Evolutionary shifts in taste coding in the fruit pest Drosophila suzukii

  1. Hany KM Dweck  Is a corresponding author
  2. Gaëlle JS Talross
  3. Wanyue Wang
  4. John R Carlson  Is a corresponding author
  1. Department of Molecular, Cellular and Developmental Biology, Yale University, United States

Abstract

Although most Drosophila species lay eggs in overripe fruit, the agricultural pest Drosophila suzukii lays eggs in ripe fruit. We found that changes in bitter taste perception have accompanied this adaptation. We show that bitter-sensing mutants of Drosophila melanogaster undergo a shift in egg laying preference toward ripe fruit. D. suzukii has lost 20% of the bitter-sensing sensilla from the labellum, the major taste organ of the head. Physiological responses to various bitter compounds are lost. Responses to strawberry purées are lost from two classes of taste sensilla. Egg laying is not deterred by bitter compounds that deter other species. Profiling of labellar transcriptomes reveals reduced expression of several bitter Gr genes (gustatory receptors). These findings support a model in which bitter compounds in early ripening stages deter egg laying in most Drosophila species, but a loss of bitter response contributes to the adaptation of D. suzukii to ripe fruit.

eLife digest

A new agricultural pest has recently emerged in the United States and Northern Europe. The invasive species is a type of fruit fly that normally lives in Southeast Asia called Drosophila suzukii (also known as the spotted wing Drosophila). This fly poses a threat to fruit crops – including strawberries, blueberries, cherries, peaches and grapes – because, while other fruit flies lay eggs in overripe fruit, D. suzukii lays eggs in ripe fruit, leading to agricultural losses.

This shift in where fruit flies prefer to lay their eggs is related to changes in the senses of smell and touch, and taste could also play a role. Insects have evolved mechanisms that dissuade them from eating or laying eggs in plants with high levels of toxins, which taste bitter. If D. suzukii is less sensitive to bitter tastes than other flies, this could help explain why it lays eggs in just-ripe fruit, since the levels of certain bitter compounds are higher in the early stages of ripening than later on.

To figure out if this is the case, Dweck et al. studied different species of fruit fly. Compared to Drosophila melanogaster (a fruit fly common in America and Europe that is regularly used in scientific studies), D. suzukii had fewer bitter taste receptor neurons on the major taste organ of the fly head. These receptor neurons were also less responsive to a variety of bitter compounds.

Next, Dweck et al. tested whether D. melanogaster and D. suzukii showed different preferences for where to lay their eggs by offering them strawberry purées made from fruit at different ripening stages. In this experiment, D. suzukii preferred to lay its eggs on purées made from unripe or just-ripe strawberries, while D. melanogaster showed a preference for fermented (overripe) purée. Furthermore, when D. melanogaster flies were genetically modified so that they became less sensitive to bitter taste, they preferred to lay their eggs in ripe (rather than overripe) fruit, similar to D. suzukii. These results suggest that taste has a major role in the egg laying preferences of D. suzukii.

Further research is needed to determine which bitter compounds influence egg-laying decisions in each species of fruit fly, and what receptors respond to these compounds. However, Dweck et al.’s results lay the groundwork for new approaches to reducing D. suzukii’s impact on agriculture.

Introduction

A major agricultural pest has recently emerged in dramatic fashion. Drosophila suzukii, endemic to Southeast Asia, invaded California in 2008 (Hauser, 2011). It moved rapidly across the United States and has now emerged in Northern Europe as well (Asplen et al., 2015; Cini et al., 2012; Deprá et al., 2014; Dos Santos et al., 2017; Walsh et al., 2011). D. suzukii is a threat to a wide variety of fruit crops, including strawberries, blueberries, peaches, cherries, and grapes (Burrack et al., 2013; Lee et al., 2011; Mazzi et al., 2017). Whereas related species such as Drosophila melanogaster lay eggs in fermenting fruit that is of no commercial value, D. suzukii lays eggs in ripe fruit, leading to larval infestations and microbial infections that destroy crops (Karageorgi et al., 2017; Lee et al., 2011; Walsh et al., 2011).

The adaptation of D. suzukii to ripe fruits has been accompanied by the evolution of a large serrated ovipositor, which penetrates the surface of ripe fruit and deposits an egg (Atallah et al., 2014; Green et al., 2019). A recent study showed that changes in the olfactory and mechanosensory systems contribute to the adaptation of D. suzukii to its new niche (Karageorgi et al., 2017). The study also suggested the possibility that taste may play a role, a suggestion that we explore in the present study.

Plants produce a vast diversity of toxins to defend themselves against insect attack (Biere et al., 2004; Frost et al., 2008; Fürstenberg-Hägg et al., 2013; Ibanez et al., 2012; War et al., 2012). Many of these compounds are secondary metabolites that taste bitter to humans (Dagan-Wiener et al., 2017; Drewnowski and Gomez-Carneros, 2000; Keast et al., 2003; Wiener et al., 2012). Insects in turn have evolved mechanisms for detecting these bitter compounds and avoiding them; these compounds thus deter feeding and oviposition (Briscoe et al., 2013; Chen et al., 2019; Pontes et al., 2014; Salloum et al., 2011; Sellier et al., 2011; Wada-Katsumata et al., 2013). Since levels of bitter compounds differ among various stages of fruit ripening, it seems plausible that the sensitivity of an insect to different bitter compounds may influence its choice of a ripening stage on which to lay eggs (Batista-Silva et al., 2018; Cheng and Breen, 1991; Taghadomi-Saberi et al., 2018). As a corollary, it seems conceivable that changes in bitter perception might contribute to the shift of oviposition preference in D. suzukii.

Although there has been little, if any, previous analysis of the bitter taste system in D. suzukii, bitter taste in D. melanogaster has been studied in detail (Delventhal and Carlson, 2016; Dweck and Carlson, 2020; Liman et al., 2014; Ling et al., 2014; Scott, 2018; Weiss et al., 2011). Bitter-sensing neurons are housed in taste sensilla in the labellum (one of the mouthparts), the tarsal segments of the legs, and the pharynx (Chen and Dahanukar, 2017; Delventhal and Carlson, 2016; Dweck and Carlson, 2020; Lee et al., 2010; Lee et al., 2015; Ling et al., 2014; Marella et al., 2006; Meunier et al., 2003; Moon et al., 2009; Poudel and Lee, 2016; Rimal et al., 2020; Sang et al., 2019; Weiss et al., 2011). Although there are several kinds of taste receptors, bitter responses depend largely on the Gr (gustatory receptor) family (Clyne et al., 2000; Joseph and Carlson, 2015; Liman et al., 2014; Scott, 2018). Many Gr genes have been found to be required for response to individual bitter compounds (Dweck and Carlson, 2020; Lee et al., 2010; Lee et al., 2015; Moon et al., 2009; Poudel and Lee, 2016; Rimal et al., 2020; Sang et al., 2019; Weiss et al., 2011). Moreover, expression of certain Gr genes in sugar-sensing neurons confers response to bitter compounds (Dweck and Carlson, 2020; Shim et al., 2015; Sung et al., 2017).

Here, we analyze bitter taste and its role in the evolution of oviposition behavior in D. suzukii. First we measure the preferences of D. suzukii and related species (Figure 1A) for strawberries at a variety of ripening stages. We then show that a mutant of D. melanogaster with reduced bitter response has a shift in oviposition preference like that of D. suzukii. Anatomical analysis of D. suzukii shows that it has lost 20% of its bitter-sensing sensilla from the labellum. Physiological analysis of D. suzukii and its close relative Drosophila biarmipes reveals that the shift to ripe fruits has been accompanied by a loss of many bitter responses, including responses to individual bitter compounds and to strawberry purées. Likewise, D. suzukii lays eggs on substrates with bitter compounds that deter oviposition in D. melanogaster and D. biarmipes. Finally we characterize the labellar transcriptomes of all three species and find that D. suzukii has reduced expression of a number of bitter taste receptor genes. Taken together, these results provide an unprecedented view of how the bitter taste system of an invasive crop pest evolved in its shift to a new ecological niche.

Oviposition preferences of Drosophila suzukii among a broad range of ripening stages.

(A) Phylogenetic tree depicting the relationship between D. suzukii and closely related Drosophila species. From http://spottedwingflybase.org/. (B) The multiple-choice oviposition assay. (C–E) Oviposition preferences of Drosophila melanogaster (C), D. suzukii (D), and Drosophila biarmipes (E) for different ripening stages: 1 = white-green, 2 = mature first blush, 3 = light red, 4 = dark red, 5 = ripe, 6 = early fermented, and 7 = fermented. One-way ANOVA followed by Tukey’s multiple comparison test; n = 5. Error bars are SEM. Values indicated with different letters are significantly different (p<0.05).

Figure 1—source data 1

Source data for number of eggs laid on each stage of ripening in Figure 1.

https://cdn.elifesciences.org/articles/64317/elife-64317-fig1-data1-v1.xlsx

Results

Oviposition preferences of D. suzukii among a broad range of ripening stages

In a natural environment, female fruit flies seeking an oviposition site often have a wide range of choices. A given plant may simultaneously bear fruit at stages ranging from green to ripe to overripe, with fermenting fruit on the ground underneath. To determine which stages are most and least preferred by D. suzukii we used a multiple-choice oviposition paradigm.

We collected strawberries from a field in Connecticut, USA, and separated them into seven stages: white-green, mature first blush, light red, dark red, ripe, early fermented, and fermented. From fruit at each stage we generated a purée, from which we prepared an agar plate. We then tested a stock of D. suzukii that also originated from a field in Connecticut. Flies were allowed to choose oviposition sites in the dark (Figure 1B).

Whereas D. melanogaster laid the most eggs on the purée of the fermented stage of strawberry (Stage 7, Figure 1C), D. suzukii females laid the fewest eggs on this fermented stage (Figure 1D). Rather, D. suzukii laid more eggs on the white-green and ripe stages (Stages 1 and 5).

We also tested a third species, D. biarmipes, which is phylogenetically much closer to D. suzukii than to D. melanogaster (Figure 1A), and did not find strong preferences (Figure 1E). We note that this species laid a smaller number of eggs than the other two species in this experiment.

These results from our multiple-choice paradigm confirm and extend previous studies (Bernardi et al., 2017; Karageorgi et al., 2017; Lee et al., 2011; Olazcuaga et al., 2019; Shrader et al., 2019) showing that D. suzukii has an oviposition preference for early maturation stages, including both ripe fruit and earlier ripening stages, unlike D. melanogaster and many other drosophilids.

Taste contributes to the oviposition difference between D. suzukii and D. melanogaster

We asked whether taste plays a role in the oviposition differences between D. melanogaster and D. suzukii. For this purpose we tested the oviposition preference of D. melanogaster and D. suzukii for ripe and overripe strawberry in a two-choice assay (Figure 2A). D. melanogaster preferred the overripe fruit, whereas D. suzukii preferred the ripe fruit, as expected (Figure 2B).

Taste contributes to the oviposition difference between Drosophila suzukii and Drosophila melanogaster.

(A) The two-choice oviposition assay. (B) Oviposition preferences of D. suzukii and D. melanogaster for ripe and overripe strawberry. *p<0.05, Mann-Whitney test, n = 7. The numbers of eggs laid were 43 ± 7 for D. melanogaster and 77 ± 12 for D. suzukii. Error bars are SEM. (C,D) Preferences of two Gr33 mutants and control w1118 Canton-S flies for ripe and overripe strawberry. The strawberries used in (D) were from a different source than those in all other experiments. **p<0.01, ****p<0.0001, Mann-Whitney test; n = 18 for Gr33a2 and n = 19–20 for Gr33a3 and control. In (C) the numbers of eggs laid were 156 ± 15 for the control and 90 ± 10 for Gr33a2; in (D) the numbers were 56 ± 7 for the control and 173 ± 25 for Gr33a3. Error bars are SEM.

We then tested D. melanogaster mutant for Gr33a (gustatory receptor), a receptor that is expressed in many taste neurons and is required for behavioral and physiological responses to many bitter tastants (Dweck and Carlson, 2020; Moon et al., 2009). Surprisingly, Gr33a2 showed a shift in preference similar to that of D. suzukii (Figure 2C; the genetic background control is w1118 Canton-S, p<0.0001, n = 18, Wilcoxon signed-rank test). We confirmed this shift with another allele, Gr33a3, and a different source of strawberries (Figure 2D, p<0.01, n = 19–20).

These results support a role for bitter taste in the oviposition preference between early and late ripening stages. One hypothesis suggested by these results is that the adaptation of D. suzukii to ripe fruit has been accompanied by a loss of bitter responses.

A reduced repertoire of taste sensilla in D. suzukii

We next investigated the anatomical basis of taste in D. suzukii. We examined three organs that make direct contact with potential oviposition sites: the labellum, the legs, and the ovipositor. These organs all harbor sensilla that could differ in number, structure, or position from those in closely related Drosophila species with different oviposition preferences.

