1. Cell Biology
  2. Developmental Biology

Glypicans define unique roles for the Hedgehog co-receptors boi and ihog in cytoneme-mediated gradient formation

  1. Eléanor Simon
  2. Carlos Jiménez-Jiménez
  3. Irene Seijo-Barandiarán
  4. Gustavo Aguilar
  5. David Sánchez-Hernández
  6. Adrián Aguirre-Tamaral
  7. Laura González-Méndez
  8. Pedro Ripoll
  9. Isabel Guerrero  Is a corresponding author
  1. Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Spain
  2. Growth and Development, University of Basel, Switzerland
https://doi.org/10.7554/eLife.64581
Share this article
Cite this article
  1. Eléanor Simon
  2. Carlos Jiménez-Jiménez
  3. Irene Seijo-Barandiarán
  4. Gustavo Aguilar
  5. David Sánchez-Hernández
  6. Adrián Aguirre-Tamaral
  7. Laura González-Méndez
  8. Pedro Ripoll
  9. Isabel Guerrero
(2021)
Glypicans define unique roles for the Hedgehog co-receptors boi and ihog in cytoneme-mediated gradient formation
eLife 10:e64581.
https://doi.org/10.7554/eLife.64581
  2. Download BibTeX
  3. Download .RIS

Abstract

The conserved family of Hedgehog (Hh) signaling proteins plays a key role in cell–cell communication in development, tissue repair, and cancer progression, inducing distinct concentration-dependent responses in target cells located at short and long distances. One simple mechanism for long distance dispersal of the lipid modified Hh is the direct contact between cell membranes through filopodia-like structures known as cytonemes. Here we have analyzed in Drosophila the interaction between the glypicans Dally and Dally-like protein, necessary for Hh signaling, and the adhesion molecules and Hh coreceptors Ihog and Boi. We describe that glypicans are required to maintain the levels of Ihog, but not of Boi. We also show that the overexpression of Ihog, but not of Boi, regulates cytoneme dynamics through their interaction with glypicans, the Ihog fibronectin III domains being essential for this interaction. Our data suggest that the regulation of glypicans over Hh signaling is specifically given by their interaction with Ihog in cytonemes. Contrary to previous data, we also show that there is no redundancy of Ihog and Boi functions in Hh gradient formation, being Ihog, but not of Boi, essential for the long-range gradient.

Introduction

The Hedgehog (Hh) signaling pathway has a conserved central role in cell–cell communication during tissue patterning, stem cell maintenance, and cancer progression (Briscoe and Thérond, 2013). During development, Hh ligand is usually released from a localized source inducing at distance concentration-dependent cellular differentiation and/or proliferation responses. Hh is synthetized as a precursor molecule that undergoes two post-translational lipid modifications: cholesterol (Porter et al., 1996) and palmitic acid (Pepinsky et al., 1998), which associate Hh to cell membranes restricting its free spreading through the extracellular milieu (Peters et al., 2004). Several mechanisms have been proposed to explain Hh dispersion (Lewis et al., 2001); among these, the transport by filopodia-like structures (known as cytonemes) is the most suitable model, since they facilitate direct contact between cell membranes for delivery and reception (reviewed in González-Méndez et al., 2019).

Cytonemes have been described as dynamic actin-based protrusive structures that deliver or uptake many signaling proteins in different biological contexts (Ramírez-Weber and Kornberg, 1999; reviewed in González-Méndez et al., 2019). In Drosophila, Hh has been shown to be localized along cytonemes in the germline stem cells niche (Rojas-Ríos et al., 2012), in abdominal histoblast nests, and in wing imaginal discs (Callejo et al., 2011; Bilioni et al., 2013; Gradilla et al., 2014; Chen et al., 2017). Spatial and temporal correlations between Hh gradient establishment and cytoneme formation have also been described (Bischoff et al., 2013; González-Méndez et al., 2017). As the Drosophila Hh (Gradilla et al., 2014), the vertebrate homolog Sonic-hh (Shh) has also been visualized in vivo in vesicle-like structures moving along filopodia protruding from Shh-producing cells during chick limb bud development (Sanders et al., 2013), in mouse tissue culture cells (Hall et al., 2021), and during regeneration of axolotls (Zhang et al., 2021). Although the importance of cytonemes in the coordination of growth and patterning is well documented (Ali-Murthy and Kornberg, 2016; González-Méndez et al., 2019; Zhang and Scholpp, 2019), much less is known about the intrinsic and extrinsic cues that regulate their establishment and dynamics.

In larval wing imaginal discs and pupal abdominal histoblast nests, Hh is produced and secreted by the Posterior (P) compartment cells and transported towards the receiving Anterior (A) compartment cells, resulting in a graded Hh distribution in this compartment. Cytonemes emanating at the basal surface of the polarized epithelia guide Hh delivery directly from P to A at cytoneme contact sites where Hh reception takes place (Bischoff et al., 2013; Chen et al., 2017; González-Méndez et al., 2017; González‐Méndez et al., 2020). To activate its targets in a concentration-dependent manner, Hh binds to its receptor complex formed by the canonical receptor Patched (Ptc), the co-receptors Interference hedgehog (Ihog) and Brother of Ihog (Boi) (Yao et al., 2006b), and the membrane-anchored glypicans Dally-like protein (Dlp) and Dally (Desbordes and Sanson, 2003; Lum et al., 2003b; Han et al., 2004; Williams et al., 2010). All these proteins are associated with Hh presenting (Bilioni et al., 2013; Bischoff et al., 2013) and receiving cytonemes (Chen et al., 2017; González-Méndez et al., 2017). In addition, Boc and Cdo, homologs of Ihog and Boi in vertebrates, have been reported to be associated to Hh transport and reception through cytonemes (Sanders et al., 2013; Hall et al., 2021).

The glypicans Dlp and Dally have been described as necessary for cytoneme attachment in the wing imaginal discs (Huang and Kornberg, 2016; González-Méndez et al., 2017) and for cytoneme formation in the air sac primordium (Huang and Kornberg, 2016). Dally and Dlp contain heparan sulfate (HS) and glycosaminoglycan (GAG) chains attached to a core of glypican proteins, which in turn are bound to the membrane via a GPI anchor; they have a generalized, but not uniform, expression in the wing imaginal disc (Nakato et al., 1995; Baeg et al., 2001). Glypicans regulate most morphogenetic gradients, i.e. Hh (Han et al., 2004, reviewed in Filmus and Capurro, 2014), Wingless (Wg) (Franch-Marro et al., 2005; Gallet et al., 2008; Yan et al., 2009), Decapentaplegic (Dpp) (Jackson et al., 1997; Belenkaya et al., 2004; Norman et al., 2016), and FGF (Yan and Lin, 2007); however, how glypicans achieve their specificity for each signal is not known. In Hh signaling, Dlp is needed for Hh reception (Desbordes and Sanson, 2003; Lum et al., 2003a; Han et al., 2004; Williams et al., 2010) and delivery from the Hh-producing cells (Callejo et al., 2011), while Dally is needed for maintenance of Hh levels (Han et al., 2004; Bilioni et al., 2013).

To date, the co-receptors Ihog and Boi are thought to have redundant functions because Hh signaling is only blocked when both are simultaneously absent in the Hh-receiving cells (Zheng et al., 2010). Both adhesion proteins share sequence similarities: they are type one transmembrane proteins with four Ig and two Fibronectine type III (FNIII) extracellular domains, and an undefined intracellular domain (Yao et al., 2006a). Nevertheless, Ihog and Boi are separately needed for the maintenance of normal Hh levels in Hh-producing cells (Yan et al., 2010). Both proteins are expressed ubiquitously in the wing disc, although their protein levels are reduced at the A/P boundary in response to Hh signaling. More specifically, Ihog is more abundant in basal plasma membranes of the wing disc epithelium (Zheng et al., 2010; Bilioni et al., 2013; Hsia et al., 2017) and it has the ability to stabilize cytonemes when overexpressed, clearly influencing cytoneme dynamics (Bischoff et al., 2013; González-Méndez et al., 2017).

In this work, we further analyze the interactions of glypicans with Ihog and Boi and the role of these interactions on cytoneme dynamics and Hh signaling. We describe that whereas Ihog and Boi functions are not needed for the maintenance of glypicans levels, glypicans are required to maintain Ihog, but not Boi, protein levels. In addition, we observe that ectopic Ihog, but not Boi, stabilizes cytonemes. We further dissect the functional domains of Ihog responsible for the interaction with Dally and Dlp, Hh and Ptc, as well as for cytoneme stability and Hh gradient formation. We describe that the Hh-binding Fn1 domain of Ihog (McLellan et al., 2006) is crucial for glypican interaction and cytoneme stabilization, though the amino acids involved are different from those responsible for the Ihog/Hh interaction (Wu et al., 2019). Similarly, the previously described Ptc-interacting Fn2 domain (Zheng et al., 2010) is also key for Ihog interaction with glypicans as well as for the stabilization of cytonemes. We conclude that the FNIII domains of Ihog interact with glypicans to regulate cytoneme behavior and that these interactions provide glypican specificity for Hh signaling as well as a key function for Hh gradient formation. We further propose that the presence of Ihog, but not of Boi, in basally located cytonemes is essential for Hh signaling gradient formation.

