protein homeostasis.

Our screen revealed an additional requirement for mitochondria in protein homeostasis; specifically, for Krebs cycle activity. Inhibiting mitochondrial aconitase (aco-2) produced a different phenotype from inhibiting ATP synthase; namely, a failure to acidify lysosomes. Why might this be? Again, the explanation seems unlikely to involve energy limitation since inhibiting ETC components or ATP synthase did not produce this phenotype. One possibility is that inhibiting the Krebs cycle affects lysosome acidification by affecting redox potential, as several Krebs cycle enzymes affecting protein aggregation (ogdh-1 and sdhd-1) encode dehydrogenases that produce the reducing agents NADH and FADH₂, and aconitase supplies the substrate for another Krebs cycle dehydrogenase. Alternatively, other metabolites generated via Krebs cycle intermediates could influence the events leading to lysosome acidification. It will be interesting to explore this mechanism in the future.

Previously, we observed lysosomes engulfing protein aggregates in a process reminiscent of microautophagy (Bohnert and Kenyon, 2017). Before these observations, microautophagy had not been described in C. elegans. In this study, using a candidate approach, we showed that inhibiting ESCRT-complex members, which are known to mediate microautophagy in other organisms, prevents aggregate accumulation in maturing C. elegans oocytes. Moreover, they influence protein aggregation independently of lysosomal acidification, consistent with their having a direct role. These findings strengthen the case that microautophagy is an active proteostasis mechanism in C. elegans, and likely the mechanism by which aggregates are cleared in response to oocyte maturation signals (Figure 7).

Together, our findings all point towards lysosomal acidification being a key determinative event in oocyte protein-aggregate clearance. Notably, the screen hits that affected the lysosomal V-ATPase and COPII (ER-to-lysosomal vesicle transport) had a striking ability to accelerate age-dependent protein aggregation in somatic cells. Thus, the same mechanisms that enhance oocyte proteostasis in the immortal germline likely enhance somatic proteostasis as well. These findings may have implications for aging and longevity more broadly. In yeast, lysosomal acidity declines with age, and overexpressing the yeast ortholog of the C. elegans V-ATPase gene vha-13 delays this decline and extends replicative lifespan (Hughes and Gottschling, 2012). In worms, lysosome acidification also declines with age, and this decline is delayed in long-lived mutants (Baxi et al., 2017; Sun et al., 2020). Whether increasing V-ATPase function might be sufficient to extend lifespan in C. elegans is unclear, but overproduction of the transcription factor HLH-30/TFEB, which augments many lysosomal functions, has been shown to do so (Lapierre et al., 2013; O'Rourke and Ruvkun, 2013), and in mammals, similar perturbations slow the aging of the immune system (Zhang et al., 2019).

In summary, a genetic screen for proteostasis enhancers in the immortal germ lineage has revealed a landscape of interconnected processes spanning protein translation, cytoskeletal dynamics, Krebs cycle activity, ER activation and vesicle transport, that together enable lysosome acidification and clearance of protein aggregates during oocyte maturation. Lysosomal acidification maintains proteostasis in the aging soma as well. In addition to raising many new questions for future investigations, our findings support a growing body of evidence indicating that interventions which rejuvenate lysosomal activity during aging might yield new ways to increase human health and longevity.

All strains used in this study are listed in Supplementary file 2. Hermaphrodites expressing germline transgenes were maintained at 25°C to delay silencing. Mutants carrying the thermosensitive, feminizing fem-1(hc17ts) allele, which causes cells that would normally become sperm instead to become oocytes, were maintained at the permissive temperature of 15°C and moved to 25°C for feminization prior to hatching, or at the L1 stage. Animals were grown under standard laboratory conditions (Brenner, 1974) and maintained on Nematode Growth Medium (NGM) seeded with OP50 bacteria, unless otherwise indicated.

Unless otherwise indicated, RNAi was initiated in the early L4 larval stage prior to formation of oocytes but following much of development. One exception was fem-1 RNAi, which was initiated at hatching to ensure feminization. RNAi bacterial feeding was initiated and maintained for 36–40 hr prior to imaging to allow sufficient time for knockdown.