We first examined the labellum, the main taste organ of the fly head, via scanning electron microscopy (SEM). Three types of taste sensilla were identified: short (S), intermediate (I), and long (L) (Figure 3A–D). S sensilla are present on the most medial region (Figure 3A, white dots); I sensilla are found more laterally (Figure 3A, arrowheads); L sensilla (Figure 3A, arrows) are located between S and I sensilla. Corresponding classes with similar distributions are found in D. melanogaster (Shanbhag et al., 2001; Stocker, 1994; Weiss et al., 2011). Taste sensilla in both species fall into two classes distinguishable by the morphology of their tips: straight (Figure 3B) and forked (Figure 3C). In D. melanogaster, the straight tip and each prong of the forked tip have been shown to contain a terminal pore (Nayak and Singh, 1983). Two other sensilla lie near the periphery (Figure 3A, asterisks) in both species. They are ~17 μm long and taper to a fine tip with no pore, arguing against a function in taste.

Figure 3 with 1 supplement see all
Taste sensilla on the labellum and leg.

(A) Scanning electron micrograph of the labellum of D. suzukii showing short taste sensilla (white dots), intermediate taste sensilla (white arrowheads), long taste sensilla (white arrows), and sensilla that have no terminal pores (asterisks). (B) Scanning electron micrograph of an intermediate taste sensillum with a straight tip. (C) Scanning electron micrograph of a long taste sensillum with a forked tip. (D) Maps of labellar taste sensilla in the three species. (E) Map of taste sensilla on the two most distal tarsal segments of the female foreleg; the map applies to all three species.

A striking difference in sensillum morphology was found between D. suzukii and D. melanogaster: sensilla in D. suzukii are much longer. S sensilla of D. suzukii are ~43–53 μm long compared to ~20–30 μm in D. melanogaster; I sensilla are ~57–63 μm vs. 30–40 μm; L sensilla are ~73–100 μm vs. ~ 40–50 μm.

D. suzukii has fewer labellar sensilla. On each half-labellum of D. suzukii and D. biarmipes there are 27, rather than 31, sensilla as in D. melanogaster. The numbers of S sensilla and I sensilla are each reduced by two (Figure 3D). Unlike D. melanogaster, the region between I0 and L7 sensilla lacks sensilla in both D. suzukii and D. biarmipes. The positions of the remaining S and I sensilla do not correspond precisely to those of D. melanogaster sensilla, but the overall spatial patterns are similar, providing an opportunity for a comparative analysis of their functions.

Next we examined the 4th and 5th segments of the female foreleg in D. suzukii by light microscopy. We identified three putative taste sensilla on the 4th segment and four on the 5th segment (Figure 3E). All of these sensilla, except f4c, are arranged in pairs, such that lateral sensilla have a symmetric counterpart on the medial surface of the leg. These taste sensilla are similar in morphology and position to those in D. melanogaster and D. biarmipes. We adopt the nomenclature used for D. melanogaster, for example, ‘f’ indicates ‘female,’ and ‘4’ indicates the fourth tarsal segment (Ling et al., 2014; Meunier et al., 2003; Zhang et al., 2011; Zhang et al., 2010).

Ovipositors have taste function in larger flies (Merritt and Rice, 1984). Although the ovipositor is often referred to as a taste organ in D. melanogaster (Stocker, 1994), there is little, if any, evidence to support a taste function in this species. The saw-like ovipositor of D. suzukii is larger and facilitates egg laying in ripening fruit that other drosophilid species cannot use (Atallah et al., 2014; Harris et al., 2014; Lee et al., 2011). We hypothesized that it might have evolved a taste function lacking in D. melanogaster. We examined the D. suzukii ovipositor by SEM and identified four types of structures on each vaginal plate (VP): trichoid sensilla (TS), long bristles (LB), thorn bristles type I (TB1), and thorn bristles type 2 (TB2) (Figure 3—figure supplement 1; structures described in legend; terminology from Hodgkin and Bryant, 1978; Lauge, 1982). We did not observe a pore at the tip of any of these structures, suggesting that they do not function in taste.

Thus, of the three D. suzukii organs that make contact with potential oviposition sites, the labellum and legs but not the ovipositor have a repertoire of sensilla whose morphology is characteristic of taste sensilla. We focused on them for a functional analysis.

Shifts in coding of bitter tastants in the D. suzukii labellum

Since we had found that bitter taste contributes to the difference in oviposition preference between D. suzukii and D. melanogaster (Figure 2), we analyzed the coding of bitter taste in D. suzukii. Bitter taste is the interface between drosophilids and many plant secondary metabolites that are toxic to insects (Briscoe et al., 2013; Dweck and Carlson, 2020; Pentzold et al., 2017; Weiss et al., 2011). A wide variety of insect species have undergone evolutionary shifts that allow them to specialize on particular plant hosts that are toxic to other species, thereby reducing competition (Whiteman and Pierce, 2008).

To examine bitter taste coding in female D. suzukii, we systematically measured electrophysiological responses of all 27 labellar sensilla to a panel of 16 bitter compounds, that is, 432 sensillum-tastant combinations, in an analysis comprising >3100 recordings. The compounds are structurally diverse and include naturally occurring alkaloids, terpenoids, and phenolic compounds. They also include DEET (N,N-Diethyl-meta-toluamide), the most widely used insect repellent worldwide (Diaz, 2016).

We found that L sensilla of D. suzukii showed little or no response to any tested bitter compound (Figure 4). Two S sensilla, S3 and S7, also showed little response to bitter compounds (n < 10 spikes/s to all tastants). I sensilla responded to a subset of bitter compounds, and most S sensilla responded to different subsets. The strongest responses were from several S sensilla to escin (ESC) and aristolochic acid (ARI), ~60 spikes/s in each case (Figures 4 and 5A). Some bitter compounds, such as DEET and saponin (SAP), elicited little or no response from any sensillum.

Figure 4 with 2 supplements see all
Electrophysiological responses to bitter compounds in labellar sensilla of the three Drosophila species.

For Drosophila suzukii, n = 5–10 for 84% of the 459 tastant-sensillum combinations; n > 10 for the remaining 16%. For Drosophila biarmipes, n = 5–10 for 96% of the 459 tastant-sensillum combinations; n > 10 for the remaining 4%. Responses of Drosophila melanogaster are adapted from Weiss et al., 2011. Responses to the diluent control, tricholine citrate (TCC), were subtracted. Values for D. suzukii and D. biarmipes are in a Supplementary file.

Figure 4—source data 1

Responses to bitter compounds across species.

(A) Responses in spikes/s of labellar sensilla of three species to bitter compounds. Values represent the mean responses in spikes per second as measured by the number of action potentials generated over a 500 ms interval. For Drosophila suzukii, n = 5–10 for 84% of the 459 tastant-sensillum combinations; n > 10 for the remaining 16%. For Drosophila biarmipes, n = 5–10 for 96% of the 459 tastant-sensillum combinations; n > 10 for the remaining 4%. Responses to the tricholine citrate (TCC) diluent have been subtracted from the tastant responses. (B) SEMs of responses shown in (A). Data from Drosophila melanogaster are from Weiss et al., 2011.

https://cdn.elifesciences.org/articles/64317/elife-64317-fig4-data1-v1.pdf
Sample electrophysiological traces from labellar sensilla of the three species.

(A) Escin (ESC) elicits strong responses from S9 in Drosophila suzukii and Drosophila biarmipes but a weak response from S10 in Drosophila melanogaster, which is at approximately the same position as S9 in the other species. (B) Caffeine (CAF) elicits little, if any, response from I6 in D. suzukii and D. biarmipes but a strong response from I8 in D. melanogaster, which is at approximately the same position as I6 in the other species. (C) N,N-Diethyl-meta-toluamide (DEET) elicits little, if any, response from any S sensillum in D. suzukii but elicits responses from several S sensilla in D. biarmipes and D. melanogaster. (D) Saponin (SAP) elicits little, if any, response from any S sensillum in D. suzukii but elicits responses from most S sensilla in D. biarmipes and D. melanogaster.

How does bitter coding of D. suzukii compare to that in other species? We carried out a comparable analysis in D. biarmipes, examining the same 432 sensillum-tastant combinations (>2700 total recordings). We also took advantage of a dataset that was generated previously in our laboratory for D. melanogaster and that is comparable to those obtained with our current methods (one-way ANOSIM test of distinguishability, R = 0.58, p=0.19; Weiss et al., 2011, Dweck and Carlson, 2020).

We found that some basic organizational principles are conserved among all three species. All three show a paucity of bitter responses among L sensilla, and in all species there are two S sensilla that show little, if any, response to the bitter compounds (Figure 4 and Figure 4—source data 1). A number of S sensilla appeared more broadly tuned than I sensilla in each species.

Different compounds elicited the strongest responses from different species: ESC and ARI in D. suzukii, ESC in D. biarmipes, and caffeine (CAF), umbelliferone (UMB), theophylline (TPH), and SAP in D. melanogaster. Interestingly, the strongest responses to ESC in D. suzukii are from S1, S4, and S9; corresponding sensilla show similar responses in D. biarmipes (S1, S4, and S9), but in D. melanogaster none of the S sensilla show such strong responses to ESC (Figures 4 and 5A).

D. melanogaster differs markedly from the other two species in its strong responses of I sensilla, that is, the responses of I8, I9, and I10 to CAF, UMB, and TPH. These responses are virtually absent in D. suzukii and D. biarmipes, even at higher concentrations (Figures 4 and 5A, Figure 4—figure supplement 1, and Figure 4—source data 1).

D. suzukii differs from both D. melanogaster and D. biarmipes in having little or no response to DEET or SAP (Figures 4 and 5C,D). By contrast, D. suzukii has evolved stronger responses to ARI than are observed in either of the other species (Figure 4).

To determine the number of functional classes of sensilla on the labellum of D. suzukii, we performed a hierarchical cluster analysis. Sensilla fell into four functional classes (Figure 4—figure supplement 2A). All L sensilla clustered together with two S sensilla (‘S-c’ sensilla) to form a class that showed little or no response to any of the tested bitter compounds. The other three classes consisted uniformly of either S or I sensilla. We carried out a similar cluster analysis of D. biarmipes (Figure 4—figure supplement 2B) and then compared the results from both species to an earlier analysis of D. melanogaster (Figure 4—figure supplement 2C).

All three species have a cluster consisting of all L sensilla and two S sensilla. In each species the remaining S sensilla divide into two classes, which we will refer to as S-a and S-b, but the functional characteristics of these S classes vary across species.

In D. suzukii, the S-a class contains four members and was broadly tuned, responding to 13 of the 16 tested bitter compounds with a mean spike frequency of >10 spikes/s. S-b contains three members and responded to only four compounds at >10 spikes/s.

In D. biarmipes, S-a also contains four members and is broadly tuned. S-b contains three members and responded to only two bitter compounds with a response greater than 10 spikes/s.

In D. melanogaster, S-a contains six S sensilla and S-b contains three. S-a and S-b are both broadly tuned, responding to 9 and 15 of the 16 bitter compounds, respectively, with a spike frequency >10 spikes/s.

I sensilla all fall into a single class, I-a, in both D. suzukii and D. biarmipes. In D. melanogaster, the I sensilla fall into two classes, I-a and I-b, which respond to non-overlapping subsets of tastants.

These results, taken together, reveal that functional classes of taste neurons and their tuning breadths expanded or contracted during the evolution of the three species.

Strawberry extracts elicit different labellar responses from D. suzukii than from other species

Having characterized labellar sensilla of the three species, we next asked whether there were functional differences among species that could contribute to their oviposition preferences. We measured electrophysiological responses of the entire ensemble of labellar sensilla of all three species to extracts of ripe and overripe strawberry.

The response of S sensilla to ripe strawberry was low in all three species (Figure 6A, left). However, total spike input was lower in D. suzukii and D. biarmipes than in D. melanogaster in both S-a and S-b (Figure 6B, left; p<0.05, one-way ANOVA followed by Tukey's multiple comparison test, n = 5).

Figure 6 with 2 supplements see all
Strawberry extracts elicit different labellar responses from Drosophila suzukii than from other species.

(A) Labellar taste responses of Drosophila melanogaster, D. suzukii, and Drosophila biarmipes to ripe and overripe strawberry. The strawberry extracts were those used as stages 5 and 7 in the experiment shown in Figure 1. n = 5–15. Error bars are SEM. (B) Summed responses of S-a and S-b sensilla to ripe and overripe strawberry. One-way ANOVA followed by Tukey’s multiple comparison test; n = 5. Error bars are SEM. Values indicated with different letters are significantly different (p<0.05). (C) Sample traces of electrophysiological recordings from S7 of the control w1118 Canton S, Gr33a2, and Gr33a3 to overripe strawberry. (D) Electrophysiological responses of S5, S6, and S7 of w1118 Canton S, Gr33a2, and Gr33a3 to overripe strawberry (**p=0.001, ***p=0.0001, ****p<0.0001; Mann-Whitney test; n = 5–14).

