Single-PanIN-seq unveils that ARID1A deficiency promotes pancreatic tumorigenesis by attenuating KRAS-induced senescence
- Department of Molecular and Human Genetics, Baylor College of Medicine, United States
- Genetics and Genomics Graduate Program, Baylor College of Medicine, United States
- Cancer and Cell, Biology Graduate Program, Baylor College of Medicine, United States
- Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, United States
- McNair Medical Institute, Baylor College of Medicine, United States
Figures
Figure 1 with 4 supplements
Single pancreatic intraepithelial neoplasia (PanIN) lesion RNA-seq unveils the potential player contributing to the attenuation of Kras-induced senescence in Arid1a knockout mice.
(A) Experimental scheme of transcriptome profiling of single PanIN lesions. (B) Multidimensional scaling plot showed a clear separation of the transcriptome profiles of lesions from AKC mice (Arid1af…
Figure 1—figure supplement 1
Mutations in ARID1A in ICGC-PACA-AU and TCGA pancreatic ductal adenocarcinoma (PDAC) cohorts based on cBioPortal data portal.
(A) Lollipop plot of mutations in ARID1A from ICGC-PACA-AU cohort (total sample: 383). (B) The frequency of different types of mutations in ARID1A in ICGC-PACA-AU cohort. Based on the ICGC data …
Figure 1—figure supplement 2
Arid1a knockout drastically accelerates pancreatic intraepithelial neoplasia (PanIN) progression.
(A) Genetic makeup and experimental scheme. (B) Representative H&E staining images of pancreata from A+/+KC, Afl/+KC, and Afl/flKC mice after administration of tamoxifen for 2, 4, and 6 months. (C) …
Figure 1—figure supplement 3
Profile of the transcriptomes of individual pancreatic intraepithelial neoplasia (PanIN) by PanIN-seq.
(A) Representative images of lesion region before and after laser capture microdissection. Scale bar, 100 µm. (B) The gene set enrichment analysis plot of apoptosis-related pathway between AKC PanIN …
Figure 1—figure supplement 4
The gene set enrichment plots of 27 relevant pathways with statistical significance in Afl/flKC lesions.
Figure 2 with 1 supplement
In vivo, ex vivo, and in vitro verification of attenuation of Kras-induced senescence by Arid1a deficiency.
(A) Representative images of senescence-associated beta-galactosidase (SA-β-Gal) staining of frozen pancreatic sections from KC mice and AKC mice. (B) SA-β-Gal-positive lesions were counted at five …
Figure 2—figure supplement 1
Generation of cell line with inducible KRAS overexpression and ARID1A knockout.
(A) Examination of activation of KRAS signaling by western in human pancreatic Nestin-expressing (HPNE) cells with inducible KRAS knockin (iKRAS-HPNE cells clone #4). Phosphorylation of ERK was used …
Figure 3 with 4 supplements
ARID1A knockout upregulates aldehyde dehydrogenase (ALDH) expression.
(A) Multidimensional scaling plot demonstrated clear separation between the transcriptome profiles of ARID1A-KO human pancreatic Nestin-expressing (HPNE) cells and wildtype cells with or without …
Figure 3—figure supplement 1
Gene set enrichment analysis on RNA-seq data.
(A) Gene set enrichment analysis between ARID1A-KO cell line and wildtype cell line under KRAS induction. (B) Gene set enrichment plots for the pathways reaching statistical significance (FDR < …
Figure 3—figure supplement 2
ARID1A knockout impairs phosphorylation of ERK in human pancreatic Nestin-expressing (HPNE) cells upon KRAS induction.
ARID1A-KO and wildtype HPNE cells were treated with or without 2 µg/ml doxycycline (Dox.) for 2 days. Phospho-ERK (p-ERK) was examined by western blot.
Figure 3—figure supplement 3
Differential response to oncogenic KRAS in ARID1A-KO and wildtype cells.
(A) Gene set enrichment analysis on the genes with differential response to oncogenic KRAS in ARID1A-KO and wildtype cells. (B) Gene set enrichment plots for the pathways with significant enrichment …
Figure 3—figure supplement 4
ALDH1A1 expression in ARID1A knockout human pancreatic Nestin-expressing (HPNE) cells.