The initial whole-genome primary screen yielded 367 candidate genes, whose knockdown starting at the L4 larval stage resulted in GFP::RHO-1-aggregate accumulation within oocytes of young-adult hermaphrodites. False positives were eliminated by three independent rounds of validation, again using the GFP::RHO-1 strain, in which all candidates were subjected to the same workflow as the primary screen. The validation rounds were performed in a blinded fashion by two independent experimentalists and included the positive controls vha-13 and atp-2 RNAi (Bohnert and Kenyon, 2017). A candidate was considered to be positive if aggregation was observed in >50% animals in at least two out of the three rounds of validation. This led to the confirmation of 88 candidates required for preventing GFP::RHO-1 aggregation in the hermaphrodite germline. Next, we randomly selected 55 candidates (ensuring representation of all the GO categories in Figure 1D, as well as each individual orphan candidate) and subjected them to orthogonal verification using the NMY-2::GFP reporter. If the representative candidates from a particular GO category tested positive in this round of screening, the entire category was considered confirmed. Finally, we discarded candidates that were (i) known to be required for male gonad development or spermatogenesis, (ii) non-specific RNAi targets, or (iii) known targets of the RHO-1 protein, thereby confirming 81 verified genes from the screen (Figure 1C). Notably, our analysis did not allow the identification of false negatives and we manually tested some genes that we thought might be involved in the pathway [e.g., TOR pathway genes (which did produce a clear positive signal) and ESCRT-complex subunits].

For selecting the ‘assay pool’ of genes used in all further phenotypic screens, we picked candidates from each GO category that were associated with consistent GFP::RHO-1 aggregation, with intermediate to strong phenotypes. In categories such as translation or protein degradation, we specifically included at least one candidate of small and large ribosomal subunits or structural and regulatory proteasomal subunits, respectively. Similarly, in the actin cytoskeletal category, we ensured that both structural and regulatory genes were included. No other specific criteria were used to avoid any bias in candidate selection. All confirmed orphans were included in the assay pool without any further selection.

Confocal fluorescence images were acquired on a Nikon Eclipse Ti CSU-X1 equipped with 405, 488, 561, and 640 nm lasers. Emission was collected through 455/50, 525/36, 605/70, or 700/75 nm filters on an Andor iXon Ultra EMCCD camera using the NIS-Elements software. Images were visualized using ImageJ Fiji. Maintenance and selection of transgenic worms expressing fluorescent markers were performed using a Leica M165 FC fluorescent stereo microscope equipped with a Sola SE-V light source. Photobleaching and wide-field experiments were performed using a Leica TIRF microscope equipped with an infinity scanner using 488 nm laser excitation. Emission was collected through a GFP-T filter cube on a Hamamatsu ORCA-Flash4 camera.

An individual female animal was immobilized on an agarose pad using 2 mM levamisole, and the reporter of interest was imaged in the anterior gonad arm. Levamisole was washed off immediately, and the animal was introduced to an NGM plate containing young CB1490 male animals in a small spot of OP50 bacteria (five males:one female). The interactions were monitored using a benchtop stereo microscope, and when mating occurred, the female was transferred immediately to the agarose pad and imaged again, ensuring that the same oocytes were visualized before and after mating. Successful mating events were tracked by gonadal sheath contractions in response to sperm and subsequently confirmed by successful ovulation. Changes within individual oocytes upon mating were monitored up to 90 min at 10 min intervals. An identical procedure was performed for control females, except for exposure to males. Specific regions within proximal oocytes of control female animals were compared at all time points to determine the extent of signal intensity change due to photobleaching, with increasing time (Figure 2—figure supplement 5). In addition, regions of the distal germline were also monitored in mated animals (data not shown) to verify that the disappearance of the signal representing ER clusters and protein aggregates was not due to photobleaching.

A synchronized population of KIN-19::split-wrmScarlet-expressing CF4609 animals was grown on OP50 from L1 at 20°C. Worms were transferred every other day to freshly seeded NGM plates to remove progeny. Worms were imaged by confocal microscopy at days 1, 4, 7, and 11 of adulthood.