The response to overripe strawberry also differed among species (Figure 6A, right column). Whereas all S sensilla of D. melanogaster responded, there was little or no response of any S-a or S-b sensilla of D. suzukii. Specifically, the responses of D. melanogaster to overripe strawberry in S-a and S-b sensilla were 13 ± 0.6 spikes/s and 14 ± 0.5 spikes/s, respectively (Figure 6—figure supplement 1A). In D. suzukii, the corresponding responses were 1.0 ± 0.2 spikes/s and 0.0 ± 0 spikes/s. Moreover, since D. suzukii has two fewer S-a sensilla than melanogaster, the difference in total spike input is even greater: 78 spikes/s compared to 4 spikes/s (Figure 6B; note the scale in the left and right panels of Figure 6B are different; see also Figure 6—figure supplement 1C,D).

Interestingly, the response of D. biarmipes to overripe strawberry is intermediate. S-b sensilla do not respond in D. biarmipes (Figure 6A and Figure 6—figure supplement 1A); S-a show a response, but lower than that of D. melanogaster. The total spike input is 40 spikes/s (Figure 6B, right).

Based on the spike amplitudes, the responses of S sensilla to overripe strawberry appeared to represent the activity of the bitter-sensitive neuron in these sensilla. As a test of this notion, we measured the response of S sensilla to overripe strawberry in D. melanogaster mutant for Gr33a. We found that the response was eliminated or severely reduced, in each of three S sensilla tested: S5, which is an S-b sensillum, and S6 and S7, which are of the S-a class (Figure 6C,D). Response was reduced in each of two independently generated Gr33a alleles.

The L class of sensilla do not contain bitter-sensing neurons, and the responses we have measured represent response to sugars, salts, and other compounds. L sensilla gave a greater response to ripe strawberry in D. suzukii and D. biarmipes than in D. melanogaster (Figure 6—figure supplement 1A,B, p<0.05, one-way ANOVA followed by Tukey's multiple comparison test, n = 5, for both A and B). The I class of sensilla contain bitter-sensing neurons but we are unable to resolve their spikes from the spikes of neurons that respond to other compounds. I sensilla gave greater total input to ripe strawberry in D. suzukii than D. melanogaster as well (Figure 6—figure supplement 1B, p<0.05, one-way ANOVA followed by Tukey's multiple comparison test, n = 5, for both A and B).

Principal component analysis (PCA) showed that all three species are distinguishable based on their responses to extracts of ripe or overripe strawberry (Figure 6—figure supplement 2A,B, ANOSIM based on Bray-Curtis similarity; R = 0.88, p<0.0001 for ripe strawberry; R = 0.99, p<0.0001 for overripe strawberry).

Taken together, these results indicate that labellar taste response to extracts of ripe and overripe strawberry have changed in D. suzukii compared to the other species.

Shifts in tarsal coding of bitter tastants in D. suzukii

We analyzed coding of bitter tastants in the tarsal segments of the female forelegs, focusing on the same panel of 16 bitter tastants and 7 sensilla of the two most distal segments of all three species, that is, 336 tastant-sensillum combinations in all. As in the labellum, different sensilla responded to different subsets of tastants, and different tastants elicited responses from different subsets of sensilla (Figure 7A and Figure 7—source data 1). Some sensilla such as f5s responded to a number of tastants in all species, whereas others such as f5a and f4b responded to none in any species. f5v responded to several bitter compounds in D. biarmipes, but not in D. suzukii or D. melanogaster (Figure 7A,B).

Figure 7 with 1 supplement see all
Coding of bitter compounds in the female foreleg of Drosophila suzukii and related species.

(A) Heat map of electrophysiological responses to bitter compounds. n = 5–17. Responses to the diluent control, tricholine citrate (TCC), were subtracted. (B) Sample electrophysiological traces. Strychnine nitrate salt (STR) elicits little, if any, response from f5v in Drosophila melanogaster and D. suzukii but elicits a response from f5v in Drosophila biarmipes. (C) Coumarin (COU) elicits response from f4s in D. melanogaster and D. biarmipes but elicits little, if any, response from f4s in D. suzukii. (D) N,N-Diethyl-meta-toluamide (DEET) elicits a response from f5b in D. melanogaster and D. biarmipes but elicits little, if any, response from f5b in D. suzukii.

Figure 7—source data 1

Responses in spikes/s of tarsal sensilla of three species to bitter compounds.

Values represent the mean ± SEM responses of spikes/s. n = 5–17. Responses to the diluent control, tricholine citrate (TCC), were subtracted.

https://cdn.elifesciences.org/articles/64317/elife-64317-fig7-data1-v1.pdf

D. suzukii shows a striking loss of response to certain bitter compounds. Coumarin (COU) and DEET both elicit excitatory responses from f5b, f4s, and f4c in both D. melanogaster and D. biarmipes, but few, if any, excitatory responses (n > 0 spikes/s) from any sensilla in D. suzukii; interestingly, both tastants appear to inhibit f5s (Figure 7A,C,D).

A hierarchical cluster analysis based on the bitter responses elicited from these sensilla identified classes of bitter-sensing neurons and shows that they have been dynamic over evolutionary time. Specifically, the analysis identified three classes in D. suzukii and D. melanogaster; each class contains the same sensilla in these two species (Figure 7—figure supplement 1). The tarsal sensilla in D. biarmipes fall into five classes. In all three species, one class consists of sensilla that responded to none of the tested tastants. In D. melanogaster and D. suzukii, this class contains three sensilla, f5a, f5v, and f4b; in D. biarmipes, the class contains only two, f5a and f4b, as f5v has evolved a different profile and falls into a separate class. In all three species f5s is the sole member of a class. All three species have another class that includes f5b and f4s; in D. melanogaster and D. suzukii, this class includes f4c, but in D. biarmipes f4c has evolved a different response profile and is the unique member of another class.

D. suzukii oviposition is not deterred by bitter compounds

The oviposition preference shift observed in Gr33a mutants (Figure 2), the loss of bitter-sensing sensilla in D. suzukii (Figure 3), and the loss of response to certain bitter compounds in the D. suzukii labellum (Figures 4 and 5B–D) and tarsi (Figure 7) together suggested the hypothesis that bitter compounds could play a role in the oviposition differences between species. We wondered if there were any bitter compounds in ripe fruit that deterred oviposition in D. melanogaster but not in D. suzukii.

We assessed the egg laying behavior of D. suzukii, D. melanogaster, and D. biarmipes to the 16 bitter taste compounds using a two-choice oviposition assay (Figure 8A), initially at 0.5 mM concentrations. D. melanogaster avoided laying eggs on COU, lobeline hydrochloride (LOB), DEET, and denatonium benzoate (DEN), and D. biarmipes avoided COU, LOB, DEN, and sparteine sulfate salt (SPS). Remarkably, D. suzukii oviposition was not deterred by any of these bitter compounds (Figure 8B).

Drosophila suzukii oviposition is not deterred by bitter compounds that deter its close relatives.

(A) The two-choice oviposition assay. The oviposition preference is defined as: (number of eggs on sucrose substrate – number of eggs on sucrose+bitter substrate)/(total number of eggs on both substrates). (B) Oviposition preferences of Drosophila melanogaster, D. suzukii, and for individual bitter compounds. One-way ANOVA followed by Dunnett’s multiple comparison test; n = 15–21. Error bars are SEM. (C) Oviposition preferences for three different concentrations of N,N-Diethyl-meta-toluamide (DEET), sparteine sulfate salt (SPS), coumarin (COU), (-)-lobeline hydrochloride (LOB), and denatoniumbenzoate (DEN). Data for 0.5 mM concentrations were taken from panel B. n = 6–11. Error bars are SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

To confirm and extend our finding that D. suzukii lacks oviposition avoidance of the five bitter compounds that elicited responses from either of the other two species, we tested higher concentrations of all five compounds. D. suzukii again showed no deterrence at either of the higher concentrations of any tested compound (Figure 8C; one-way ANOVA followed by Dunnett's multiple comparison test, p>0.05).

Together these results demonstrate that D. suzukii has lost oviposition deterrence to at least some bitter compounds that deter its close relatives. This behavioral difference may represent an adaptation that facilitates the ability of D. suzukii to lay eggs on earlier ripening stages.

Reduced expression of bitter taste receptor genes in D. suzukii

We wondered if there were differences in gene expression between the taste systems of D. suzukii and its relatives, perhaps even differences in the expression of bitter receptors. Since the most striking anatomical and physiological differences we had found were in the labellum, we profiled the labellar transcriptomes of the three species. We carried out high-throughput sequencing of polyadenylated labellar RNA samples and obtained a total of 100–130 million paired-end reads from each species, deriving from a total of three biological replicates in each case.

As a test of the purity of our labellar RNA samples, we asked whether they contained transcripts from pharyngeal taste neurons, which are anatomically close to the labellar neurons (Figure 9—figure supplement 1A). Ionotropic receptor (IR) gene expression in the labellum and pharynx has been characterized in D. melanogaster previously (Chen and Dahanukar, 2017; Koh et al., 2014; Sánchez-Alcañiz et al., 2018). In the D. melanogaster samples, we detected the expression of most labellar IRs (Figure 9—figure supplement 1B,C, blue) but none of the pharyngeal-specific IRs (Figure 9—figure supplement 1B,C, red, Supplementary file 1). The same pharyngeal-specific IRs were also absent from the D. suzukii and D. biarmipes samples, suggesting that our labellar RNA samples contain little, if any, pharyngeal RNA (Supplementary file 2). Similarly, nearly all Grs and odorant binding proteins (Obps) previously detected in the labellum via GAL4 drivers or microarrays (Galindo and Smith, 2001; Jeong et al., 2013; Koganezawa and Shimada, 2002; Sánchez-Gracia et al., 2009; Weiss et al., 2011; Yasukawa et al., 2010) were also detected in our D. melanogaster transcriptome (Figure 9—figure supplement 2A,B, blue). These included 24 Grs found previously (Weiss et al., 2011) to be expressed in bitter-sensing neurons (Supplementary file 1). Grs whose expression was clearly detected in the labellum by RNAseq also included eight sugar-sensitive Grs – Gr5a, Gr61a, Gr64a, Gr64b, Gr64c, Gr64d, Gr64e, and Gr64f  consistent with several earlier studies of their expression (Dahanukar et al., 2001; Dahanukar et al., 2007; Jiao et al., 2007). We also identified labellar IRs, Grs, and Obps that had not previously been found to be expressed in the labellum (Figure 9—figure supplement 1C, gray and Figure 9—figure supplement 2A,B gray; Supplementary file 1).

To compare the transcriptomes, we considered those genes for which an ortholog was annotated in all three species. Among such genes, more than 4500 showed a discrepancy in the coding sequence length across the three species orthologs. We inspected the read coverage of nearly a quarter of these genes; most appeared to be misannotated or truncated in the D. suzukii genome (version 1.0). We manually fixed the annotation of the genes inspected (n ~ 1000) and excluded the other genes from the analysis (~3500). Additionally, we expanded the set of D. suzukii genes by annotating 86 chemosensory-related genes that had been missing or misannotated (<10% of all reannotated genes). Altogether we analyzed the labellar expression levels of more than 6000 genes. We detected transcripts from 4200 to 4500 genes in each species (≥10 Transcripts Per Million (TPM); Supplementary file 2).

The labellar transcription profile of D. suzukii is more closely related to that of D. biarmipes than that of D. melanogaster, as determined by a hierarchical cluster analysis (Figure 9A). This finding is consistent with the phylogenetic relationship among these species (Figure 1A). We analyzed the relationship among the transcriptomes by PCA, which confirmed that each species has a distinct transcriptome (Figure 9B). The first component separates all three species (Figure 9B). Intriguingly, the second component clearly separated D. suzukii from its relatives but showed unexpected similarity between D. melanogaster and D. biarmipes. Such separation is reminiscent of the difference between the ecological niche occupied by D. suzukii and those of other Drosophila species.

Figure 9 with 3 supplements see all
Distinct labellar transcriptomes across the Drosophila species.

(A) Hierarchical clustering of the Drosophila melanogaster, Drosophila suzukii, and Drosophila biarmipes labellar transcriptomes. (B) Principal component analysis of the D. melanogaster, D. suzukii, and D. biarmipes labellar transcriptomes. (C) Volcano plot highlighting differentially expressed chemosensory-related genes between D. suzukii and D. melanogaster (|log2FC| ≥ 2, q < 0.01). All differentially expressed gustatory receptors (Grs) (pink) and ionotropic receptors (IRs) (blue) are labeled; metabolic enzymes (green) and other chemosensory genes (purple) are labeled only if differentially expressed between D. suzukii and both of the other species. We note that the genes indicated here belong to families of genes associated with chemosensation, but not all individual members have been implicated in chemoreception. (D) Volcano plot highlighting differentially expressed chemosensory-related genes between D. suzukii and D. biarmipes (|log2FC| ≥ 2, q < 0.01). For convenience of illustration we have plotted the log2 Fold Change but we note that in some cases, such as Gr22f and IR40a expression in D. suzukii, the expression level is extremely low, so that the fold-change is not informative.