Results

Glypicans interact with Ihog to stabilize it at the plasma membranes

Previous work described interactions between glypicans and Ihog that were revealed by the ectopic Ihog recruitment of glypicans in wing disc cells (Bilioni et al., 2013). Here, we have further investigated the interactions of Ihog and Boi with glypicans. We did not detect changes to the levels of Dlp and Dally in boi−/− ihog−/− double mutant clones (Figure 1A,B). Conversely, Ihog was detectable at abnormally low levels in double mutant clones for tout velu (ttv) and brother of tout velu (botv) (Figure 1C); these genes code for enzymes that synthesize the HS-GAG chains of the glypican core proteins Dally and Dlp (Takei et al., 2004; Han et al., 2004). While in double dlp−/− dally−/− mutant clones the downregulation is evident (Figure 1F), this downregulation is not significant within dlp−/or dally−/− single mutant clones (Figure 1D,E). Thus, this effect on Ihog levels only appears in the absence of both Dally and Dlp proteins. This regulation seems to be dose-dependent since in sister clones (homozygous dlp+/+ dally+/+ or ttv+/+ botv+/+ wild-type cells contiguous to homozygous mutant clones dlp−/−dally−/− or ttv−/−botv−/−) there are higher levels of Ihog than in the heterozygous dlp-/+ dally-/+ or ttv-/+ botv-/+ background cells (Figure 1C,c,F,f, red arrowheads). Since ttv−/− botv−/− and dally−/− dlp−/− double mutant clones show identical effects on Ihog levels, the interaction between glypicans and Ihog might take place through the HS-GAG chains of the glypicans.

Figure 1 with 1 supplement see all
Download asset Open asset
Glypicans regulate Ihog but not Boi presence at the plasma membrane.

(A, B) boi-; ihogZ23 double mutant clones (labeled by the lack of GFP) do not affect the expression of the glypicans Dlp (A) and Dally (B) (gray channels). (C) Ihog levels (Bac Ihog:GFP, gray channel) decrease in ttv524 botv510 double mutant clones (labeled by the lack of GFP, yellow arrowhead); (c) enlargement of one of the clones. (D, E) dlp20 (D) and dally32 (E) single mutant clones (labeled by the lack of RFP in green) do not affect Ihog levels (α-Ihog antibody, gray channel). (F) Ihog levels (labeled with α-Ihog antibody, gray channel) decrease in dally32 dlp20 double mutant clones (labeled by the lack of GFP, yellow arrowhead); (f) enlargement of one clone. (G) Boi levels (labeled with anti Boi antibody, gray channel) are not affected in dally32 dlp20 double mutant clones (labeled by the lack of GFP, yellow arrowhead); (g) enlargement of one clone. Note that the homozygous wild-type sister clones (more intense green) positively modulate Ihog levels (red arrowheads in C and F). The discs shown in panels are representative of four to eight discs containing clones in at least three experiments. Scale bar: 20 μm.

We then analyzed the interaction of glypicans with Boi. Interestingly, in the case of Boi there is no evidence for a similar modulation. In contrast with the strong decrease of Ihog, there are no changes of Boi protein levels in dlp−/− dally−/− double mutant clones (Figure 1G). In summary, these data reveal a novel functional role of Dally and Dlp to maintain Ihog, but not Boi, protein levels.

We further explored the interaction of Ihog and Boi with glypicans. The apical–basal cellular distribution of Dally and Dlp in the disc epithelium is different: Dlp is more basally distributed than Dally, as it has been previously described (Gallet et al., 2008). Since the ectopic Ihog recruits glypicans in wing disc cells, we analyzed if ectopic Boi also does. Overexpressing in the dorsal compartment of the wing disc of Ihog or Boi (Figure 1—figure supplement 1), using the ventral compartment as internal control, we observed that although ectopic Boi also accumulates glypicans, the apical/basal distribution of this increase in the disc epithelium was different than that of Ihog. While Boi accumulates Dally and Dlp mainly at the apical side of the disc (Figure 1—figure supplement 1A), Ihog accumulates them basally (Figure 1—figure supplement 1B). This result, together with the differential effect of Dally and Dlp to maintain Ihog, but not Boi, protein levels at the plasma membrane, suggests that the ways in which Ihog and Boi interact with glypicans differ both in function and in mechanism.

Ihog functional domains implicated in the glypican–Ihog interaction

To investigate the role of the various Ihog protein domains in Ihog–Dally and Ihog–Dlp interactions, we generated transgenic lines to ectopically express Ihog proteins carrying deletions for the different extracellular domains, each fused to the red fluorescent protein (RFP) in the C-terminal. The following constructs were generated all carrying the transmembrane domain: Ihog lacking the four Ig domains (UAS.ihogΔIg-RFP), the two FNIII domains (UAS.ihogΔFn-RFP), the Fn1 domain (UAS.ihogΔFn1-RFP), the Fn2 domain (UAS.ihogΔFn2-RFP); Ihog containing only the intracellular C-terminus (UAS.ihogCT-RFP), or the extracellular domain alone (UAS.ihogΔCT-RFP) were also generated. The molecular weights corresponding to the generated Ihog mutant forms were estimated by Western blot (Figure 2—figure supplement 1).

Previously, it has been described that ectopic Ihog expression recruits glypicans (Bilioni et al., 2013; Figure 2A,A’); therefore, the analysis to identify the protein domain(s) responsible for the Ihog–glypican interaction was done through the study of the recruitment of Dally and Dlp after overexpressing the Ihog mutant variants in the dorsal compartment of the wing disc, using the ventral compartment as internal control (Figure 2B–D’, Figure 2—figure supplement 2). The results obtained were quantified (Figure 2E,E’), and we found no increase in the amount of either Dally or Dlp after ectopic expression of UAS.ihogCT-RFP (Figure 2—figure supplement 2A,A’). Ectopic expression of UAS.ihogΔIg-RFP increases glypican levels in a way similar to the ectopic expression of the full-length Ihog form (Figure 2—figure supplement 2B,B’), while the ectopic UAS.ihogΔFn-RFP does not result in Dally or Dlp increase (Figure 2B,B’). These results confirm the implication of the extracellular fragment and specifically identify the fibronectin domains as responsible for the glypican interaction. We then determined which of the two FNIII domains was responsible for the Ihog–glypican interaction. Quantification of the increase of glypicans by the expression of UAS.ihogΔFn1-RFP shows a very mild increase of Dally and Dlp (Figure 2C,C’ and E,E’). On the other hand, the expression of UAS-ihog.ΔFn2-RFP results in very mild Dally but high Dlp increase (Figure 2D,D’ and E,E’). These data indicate that while Ihog–Dlp interaction is mediated by the Fn1 domain, Ihog–Dally interaction needs both Fn1 and Fn2 domains.

Figure 2 with 2 supplements see all
Download asset Open asset
Interaction of Ihog mutant forms with glypicans.

(A–D) Glypicans accumulation in: apGal4 tubGal80ts/+; UAS.ihog-RFP/+ (A–A’), apGal4 tubGal80ts/+; UAS.ihogΔFn-RFP/ + (B–B’), apGal4 tubGal80ts/+; UAS.ihogΔFn1-RFP/+ (C–C’), apGal4tubGal80ts/+; UAS.ihogΔFn2-RFP/+ (D–D’) wing discs after 30 hr at the restrictive temperature. (E–E’) Percentage of Dally (E) and Dlp (E’) recruitment in the dorsal compartment relative to the endogenous control (ventral compartment). Each image incorporates at its side a plot profile (taken from the framed area in each image), indicating the relative intensity fluorescence for each glypican. Note that IhogΔFn-RFP does not increase either Dally (B, E) or Dlp (B’, E’). However, in ectopic expression of a partial deletions of the Ihog FN-type III domains (IhogΔFn1-RFP and IhogΔFn2-RFP) an accumulation of Dally (C–E) is observed although at lower levels than those of the ectopic Ihog-RFP (A, E). Curiously, IhogΔFn2-RFP recruits Dlp (D’, E’) at the same levels as Ihog-RFP (A’, E’) does. Discs are oriented with dorsal part down (D), ventral up (V), and posterior (P) right. Plot profiles were done over a ROI of size of 40 μm X 20 μm for Dally and 80 μm × 20 μm for Dlp. Data of glypicans recruitment is available at Figure 2—source data 1 for Dally and Figure 2—source data 2 for Dlp measure; p-values of the statistical analysis are shown in Tables 1 and 2 (Materials and methods). The discs shown in panels are representative of at least four discs in three independent experiments. Scale bar: 20 μm.

Figure 2—source data 1

Dally recruitment measures ussing different Ihog mutant constructs.

https://cdn.elifesciences.org/articles/64581/elife-64581-fig2-data1-v2.xlsx
Figure 2—source data 2

Dlp recruitment measures ussing different Ihog mutant constructs.

https://cdn.elifesciences.org/articles/64581/elife-64581-fig2-data2-v2.xlsx
Table 1
Statistical analysis of the Dally recruitment for different Ihog mutants.

p-values obtained from pairwise T test to statistically compare the Dally recruitment for different Ihog mutants (gray: n.s = not significant; orange: significant, with the corresponding p-value in scientific notation).

Pairwise.t.testUAS.ihogDFN-RFPUAS.ihogDFN1-RFPUAS.ihogDFN2-RFPUAS.ihogFN1***-RFPUAS.ihogDIg-RFP
UAS.ihogDFN1-RFP0.027
UAS.ihogDFN2-RFP0.023n.s
UAS.ihogDIg-RFP4.7e-106.1e-078.1e-07
UAS.ihogFN1***-RFP1.0e-091.0e-061.3e-06n.s
UAS.ihog-RFP9.9e-111.1e-071.5e-07n.sn.s
Table 2
Statistical analysis of the Dlp recruitment for different Ihog mutants.

p-values obtained from pairwise T test to statistically compare the Dlp recruitment for different Ihog mutants (gray: n.s = not significant; orange: significant, with the corresponding p-value in scientific notation).

Pairwise.t.testUAS.ihogDFN-RFPUAS.ihogDFN1-RFPUAS.ihogDFN2-RFPUAS.ihogFN1***-RFPUAS.ihogDIg-RFP
UAS.ihogDFN1-RFP0.0324
UAS.ihogDFN2-RFP6.4e-060.0288
UAS.ihogDIg-RFP6.4e-070.0037n.s
UAS.ihogFN1***-RFP1.3e-060.0037n.sn.s
UAS.ihog-RFP1.8e-060.0094n.sn.sn.s

The Ihog–Fn1 interacts with Hh and glypicans through different amino acids

Both Ihog and Boi have demonstrated roles in the maintenance of extracellular Hh levels in the Hh-producing cells, since the extracellular levels of Hh decrease in wing discs after the loss of function of Ihog, Boi, or both (Yan et al., 2010; Avanesov and Blair, 2013; Bilioni et al., 2013). According to these data, overexpression of Ihog in the dorsal compartment of the wing disc accumulates Hh mainly at the basolateral plasma membrane of the disc epithelium (Figure 3A; Yan et al., 2010; Callejo et al., 2011; Bilioni et al., 2013).