(A) Volcano plot of differentially expressed genes between ARID1A knockout cells (clone #2) and wildtype cells without KRAS induction. (B, C) Volcano plot of differentially expressed genes between AR…
Figure 4 with 2 supplements
ARID1A knockout facilitates escape from KRAS-induced senescence by upregulating ALDH1A1 expression.
(A) Heatmap of the expression levels of aldehyde dehydrogenase (ALDH) family members in pancreatic ductal adenocarcinoma (PDAC) patients (Bailey et al., 2016). (B) Mutation rates of ALDH1A1, ALDH1A3,…
Figure 4—figure supplement 1
The expression of aldehyde dehydrogenase (ALDH) family members in normal pancreas and pancreatic ductal adenocarcinoma (PDAC).
(A) The expression level of different ALDH genes in normal pancreas. (B) The expression level of ALDH1A1 in different cell types of normal pancreas. (C) The distribution of the expression level of AL…
Figure 4—figure supplement 2
Knockdown efficiency of ALDH1A1 in human pancreatic Nestin-expressing (HPNE) cells with ARID1A knockout (clone #2 and #11) was confirmed by qRT-PCR.
Student’s t-test: **p<0.01; ***p<0.001, ****p<0.0001.
Figure 5 with 6 supplements
ARID1A knockout activates transcription of the ALDH1A1 gene by increasing the accessibility of its enhancer region.
(A) Spearman correlation coefficients of the read counts in peaks between ARID1A-KO human pancreatic Nestin-expressing (HPNE) cells and wildtype cells. ATAC sequencing was performed with three …
Figure 5—figure supplement 1
Quality control of ATAC-seq.
(A) The distribution of fragment size of wildtype cells. (B) The transcription start site (TSS) enrichment score of wildtype cells. (C) The enrichment of nucleosome-free reads at TSS compared to the …
Figure 5—figure supplement 2
Read density profiles of differential peaks.
(A) The read density profiles of the distal regions with increased accessibility in ARID1A-KO cells compared to wildtype cells. (B) The read density profiles of the distal regions with decreased …
Figure 5—figure supplement 3
General analysis of ATAC-seq by GREAT.
(A) The genomic distribution of the peaks with significantly decreased accessibility in ARID1A-KO cells compared to wildtype cells. (B) The genomic distribution of the peaks with significantly …
Figure 5—figure supplement 4
The overlap between the differentially expressed genes and differential peaks at promoter regions (A, B) and enhancer regions (C, D).
(A) The overlap between the significantly upregulated genes and the genes with significantly increased accessibility at promoter regions. (B) The overlap between the significantly downregulated …
Figure 5—figure supplement 5
Comparison in the change of chromatin accessibility between the genes within KRAS signaling pathway and the randomly chosen genes.
For the 173 genes from KRAS_SIGNALING_UP gene set from Hallmark gene sets, we calculated the chromatin accessibility fold change of these genes between ARID1A KO and wildtype. In comparison, 500 …
Figure 5—figure supplement 6
Motif analysis on the promoter regions.
(A) Motif enrichment analysis on the promoter regions with significantly increased accessibility in ARID1A-KO cells compared to wildtype cells. (B) Motif enrichment analysis on the promoter regions …
Figure 6 with 2 supplements
ARID1A knockout activates transcription of the ALDH1A1 gene by increasing the accessibility of its enhancer region.
(A) The ATAC-seq tracks and H3K4me1/H3K27ac ChIP-seq tracks of the distal regions of the ALDH1A1 gene. The ChIP-seq tracks from different cell lines are labeled in different colors and overlaid. The …
Figure 6—figure supplement 1
The landscape of H3K27ac and H3K4me1 at the upstream of ALDH1A1 gene in ALDH1A1high cell lines.
(A) The landscape of H3K4me1 at the upstream of ALDH1A1 gene in five ALDH1A1high cell lines. (B) The landscape of H3K27ac at the upstream of ALDH1A1 gene in six ALDH1A1high cell lines.
Figure 6—figure supplement 2
Verification of knockdown efficiency.