N2E hermaphrodites and fem-1(hc17ts) females were cultured for five generations at 15°C without starvation or contamination at any point. Animals from 12 small plates of each strain were bleached, and the synchronized eggs were collected and washed thoroughly in M9 and strained through 40 µm strainers to remove adult carcasses. Eggs were then resuspended in fresh M9 and incubated at 25°C overnight on a rotating mixer. Synchronized L1 animals were moved to NGM plates seeded with OP50 and incubated at 25°C (~50 animals per plate). Newly developed day 1 adults were further processed according to standard C. elegans TEM techniques (Hall et al., 2012). Briefly, the animals were loaded into 100-µm-deep specimen carriers and high-pressure frozen in a Bal-tec HPM (approximately 20 worms per carrier). After freezing, the carriers were transferred to vials containing freeze substitution (FS) media (1% OsO4% and 0.1% uranyl acetate in acetone), while still submerged in liquid N₂. Frozen samples were slowly warmed to approximately −15°C while being agitated on a rotating platform (adapted from McDonald and Webb, 2011). Following FS, samples were infiltrated with epon resin/acetone series (25% resin [1 hr], 50% resin [1 hr], 75% resin [overnight], 100% resin [1 hr], 100% resin [1 hr], and the resin from last step replaced with fresh resin for embedding) and subjected to polymerization at 60°C for 48 hr. For staining, thin sections (70 nm thick) were cut on an ultramicrotome, picked up on Formvar-coated 50 mesh grids, and post-stained for 7 min in 2% uranyl acetate (aq), followed by 7 min in lead citrate. Images were acquired on a Tecnai 12 TEM.

CF4609 animals treated with vps-20 RNAi, vps-54 RNAi or empty-vector control were recovered after imaging, collected in Eppendorf DNA LoBind tube with 10 µl of Cells-to-Ct lysis buffer supplemented with DNase I (Thermo Fisher Scientific) and placed at −80°C for 30 min. Tubes were thawed on ice and processed on a bead-beater for 30 s at 4°C. Worm lysates were incubated at room temperature for 10 min, and lysis was stopped by adding 2 µl of Stop Buffer from the Cells-to-Ct kit. Samples were then incubated at 95°C, 5 min. cDNAs were synthesized from RNA templates using a reverse transcription mix following the manufacturer’s instructions. qPCR was carried out on an QuantStudio 6 Flex Real-Time PCR System using a SYBR green-based real‐time kit (Kapa Biosystems). The RNA polymerase II subunit ama-1 was used as the housekeeping control. The qPCR primers were as follows: vps‐20 [TCCGATCAGGATAATGCGATTT]/[AGCGCCTGGAATTACCAAA]; vps‐54 [TTCACTCTTCACAGGTGAGTTC]/[CCTGTGATCTACATGATTCTCTCTC]; ama‐1 [GACGAGTCCAACGTACTCTCCAAC]/[TACTTGGGGCTCGATGGGC].

ImageJ Fiji was used to quantify and analyze attributes from image data, and images from a given experimental set were scaled and processed identically for comparison. Preparation of graphs and statistical analyses was performed using GraphPad Prism 8. Statistical tests used to determine significance and p-values are described in the figure legends of each experiment. Each violin plot representation includes the median and quartiles, and distributions in bar graphs represent mean ± standard deviation. Figures displaying numerical values obtained by analysis of microscopy images of dye-stained worms report the average of multiple independent values (technical replicates) from individual animals (biological replicates), each of which are represented as data points. Experiments reporting qualitative phenotypes from microscopy images were performed at least three times (independently) with 10–15 animals per condition in each individual experiment (except the primary screen that was done only once but validated in three independent experiments). For all other cases, sample sizes and replicates are included in the corresponding figure legends. No statistical methods were used to predetermine sample sizes. Investigators were blinded to identity of RNAi clones (except for controls) while imaging multiple knockdown conditions in 96-well plates.

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

We thank colleagues in the Kenyon lab and at Calico Life Sciences for advice and discussion, and Daniel Gottschling and Calvin Jan for comments on the manuscript. Special thanks to Andrew Dillin (University of California, Berkeley) for sharing his transmission electron microscopy resources, and Peichuan Zhang for help with converting the RNAi collection format. We thank Robert Keyser for help with liquid handling robotics for the primary screen, and Kayley Hake for suggesting skewness as a way to capture puncta/aggregate formation in microscopy images. Peichuan Zhang and Rex Kerr helped to analyze somatic KIN-19::split-wrmScarlet aggregation. We thank Di Chen for sharing the DCL565 and DCL569 strains. Some C. elegans strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). The endogenously tagged V-ATPase and MosSCI C. elegans strains were generated by SunyBiotech, China. Some illustrations in Figures 1 and 7 were created with BioRender.com. The study was supported by Calico Life Sciences, DHH was supported by NIH OD010943, and MeS was supported by HHMI funding to A Dillin.

1. Received: September 2, 2020
2. Accepted: March 24, 2021
3. Version of Record published: April 13, 2021 (version 1)

© 2021, Samaddar et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.