Figure 3 with 2 supplements see all
Download asset Open asset
Effects of Ihog mutant forms and Ihog Fn point mutations on Hh and glypican interactions.

(A–G) Hh (BacHh:GFP) expression in wing discs after 30 hr at the restrictive temperature in apGal4 BacHh:GFP/+; UAS.ihog-RFP/tubGal80ts (A), apGal4 BacHh:GFP/+; UAS.ihogΔFn-RFP/tubGal80ts (B), apGal4 BacHh:GFP/+; UAS.ihogΔFn2-RFP/tubGal80ts (C), apGal4 BacHh:GFP/+; apGal4 BacHh:GFP/+; UAS.ihogΔFn1-RFP/tubGal80ts (D), UAS.ihogFn1***-RFP/tubGal80ts (E), apGal4 BacHh:GFP/+; UAS.cd8.Fn1-Cherry/tubGal80ts (F), percentage of Hh recruitment in the dorsal compartment relative to the endogenous control (ventral compartment) (G). (H, I) Increase of glypicans after 30 hr at the restrictive temperature in apGal4 tubGal80ts/+; UAS.ihogFn1***-RFP/+ (H, H’) and percentage of Dally (I) and Dlp (I’) recruitment in the dorsal compartment relative to the endogenous control (ventral compartment). Images incorporate at their side a plot profile (taken from the framed area in each image), indicating the modulation of glypican levels. Plot profiles were done over ROI of size 80 μm × 30 μm for Hh, 40 μm × 20 μm for Dally and 80 μm × 20 μm for Dlp. Note that Ihog Fn1*** does not interact with Hh (E, G) while increasing Dally (H, I) and Dlp (H’, I’) at same levels that Ihog-RFP does. Discs are oriented with dorsal part down (D), ventral up (V) and posterior (P) right. Data is available at Figure 3—source data 1 for Hh recruitment and p-values of the statistical analysis are shown in Table 3 (Materials and methods). Data is available at Figure 2—source data 1 for Dally recruitment and Figure 2—source data 2 for Dlp recruitment; p-values of the statistical analysis are shown in Tables 1 and 2 (Materials and methods). The discs shown in panels are representative of at least four discs from three independent experiments. Scale bar: 20 μm.

Figure 3—source data 1

Hh recruitment measures ussing different Ihog mutant constructs.

https://cdn.elifesciences.org/articles/64581/elife-64581-fig3-data1-v2.xlsx
Table 3
Statistical analysis of the Hh recruitment for different Ihog mutants.

p-values obtained from pairwise T test to statistically compare the Hh recruitment for different Ihog mutants (gray: n.s = not significant; orange: significant, with the corresponding p-value in scientific notation).

Pairwise.t.testUAS.ihogDFN-RFPUAS.ihogDFN1-RFPUAS.ihogDFN2-RFPUAS.ihogFN1***-RFPUAS.ihogDIg-RFP
UAS.ihogDFN1-RFPn.s
UAS.ihogDFN2-RFP3.3e-069.6e-06
UAS.ihogDIg-RFP0.0120.0270.027
UAS.ihogFN1***-RFPn.sn.s9.6e-060.027
UAS.ihog-RFP<2e-16<2e-16<2e-16<2e-16<2e-16

The Ihog–Hh interaction was described to take place through the Ihog-Fn1 domain (McLellan et al., 2006; Yao et al., 2006b) and, as expected, we found that the expression of either UAS-ihogΔFn-RFP or UAS-ihogΔFn1-RFP does not result in Hh increase (Figure 3B and Figure 3D, respectively; Figure 3G for quantifications). To further analyze the potential Fn1 domain sequences responsible for Hh and/or glypican accumulation, we made an in silico prediction of the amino-acid residues responsible for the Ihog–Hh interaction based on structural analysis of Ihog (McLellan et al., 2008). We then generated an Ihog variant carrying point mutation substitutions in three residues (D558N, N559S, E561Q) in the region previously predicted to interact with Hh via hydrogen bonds (McLellan et al., 2006). As anticipated, overexpression of this Ihog form (UAS.IhogFn1***-RFP) does not accumulate Hh, probably due to loss of the Ihog–Hh interaction when at least one of the three amino acids is mutated (Figure 3E,G). We next analyzed the interaction of the same Ihog mutant form, UAS.IhogFn1***, with glypicans and observed that both Dally and Dlp accumulate (Figure 3H,H’; Figure 3I,I’) at a level similar to that following overexpression of the wild-type Ihog (Figure 2A,A’; Figure 2E,E’), indicating that the Fn1 amino acids that interact with glypicans are different from those carrying out the Ihog–Hh interaction. To test the sufficiency of Ihog–Fn1 domain for the interaction with Hh, we targeted it to the membrane by fusing it to the extracellular domain of CD8 (UAS.CD8.Fn1-Cherry). Expression of this construct in the dorsal compartment resulted in a small increase of Hh levels (Figure 3F,G). Altogether these results suggest that although Fn1 is the specific Ihog domain binding Hh and interacting with Dlp and Dally, the optimal binding may also require the cooperation of the Fn2.

Ihog–Fn2 domain partially influences Hh interaction

The ectopic expression of UAS-ihog.ΔFn2-RFP still accumulates Hh (Figure 3C,G), although at noticeably lower levels than the expression of the wild-type Ihog (Figure 3A,G). This last reduction in Hh increase might result from a diminished interaction of Ihog.ΔFn2 with Dally (Figure 2D,E), as Dally seems to be needed for Hh stability at the plasma membrane (Bilioni et al., 2013). Finally, as expected, Hh recruitment is not observed when expressing only the intracellular part of the protein (Figure 3—figure supplement 1B). We therefore conclude that, although the Ihog interaction with Hh is primarily mediated by Fn1, the Fn2 domain may play a minor secondary role as a consequence of its implication in Ihog–Dally interaction.

Previous research has described the role of the Fn2 domain of Ihog as enhancing Hh protein binding in cells co-expressing its receptor Ptc (Yao et al., 2006b) through Ptc interaction with two specific Fn2 amino-acid residues (Zheng et al., 2010). Since Dlp, and probably Dally, are also part of the Hh reception complex, we next studied if these amino acids could also be implicated in the interaction of Fn2 with Hh and the two glypicans. We generated an Ihog variant carrying point mutations in the two amino-acid residues (K653 and Q655) (Zheng et al., 2010) and fused it to RFP (UAS.ihogFn2**-RFP). Interestingly, the expression of this Ihog mutant form does not accumulate Hh (Figure 3—figure supplement 1C), Dally or Dlp (Figure 3—figure supplement 1D,D’). To our surprise, this result is different from that obtained by the expression of UAS.ihogΔFn2 (Figure 3C), lacking the entire Fn2 domain, which still recruits Hh. Moreover, the expression of UAS.ihogFn2**, with or without RFP (Zheng et al., 2010), decreases the amount of endogenous Dally (Figure 3—figure supplement 1D and Figure 3—figure supplement 2A), acting as dominant negative in the recruitment of Dally and thus indirectly affecting Hh stabilization.

Ihog Fn1 and Fn2 domains influence Hh gradient formation

To further investigate the effect of UAS.ihogΔFn2-RFP and UAS.ihogFn2**-RFP variants on Hh reception, we overexpressed the wild-type Ihog and these mutant forms in the Ptc expressing cells of the ventral side of the wing disc, using LexAop.Gal80; ap.LexA Ptc.Gal4 as driver, thus maintaining the dorsal side as internal wild-type control (Figure 4). We then analyzed the response of the high-threshold target Ptc and the low threshold target Cubitus interruptus (Ci). After ectopic Ihog-RFP expression, Hh reception is slightly affected, resulting in flattened gradient responses with an extension of Ptc expression together with a reduction of its highest levels and an extension of Ci expression (Figure 4A,A’, see also Yan et al., 2010). The flattening effect is more evident when expressing UAS.ihogΔFn2-RFP (Figure 4—figure supplement 1A,A’). Unexpectedly, no effect is detected after the expression of UAS-ihogFn2**-RFP, that carries the two Fn2 point mutations (Figure 4—figure supplement 1B,B’) proposed to reduce the interaction with Ptc (Zheng et al., 2010).

Figure 4 with 3 supplements see all
Download asset Open asset
Effect of the ectopic expression of Ihog mutant forms on Hh gradient formation.

(A–C) Ptc (A–C) and Ci (A’–C’) expression in wing discs after 28 hr induction of: UAS.ihog-RFP (A), UAS.ihogΔFn1-RFP (B), and UAS.ihogFn1***RFP (C) using the multiple driver LexAopGal80; apLexA ptcGal4/+; tubGal80ts/+. Images incorporate underneath plots of the fluorescence intensity of Ptc and Ci expression in the ventral experimental side (red) compared with the dorsal control side (blue) of the wing disc. Note that both IhogΔFn1 and IhogFn1*** strongly reduce Hh reception. Discs are oriented with dorsal (D) part down and posterior (P) right. Plot profiles were performed over a ROI of size 120 μm × 20 μm. The discs shown in panels are representative of at least five discs in three independent experiments. Scale bar: 20 μm.

We then analyzed the role of ΔFn1 in Hh gradient formation. In agreement with the inability of UAS.ihogΔFn1-RFP or UAS.ihogFn1***-RFP to interact with Hh, their ectopic expression in Hh-receiving cells has a different effect, lacking expression of the high-threshold target En (Figure 4—figure supplement 2A,B), nearly absent expression of Ptc and expanded expression of the low threshold target Ci (Figure 4B–C’). Thus, these Ihog mutants show a dominant negative effect on Hh gradient responses because it should not occur when the endogenous genes ihog and boi are present.