We next performed a pairwise comparison between D. suzukii and D. melanogaster and between D. suzukii and D. biarmipes. We found 162 genes differentially expressed between D. suzukii and both of the other two species, as determined by the following conservative statistical criteria: |log2 Fold Change| > 2, and adjusted p-value<0.01 across all of four different differential expression (DE) analysis pipelines (Supplementary file 3, Supplementary file 4; see Materials and methods). Of these 162 genes, 13% were associated with the GO term ‘sensory perception of chemical stimulus,’ a fivefold enrichment compared to the set of all genes expressed in the labellum of any species (adjusted p-value=2.99E-5). Altogether, the results suggest a molecular basis for the evolutionary shift between D. suzukii and its relatives.

Gr gene expression in the D. suzukii labellum showed a reduction compared to its D. melanogaster and D. biarmipes counterparts. Of 38 Grs whose expression was detected in this study, seven are expressed at levels fourfold lower or less in D. suzukii than in D. melanogaster (Figure 9C, log2FC<-2, adjusted p-value<0.01, Supplementary files 14). Interestingly, five of these, Gr8a, Gr22e, Gr22f, Gr32a, and Gr98d, have been found previously to be expressed in bitter-sensing neurons (Weiss et al., 2011). There were 10 Grs expressed at levels fourfold lower or less in D. suzukii than in D. biarmipes, including four Grs expressed in bitter-sensing neurons, Gr22f, Gr39b, Gr47a, and Gr59b (Figure 9D and Supplementary file 4). By contrast, no Grs were expressed at levels fourfold higher in D. suzukii than in either of the other species.

Gr22f is a particularly striking case. Its expression was detected in both D. melanogaster and D. biarmipes, but was undetectable in D. suzukii by RNAseq even with 50 million paired-reads for a sample. To confirm that Gr22f is virtually absent from the D. suzukii labellar transcriptome, we carried out RT-PCR experiments. Consistent with the RNAseq results, a Gr22f product was amplified by RT-PCR from D. melanogaster and D. biarmipes labellar RNA, but little, if any, product was observed from a D. suzukii preparation (Figure 9—figure supplement 3A). We confirmed the severely reduced levels of Gr22f expression in D. suzukii by performing RT-PCR with three additional Gr22f primer sets (Figure 9—figure supplement 3B). Interestingly, mutation of Gr22f in D. melanogaster reduces the response to DEN in the S-b sensilla (Sung et al., 2017). This phenotype is reminiscent of the reduced response to DEN in the S-b sensilla of D. suzukii, relative to D. melanogaster. Perhaps an evolutionary loss of Gr22f receptor expression accounts for this loss of DEN responses in D. suzukii. A detailed genetic analysis of Gr22f in taste and oviposition behaviors of D. melanogaster could be highly informative.

The IR co-receptor genes IR76b and IR25a were expressed at similar levels across the three species (Supplementary file 3, Supplementary file 4, that is, they did not meet the statistical criteria). We note that the comparable expression of these genes, which are broadly expressed in taste neurons (Sánchez-Alcañiz et al., 2018), as well as the comparable expression of the pan-neuronal genes elav and nsyb, argues against the possibility that the reduced expression of certain Grs in D. suzukii is a simple consequence of fewer neurons or more non-neuronal cells in the D. suzukii labellum.

By contrast, four IR genes, IR11a, IR40a, IR60a, and IR76a fell below the detection level in D. suzukii and D. biarmipes but were readily detected in the labellum of D. melanogaster. Curiously, in all three replicates of the D. suzukii labellar transcriptome, IR21a was expressed more abundantly than any other IR, including the co-receptor genes. IR21a was expressed ~85 times more abundantly in D. suzukii than in D. melanogaster. In D. biarmipes, IR21a was the second most abundant IR, after the co-receptor IR76b. IR21a has been implicated in cool sensing, raising interesting questions about the regulation and function of this receptor (Ni et al., 2016).

Members of other chemosensory-related gene families are also differentially expressed (Figure 9C,D). Unlike bitter receptor genes, however, the number of these other genes that are expressed at higher levels in D. suzukii is nearly identical to the number expressed at lower levels, when compared to either D. melanogaster or D. biarmipes. The differentially expressed genes include 73 members (out of 136 detected) of the Obp, chemosensory protein (Che), pickpocket (Ppk), cytochrome P450 enzyme (Cyp), and glutathione S transferase (Gst) families (Supplementary file 3, Supplementary file 4). Of these, 26 are differential expressed in D. suzukii compared to both its relatives. We speculate that some Cyps may contribute to the adaptation of D. suzukii by metabolizing toxic compounds in early ripening stages.

We note finally an observation that may have significance for pest control: Cyp6g1 and Cyp12d1-p are more abundant in D. suzukii than in D. melanogaster (100- and 25-fold, respectively) and D. biarmipes (5- and 20-fold, respectively). Overexpression of either gene in D. melanogaster increases resistance to insecticides, including Dichlorodiphenyltrichloroethane (DDT) (Daborn et al., 2007; Festucci-Buselli et al., 2005).

Discussion

Capitalizing on the wealth of knowledge about the taste system of D. melanogaster, we have found that the evolutionary transition of D. suzukii to oviposition on ripe fruits was paralleled with several gustatory innovations. We found anatomical, physiological, behavioral, and molecular differences between the taste systems of D. suzukii and D. melanogaster. Our results support a major role for gustation in the altered oviposition preferences of D. suzukii.

Evolution of bitter taste coding in D. suzukii

Early ripening stages of fruits differ in their physicochemical parameters from those of overripe stages (Ménager et al., 2004). We have focused on plant secondary metabolites that taste bitter to humans and that are aversive and toxic to many insects (Biere et al., 2004; Dagan-Wiener et al., 2017; Dweck and Carlson, 2020; Ibanez et al., 2012; Lee et al., 2010; Moon et al., 2009; Pontes et al., 2014; Poudel and Lee, 2016; Weiss et al., 2011; Whiteman and Pierce, 2008; Wiener et al., 2012). The profiles of these metabolites are dynamic, changing as the fruit develops (Cheng and Breen, 1991; Oikawa et al., 2015). For example, levels of flavonoids, many of which taste bitter to humans, decline as a function of developmental stage in strawberries (Cheng and Breen, 1991).

We have found six lines of evidence supporting a model in which a loss of bitter responses in D. suzukii has contributed to its novel oviposition preference:

  1. Gr33a mutations that reduce bitter responses of D. melanogaster shift its oviposition preference from overripe toward ripe strawberry purée, in alignment with the preference of D. suzukii.

  2. The number of sensilla that respond robustly to bitter compounds in the labellum has declined from 20 in D. melanogaster (11 I sensilla and 9 S sensilla) to 16 in D. suzukii, a 20% decline.

  3. The remaining labellar sensilla of D. suzukii have lost response to a variety of individual bitter compounds. For example, the S5 sensillum of D. suzukii has lost the response to SAP that is observed in D. biarmipes and D. melanogaster. Likewise, the tarsal sensilla f4s and f5b have lost the responses to COU and DEET that are observed in the other species.

  4. D. suzukii has reduced responses in both S-a and S-b sensilla to complex tastant mixtures, strawberry purées, which elicit responses from S sensilla of D. melanogaster.

  5. Although oviposition of D. melanogaster is deterred by a variety of bitter compounds, this deterrence has been lost in D. suzukii, across a range of concentrations.

  6. In D. suzukii, a variety of bitter Grs are expressed at reduced levels, and none are expressed at increased levels. Reduction in levels of a receptor could reflect its expression in fewer neurons, or at lower levels within neurons, either of which could reduce sensitivity.

Taken together these six lines of evidence support the notion that loss of bitter taste from D. suzukii contributes to its evolutionary shift in oviposition preference. We do not claim that the loss of bitter responses is the only gustatory change that facilitated the evolutionary transition of D. suzukii to oviposition on ripe fruit. Sugar responses, for example, may also have changed and may contribute to the transition, a possibility that deserves investigation. Nor is the gustatory system the only sensory system that has adapted in D. suzukii: the olfactory and mechanosensory systems have also adapted (Karageorgi et al., 2017). However, our results suggest a major role for bitter sensation in the shift of D. suzukii to a new niche.

It is striking that so much of the evolutionary plasticity we have found – anatomical, physiological, and molecular – is in the peripheral taste system, that is, in taste organs. A priori one might have imagined that taste organs could have retained their underlying molecular and cellular underpinnings, with the plasticity occurring exclusively in the central processing of taste input. In fact, a recent study found that evolution of Drosophila mating preferences emerged from evolution of a central circuit, with the peripheral detection mechanisms remaining conserved (Seeholzer et al., 2018). Although we have found extensive changes in the peripheral taste system, we suspect there may also be changes in central circuit mechanisms. For example, we note that D. suzukii has lost oviposition response to LOB, to which it has retained much of its physiological response, suggesting the possibility of changes in central circuitry. It seems likely that evolution has operated at a variety of levels in the shift of D. suzukii to its new niche.

D. biarmipes is much closer to D. suzukii phylogenetically than to D. melanogaster (Figure 1A). However, D. biarmipes did not show the oviposition preference for early ripening stages observed for D. suzukii (Figure 1C). Rather, D. biarmipes showed an intermediate phenotype, as it did in another study using different oviposition assays (Karageorgi et al., 2017). The D. biarmipes taste system also appears intermediate, in the sense that some phenotypes resemble those of D. suzukii and some those of D. melanogaster. D. biarmipes is like D. suzukii in that both have four fewer taste sensilla than D. melanogaster. D. biarmipes is like D. melanogaster in that both show oviposition avoidance to several bitter compounds that did not affect D. suzukii (Figure 8). The S-a sensilla of D. biarmipes are like those of D. melanogaster in that they retain a substantial response to overripe strawberry, but the S-b sensilla are like those of D. suzukii in that they have lost this response (Figure 6). One interpretation of all these results, taken together, is that evolutionary changes in a common ancestor of D. suzukii and D. biarmipes provided a foundation for further adaptations that allowed D. suzukii to occupy its current niche.

D. suzukii exemplifies a broad theme in drosophilid evolution: the successful adaptation of a variety of species to a variety of niches. While D. suzukii has adapted to occupy ripening stages not exploited by other drosophilids, other Drosophila species have adapted to particular host species. For example, Drosophila sechellia has specialized on the noni fruit (Morinda citrifolia), which is toxic to other species, and Drosophila erecta has specialized on screw pine fruit (Pandanus spp.) (Jones, 1998; Linz et al., 2013; Whiteman and Pierce, 2008).

Are the features of adaptation that we have observed in D. suzukii also found in these other species? D. suzukii differs from D. sechellia and D. erecta in that it has lost taste sensilla from the labellum; D. sechellia and D. erecta have retained the canonical numbers and map positions of taste sensilla defined originally in D. melanogaster (Dweck and Carlson, 2020). However, commonalities in adaptation mechanisms are also suggested by our results. First, analysis of the D. sechellia genome suggested that the rapid loss of 12 bitter Grs contributed to a loss of taste responses to bitter secondary metabolites of noni fruit (McBride, 2007; McBride et al., 2007). Our results in D. suzukii using RNAseq support this notion that loss of bitter Gr expression may contribute to a shift in evolutionary niche. Second, oviposition preference in D. sechellia was found to depend on two genes expressed in the legs, Obp57d (odorant binding protein) and Obp57e, leading to the suggestion that an evolutionary change in tarsal taste response contributed to its shift in oviposition preference (Matsuo et al., 2007). Our results now establish precedent via direct electrophysiological recording for such a change in tarsal response profiles. In fact, our results indicate how functional classes of taste neurons and their tuning breadths expanded or contracted during the evolution of the three species we examined. Plasticity was not restricted to a particular type of taste sensillum or taste organ.

Bitter taste and oviposition

We have found a shift from overripe toward ripe preference in D. melanogaster mutants whose bitter taste responses are reduced compared to wild type. We also found that D. suzukii has bitter taste responses that are reduced in many ways relative to D. melanogaster. What is the link between bitter taste and oviposition preference?

One simple model to explain our results is that bitter compounds in early ripening stages deter oviposition in D. melanogaster. Loss of bitter response in Gr33a mutants of D. melanogaster or in D. suzukii would reduce detection of these deterrent compounds, and may thereby contribute to a shift toward oviposition on ripe fruits. Thus the loss of bitter-sensing sensilla, bitter Grs, and physiological responses of the remaining sensilla would all represent adaptations that allow D. suzukii to occupy a niche whose bitter compounds deter competition from other Drosophila species. Direct evidence to support this model comes from electrophysiological recordings of S sensilla, the only class of sensilla in which activity can be confidently attributed to bitter-sensing neurons. In the case of both S-a and S-b sensilla, responses to ripe purée of strawberry are severely reduced in D. suzukii compared to D. melanogaster (Figure 6B).

However, although the loss of response in D. suzukii to bitter compounds in early ripening stages seems likely to contribute to the oviposition shift, further investigation will be required to fully understand the role of bitter taste in the shift. One might have expected an increased response of D. suzukii to overripe fruit. However, the response of S-a and S-b sensilla to overripe purées is also reduced in D. suzukii. This reduced response to overripe strawberry might by itself, according to the simplest model, be expected to favor a countervailing preference for overripe fruit. This finding illustrates that a full appreciation of the role of bitter taste in the evolutionary shift will require a better understanding of the role of bitter neurons in driving oviposition behaviors, in two respects.