(A) The knockdown of EP300 is verified by qRT-PCR. (B) The knockdown of NR3C1 is verified by qRT-PCR.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Ptf1aCreERT | Jackson Lab | No: 019378 | |
| Genetic reagent (M. musculus) | Lox-Stop-Lox-KrasG12D | Jackson Lab | No: 008179 | |
| Genetic reagent (M. musculus) | Arid1aflox | PMID:18448678 | Dr. Zhong Wang lab (University of Michigan) | |
| Cell line (Homo sapiens) | hTERT-HPNE | Dr. Jennifer Baily lab (UT Health) | RRID:CVCL_C466 | |
| Recombinant DNA reagent | pInducer20-KRASG12D | Dr. Haoqiang Ying lab (MD Anderson Cancer Center) | Inducible expression of KRASG12D | |
| Recombinant DNA reagent | pL-CRISPR.EFS.tRFP | Addgene | RRID:Addgene_57819 | Pol III-based sgRNA expression backbone |
| Recombinant DNA reagent | pGIPZ | Open Biosystems | Pol III-based shRNA expression backbone | |
| Sequence-based reagent | sgARID1A | This paper | sgRNA | CAGCGGTACCCGATGACCAT |
| Sequence-based reagent | shALDH1A1 | This paper | shRNA | GGAGTGTTTACCAAAGACATT |
| Sequence-based reagent | shEP300-1 | This paper | shRNA | CGGCAAACAGTTGTGCACA |
| Sequence-based reagent | shEP300-2 | This paper | shRNA | AGCTACTGAAGATAGATTA |
| Sequence-based reagent | shNR3C1-1 | This paper | shRNA | CCAACGGTGGCAATGTGAA |
| Sequence-based reagent | shNR3C1-2 | This paper | shRNA | AGCTGTAAAGTTTTCTTCA |
| Commercial assay or kit | ROS detection assay kit | BioVision | Cat# K936-250 | |
| Commercial assay or kit | Senescence β-Galactosidase Staining Kit | Cell Signaling Technology | Cat# 9860 | |
| Chemical compound, drug | ALDEFLUOR diethylaminobenzaldehyde (DEAB) reagent, 1.5 mM in 95% ethanol | Stemcell Technologies Inc | Cat# 01705 | |
| Antibody | (Rabbit polyclonal) anti-ALDH1A1 | Abcam | Abcam Cat# ab23375, RRID:AB_2224009 | WB(1:400) |
| Antibody | (Rabbit polyclonal) anti-Aldh3a1 | Abcam | Abcam Cat# ab76976, RRID:AB_1523110 | IHC(1:100) |
| Antibody | (Rabbit polyclonal) anti-Ras | Abcam | Abcam Cat# ab180772, RRID:AB_2884935 | WB(1:500) |
| Antibody | (Mouse monoclonal) anti-β-Actin | Sigma-Aldrich | Sigma-Aldrich Cat# A1978, RRID:AB_476692 | WB(1:4000) |
| Antibody | (Rabbit monoclonal) anti- Phospho-p44/42 MAPK (Erk1/2) | Cell Signaling Technology | Cell Signaling Technology Cat# 4370, RRID:AB_2315112 | WB(1:1000) |
Additional files
-
Supplementary file 1
Gene set enrichment analysis on PanIN-seq.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp1-v2.xlsx
-
Supplementary file 2
Differential gene expression analysis on PanIN-seq.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp2-v2.xlsx
-
Supplementary file 3
Differential gene expression analysis on RNA-seq.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp3-v2.xlsx
-
Supplementary file 4
Interaction test on the RNA-seq data.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp4-v2.xlsx
-
Supplementary file 5
Quality control of ATAC-seq data.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp5-v2.xlsx
-
Supplementary file 6
ATAC peaks in the regulatory regions of ALDH1A1.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp6-v2.xlsx
-
Supplementary file 7
Motif enrichment analysis on differential ATAC peaks.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp7-v2.xlsx
-
Supplementary file 8
Expression (RPKM) of ALDH1A1 in other human cell lines.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp8-v2.xlsx
-
Supplementary file 9
Binding of TFs at the regulatory region of ALDH1A1 in human cell lines.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp9-v2.xlsx
-
Supplementary file 10
List of ENCODE datasets used.
- https://cdn.elifesciences.org/articles/64204/elife-64204-supp10-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64204/elife-64204-transrepform1-v2.docx