To test the existence of a dominant negative effect, we used the Ihog Bac-GFP reporter (Hsia et al., 2017) and expressed either UAS.ihogΔFn1-RFP or UAS.ihogFn1***-RFP. Under these conditions, the endogenous Ihog levels were clearly diminished mainly at the basal part of the disc epithelium (Figure 4—figure supplement 3A,B), supporting the dominant negative effect of these constructs over the endogenous Ihog.

Excess of ihog, but not of Boi, can modulate cytoneme dynamics

The in vivo imaging of the abdominal histoblast nests allows studying cytoneme dynamics in physiological conditions. In this system, cytoneme behavior is not altered when analyzed using innocuous actin reporters (Bischoff et al., 2013; Chen et al., 2017; González-Méndez et al., 2017) such as the actin-binding domain of moesin fused to GFP (GMA-GFP) (Bloor and Kiehart, 2001). Using this system, it has been previously observed that ectopic expression of Ihog stabilizes roughly 75% of all cytonemes by slowing down their elongation/retraction velocities, without affecting their length (González-Méndez et al., 2017).

We first investigated if cytonemes were normal in the absence of either Ihog or Boi as well as the requirement of Ihog and Boi for cytoneme formation and dynamics. We compared the dynamics of cytonemes after expressing GMA-GFP (Video 1B) or expressing GMA-GFP in the absence of Ihog and Boi in the P compartment (Video 1C). Cytonemes labeled with GMA-GFP, that are downregulated for Ihog and Boi, have dynamics similar to those of wild-type cells expressing only GMA-GFP (Figure 5C). Based on the results obtained after knocking down Ihog and Boi through RNAi expression (Figure 5—figure supplement 1), it appears that wild-type cells may not need Ihog and Boi to produce cytonemes, even though ectopic expression of Ihog modulates cytoneme dynamics.

Figure 5 with 2 supplements see all
Download asset Open asset
Effect of Ihog and its mutant forms in the regulation of cytoneme dynamics.

(A) Violin plots of lifetime distributions of dynamic cytonemes in different Ihog overexpression genotypes: UAS.ihog-RFP (blue), wild-type control UAS.GMA-GFP (green), and different Ihog deletion mutants (orange). (B) Comparison between the effect of the ectopic expression of different Ihog point mutations: Control UAS.ihog-RFP (blue), wild-type control UAS.GMA-GFP (green); mutants of Ihog (orange). (C) Comparison between different levels of Ihog and Boi: UAS.ihog-RFP (blue), UAS.boi-YFP (yellow), UAS.GMA-GFP (green), and UAS.RNAi-Boi/UAS.RNAi-ihog (orange). (D) Table summarizing the dynamic of cytoneme in different genotypes: Stabilized cytonemes in blue and dynamical cytonemes in green. (*) Statistically significant lifetime differences compared to wild-type GMA-GFP cytonemes. Data is available at Figure 5—source data 1 and p-values of the statistical analysis are shown in Tables 4 and 5 (Material and methods).

Figure 5—source data 1

Cytonemes lifetime measures under different experimental conditions.

https://cdn.elifesciences.org/articles/64581/elife-64581-fig5-data1-v2.xlsx
Video 1
Download asset
Cytoneme dynamics under different levels of Ihog and Boi in histoblasts.

Abdominal histoblasts of pupae expressing UAS.GMA-GFP (black) under the control of Hh.Gal4; tubGal80ts and also expressing UAS.Ihog-RFP (after 24 hr of expression) (A). Note the stabilization of cytonemes compared with the very dynamic cytonemes of the control (expression of only GMA-GFP) (B). Abdominal histoblasts of a pupa continuously expressing UAS.RNAi-Ihog and UAS.RNAi-Boi in the P compartment during development (C) show cytonemes with similar dynamics to that of the control expressing only GMA-GFP (B). Movies are 30 min long. Frames correspond to the projection of a Z-stack at 2 min intervals. The A compartment is on the left. Pupae were around 30 hr after puparium formation. Scale bar: 10 μm.

On the other hand, since Boi and Ihog have been proposed to have redundant functions in Hh reception (Zheng et al., 2010), we explored if this redundancy also applies to the induction of cytoneme stability. We found that overexpression of Boi does not stabilize cytonemes: Hh-producing abdominal histoblasts ectopically expressing Boi emit dynamic cytonemes (Video 2, Figure 5C), while co-overexpression of Boi and Ihog leads, as predicted, to more stable cytonemes (Video 3). We next examined if Boi knockdown influences ectopic Ihog-driven cytoneme stabilization. To do this, we expressed throughout development Ihog-RFP and silenced Boi at the same time in the P compartment, and found that in those conditions cells showed stabilized cytonemes (Video 4). These results indicate that, unlike Ihog, ectopic expression of Boi does not affect cytoneme dynamics.

Video 2
Download asset
Cytoneme dynamics of abdominal histoblasts expressing UAS.boi-YFP.

Abdominal histoblasts of a UAS.boi-YFP/+; hh.Gal4 tubGal80ts pupa expressing Boi-YFP (green) during 24 hr. (A) Z-stack from apical to basal, showing cytonemes in the most basal part. (B) 30 min movie of the same pupa showing dynamic cytonemes. Frames correspond to the projection of a Z-stack at 2 min intervals between frames. The A compartment is on the left. Pupa was around 30 hr after puparium formation. Scale bar: 10 μm.

Video 3
Download asset
Cytoneme dynamics of histoblasts expressing both UAS.boi-YFP and UAS.ihog-RFP.

Abdominal histoblasts of a UAS.boi-YFP/UAS.ihog-RFP; hh.Gal4 tubGal80ts pupa. Boi-YFP (green) and Ihog-RFP (gray) were expressed during 24 hr before recording. (A) Z-stack from apical to basal showing basal cytonemes. (B) 30 min movie of the same pupa showing stabilized cytonemes. Frames correspond to the projection of a Z-stack at 2 min intervals. The A compartment is on the left. Pupa was around 30 hr after puparium formation. Scale bar: 10 μm.

Video 4
Download asset
Cytoneme dynamics of histoblasts expressing UAS.ihog-RFP and UAS-RNAi-boi.

Abdominal histoblasts of a UAS.Ihog-RFP/UAS.RNAi-Boi; Hh.Gal4 tubGal80ts/+ pupa. Ihog-RFP (gray) and RNAi-Boi were expressed during 24 hr before recording. (A) Projection of a Z-stack from apical to basal show basal location of cytonemes. (B) 30 min movie of the same pupa showing stabilized cytonemes. Frames correspond to the projection of a Z-stack at 2 min intervals. The A compartment is on the left. Pupa was around 30 hr after puparium formation. Scale bar: 10 μm.

The Ihog FNIII domains can modulate cytoneme dynamics

Once we had found that Ihog recruits glypicans mainly at the basolateral side of the epithelium where cytonemes are formed, we then analyzed whether the Ihog–glypican interaction is responsible for the regulation of cytoneme dynamics by testing the different Ihog domain(s) in relation to cytoneme stabilization. Cytoneme behavior was analyzed in the Hh-producing cells measuring the lifetime of cytonemes when expressing GMA-GFP together with either wild-type Ihog or the different Ihog mutant variants (Videos 5 and 6; Figure 5A,B; Figure 5—figure supplement 2B for cytoneme dynamics graphics). All cytonemes labeled with GMA-GFP are also marked with Ihog-RFP constructs (González-Méndez et al., 2017; Figure 5—figure supplement 2A). As anticipated, no cytoneme stabilization was observed after ectopic expression of the Ihog intracellular fragment (UAS.ihogCT-RFP) (Figure 5A; Video 5D). Complementarily, 70-80% of stabilized cytonemes were observed after the ectopic expression of Ihog lacking the C-terminal fragment (UAS.ihogΔCT-RFP) (Figure 5A; Video 5C). Ihog cytonemes were also dynamic when co-expressing GMA and Ihog lacking FNIII domains (UAS.ihogΔFn-RFP) (Figure 5A; Video 5F). The lifetime and extent of UAS.ihogΔFn-RFP cytonemes visualized with both RFP and GMA-GFP were like those of wild-type cytonemes expressing GMA-GFP alone (Figure 5—figure supplement 1). Likewise, the absence of either the Fn1 (Figure 5A; Video 5G) or the Fn2 (Figure 5A; Video 5H) domains results in no cytoneme stabilization. However, surprisingly, the absence of the Ig domain (UAS.ihogΔIg-RFP) does not stabilize cytonemes (Figure 5A; Video 5E), despite the normal interaction of this construct with glypicans. Interestingly, we have also noticed that the expression levels of UAS.ihogΔIg-RFP at membranes are lower than those of the rest of the constructs, and this difference could give rise to this unexpected effect on cytoneme dynamics. An alternative explanation is that the Ig domains could interact with extracellular matrix components other than glypicans that could also influence cytoneme dynamics.

Video 5
Download asset
Roles of Ihog domains on cytoneme stability.

Abdominal histoblasts expressing UAS.GMA-GFP (black) under the control of Hh.Gal4 tubGal80ts pupae (24 hr of expression) (A) and also expressing UAS.Ihog-RFP (B); UAS.Ihog-ΔCT-RFP (C); UAS.IhogCT-RFP (D); UAS.Ihog-ΔIg-RFP (E); UAS.Ihog-ΔFn-RFP (F); UAS.Ihog-ΔFn1-RFP (G) and UAS.Ihog-ΔFn2-RFP (H). Note that cytonemes are stable in (B and C), while they are dynamic in (D–H). Movies are 30 min long. Frames correspond to the projection of a Z-stack at 2 min intervals. The A compartment is on the left. Pupae were around 30 hr after puparium formation. Scale bar: 10 μm.

Video 6
Download asset
Different effects of Ihog-FN1*** and IhogFN2** on cytoneme stability.