First, previous work has shown that the influence of tastants on oviposition decisions is complex (Joseph et al., 2009; Joseph and Heberlein, 2012; Schwartz et al., 2012; Yang et al., 2008). Bitter-sensing neurons are diverse in their specificities (Delventhal and Carlson, 2016; Dweck and Carlson, 2020; Weiss et al., 2011), and the activation of different bitter neurons may have distinct effects, or even opposing effects, on behavioral circuits at certain concentrations or in certain contexts (Joseph et al., 2009; Joseph and Heberlein, 2012; Schwartz et al., 2012; Yang et al., 2008). Bitter neurons of D. melanogaster and D. suzukii are tuned differently and may be sensitive to different natural cues; D. suzukii could conceivably have acquired a new response to a bitter compound in ripe strawberry, perhaps in an I sensillum, that favors a shift toward ripe fruits. Clearly, further work will be required to understand which of the evolutionary changes in bitter coding we have observed affect oviposition choices and the mechanisms by which they affect them.

Second, we emphasize that bitter neurons operate in a larger context; their activities contribute to, but do not alone dictate, oviposition responses. As an illustration, S sensilla in D. melanogaster gave a greater response to overripe than ripe purée. If bitter-sensing neurons of D. melanogaster detect deterrent cues in an overripe fruit, why do these flies lay eggs on it? Oviposition decisions are likely made based on an evaluation of many cues, both negative and positive, and it seems likely that positive cues detected by other neurons of D. melanogaster – for example, by sugar neurons of the taste system or by neurons of other sensory modalities – predominate in the overripe fruit we have tested. By contrast, in a natural environment in which overripe fruits become increasingly covered with diverse populations of microbes, bitter neurons may provide a warning system that detects toxins, responds strongly, and inhibits oviposition.

Our results lay a foundation for a wide variety of avenues for future investigation. What specific bitter compounds in ripe or overripe strawberries influence oviposition decisions of each species in a natural context? Are the most influential compounds present in other fruits? We have tested individual compounds and purees, but we do not know the identities or quantities of the compounds that a fly encounters while exploring a fruit in nature. Which bitter receptors respond to these compounds, and is their expression reduced in D. suzukii? Might the receptors that respond to these compounds have undergone evolutionary changes in their functional characteristics? Finally, how is information about bitter compounds integrated with information about sugars, other tastants, and other cues to guide oviposition, and have there been evolutionary adaptations in the taste circuitry of D. suzukii?

Conclusion

In summary, we have identified gustatory innovations – anatomical, physiological, behavioral, and molecular – in D. suzukii. Our results support a major role for gustation in the altered oviposition preferences of D. suzukii. Taken together our study provides, for the first time to our knowledge, new understanding of how the gustatory system of an invasive pest species has adapted in its evolutionary adaptation to a new niche.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Strain (Drosophila melanogaster)Canton-SKoh et al., 2014NADOI:10.1016/j.neuron. 2014.07.012
Strain (Drosophila melanogaster)Canton-S w1118Koh et al., 2014NADOI:10.1016/j.neuron. 2014.07.012
Strain (Drosophila melanogaster)Gr33a2Dweck and Carlson, 2020NADOI:10.1016/j.cub.2019.11.005
Strain (Drosophila melanogaster)Gr33a3Dweck and Carlson, 2020NADOI:10.1016/j.cub.2019.11.005
Strain (Drosophila biarmipes)DbiaDrosophila species stock center14023–0361.04Drosophila species stock center
Strain (Drosophila suzukii)DsuzThis paperNAConnecticut
Chemical compoundAristolochic acid (ARI)MilliporeSigmaCat # A5512CAS # 313-67-7
Chemical compoundAzadirachtin (AZA)MilliporeSigmaCat # A7430CAS # 11141-17-6
Chemical compoundBerberine chloride (BER)MilliporeSigmaCat # Y0001149CAS # Y0001149
Chemical compoundCaffeine (CAF)MilliporeSigmaCat # C1778CAS # 58-08-2
Chemical compoundCoumarin (COU)MilliporeSigmaCat # C4261CAS # 91-64-5
Chemical compoundN,N-Diethyl-meta- toluamide (DEET)MilliporeSigmaCat # 36542CAS # 134-62-3
Chemical compoundDenatonium benzoate (DEN)MilliporeSigmaCat # D5765CAS # 3734-33-6
Chemical compoundEscin (ESC)MilliporeSigmaCat # E1378CAS # 6805-41-0
Chemical compound(±)-Gossypol from cotton seeds (GOS)MilliporeSigmaCat # G8761CAS # 303-45-7
Chemical compound(-)-Lobeline hydrochloride (LOB)MilliporeSigmaCat # 141879CAS # 134-63-4
Chemical compoundSaponin (SAP)MilliporeSigmaCat # 47036CAS # 8047-15-2
Chemical compoundD-(+)-sucrose octaacetate (SOA)MilliporeSigmaCat # W303801CAS # 126-14-7
Chemical compoundSparteine sulfate salt (SPS)MilliporeSigmaCat# 234664CAS # 6160-12-9
Chemical compoundStrychnine nitrate salt (STR)MilliporeSigmaCat # S2880CAS # 66-32-0
Chemical compoundTheophylline (TPH)MilliporeSigmaCat # T1633CAS # 58-55-9
Chemical compoundTricholine citrate (TCC)MilliporeSigmaCat # T0252CAS # 546-63-4
Chemical compoundUmbelliferone (UMB)MilliporeSigmaCat # H24003CAS # 93-35-6

Drosophila stocks

Request a detailed protocol

D. melanogaster Canton-S, D. suzukii, and D. biarmipes were reared on corn syrup and soy flour culture medium (Archon Scientific) at 25 °C and 60% relative humidity in a 12:12 hr light-dark cycle. D. suzukii stock was collected in Connecticut. D. biarmipes stock (14023–0361.04) was obtained from the Drosophila Species Stock Center. Gr33a2 is described in Dweck and Carlson, 2020; Gr33a3 is an independent allele generated by the same means in the same study.

Strawberries

Request a detailed protocol

Ripening stages of strawberries were collected from Lockwood Farm, Connecticut Agricultural Experiment Station, Hamden, CT. Strawberries used in the single experiment shown in Figure 2D were from Elm City Market, New Haven, CT; in this case overripe strawberries were obtained by leaving ripe strawberries at room temperature for 3 days.

Bitter tastants

Request a detailed protocol

Bitter tastants were obtained at the highest available purity from Sigma-Aldrich. All tastants were dissolved in 30 mM tricholine citrate (TCC), an electrolyte that inhibits the water neuron. All tastants were prepared fresh and used for no more than 1 day. For electrophysiological recordings, tastants were tested at the following concentrations unless otherwise indicated: ARI, 1 mM; azadirachtin (AZA), 1 mM; berberine chloride (BER), 1 mM; CAF, 10 mM; coumarin (COU), 10 mM; DEET, 10 mM; DEN, 10 mM; ESC, 10 mM; gossypol from cotton seeds (GOS), 1 mM; (-)-LOB, 1 mM; saponin from quillaja bark (SAP), 1%; D-(+)-sucrose octaacetate (SOA), 1 mM; SPS, 10 mM; strychnine nitrate salt (STR), 10 mM; TPH, 10 mM; UMB, 10 mM. All compounds were stirred for 24 hr. THE and UMB were additionally heated to increase their solubility, then cooled and tested while in solution.

Multiple-choice oviposition assay

Request a detailed protocol

These experiments were carried out in a cage (24.5 cm x 24.5 cm x 24.5 cm) that was equipped with seven Petri dishes (60 mm × 15 mm, Falcon). Each Petri dish was filled with 1% agar containing 10% w/v purée of one of the ripening stages. One hundred 5- to 7-day-old flies (80 females and 20 males) were placed in each cage. Experiments were carried out in a climate chamber (22°C, 60% humidity, in the dark). The number of eggs was counted after 24 hr. The positioning of the oviposition plates was randomized in each replicate.

Two-choice oviposition assay

Request a detailed protocol

The two-choice oviposition assay was modified from Joseph et al., 2009, except that corn meal food was replaced with 1% agar containing 100 mM sucrose. Oviposition plates consisted of plastic Petri dishes (60 mm × 15 mm, Falcon), which were divided into two halves; each half contained either sucrose or sucrose mixed with a bitter compound. Fifty flies (40 females and 10 males), when 5- to 7-day-old, were placed into an oviposition cage (Genesee Scientific) without anesthesia through a small funnel that fits in the lid of the cage, and left for 24 hr in the dark. Experiments were carried out in a climate chamber (22°C, 60% humidity). Eggs on each substrate were counted. An oviposition preference index was calculated as follows: (number of eggs on sucrose substrate – number of eggs on sucrose+bitter substrate)/(total number of eggs on both substrates).

Scanning electron microscopy

Request a detailed protocol

Flies were fixed in a solution of 0.1 M sodium cacodylate, 2% paraformaldehyde, and 2.5% glutaraldehyde for 2 hr in microporous specimen capsules (Electron Microscopy Sciences). Flies were then dehydrated in a graded series of ethanol washes until they were incubated overnight in 100% ethanol. Ethanol-dehydrated flies were dried in a Leica CPD300 critical point dryer. Flies were then glued to metallic pegs with graphite conductive adhesive (Electron Microscopy Sciences). Samples were then coated in 2 nm of iridium with a Cressington Sputter Coater and imaged in a Hitachi SU-70 SEM.

Electrophysiology

Request a detailed protocol

Electrophysiological recordings were performed with the tip-recording method (Hodgson et al., 1955), with some modifications; 5- to 7-day-old mated female flies were used. Flies were immobilized in pipette tips, and the labellum or the female foreleg was placed in a stable position on a glass coverslip. A reference tungsten electrode was inserted into the eye of the fly. The recording electrode consisted of a fine glass pipette (10–15 µm tip diameter) and connected to an amplifier with a silver wire. This pipette performed the dual function of recording electrode and container for the stimulus. Recording started the moment the glass capillary electrode was brought into contact with the tip of the sensillum. Signals were amplified (10x; Syntech Universal AC/DC Probe; http://www.syntech.nl), sampled (10,667 samples/s), and filtered (100–3000 Hz with 50/60 Hz suppression) via a USB-IDAC connection to a computer (Syntech). Action potentials were extracted using Syntech Auto Spike 32 software. Responses were quantified by counting the number of spikes generated over a 500 ms period after contact. Different spike amplitudes were sorted; we did not convolve all neurons into a single value. However, in nearly all recordings in this study the great majority of the spikes were of uniform amplitude (e.g., Figures 5 and 7B–D), and those were the spikes whose frequencies we report. Responses to the TCC diluent alone were subtracted.

RNA purification, library preparation, and sequencing

Request a detailed protocol

Labella were meticulously hand-dissected from approximately one-hundred 5-day-old D. melanogaster, D. suzukii, and D. biarmipes females. The tissues were collected and mechanically disrupted in lysis buffer (‘RTL lysis buffer’ from Qiagen). Labellar RNA was extracted using the hot acid phenol procedure. Three biological replicates were produced for each species. Libraries were prepared using KAPA mRNA HyperPrep Kit (Kapa Biosystems) and sequenced on an Illumina HiSeq 2500 sequencer by the Yale Center for Genome Analysis. Thirty to fifty million 75 bp paired-end reads were obtains per sample. Raw reads are accessible at the Genbank SRA database (BioProject accession number PRJNA670502).

RNA sequencing analysis

Request a detailed protocol

Reads were aligned to the D. melanogaster genome (BDGP6), D. suzukii genome (version 1.0), or the D. biarmipes genome (version 2.0) using TopHat (version 2.1.1). Cufflinks (version 2.2.1) was used to generate de novo GTF files for each species and quantify D. melanogaster labellar transcripts (Ensemble annotation version 100) (Figure 9—figure supplement 1 and 2). IGV, Integrative genomics viewer (version 2.5.3), was used to inspect the read coverage of genes of interest.

For quantification, only the coding sequence (CDS) of genes was considered and CDS with length differences across species larger than the read length were discarded. Reads were remapped to the curated CDS transcriptomes and counted using HTseq (version 0.6.1). Read 1 and read 2 were analyzed separately. Differential expression (DE) analysis was carried between D. suzukii and D. melanogaster and between D. suzukii and D. biarmipes using four different pipelines: (i) DESeq2 (version 1.26.0) using ashr for Log Fold Change (LFC) shrinkage (Stephens, 2017); (ii) edgeR (version 3.28.1); (iii) NOIseq (version 2.31.0) with counts normalized by length and read depth (TPM); (iv) NOIseq with counts normalized with SCBN (scale-based normalization, version 1.4.0), a recent method optimized for cross species DE analysis (Zhou et al., 2019). The two latter approaches were used to estimate the number of false positive candidates related to minor differences in transcript length. In the case of duplicated genes, the closest ortholog was kept. If this could not be determined, the most abundant was used. Only significant hits (|Log2FC| ≥ 2, adjusted p-value≤0.01) common to all DE analysis methods were considered.