Abdominal histoblasts of pupae expressing UAS.GMA-GFP (in black) and UAS.ihog-RFP (A); UAS.ihog-Fn1***-RFP (B); UAS.ihogFn2**-RFP (C); UAS.ihogFn2** (D) under the Hh.Gal4 tubGal80ts control (24 hr of induction). Note that cytonemes from cells expressing Ihog-Fn1***-RFP, that alters its interaction with Hh but not with glypicans (B), are as stable as those from the control cells expressing Ihog-RFP (A), while IhogFn2** presents normal cytoneme dynamics (C, D). Movies are 30 min long. Frames correspond to the projection of a Z-stack at 2 min intervals. The A compartment is on the left. Pupae were around 30 hr after puparium formation. Scale bar: 10 μm.

Since both FNIII domains (Fn1 and Fn2) affect cytoneme dynamics, we then analyzed the effect on cytoneme stabilization of the point mutation constructs. The expression of UAS.ihogFn1***-RFP, affecting Ihog interaction with Hh (Figure 3E) but not with glypicans (Figure 3H,H’) resulted in cytoneme stabilization (Figure 5B; Video 6B), showing that the ability of Ihog overexpression to modulate cytoneme dynamics is not dependent on the same amino acids needed for Hh binding, but rather on those involved in the interaction with glypicans. In contrast, the expression of UAS.ihogFn2**, described to modify the interaction of Ihog with Ptc (Zheng et al., 2010), does not stabilize cytonemes with or without RFP (Figure 5B; Video 6C,D). Nevertheless, this construct performs as non-functional since it does not turn out the same effects as the lack of the entire Fn2 domain when expressing it, except for a decrease in the amount of endogenous Dally (Figure 3—figure supplement 2).

In summary, these results show that the two Ihog FNIII domains (which are also responsible for the Ihog–glypicans interaction) have a predominant role in cytoneme stabilization, and this stabilization is not dependent on the same residues that regulate the Ihog–Hh interaction.

Ihog and Boi functions are not interchangeable for Hh gradient formation

The data presented so far indicate distinctive roles for Ihog and Boi in Hh gradient formation. First, as Boi has a more apical subcellular location and Ihog more basal (Bilioni et al., 2013; Hsia et al., 2017), it was not surprising to find that ectopic Boi accumulates glypicans apically, while ectopic Ihog does it basally (Figure 1—figure supplement 1). Second, glypicans are required to stabilize Ihog, but not Boi, at the plasma membranes (Figure 1F,G respectively). Third, excess of Ihog but not of Boi, modulates cytoneme dynamics (Videos 1, 2, and 4).

Thus, to explore Ihog and Boi potentially different requirements for Hh gradient formation, we generated ihog−/− mutant clones abutting the A/P compartment border in a wild-type background (Figure 6A) or in a boi mutant background (Figure 6B). Unexpectedly, the lack of Ihog is sufficient to reduce Hh responses in Hh-receiving cells despite Boi presence (Figure 6A, dotted line area, clone 1), while the absence of Boi does not reduce Hh responses in the same way when Ihog is present (Figure 6B, yellow arrowhead). In addition, the low Hh threshold target Ci is also reduced in ihog−/− mutant clones located in the Hh reception area but not touching the A/P compartment border (Zheng et al., 2010; Figure 6A, dotted line area, clone 2). On the other hand, as expected, the lack of both co-receptors abolishes the Hh signaling gradient (Figure 6B, dotted line area). These results demonstrate a non-redundant role of Ihog and Boi in Hh reception.

Figure 6 with 1 supplement see all
Download asset Open asset
Ihog and Boi have differential roles on Hh gradient formation.

(A) Homozygous ihogZ23 mutant clones (labeled by the lack of GFP) in boi wild-type background (A) and in boi−/− mutant background (B). Both experiments are immunostained for Ptc and Ci. Ptc expression is significantly reduced in ihogZ23 mutant clones located in the A compartment abutting the A/P compartment border (clone one in A) and Ci is reduced in clones close to the A/P border in the Hh signaling zone (clone two in A). However, Ptc and Ci expressions are maintained in a boi- mutant background (B, yellow arrowhead). Note that there is not Hh signaling in the absence of both Ihog and Boi (B, dotted line area). (C, D) Ptc, Ci, and En expression in wing discs after 48 hr induction of UAS.ihog-RNAi (C) and UAS.boi-RNAi (D) using the multiple driver LexAopGal80; apLexA ptcGal4/+; tubGal80ts/+ (the scheme above shows the ventral/anterior domain of induction using this multiple driver). The UAS.ihog-RNAi expression reduces Ptc, Ci, and En levels (C), while extends Hh gradient slightly (Ptc and Ci show a more flattened pattern) after UAS.boi-RNAi expression (D). Discs are oriented with dorsal (D) part down and posterior (P) right. Plot profiles were performed over a ROI of size 120 μm × 20 μm for Ptc, Ci and En. The discs shown in panels are representative of at least five discs in three independent experiments. Scale bar: 20 μm.

In agreement with previous results, the knockdown of Ihog by RNAi expression in the ventral receiving cells reduces the expression of the high (En and Ptc) and the low (Ci) threshold Hh targets, compared to the wild-type control dorsal side (Figure 6C) and in spite of an increase in Boi levels under these experimental conditions (Figure 6—figure supplement 1). We then analyzed the effect on Hh gradient of knocking down Boi without altering Ihog. We observed the opposite effects: a slight flattening of the Hh gradient with a decrease in the high levels of Ptc, a slight extension of the Ci gradient and a maintenance of En levels in the A compartment (Figure 6D). These results indicate that in the absence of Ihog the long- and short-range gradient of Hh is affected and it is not rescued by the co-receptor Boi, which is only capable of partially maintain the Hh responses.

Discussion

Glypicans and Ihog interaction

There is strong experimental evidence for the glypicans Dally and Dlp to regulate the release, dispersal, and reception of Hh in Drosophila (reviewed in Yan and Lin, 2009; Filmus and Capurro, 2014). Although the glypican core region of Dlp is known to function as a Hh signaling binding protein, a direct high-affinity interaction between Dlp and either Hh or the Hh-Ihog complex had not yet been detected (Williams et al., 2010). On the other hand, it has previously been postulated that Ihog and Boi, two adhesion molecules that act as Hh coreceptors, are required for all known biological responses to Hh signaling during embryonic and imaginal development (Yao et al., 2006b; Camp et al., 2010; Zheng et al., 2010).

In this report, we show evidence of the Ihog–glypican protein interaction in wing imaginal discs. First, we demonstrated that Ihog is stabilized at the plasma membrane by glypicans, since the level of Ihog drastically decreases in double mutant clones for genes encoding glypicans (dally and dlp). Interestingly, this interaction between glypicans and Ihog could be mediated by the HS-GAG chains of the glypicans, as the same effect is observed in clones mutant for the enzymes that synthetize the HS-GAG chains (ttv and btv). The molecular mechanisms leading to this regulation are still unknown; nonetheless, as glypicans are required for Hh (Bilioni et al., 2013) and Wg recycling (Gallet et al., 2008) they might also be required for a hypothetical recycling of Ihog. Second, we showed a different role of glypicans with respect to Boi: under the same experimental conditions, Boi plasma membrane levels are not affected, indicating that the modulation of Ihog by glypicans is specific. Third, we determined that the glypicans–Ihog interaction is mediated by both Ihog FNIII domains, Fn1 and Fn2; however, even though the Fn1 domain interacts equally with both glypicans (see also Yang et al., 2021), the Fn2 domain is almost dispensable for the interaction with Dlp, but necessary for that with Dally.

Ihog–glypican interaction regulates cytoneme dynamics

In wing discs and in the abdominal histoblast nests, the ectopic expression of Ihog stabilizes cytonemes, although without affecting their normal length (Bischoff et al., 2013; González-Méndez et al., 2017). On the other hand, general cytoneme establishment and dynamics are not affected after inhibiting Ihog and Boi using actin reporters to visualize them. However, with our current experimental tools we cannot discriminate Hh specific cytonemes from those probably used for other signaling pathways. Thus, the formation of cytonemes may probably be regulated by a general cell machinery, notwithstanding the existence of pathway specific regulation.

It was interesting finding out that the Ihog cytoneme stabilization effect depends on these extracellular FNIII domains. In particular, the Fn1 domain is involved in the recruitment of Hh and the two glypicans Dally and Dlp at cytonemes. In addition, the expression of Ihog without the Fn2 domain results on dynamic cytonemes in abdominal histoblast nests. Ihog ΔFn2 lacks the ability to interact with the glypican Dally, but still retains its interaction with Dlp, suggesting a more specific role of Dally in cytoneme dynamics. Besides, the expression of Ihog lacking the intracellular domain still stabilizes cytonemes, while the expression of the intracellular domain only does not. Therefore, the intracellular fragment, potentially in contact with the actin machinery (reviewed in Sanchez-Arrones et al., 2012) needed for the elongation and retraction of cytonemes, does not appear to influence their stabilization.

Ihog binding to Hh is influenced by its interaction with glypicans

Ihog has a known role in Hh recruitment to the membranes of both producing and receiving cells in the wing disc (Yan et al., 2010; Bilioni et al., 2013). It has also been proposed that Ihog may act as an exchange factor by retaining Hh on the cell surface, competing with Dlp for Hh binding (Yan et al., 2010). In addition, of the three Ihog extracellular domains (Fn1, Fn2, and Ig), only Fn1 and Fn2 are necessary for in vivo Hh signaling, although accomplishing independent functions (McLellan et al., 2006; Zheng et al., 2010).

The Fn1 domain has been described as specifically needed for Hh binding (McLellan et al., 2006; Yao et al., 2006b). In agreement, we have observed that the ectopic expression of the variant of Ihog lacking Fn1 does not accumulate Hh in the P compartment as the ectopic wild-type Ihog does. Specifically, the amino-acid changes (D558N, N559S, E561Q) that we have generated in the Fn1 domain (Ihog-Fn1***) impede Hh accumulation. These mutations are not identical to those described by McLellan et al., 2006, although they map in the same Ihog protein region predicted to interact with Hh. Interestingly, our amino-acid alterations maintain the Ihog–glypican interaction, showing that both interactions (with Hh and with glypicans) are mediated by different sequences within the same Ihog extracellular domain. Accordingly, crystal structure of the Hh-binding fragment of Ihog has shown that the Fn1 domain is specifically needed for heparin binding-dependent Ihog dimerization as well as required for high-affinity interactions between Ihog and Hh. Also in agreement with our data, the putative heparin-binding site near the Ihog–Ihog dimer interface was found to be separated from the basic strip bridging Hh to Ihog-Fn1 (McLellan et al., 2006). Besides, we have also observed that ectopic expression of a construct carrying only the wild-type Fn1 domain recruits low levels of Hh, suggesting that, although Fn1 binds physically to Hh, cooperation between Fn1 and Fn2 domains is needed for an efficient Fn1-Hh binding. Both domains are required for proper Ihog–Dally interaction, what explains why the Fn2 domain also slightly influences Hh accumulation.

Ihog, but not Boi, function is needed for cytoneme-mediated Hh gradient

As Hh co-receptors, the functions of Ihog and Boi have been described to be interchangeable for Hh signaling (Yao et al., 2006b; Camp et al., 2010; Zheng et al., 2010). Nevertheless, here we have shown different functional requirements for each protein: (1) ectopic Ihog, but not Boi, accumulates glypicans in the basal part of the wing disc tissue; (2) the levels of glypicans are key to maintain Ihog, but not Boi, protein levels at cytoneme membranes; and (3) Ihog, but not Boi, has a cytoneme-stabilizing function in vivo. These observations overall suggest a specific function of Ihog and its interaction with glypicans to stabilize cytonemes and regulate the Hh gradient. In agreement, we show that Hh gradient was affected in the absence of Ihog, even though Boi levels are maintained. Although Ihog and Boi are both part of the Ptc-coreceptor complex, our data demonstrate that Boi cannot substitute Ihog function in the formation of the Hh gradient (Figure 7B). We have previously proposed that cytonemes at the basal part of the epithelia regulate both the short- and long-range Hh gradient, while apical contacts significantly contribute to the short-range gradient (Callejo et al., 2011; Bilioni et al., 2013; Chen et al., 2017; González-Méndez et al., 2017). Accordingly, basal glypicans–Ihog interactions indicate a main function of Ihog in long-range Hh gradient formation. Boi is located more apically in the disc epithelium (Bilioni et al., 2013; Hsia et al., 2017), where no long cytonemes have been observed (Bilioni et al., 2013). Besides, the apical reception complex could have an important input in Hh high-threshold or short-range responses (Callejo et al., 2011).

Figure 7 with 1 supplement see all
Download asset Open asset
Scheme representatives of glypicans, Hh, and Ptc interaction with Ihog and its specific requirement for long-range Hh gradient.

(A) Scheme depicting the Ihog domains and their inetractions of the two FNIII domains with Hh (Yao et al., 2006b), Ptc (Zheng et al., 2010), and the glypicans Dally and Dlp. (B) Ihog and Boi loss of function differentially affect the formation of the Hh signaling gradient: while Ihog seems to be required for the short- and long range, boi is needed for the short-range Hh gradient.

The ability of glypicans to regulate Hh signaling depends on their interaction with Ihog at cytonemes

Hh-graded distribution across the receiving Drosophila epithelia is mediated by cytonemes and reception seems to happen at discrete contact sites along presenting and receiving cytonemes. At these contact places, most of the extracellular components needed for Hh signaling colocalize in a dynamic way (González-Méndez et al., 2017), similar to a synaptic process (Huang et al., 2019; González‐Méndez et al., 2020). Our results support the hypothesis that the interactions of Hh, Ptc, and Ihog with the glypicans, among other complex components, might guide the Hh reception at cytoneme contact sites. In this context, it has recently been proposed that the Ihog–Ihog homophilic interaction is competing with the Ihog-Hh heterophilic interaction through the Ihog Fn1 domain (Yang et al., 2021). This competing interaction at the cytoneme contact sites between presenting and receiving cytonemes could allow the Hh reception. On the other hand, recent research describes that the Dlp class of glypicans shields the highly hydrophobic lipid moiety of Wnt from the aqueous environment, allowing its handing over to receptors (McGough et al., 2020). For Hh signaling, Dlp could also tunnel Hh lipid modifications while transferring Hh to its receptor Ptc and coreceptors Ihog and Boi. Interestingly, Dlp, as part of the reception complex, interacts specifically with the Ihog Fn1 domain, the same domain that binds Hh.

Glypicans control several morphogenetic gradients (Bmp, FGF; Dpp; Jak/Stat) in addition to those of Hh and Wnt. Based on our data, glypican regulation over Hh signaling is mainly given by their interaction with Ihog, thus conferring pathway specificity. We, therefore, propose that the glypicans–Ihog interaction could aid cytoneme dynamics, Hh-maintenance at cytonemes, Hh presentation to Ptc, as well as Hh release during the reception process.

Materials and methods

Key resources table
Reagent type
(species) or
resource		DesignationSource or
reference		IdentifiersAdditional
information
Transgenic construct (Drosophila melanogaster)UAS.GMA-GFPBloor and Kiehart, 2001
Transgenic construct (Drosophila melanogaster)UAS.ihog-RFPCallejo et al., 2011
Transgenic construct (Drosophila melanogaster)UAS.ihog-CFPBilioni et al., 2013
Transgenic construct (Drosophila melanogaster)UAS.ihogΔCT-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.ihogΔFN-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.ihogΔIg-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transfgenic construct (Drosophila melanogaster)UAS.ihogΔFn1-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.ihogΔFn2-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.ihogFn1***-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.ihogFn2**-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.ihogFn2**Zheng et al., 2010
Transgenic construct (Drosophila melanogaster)UAS.ihogCT-RFPAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.CD8.Fn1-mCherryAvailable in Isabel Guerrero's laboratory, Severo Ochoa Molecular Biology Center, Madrid, Spain
Transgenic construct (Drosophila melanogaster)UAS.boi-YFPBilioni et al., 2013
Transgenic construct (Drosophila melanogaster)UAS.ihog-RNAiVienna Drosophila Resource Center (VDRC), ref: 102602
Transgenic construct (Drosophila melanogaster)UAS.boi-RNAiVienna Drosophila Resource Center (VDRC), ref: 108265
Transgenic construct (Drosophila melanogaster)UAS.dlp-RNAiVienna Drosophila Resource Center (VDRC), ref: 10299
Transgenic construct (Drosophila melanogaster)UAS.dally-RNAiVienna Drosophila Resource Center (VDRC), ref: 14136
Genetic reagent (Drosophila melanogaster)hs-FLPGolic and Lindquist, 1989
Genetic reagent (Drosophila melanogaster)dally32Franch-Marro et al., 2005
Genetic reagent (Drosophila melanogaster)dlp20Franch-Marro et al., 2005
Genetic reagent (Drosophila melanogaster)ttv524Takei et al., 2004
Genetic reagent (Drosophila melanogaster)botv510Takei et al., 2004
Genetic reagent (Drosophila melanogaster)boiZheng et al., 2010
Genetic reagent (Drosophila melanogaster)ihogZ23Zheng et al., 2010
Genetic reagent (Drosophila melanogaster)Bac Hh:GFPChen et al., 2017
Genetic reagent (Drosophila melanogaster)Bac ihog:GFPHsia et al., 2017
Genetic reagent (Drosophila melanogaster)dally-trap-YFPLowe et al., 2014
Genetic reagent (Drosophila melanogaster)hh.Gal4Tanimoto et al., 2000
Genetic reagent (Drosophila melanogaster)ptc.Gal4Hinz et al., 1994
Genetic reagent (Drosophila melanogaster)ap.Gal4Calleja et al., 1996
Genetic reagent (Drosophila melanogaster)ap.LexABloomington Stock Center
ref:54268
Genetic reagent (Drosophila melanogaster)LexO.TubGal80Bloomington Stock Center
ref:32217
Genetic reagent (Drosophila melanogaster)act>y+>Gal4Pignoni and Zipursky, 1997
AntibodyMouse monoclonal α-PtcCapdevila and Guerrero, 19941:30
AntibodyMouse monoclonal α-DlpLum et al., 2003b1:30
AntibodyRabbit polyclonal α-GFPMolecular Probes1:1000
AntibodyRabbit polyclonal α-IhogBilioni et al., 20131:100
AntibodyMouse monoclonal α-EnPatel et al., 19891:100
AntibodyRabbit polyclonal α-BoiBilioni et al., 20131:30
AntibodyRat monoclonal α-CiMotzny and Holmgren, 19951:20
AntibodyRabbit polyclonal α-RFPChromoteck1:5000 WB
Antibody680RD fluorescent α-rabbitLi-Cor1:10,000 WB

Generation of the Ihog constructs

Request a detailed protocol

IhogΔCT was obtained by PCR amplification using the Ihog cDNA as a template (5’CACCATGGACGCTGCTCACATCCTC3’; 5’CTTGTTTGGATTGTTTCCCCGGCTTC3’). The resulting product was then cloned into the entry vector pENTR/D-TOPO by directional TOPO cloning (Gateway system; Invitrogen) and introduced by recombination into the destination vector pTWR (pUAST-RFP).

IhogΔFn construct was obtained by PCR amplification using the Ihog/pENTR vector as a template (5’GAATTTAGTGCCCTTAAGCAGG3’; 5’CTGCTTCTGCCTGGAACCCT3’). The resulting product was then ligated obtaining the IhogDFn/pENTR vector, lacking the FN domains, that was then introduced by recombination into the destination vector pTWR (pUAST-RFP).