The hierarchical clustering of DESeq2 and edgeR result matrices was performed using default settings of the pvclust package in R with default settings. By default, reliability of the branching was assessed by generating 1000 bootstrap samples by random sampling. PCA plot was generated using the prcomp and ggbiplot packages in R with DESeq2 and edgeR results and default settings. The gene ontology (GO) analysis was performed using GOrilla.

RT-qPCR cDNA was made from 300 ng of labellar RNA as template from using EpiScript (Lucigen). Two biological replicates were prepared per species. PCR was carried out with Apex master mix (Genesee Science) using 15 ng of cDNA. Primers used in Figure 9—figure supplement 3A were the following:

  • elav-fwd: GAGATTGAGTCGGTGAAGCT

  • elav-rev: CCAGTTCCTGCTGGGTCATC

  • Dmel-Gr22f-fwd: ATGGCTTCTCCTCTACGGTTTC

  • Dmel-Gr22f-rev: CCCTCAAGGGTGAGTAGTTCATT

  • Dbia-Gr22f-fwd: TCACACAAGCCAATCCCAGTAAA

  • Dbia-Gr22f-rev: CTAAGTGCGGAGAAGCCACAA

  • Dsuz-Gr22f-fwd: CGCGATCGTTACACACTTAAGGA

  • Dsuz-Gr22f-rev:CACTAATGGTAGGATGCCAAGGAG

Primers used in Figure 9—figure supplement 3B:

  • Dsuz-Gr22f-fwd(2): ACGTGTGCGATATCACCGAAA

  • Dsuz-Gr22f-rev(2):GACTGCAGAGCCATGCAAATTC

  • Dsuz-Gr22f-fwd(3): GGGAAGCATCAAAGTTCAGGAGA

  • Dsuz-Gr22f-rev(3):ATGCCAAGGAGCGCGAATAA

  • Dsuz-Gr22f-fwd(4): CCTGGCTACTTGGGCTGTTT

  • Dsuz-Gr22f-rev(4):AGACTCCGGATTTCTCTTCTCCT

Statistical analyses

Request a detailed protocol

Hierarchical cluster analyses were performed using Ward’s method with PAST (Paleontological Statistics Software Package for Education and Data Analysis; Hammer et al., 2001). This technique organizes the data into clusters based on the response profiles of each sensillum to the panel of tastants. Euclidean distances were calculated according to Ward’s classification method for the hierarchical cluster analysis. Other statistical tests were performed in GraphPad Prism (version 6.01). All error bars are SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Data availability

We provided all the datasets associated with this manuscript in source data files.

References

    1. Cini A
    2. Ioriatti C
    3. Anfora G
    (2012)
    A review of the invasion of Drosophila suzukii in Europe and a draft research agenda for integrated pest management
    Bulletin of Insectology 65:149–160.
    1. Galindo K
    2. Smith DP
    (2001)
    A large family of divergent Drosophila odorant-binding proteins expressed in gustatory and olfactory sensilla
    Genetics 159:1059–1072.
    1. Hammer ø
    2. Harper DAT
    3. Ryan PD
    (2001)
    PAST: paleontological statistics software package for education and data analysis
    Palaeontologia Electronica 4:1–9.
  1. Book
    1. Hodgkin NM
    2. Bryant PJ
    (1978)
    Scanning electron microscopy of the adult of Drosophila melanogaster
    In: Ashburner M, Wright T. R. F, editors. The Genetics and Biology of Drosophila. London New York San Francisco: Academic Press. pp. 337–358.
    1. Jones CD
    (1998)
    The genetic basis of Drosophila sechellia's resistance to a host plant toxin
    Genetics 149:1899–1908.
  2. Book
    1. Lauge G
    (1982)
    Development of the genitalia and analia
    In: Ransom R, editors. A Handbook of Drosophila Development. Elsevier. pp. 237–263.
    1. Walsh D
    2. Bolda M
    3. Goodhue R
    4. Dreves A
    5. Lee J
    6. Bruck D
    7. Walton V
    8. O'Neal SD
    9. Frank GZ
    (2011)
    Drosophila suzukii (Diptera: Drosophilidae): Invasive pest of ripening soft fruit expanding its geographic range and damage potential
    Journal of Integrated Pest Management 106:289–295.

Decision letter

  1. Stephen Liberles
    Reviewing Editor; Harvard Medical School, United States
  2. K VijayRaghavan
    Senior Editor; National Centre for Biological Sciences, Tata Institute of Fundamental Research, India
  3. Craig Montell
    Reviewer; University of California, Santa Barbara, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

While many Drosophila species, including D. melanogaster, lay eggs on overripe/fermented fruit, the crop pest D. suzukii has undergone a remarkable evolutionary change in preferring to lay eggs on ripe or underripe fruit. The authors find that bitter chemicals deter egg laying in D. melanogaster but not D. suzukii, and they undertake a comparative physiology of the taste systems between D. suzukii and D. melanogaster- from anatomical descriptions of taste structures, changes in receptor expression, and changes in bitter receptor responses.

Decision letter after peer review:

Thank you for submitting your article "Evolutionary shifts in taste coding in the fruit pest Drosophila suzukii" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by K VijayRaghavan as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Craig Montell (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

We would like to draw your attention to changes in our policy on revisions we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

While many Drosophila species, including D. melanogaster, lay eggs on overripe/fermented fruit, D. suzukii has undergone a remarkable evolutionary change in preferring to lay eggs on ripe or underripe fruit. The authors use a compelling behavioral assay to demonstrate the shift in ripeness preference, and also to show that bitter chemicals deter egg laying in two Drosophila species but not in D. suzukii. Moreover, mutation of the bitter receptor Gr33a partially reverses overripe preference behavior in D. melanogaster, consistent with a role for bitter taste. Then, the manuscript undertakes a comparative physiology of the taste systems between D. suzukii and D. melanogaster- from anatomical descriptions of taste structures, changes in receptor expression, and changes in bitter receptor responses.

Summary:

As you will see below, the reviewers were generally enthusiastic about the paper. The reviewers suggested several additional experiments that would improve the paper- these should be taken as suggestions rather than requirements. In the absence of additional data, the manuscript should be revised to temper conclusions related to comments below. The key issues discussed were (1) that it remains unclear which of the comparative changes observed in D. suzukii actually accounts for the evolutionary shift in oviposition preference, and (2) that Figure 6 data counters an interpretation of the role of evolutionary changes in bitter taste and clarification is needed.

The full reviews are provided below. Additional experiments are not required, but are suggested to improve the paper if feasible. Otherwise, the authors can temper conclusions accordingly.

Reviewer #1:

This is a really fascinating study that investigates gustatory adaptations in the Drosophila crop pest, D. suzukii. While many Drosophila species, including D. melanogaster, lay eggs on overripe/fermented fruit, D. suzukii has undergone a remarkable evolutionary change in preferring to lay eggs on ripe or underripe fruit. The authors use a compelling behavioral assay to demonstrate the shift in ripeness preference, and also to show that bitter chemicals deter egg laying in two Drosophila species but not in D. suzukii. Moreover, mutation of the bitter receptor Gr33a partially reverses overripe preference behavior in D. melanogaster, consistent with a role for bitter taste. Then, the manuscript undertakes a comparative physiology of the taste systems between D. suzukii and D. melanogaster- from anatomical descriptions of taste structures, changes in receptor expression, and changes in bitter receptor responses. There is a lot to like in this very interesting paper.

What remains unclear is which of the comparative changes observed in D. suzukii actually accounts for the evolutionary shift in oviposition preference. Possibilities include changes in receptor expression, receptor recognition properties, signaling pathways, downstream neural circuits, and/or coarse taste morphology. Furthermore, changes in bitter taste signaling in the periphery is likely only part of the story. The authors do appropriately acknowledge some of these outstanding questions in the last paragraph.

1) Loss of bitter responses appear insufficient to explain the beautiful behavioral results in Figure 1C vs. D. If loss of deterrents were the only factor at play, D. suzukii would presumably not prefer extracts 1 and 5, but instead display equal oviposition across all fractions. Why might D. suzukii show enhanced attraction to extract 1? On a related note, extract 7 presumably has increased sugar concentrations- why doesn't this contribute to the behavior too? Are sugar responses intact in D. suzuki? How do sweet receptor knockouts perform in the behavioral assay?

2) The different neuronal responses to strawberry extracts reported in Figure 6A are a bit difficult to reconcile. The responses in S sensilla to overripe fruit are stronger than ripe fruit- if these are due to bitter reception alone (as suggested by Gr33a knockouts), then first, there are stronger bitter responses to overripe than ripe fruit in S sensilla of D. melanogaster, and second loss of such responses would presumably enhance attraction to overripe rather than ripe in D. suzukii, the opposite of what is seen. Perhaps sweet responses are also lost? Even more complicated scenarios are also possible such as gain in D. suzukii of a new bitter response for overripe (such as through altered receptor recognition properties) or even gain of attraction for an underripe fruit component (odor or taste).

3) Some bitter chemicals were not effective oviposition deterrents in D. suzukii, yet electrophysiological responses persisted. At face value, this would seem to suggest that the relevant evolutionary adaptations occurred centrally rather than peripherally. The authors should discuss this further.

4) I recognize that identifying ethologically relevant bitter chemical/receptor pairs is challenging. As is, it is unclear whether changes in receptor expression and electrophysiological responses are relevant to the behavior. Some evolutionary changes seem subtle rather than all-or-nothing (20% reduction in sensilla or partial reduction in taste responses). Possible alterations in receptor recognition properties are not explored and should be discussed. Other interesting experiments to consider here or for future studies: 1) an empty neuron experiment to look for taste receptors that detect strawberry purees, 2) testing a Gr22f mutant, if available, in the strawberry puree preference assay, and 3) since it is unclear how general one ligand-receptor pair may be, testing other fruit purees in addition to strawberry to see if the bitter metabolite is a common deterrent present in many fruits.

Reviewer #2:Drosophila suzukii is an agricultural pest that lays eggs on ripe fruit and therefore destroys crops. This is distinct from Drosophila melanogaster that lays eggs in fermenting fruit. In this work, the authors provide strong evidence supporting the model that distinctions in bitter taste between D. suzukii and D. melanogaster could account for their behavioral differences. The authors findings are very interesting and the work is a tour-de-force.The authors developed an oviposition assay using purees of strawberries at different stages of ripeness. The results confirmed the preferences of D. suzukii for ripe and early ripening stages, and D. melanogaster on fermented fruit. Interestingly, D. melanogaster mutants missing a broadly required bitter receptor, Gr33a, shifted their oviposition preference so that they behaved more like D. suzukii.

The authors then carefully compared the number, distribution and morphology of the taste sensilla on the labellum, legs and ovipositor. On the labellum they found that the sensilla are fewer in number and linger in D. suzukii. The sensilla on the female forelegs were similar in both species. However, the morphology of the sensilla on the ovipositor suggests that they do not function in taste. The authors performed an extensive set of tip recordings and identified the response profiles of different sensilla to a variety of tastants. They found that the sensilla could be grouped into four classes. Another interesting observation is that both classes of S-type sensilla in D. suzukii were nearly unresponsive to overripe strawberries, which differed from the higher responses of D. melanogaster. The D. biarmipes responses were intermediate. In response to ripe strawberries the L-type sensilla from D. suzukii were more responsive than D. melanogaster. The authors also examined the coding of tarsal sensilla to bitter tastants. D. suzukii. Next, the authors identified bitter chemicals that deter egg laying by D. melanogaster but not by D. suzukii.

Finally, the authors conducted transcriptome analyses comparing RNA expression in labella from D. melanogaster, D. suzukii and D. biarmipes. Among their findings was the observation that multiple Grs were expressed at lower levels in D. suzukii than one or both of the other two species. They also analyzed differences in the IRs and other families of genes.

In summary, this an extraordinarily extensive and fascinating study. This paper is highly appropriate for eLife in its current form. I have one experimental suggestion, which is completely optional.

Optional experiment

1) Is there a fitness effect resulting from Gr33a mutants eating ripe fruit. In particular Is the fecundity of the Gr33a mutant flies that consume ripe fruit reduced?

Reviewer #3:

Host shifts and food specialization are important drivers of ecological diversity. How host preference behaviors diverge and what sensory adaptations underlie their evolution remains largely unknown. In this manuscript, Dweck et al. investigate the peripheral gustatory system of Drosophila suzukii, a specialist that oviposits exclusively on ripe fruits, and compare it to two drosophilids that prefer to oviposit on overripe fermenting fruits, the ancestral behavior in this group. Using puréed strawberries as an oviposition substrate, the authors first confirm previous work showing that D. suzukii (Karageorgi, 2017) prefers earlier maturation stages than D. melanogaster, while D. biarmipes displays no preference. Previous work proposed that gustatory preferences are likely critical in mediating the ecological shift in oviposition preferences. Indeed, Dweck et al. find that D. melanogaster mutant for Gr33a, a gustatory receptor associated with responses to bitter tastants, shift their preference towards earlier ripening stages. Based on this observation Dweck et al. then perform a thorough description of sensory responses of two major taste organs, the labellum and the foreleg, in response to a panel of 16 bitter ligands. The sensilla of both appendages map to different broadly conserved clusters based on their response profiles, with two of them, “S-a” and “S-b”, broadly tuned towards bitter tastants. Interestingly, in D. suzukii the S-a and S-b clusters display attenuated responses to ripe and overripe strawberry purée, leading the authors to propose that D. suzukii has a higher threshold for detecting bitter compounds, which in turn could explain the observed differences in oviposition preference. Using an array of behavioral oviposition assays they show that while other species avoid laying eggs on substrates enriched with bitter tastants, D. suzukii is generally indifferent to their presence. Finally, Dweck et al. use RNA-Seq experiment to show that several Grs, including one that has been linked to bitter detection in D. melanogaster, are expressed at lower levels in the labellum of D. suzukii in comparison to D. melanogaster and D. biarmipes. Based on these findings, the authors suggest that a shift in bitter taste reception in D. suzukii is involved in the shift towards ripe fruit from overripe fruit.

Overall, this is a well-written manuscript employing a variety of well-executed experimental approaches to study bitter taste perception in an important agricultural pest and how it compares to other related species. The datasets (neurophysiological recordings, electron microscopy, RNA-Seq) will prove valuable in furthering our understanding of D. suzukii ecology and have potential importance in developing possible applications for pest management. That said, the main conclusion that divergence in peripheral bitter taste reception is involved in the host shift in D. suzukii is not fully supported by the data. Below I outline where I think the data and analyses fall short of the claims being made and offer suggestions about how the manuscript might be improved to get there.

My primary concern relates to the missing link between the behavioral observations and the neurophysiological and expression data.

1) The authors use strawberries as an oviposition substrate, but do not provide an analysis of bitter compounds present in the different maturation stages. What are the bitter compounds on the ripe strawberry that deter melanogaster and biarmipes but not D. suzukii? The missing data prevents the interpretation of the neurophysiological data: It is unclear if any of the 16 bitter tastants tested are of ecological relevance with respect to strawberries or other potential hosts (several such as DEET and denatonium benzoate for example are human-made synthetic compounds). For the same reason the observed indifference of D. suzukii towards these compounds in the oviposition assay (Figure 8), although impressive and suggestive, cannot be linked to the behavioral observations in the more natural context.

In order to make this link, a chemical characterization of the strawberry purees from different maturation stages is required, as well as an expansion of the tastant panel to ecologically relevant bitter tastants that occur in ripe but not overripe strawberries or differ in concentration.

2) The authors found that two clusters of labellar sensilla “S-a” and “S-b” are broadly responsive to bitter tastants (Figure 4). They also show that both of these clusters elicit higher spiking rates towards overripe than ripe strawberries across all species (Figure 6). These results are contradictory to the main hypothesis that D. suzukii's behavioral shift from preferring overripe to ripe fruit as an oviposition substrate reflects species-specific differences in the threshold for bitter perception. According to the author's model, I would expect S-a and S-b sensilla to have a higher response to ripe strawberries in melanogaster and biarmipes but not in D. suzukii. This is not the case in S-a and S-b. Cluster I also elicits higher responses towards overripe strawberries in all three species. It is important that the authors address these contradictions between their model and these functional results.

3) Another missing link is that of gustatory receptors to bitter tastants and behavior. The authors use previously made Gr33a knockout lines in D. melanogaster and show that a loss of function at that locus leads to a shift from overripe to ripe strawberries as preferred oviposition substrate. While the behavior of Gr33a mutant melanogaster is more D. suzukii-like, this result unfortunately does not really help in tying together the different experimental avenues undertaken in D. suzukii. While it does show that the loss of bitter reception can lead to a host shift in melanogaster, it is not a convincing analogy to D. suzukii, since 1) taste sensilla of D. suzukii are responsive to bitter tastants (Figures 4 – 7) and 2) Gr33a is not on the list of genes with decreased expression in D. suzukii compared to the other species (Figure 9).

A promising target to test the role of receptor expression differences in oviposition preference behavior seems to be Gr22f. The authors show that it is essentially missing from the D. suzukiilabellar transcriptome, which could suggest that loss of Gr22f expression is an important step in the evolution of oviposition behaviors. I suggest testing this by creating null mutants in D. melanogaster. It might also be informative to define the tuning of Gr22f copies in D. melanogaster and D. suzukii, to test whether it responds to strawberry bitter compounds in either species.

Beyond my concerns about the interpretation of the experiments and datasets in relation to the main hypothesis, I also have some questions about experimental design and the presentation or interpretation of some of the data.

Figure 1: How are maturation stages defined in strawberries? Is there an industry standard? It is currently unclear how the many maturation stages can be identified and whether these are of ecological relevance.

Figure 2: The oviposition index in "Control" females in 2C and 2D is quite different from the wild types in 2B. Could it be that the w- background interferes with oviposition behavior? What are the numbers of eggs laid in the different conditions and across genotypes? It would be good to exclude that there is an effect of genetic background on egg production and egg laying.

Figures 4, 5 and 7: Gustatory sensilla are innervated by multiple neurons. How were spikes counted? Did the authors separate different spike amplitudes? Convolving all neurons of a sensillum into a single value might complicate linking receptors to GSN responses in the future.

Figure 6B: As pointed out above, S-a and S-b sensilla seem to respond more strongly to ripe than overripe strawberry. To allow for this comparison by the reader, please also include a comparison between ripe vs. overripe for S-a and S-b within each species.

Figure 6C and D: Why is the response to overripe strawberry tested? In light of the hypothesis and oviposition behavior in D. suzukii it would be more informative to test the ripe maturation stage instead.

Figure 9: While the differential expression data and the discussion indicate that Grs are expressed at lower levels in D. suzukii in comparison to the other species, this should be statistically tested. Do the observed patterns differ from a differential expression pattern expected by chance? Potential reasons for the observation of lower levels of expression for Grs should be taken into account. Does D. suzukii have less GSNs than the other species? Does D. suzukii have more cells of other tissues than the other two that would lead to a relative reduction of reads derived from GSNs in the transcriptome?

It is hard to extract important information on how groups of genes differ in their expression between the three species from the volcano-plots provided. I suggest making a heatmap of all 9 biological replicates and indicate important genes/gene families therein. This would help identify genes differentially expressed in D. suzukii compared to the other two.

https://doi.org/10.7554/eLife.64317.sa1

Author response

Reviewer #1:

[…] What remains unclear is which of the comparative changes observed in D. suzukii actually accounts for the evolutionary shift in oviposition preference. Possibilities include changes in receptor expression, receptor recognition properties, signaling pathways, downstream neural circuits, and/or coarse taste morphology. Furthermore, changes in bitter taste signaling in the periphery is likely only part of the story. The authors do appropriately acknowledge some of these outstanding questions in the last paragraph.

The revised manuscript now contains an enhanced discussion of this issue, as detailed below, and explicitly acknowledges that "Clearly, further work will be required to understand which of the evolutionary changes in bitter coding we have observed affect oviposition choices and the mechanisms by which they affect them." We agree with the reviewer that changes in bitter taste signaling in the periphery are likely only part of the story and have added to the discussion of this point (see below).

1) Loss of bitter responses appear insufficient to explain the beautiful behavioral results in Figure 1C vs. D. If loss of deterrents were the only factor at play, D. suzukii would presumably not prefer extracts 1 and 5, but instead display equal oviposition across all fractions. Why might D. suzukii show enhanced attraction to extract 1? On a related note, extract 7 presumably has increased sugar concentrations – why doesn't this contribute to the behavior too? Are sugar responses intact in D. suzukii? How do sweet receptor knockouts perform in the behavioral assay?

We agree that changes in bitter responses are likely only part of the story, and that other cues are likely to influence the results of Figures 1C, D. The Discussion now states that "We do not claim that the loss of bitter responses is the only gustatory change that facilitated the evolutionary transition of D. suzukii to oviposition on ripe fruit. Sugar responses, for example, may also have changed and may contribute to the transition, a possibility that deserves investigation."

We have also now emphasized this point elsewhere in the Discussion: "Oviposition decisions are likely made based on an evaluation of many cues, both negative and positive, and it seems likely that positive cues detected by other neurons of D. melanogaster – for example by sugar neurons of the taste system or by neurons of other sensory modalities…"

2) The different neuronal responses to strawberry extracts reported in Figure 6A are a bit difficult to reconcile. The responses in S sensilla to overripe fruit are stronger than ripe fruit- if these are due to bitter reception alone (as suggested by Gr33a knockouts), then first, there are stronger bitter responses to overripe than ripe fruit in S sensilla of D. melanogaster, and second loss of such responses would presumably enhance attraction to overripe rather than ripe in D. suzukii, the opposite of what is seen. Perhaps sweet responses are also lost? Even more complicated scenarios are also possible such as gain in D. suzukii of a new bitter response for overripe (such as through altered receptor recognition properties) or even gain of attraction for an underripe fruit component (odor or taste).

These are interesting points, and we have now expanded the Discussion to include all of them. Specifically, we:

i) acknowledge explicitly that the responses of S sensilla to overripe fruit are stronger than to ripe fruit, which might not have been expected;

ii) indicate the likely role of sugar responses;

iii) add the reviewer's interesting suggestion that a new bitter response could even promote attraction to a fruit component of an earlier ripening stage.

"However, although the loss of response in D. suzukii to bitter compounds in early ripening stages seems likely to contribute to the oviposition shift, further investigation will be required to fully understand the role of bitter taste in the shift. […] By contrast, in a natural environment in which overripe fruits become increasingly covered with diverse populations of microbes, bitter neurons may provide a warning system that detects toxins, responds strongly, and inhibits oviposition."

– To draw further attention to the possibility of changes in the receptor repertoire we have added "Might the receptors that respond to these compounds have undergone evolutionary changes in their functional characteristics?"

– We have further revised the text to emphasize that our study is a beginning and not an end: "Our results lay a foundation for a wide variety of avenues for future investigation."

– We have amended the last sentence of the Discussion so as to draw a more conservative conclusion. It now reads "Taken together our study provides, for the first time to our knowledge, new understanding of how the gustatory system of an invasive pest species has adapted in its evolutionary adaptation to a new niche."

– Finally, for clarity in the Results section we have also switched the order of the paragraphs discussing the responses to ripe and overripe fruits (paragraph four of the original version is now paragraph two in the subsection, "Strawberry extracts").

3) Some bitter chemicals were not effective oviposition deterrents in D. suzukii, yet electrophysiological responses persisted. At face value, this would seem to suggest that the relevant evolutionary adaptations occurred centrally rather than peripherally. The authors should discuss this further.

We have now added this point to the Discussion: "Although we have found extensive changes in the peripheral taste system, we suspect there may also be changes in central circuit mechanisms. […] It seems likely that evolution has operated at a variety of levels in the shift of D. suzukii to its new niche."

4) I recognize that identifying ethologically relevant bitter chemical/receptor pairs is challenging. As is, it is unclear whether changes in receptor expression and electrophysiological responses are relevant to the behavior. Some evolutionary changes seem subtle rather than all-or-nothing (20% reduction in sensilla or partial reduction in taste responses). Possible alterations in receptor recognition properties are not explored and should be discussed. Other interesting experiments to consider here or for future studies: 1) an empty neuron experiment to look for taste receptors that detect strawberry purees, 2) testing a Gr22f mutant, if available, in the strawberry puree preference assay, and 3) since it is unclear how general one ligand-receptor pair may be, testing other fruit purees in addition to strawberry to see if the bitter metabolite is a common deterrent present in many fruits.

We have now addressed all three points:

1) The Discussion now contains mention of the importance of identifying the relevant receptors and of the interesting possibility that receptors for ethologically relevant bitter compounds have undergone evolutionary changes in their functional characteristics: "Which bitter receptors respond to these compounds, and is their expression reduced in D. suzukii? Might the receptors that respond to these compounds have undergone evolutionary changes in their functional characteristics?"

2) We are very interested in testing a Gr22f mutant as part of a separate study and have now added a sentence to this effect: "A detailed genetic analysis of Gr22f in taste and oviposition behaviors of D. melanogaster could be highly informative."

3) We have now added mention of the importance of extending the analysis to include other fruits: "What specific bitter compounds in ripe or overripe strawberries influence oviposition decisions in a natural context? Are the most influential compounds present in other fruits?"

Reviewer #2:

[…] In summary, this an extraordinarily extensive and fascinating study. This paper is highly appropriate for eLife in its current form. I have one experimental suggestion, which is completely optional.

Optional experiment

1) Is there a fitness effect resulting from Gr33a mutants eating ripe fruit. In particular Is the fecundity of the Gr33a mutant flies that consume ripe fruit reduced?

We thank the reviewer for this interesting idea, which would be an excellent addition to a future study.

Reviewer #3:

[…] Below I outline where I think the data and analyses fall short of the claims being made and offer suggestions about how the manuscript might be improved to get there.

My primary concern relates to the missing link between the behavioral observations and the neurophysiological and expression data.