To generate the IhogΔIg, IhogΔFn1, IhogΔFn2, and the IhogCT constructs two different PCR were performed (primers), introducing a restriction site (BamHI, NdeI, or KpnI). After restriction and subsequent ligation, the product lacking the domain of interest was cloned into the entry vector pENTR/D-TOPO by directional TOPO cloning (Gateway system; Invitrogen) and introduced by recombination into the destination vector pTWR (pUAST-RFP).

Primers:

  • ΔIG PCR1: 5’CACCATGGACGCTGCTCACATCCTC3’;5’CACCAAAGATTCGGATCCGCGAAG3’

  • PCR2: 5’CAGATTCAGGGATCCCGGGAATCG3’;5’CACGCCAACGCTGTTGAGGCT3’

  • ΔFn1 PCR1: 5’CACCATGGACGCTGCTCACATCCTC3’;5’CTTCTGCCTGGTACCCTGATTGGGC3’

  • PCR2:5’GCAGCCAGGTACCGCACTTGATCCG3’;5’CACGCCAACGCTGTTGAGGCT3’

  • ΔFn2 PCR1:5’CACCATGGACGCTGCTCACATCCTC3’;5’GTATTCCTCGATCTCCATATGCTCTGGCAC3’

  • PCR2:5’GAATTTAGTGCCCATATGCAGGGG3’;5’CACGCCAACGCTGTTGAGGCT3’

  • CT PCR1:5’CACCATGGACGCTGCTCACATCCTC3’; 5’CACCAAAGATTCGGATCCGCGAAG3’

  • PCR2:5’CGCACCCAAGGATCCAAAACCAGC3’;5’CACGCCAACGCTGTTGAGGCT3’

To generate the construct IhogFN1***, carrying point mutations D558N, N559S, and E561Q, a PCR was performed with the following primers: 5’TGAAGTTGGAGTGTAAGGCCA3’ and 5’TCAAGTTCAACGTCAGGAAGTCA3’. pTWR-IhogRFP vector was digested using BglII and XhoI restriction enzymes. The PCR product and the digested vector were put together by Gibson Assembly.

The construct IhogFN2** (point mutations K653E and Q655E) was generated using pTWR-IhogRFP as a template. First, a mutagenized fragment was generated by exchanging the first nucleotide for guanosine in the codons of K653 and Q655 (Zheng et al., 2010). The mutagenized fragment was then inserted into pTWR-IhogRFP by digestion with Xho1 and NgoMIV.

The construct Fn1-CD8mCherry was generated by amplification of FN1 domain with the primers: 5’AGGCATGCATCAAGTGCTGCACCTG3’ and 5’ACGGTACCCCACCGACTCCTCCAAATG3’. The fragment was then cloned by restriction ligation into the Kpn1 Sph1 sites of the pLOT-CD8-mCherry vector (Harmansa et al., 2015).

Drosophila strains

Request a detailed protocol

The description of mutations, insertions, and transgenes is available at Fly Base (http://flybase.org). The following mutants and transgenic strains were used: tub.Gal80ts, hs-Flp122 (Bloomington Drosophila Stock Centre (BDSC), Indiana, USA; http://flystocks.bio.indiana.edu), hs-FLP (Golic and Lindquist, 1989), dally32 (Franch-Marro et al., 2005), dlp20 (Franch-Marro et al., 2005), ttv524 (Takei et al., 2004), botv510 (Takei et al., 2004), boi (Zheng et al., 2010), and ihogZ23 (Zheng et al., 2010). The reporter lines used were as follows: Bac Hh:GFP (Chen et al., 2017), Bac ihog:GFP (Hsia et al., 2017), and dally-trap-YFP (Lowe et al., 2014).

Overexpression experiment

Request a detailed protocol

The following Gal4 and LexA drivers were used for ectopic expression experiments using Gal4/UAS (Brand and Perrimon, 1993) and LexA/LexAop (Yagi et al., 2010) systems: hh.Gal4 (Tanimoto et al., 2000), ptc.Gal4 (Hinz et al., 1994), ap.Gal4 (Calleja et al., 1996), and ap.LexA. The transgene act>y+>Gal4 (Pignoni and Zipursky, 1997) was used to generate random ectopic clones of the UAS lines. Larvae of the corresponding genotypes were incubated at 37°C for 12 min to induce hs-Flp-mediated recombinant clones. We use the tub-Gal80ts for the transient expression of transgenic constructs with the UAS/Gal4 system. Fly crosses were maintained at 17°C and dissected after inactivation of the Gal80ts repressor for 24 hr at restrictive temperature (29°C).

The UAS-transgenes used were as follows: UAS.GMA-GFP (Bloor and Kiehart, 2001), UAS.ihog-RFP (Callejo et al., 2011), UAS.ihog-CFP (Bilioni et al., 2013), UAS.ihogΔCT-RFP, UAS.ihogΔFN-RFP, UAS.ihogΔIg-RFP, UAS.ihogΔFn1-RFP, UAS.ihogΔFn2-RFP, UAS.ihogFn1***-RFP, UAS.ihogFn2**-RFP, UAS.ihogCT-RFP, UAS.boi-YFP (Bilioni et al., 2013), UAS.ihog-RNAi (VDRC 102602), UAS.boi-RNAi (VDRC 108265), UAS.dlp-RNAi (VDRC 10299), and UAS.dally-RNAi (VDRC 14136). UAS.ihogFn2** (Zheng et al., 2010), referred as (UAS.ihogFN2* in their study) were also used as controls to test whether or not they gave the same results as the expression of the same Ihog RFP-tagged forms and certainly they gave the same phenotypes in all the experiments.

Clonal analysis

Request a detailed protocol

Mutant clones were generated by heat shock Flp-mediated mitotic recombination.

For wing imaginal disc dissection, individuals grown at 17°C were incubated at 37°C for 45 min 48–72 hr after egg laying (AEL). The genotypes were as follows:

  • y w hsFlp122/BacihogGFP; dally32 dlp20 FRT2A / Ubi.RFP FRT2A.

  • y w hsFlp122/BacihogGFP; dally32 FRT2A / Ubi.GFP FRT2A.

  • y w hsFlp122/BacihogGFP; dlp20 FRT2A / Ubi.GFP FRT2A.

  • y w hsFlp122, boi/Y; ihogZ23 FRT40A / Ubi.RFP FRT40.

  • y w hsFlp122, boi/Y; ihogZ23 FRT 40A / Ubi.RFP FRT40; dally trap-YFP.

Immunostaining of imaginal discs

Request a detailed protocol

Immunostaining was performed according to standard protocols (Capdevila and Guerrero, 1994). Imaginal discs from third-instar larvae were fixed in 4% paraformaldehyde in PBS for 20 min at room temperature (RT) and permeabilized in PBS 0.1% Triton (PBT) before incubating with PBT 1% BSA for blocking (1 hr at RT) and then with the primary antibody (overnight at 4°C). Three washes at RT for 15 min and incubation with the appropriate fluorescent secondary antibodies (ThermoFisher) at a 1:400 dilution for 1 hr at room temperature and then washing and mounting in mounting media (Vectashield). Primary antibodies were used at the following dilutions: mouse monoclonal α-Ptc (Capdevila and Guerrero, 1994; Hybridoma Bank Iowa), 1:30; mouse monoclonal α-Dlp (Lum et al., 2003b; Hybridoma Bank, Iowa), 1:30; rabbit polyclonal α-GFP (Molecular Probes, α−6455), 1/1000; rabbit polyclonal α-Ihog (Bilioni et al., 2013), 1:100; mouse monoclonal α-En (Patel et al., 1989), 1:100; rabbit polyclonal α-Boi (Bilioni et al., 2013), 1:30; and rat monoclonal α-Ci (Motzny and Holmgren, 1995): a gift from (B. Holmgren) 1:20.

Microscopy and image processing of wing imaginal discs

Request a detailed protocol

Laser scanning confocal microscope (LSM710 Zeiss) was used for confocal fluorescence imaging of wing imaginal discs. ImageJ software (National Institutes of Health) was used for image processing and for image analysis.

Profiles of Ihog, Boi, Dlp, Dally, and Hh were made taking intensity gray values of a dorso-ventral region of the wing disc and normalizing to the mean gray value of the ventral compartment.

Profiles of Ptc and Ci were obtained taking intensity gray values of an anterior–posterior region in both ventral (experimental data) and dorsal compartment (control data). For the normalization of each profile, we subtracted the background using the average value of the posterior compartment and then normalized the data to the minimum value of the anterior compartment.

In vivo imaging of pupal abdominal histoblast nests

Request a detailed protocol

Imaging of abdominal histoblasts of 30 hr after puparium formation pupae was done using a chamber as described in Seijo-Barandiarán et al., 2015. Hh signaling filopodia from histoblasts of dorsal abdominal segment A2 were filmed using 40x magnification taking Z-stacks of around 30 μm of thickness with a step size of 1 μm every 1 or 2 min, depending on the experiment, using a LSM710 confocal microscope. All movies were analyzed with Fiji. All imaged pupae developed and hatched normally.

Quantification method and numerical analysis of glypicans and Hh recruitment

Request a detailed protocol

To statistically compare the glypicans and Hh recruitment under the different Ihog constructs, we measured the fluorescence intensity in the dorsal compartment of the disc and normalizing to the value of intensity in the ventral compartment (internal control). For Dally analysis, we measured six to seven discs overexpressing the following constructs (data is available at Figure 2—source data 1): UAS.ihog-RFP, n=7; UAS.ihogΔFn-RFP, n=6; UAS.ihogΔFn1-RFP, n=7; UAS.ihogΔFn2-RFP, n=7; and UAS.ihogFn1***-RFP, n=6. For Dlp analysis, we measured five to seven discs overexpressing the following constructs (data is available at Figure 2—source data 2): UAS.ihog-RFP, n=7; UAS.ihogΔFn-RFP, n=7; UAS.ihogΔFn1-RFP, n=7; UAS.ihogΔFn2-RFP, n=7; and UAS.ihogFn1***-RFP, n=5. For Hh analysis, we measure six to seven discs overexpressing the following constructs (data is available at Figure 3—source data 1): UAS.ihog-RFP, n=7; UAS.ihogΔFn-RFP, n=7; UAS.ihogΔFn1-RFP, n=7; UAS.ihogΔFn2-RFP, n=6; UAS.ihogFn1***-RFP, n=7; and UAS.cd8.Fn1-Cherry, n=7.