1) The authors use strawberries as an oviposition substrate, but do not provide an analysis of bitter compounds present in the different maturation stages. What are the bitter compounds on the ripe strawberry that deter D. melanogaster and biarmipes but not D. suzukii? The missing data prevents the interpretation of the neurophysiological data: It is unclear if any of the 16 bitter tastants tested are of ecological relevance with respect to strawberries or other potential hosts (several such as DEET and denatonium benzoate for example are human-made synthetic compounds). For the same reason the observed indifference of D. suzukii towards these compounds in the oviposition assay (Figure 8), although impressive and suggestive, cannot be linked to the behavioral observations in the more natural context.

In order to make this link, a chemical characterization of the strawberry purees from different maturation stages is required, as well as an expansion of the tastant panel to ecologically relevant bitter tastants that occur in ripe but not overripe strawberries or differ in concentration.

We completely agree that identification of the ecologically relevant compounds is an important goal, and have added this point to the discussion of major avenues of future investigation: "What specific bitter compounds in ripe or overripe strawberries influence oviposition decisions of each species in a natural context? Are the most influential compounds present in other fruits?" We feel that such a biochemical analysis, which will require collaboration with others, is beyond the scope of the present manuscript, which includes extensive anatomical, physiological, behavioral, and molecular analysis.

2) The authors found that two clusters of labellar sensilla “S-a” and “S-b” are broadly responsive to bitter tastants (Figure 4). They also show that both of these clusters elicit higher spiking rates towards overripe than ripe strawberries across all species (Figure 6). These results are contradictory to the main hypothesis that D. suzukii's behavioral shift from preferring overripe to ripe fruit as an oviposition substrate reflects species-specific differences in the threshold for bitter perception. According to the author's model, I would expect S-a and S-b sensilla to have a higher response to ripe strawberries in D. melanogaster and biarmipes but not in D. suzukii. This is not the case in S-a and S-b. Cluster I also elicits higher responses towards overripe strawberries in all three species. It is important that the authors address these contradictions between their model and these functional results.

We thank the reviewer for raising this point. We have now acknowledged explicitly and addressed the apparent contradiction in the Discussion section:

"However, although the loss of response in D. suzukii to bitter compounds in early ripening stages seems likely to contribute to the oviposition shift, further investigation will be required to fully understand the role of bitter taste in the shift. […] By contrast, in a natural environment in which overripe fruits become increasingly covered with diverse populations of microbes, bitter neurons may provide a warning system that detects toxins, responds strongly, and inhibits oviposition."

We have further revised the text to emphasize that our study is a beginning and not an end: "Our results lay a foundation for a wide variety of avenues for future investigation."

Finally, we have amended the last sentence of the Discussion so as to draw a more conservative conclusion. It now reads "Taken together our study provides, for the first time to our knowledge, new understanding of how the gustatory system of an invasive pest species has adapted in its evolutionary adaptation to a new niche."

3) Another missing link is that of gustatory receptors to bitter tastants and behavior. The authors use previously made Gr33a knockout lines in D. melanogaster and show that a loss of function at that locus leads to a shift from overripe to ripe strawberries as preferred oviposition substrate. While the behavior of Gr33a mutant melanogaster is more D. suzukii-like, this result unfortunately does not really help in tying together the different experimental avenues undertaken in D. suzukii. While it does show that the loss of bitter reception can lead to a host shift in melanogaster, it is not a convincing analogy to D. suzukii, since 1) taste sensilla of D. suzukii are responsive to bitter tastants (Figures 4 – 7) and 2) Gr33a is not on the list of genes with decreased expression in D. suzukii compared to the other species (Figure 9).

A promising target to test the role of receptor expression differences in oviposition preference behavior seems to be Gr22f. The authors show that it is essentially missing from the D. suzukii labellar transcriptome, which could suggest that loss of Gr22f expression is an important step in the evolution of oviposition behaviors. I suggest testing this by creating null mutants in D. melanogaster. It might also be informative to define the tuning of Gr22f copies in D. melanogaster and D. suzukii, to test whether it responds to strawberry bitter compounds in either species.

We are very interested in testing a Gr22f mutant as part of a separate study and have now added a sentence to this effect: "A detailed genetic analysis of Gr22f in taste and oviposition behaviors of D. melanogaster could be highly informative.".

Beyond my concerns about the interpretation of the experiments and datasets in relation to the main hypothesis, I also have some questions about experimental design and the presentation or interpretation of some of the data.

Figure 1: How are maturation stages defined in strawberries? Is there an industry standard? It is currently unclear how the many maturation stages can be identified and whether these are of ecological relevance.

Strawberries are classified according to their appearance, but different published studies use different classification systems. We divided strawberries into classes that seemed readily distinguishable, e.g. "light red" and/or ecological relevant, e.g. "early fermented". We acknowledge that our system, like all others of which we are aware, is not based on quantitative measures.

Figure 2: The oviposition index in "Control" females in 2C and 2D is quite different from the wild types in 2B. Could it be that the w- background interferes with oviposition behavior? What are the numbers of eggs laid in the different conditions and across genotypes? It would be good to exclude that there is an effect of genetic background on egg production and egg laying.

As requested, we have now provided the numbers of eggs in the Figure 2 legend. It is possible that oviposition behavior is sensitive to the genetic background; however, we feel that the demonstration of an effect of Gr33a mutation in different genetic backgrounds, with different Gr33a alleles, and with different sources of strawberries adds rigor and robustness to the main conclusion of this figure.

Figures 4, 5 and 7: Gustatory sensilla are innervated by multiple neurons. How were spikes counted? Did the authors separate different spike amplitudes? Convolving all neurons of a sensillum into a single value might complicate linking receptors to GSN responses in the future.

We thank the reviewer for raising this point. We did in fact separate different spike amplitudes; we did not convolve all neurons into a single value. However, in nearly all recordings in this study the great majority of the spikes were of uniform amplitude (e.g. Figures 5, 7B-D), and those were the spikes whose frequencies we report. We have now clarified this point in the Materials and methods section.

Figure 6B: As pointed out above, S-a and S-b sensilla seem to respond more strongly to ripe than overripe strawberry. To allow for this comparison by the reader, please also include a comparison between ripe vs. overripe for S-a and S-b within each species.

As requested, we have added a graph showing the data from Figure 6 as a comparison between ripe v. overripe for S-a and S-b within each species (Figure 6—figure supplement 1C, D).

Figure 6C and D: Why is the response to overripe strawberry tested? In light of the hypothesis and oviposition behavior in D. suzukii it would be more informative to test the ripe maturation stage instead.

We were originally testing an alternative hypothesis for which the comparison shown in Figure 6C, D provided the most direct test. That said, the amplitude of the spikes elicited by ripe and overripe strawberry are the same, but the frequency is higher for the overripe stimulus, so the test shown in this figure is more sensitive.

Figure 9: While the differential expression data and the discussion indicate that Grs are expressed at lower levels in D. suzukii in comparison to the other species, this should be statistically tested. Do the observed patterns differ from a differential expression pattern expected by chance? Potential reasons for the observation of lower levels of expression for Grs should be taken into account. Does D. suzukii have less GSNs than the other species? Does D. suzukii have more cells of other tissues than the other two that would lead to a relative reduction of reads derived from GSNs in the transcriptome?

It is hard to extract important information on how groups of genes differ in their expression between the three species from the volcano-plots provided. I suggest making a heatmap of all 9 biological replicates and indicate important genes/gene families therein. This would help identify genes differentially expressed in D. suzukii compared to the other two.

We did not make our description of the analysis sufficiently clear. The lower levels of the indicated Grs in D. suzukii were in fact tested statistically, in four different pipelines; we have conservatively reported only those genes that were altered in expression level by at least four-fold (not two-fold), with an adjusted p-value of p<0.01 (not p<0.05), in all four pipelines (i.e. they were not statistically significant in only one, two or three pipelines). We have now made this clearer in the text.

We have expanded the text to provide a reason why the reduced expression levels of certain Grs are unlikely due to a paucity of neurons or an abundance of nonneuronal cells in the labellum of D. suzukii: levels of the IR co-receptors IR25a and IR76b, as well as the pan-neuronal genes elav and nsyb, are similar in D. melanogaster and D. suzukii. "The IR co-receptor genes IR76b and IR25a were expressed at similar levels across the three species (Supplementary files 3, 4, i.e. they did not meet the statistical criteria). We note that the comparable expression of these genes, which are broadly expressed in taste neurons (Sanchez-Alcaniz et al., 2018), as well as the comparable expression of the pan-neuronal genes elav(embryonic lethal abnormal vision) and nsyb (neuronal Synaptobrevin), argues against the possibility that the reduced expression of certain Grs in D. suzukii is a simple consequence of fewer neurons or more non-neuronal cells in the D. suzukii labellum."

https://doi.org/10.7554/eLife.64317.sa2

Article and author information

Author details

  1. Hany KM Dweck

    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, United States
    Contribution
    Conceptualization, Funding acquisition, Investigation, Visualization, Methodology, Writing - original draft, Project administration
    For correspondence
    hany.dweck@yale.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7017-5020
  2. Gaëlle JS Talross

    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, United States
    Contribution
    Investigation, Visualization, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4785-0606
  3. Wanyue Wang

    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, United States
    Contribution
    Investigation, Visualization, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
  4. John R Carlson

    Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Writing - original draft, Writing - review and editing
    For correspondence
    john.carlson@yale.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0244-5180

Funding

National Institutes of Health (NIH R01 DC11697)

  • John R Carlson

National Institutes of Health (NIH R01 DC02174)

  • John R Carlson

National Institutes of Health (NIH R01 DC04729)

  • John R Carlson

Life Science Research Foundation

  • Hany Dweck

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Zina Berman for technical support, Dr. Joshua Gendron for helpful discussion, Dr. Richard Cowles, Connecticut Agricultural Station, for providing us with D. suzukii, and Dr. Abigail A Maynard, Connecticut Agricultural Station, for providing us with ripening stages of strawberry. This work was supported by a Merck fellowship from the Life Sciences Research Foundation to HKMD and NIH R01 DC11697, NIH R01 DC02174, and NIH R01 DC04729 to JRC.

Senior Editor

  1. K VijayRaghavan, National Centre for Biological Sciences, Tata Institute of Fundamental Research, India

Reviewing Editor

  1. Stephen Liberles, Harvard Medical School, United States

Reviewer

  1. Craig Montell, University of California, Santa Barbara, United States

Version history

  1. Received: October 26, 2020
  2. Accepted: January 23, 2021
  3. Version of Record published: February 22, 2021 (version 1)

Copyright

© 2021, Dweck et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 3,234
    Page views
  • 493
    Downloads
  • 25
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Hany KM Dweck
  2. Gaëlle JS Talross
  3. Wanyue Wang
  4. John R Carlson
(2021)
Evolutionary shifts in taste coding in the fruit pest Drosophila suzukii
eLife 10:e64317.
https://doi.org/10.7554/eLife.64317

Further reading

    1. Neuroscience
    Yang Xu, Tian-liang Cui ... Jin-Hui Wang
    Research Article

    The joint storage and reciprocal retrieval of learnt associated signals are presumably encoded by associative memory cells. In the accumulation and enrichment of memory contents in lifespan, a signal often becomes a core signal associatively shared for other signals. One specific group of associative memory neurons that encode this core signal likely interconnects multiple groups of associative memory neurons that encode these other signals for their joint storage and reciprocal retrieval. We have examined this hypothesis in a mouse model of associative learning by pairing the whisker tactile signal sequentially with the olfactory signal, the gustatory signal, and the tail-heating signal. Mice experienced this associative learning show the whisker fluctuation induced by olfactory, gustatory, and tail-heating signals, or the other way around, that is, memories to multi-modal associated signals featured by their reciprocal retrievals. Barrel cortical neurons in these mice become able to encode olfactory, gustatory, and tail-heating signals alongside the whisker signal. Barrel cortical neurons interconnect piriform, S1-Tr, and gustatory cortical neurons. With the barrel cortex as the hub, the indirect activation occurs among piriform, gustatory, and S1-Tr cortices for the second-order associative memory. These associative memory neurons recruited to encode multi-modal signals in the barrel cortex for associative memory are downregulated by neuroligin-3 knockdown. Thus, associative memory neurons can be recruited as the core cellular substrate to memorize multiple associated signals for the first-order and the second-order of associative memories by neuroligin-3-mediated synapse formation, which constitutes neuronal substrates of cognitive activities in the field of memoriology.

    1. Chromosomes and Gene Expression
    2. Neuroscience
    Alan E Murphy, Nurun Fancy, Nathan Skene
    Research Article

    Mathys et al. conducted the first single-nucleus RNA-seq (snRNA-seq) study of Alzheimer’s disease (AD) (Mathys et al., 2019). With bulk RNA-seq, changes in gene expression across cell types can be lost, potentially masking the differentially expressed genes (DEGs) across different cell types. Through the use of single-cell techniques, the authors benefitted from increased resolution with the potential to uncover cell type-specific DEGs in AD for the first time. However, there were limitations in both their data processing and quality control and their differential expression analysis. Here, we correct these issues and use best-practice approaches to snRNA-seq differential expression, resulting in 549 times fewer DEGs at a false discovery rate of 0.05. Thus, this study highlights the impact of quality control and differential analysis methods on the discovery of disease-associated genes and aims to refocus the AD research field away from spuriously identified genes.