Next, we performed a statistical analysis of the normality of the data employing Shapiro test in the free software R-Studio to analyze the differences between means using the T-test for normal data and the Wilcox test for non-normal data. The R-Studio code is available at Source code 1. p-values of the analysis are shown in the next three tables.

Quantification method and numerical analysis of cytoneme dynamics

Request a detailed protocol

To statistically compare the cytoneme lifetime when boi and ihog expression is altered, we used the method described in González-Méndez et al., 2017, tracking cytonemes with the GMA-GFP signal (hh.Gal4 tubG80ts UAS.ihog-RFP UAS.GMA-GFP n=4; hh.Gal4 UAS.GMA-GFP n=6; hh.Gal4 UAS.Boi-YFP/UAS.GMA-GFP n=2; hh.Gal4 UAS.boi-RNAi UAS.ihog.RNAi UAS.GMA-GFP n=7). Data is available at Figure 5—source data 1.

Cytonemes were tracked using MTrackJ plugin of ImageJ (https://imagescience.org/meijering/software/mtrackj/). We took the base (track#1) and the tip (track#2) point coordinates of each cytoneme (cluster) and colored them by cluster, so that each cytoneme would be in a different color. The tracking was done in a region of 49 μm x 76 μm for GMA cytoneme dynamics.

To statistically compare the cytoneme lifetime when the Ihog proteins, either the wild-type or the mutant forms, are expressed ectopically, we manually quantified the frames in which cytonemes had been observed tracking the GMA-GFP signal. For each condition, we scored three to five pupae and between 10 and 20 cytonemes per pupa (hh.Gal4 tubG80ts UAS.ihogΔCt-RFP/UAS.GMA-GFP n=3; hh.Gal4 tubG80ts UAS.ihogCt-RFP/UAS.GMA-GFP n=4; hh.Gal4 tubG80ts UAS.ihogΔIg-RFP/UAS.GMA-GFP n=5; hh.Gal4 tubG80ts UAS.ihogΔFn-RFP/UAS.GMA-GFP n=5; hh.Gal4 tubG80ts UAS.ihogΔFN1-RFP/ UAS.GMA-GFP n=6; hh.Gal4 tubG80ts UAS.ihogΔFN2-RFP/UAS.GMA-GFP n=4; hh.Gal4 tubG80ts UAS.ihogFN1***-RFP/UAS.GMA-GFP n=4; hh.Gal4 tubG80ts UAS.ihogFN2**-RFP/UAS.GMA-GFP n=5; hh.Gal4 tubG80ts UAS.ihogFN2**/UAS.GMA-GFP n=5). Data is available at Figure 5—source data 1.

The manual quantification of the data was stored in an excel file and uploaded in a Matlab script. The Matlab script was designed to organize the data, to compute the statistical analysis, and to represent the results in different violin plots (Figure 5), and is available at Source code 2.

For genotypes showing only dynamic cytonemes, the statistical analysis was done using their numerical lifetimes. To examine the normality of the data distribution, we performed a Shapiro–Wilk test. Since the results showed a non-parametric distribution of the experimental data, we selected a Wilcoxon rank sum test to compare the numerical lifetimes between two genotypes. The resulting p-values can be seen in Tables 4 and 5.

Table 4
Statistical analysis of the lifetime for different Ihog levels.

p-values obtained from Wilcoxon rank sum test to statistically compare cytoneme lifetimes for different levels of Ihog (n.s, not significant, in gray; significant with the corresponding p-value in scientific notation, in orange).

Wilcoxon rank sum testUAS.GMA-GFPUAS.RNAi-boi UAS.RNAi-ihog
UAS.boi-YFPn.sn.s
UAS.GMA-GFP5.00E-02
UAS.RNAi-boi;UAS.RNAi-ihog
Table 5
Statistical analysis of the lifetime for different Ihog mutants.

p-values obtained from Wilcoxon rank sum test to statistically compare cytoneme lifetimes for different Ihog mutants with the control (UAS.GMA-GFP) (gray: n.s = not significant; orange: significant, with the corresponding p-value in scientific notation).

Wilcoxon rank sum testUAS.ihogCt-RFPUAS.ihogDIg-RFPUAS.ihogDFN-RFPUAS.ihogDFN1-RFPUAS.ihogDFN2-RFPUAS.GMA-GFP
UAS.ihogCt-RFPn.s7.23E-06n.sn.sn.s
UAS.ihogDIg-RFP6.06E-04n.sn.sn.s
UAS.ihogDFN-RFP9.30E-042.05E-05
UAS.ihogDFN1-RFPn.sn.s
UAS.ihogDFN2-RFPn.s
UAS.GMA-GFP

For genotypes showing both static and non-static cytonemes, we defined a no numerical case to quantify the frequency of static cytonemes. As a result, we obtained ‘mixed’ violin plots representing the distribution of the lifetime of the whole cytoneme population.

Western blot analysis

Request a detailed protocol

The expression levels of the proteins induced by the UAS constructs were analyzed by western blotting (Figure 2—figure supplement 1). Protein extracts from third-instar larvae of tubGal4/tubGal80ts;UAS.ihog.RFP/+, tubGal4/tubGal80ts;UAS.ihogCT-RFP/+, tubGal4/tubGal80ts;UAS.ihogΔIg-RFP/+,tubGal4/tubGal80ts;UAS.ihogΔFn-RFP/+, tubGal4/tubGal80ts;UAS.ihogΔFn1-RFP/+, and tubGal4/tubGal80ts;UAS.ihogΔFn2-RFP/+ genotypes were prepared in lysis buffer containing protease inhibitors. The samples were re-suspended in sample buffer with β-mercaptoethanol and subjected to 1 D SDS–PAGE (8%) and western blotting. Blotted membranes were probed with the anti-RFP (1:5000 rabbit polyclonal Chromoteck). Blots were incubated with fluorescent α-rabbit (680RD) secondary antibody (Li-Cor) and imaged with the 364-Odyssey equipment.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

Decision letter

  1. Steffen Scholpp
    Reviewing Editor; University of Exeter, United Kingdom
  2. Didier YR Stainier
    Senior Editor; Max Planck Institute for Heart and Lung Research, Germany

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

In general, the revised version of the manuscript has improved substantially. The structure is clear, and the experiments are ordered in a logical way. The re-organisation of the results has improved readability. The authors have introduced new figures and eliminated those which were unnecessary. Overall, I think this is an excellent manuscript.

Decision letter after peer review:

Thank you for submitting your article "Glypicans specifically regulate Hedgehog signaling through their interaction with Ihog in cytonemes" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Didier Stainier as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

In summary, this manuscript elucidates the function of Glypicans in Hh transport via cytonemes. The reviewers felt that the manuscript describes convincingly that the fly glypicans Dally and Dally-like are required to maintain the expression of the Hh co-receptor Ihog, which stabilises cytonemes to establish the Hh gradient in the wing imaginal disc. A molecular analysis of Ihog domains was well executed.

Although the manuscript provides an in-depth analysis, the reviewers believe that the presentation of the data is rather challenging for the readers. The authors need to clearly describe the different roles that have been attributed to the glypicans and for every experiment presented, a clear explanation of the impact of the results is needed e.g. Figure 5. In addition, the stability of Ihog and Boi by altered Glypican levels and their ability to stabilize cytonemes needs to be investigated. Finally, linking the Ihog analysis to cytoneme stability analysis needs improvement.

The detailed criticisms of the reviewers are listed below:Reviewer #1:

In the article "Glypicans specifically regulate Hedgehog signalling through their interaction with Ihog in cytonemes" Simon et al., elucidate the function of Glypicans in Hh transport via cytonemes. The manuscript describes convincingly that the fly glypicans Dally and Dally-like are required to maintain the expression of the Hh co-receptor Ihog. Ihog – in turns – stabilises Hh cytonemes through its interaction with Glypicans to establish the Hh gradient in the wing imaginal disc. The authors further carried out an extensive molecular analysis of Ihog and identified the relevant domains within the protein required for interactions with Glypicans, Patched, and Hh. In general, this is a very thorough, detailed analysis of Ihog function. The images and videos are excellent. However, prior publication, there are two major criticisms, which needs to be addressed, in my opinion.

Firstly, the first part of the manuscript, the molecular analysis of Ihog (Figure 1-4) seems to be detached from the second cytoneme-focussed part (Figure 5, 6). Independent evidence is needed to show support for the idea that the Ihog-Gly mediated stabilisation of cytonemes is responsible for the expansion of the signalling gradient. Are the static cytonemes involved in a flattened gradient or are the receiving cells just sensitised for Hh? Can cytonemes be (de-) stabilised w/o interfering with Hh components to untangle these observations?

The authors write "Intriguingly, the same Ihog domains that regulate cytoneme dynamics are those also involved in the recruitment of Hh ligand, glypicans and the reception complex. "

My concern is that cytoneme dynamics and Hh gradient formation could be two parallel, independent events -> one needs to show this interdependency in a clear way. I could imagine an analysis of the consequences when Ihog is overexpressed, and cytoneme formation is inhibited (by other means). Consistently, could one stabilise cytonemes in an Ihog-reduced background and analyse gradient formation?

Secondly, the authors demonstrate an effect of Ihog alterations on the formation of the gradient. However, what is the physiological relevance? What are the consequences of Ihog/Gly-mediated cytoneme stabilisation and gradient formation on tissue patterning and wing formation? If this is not possible to show experimentally, this needs to be discussed.

Specific comments:

First, the authors describe the interaction between Ihog and Dally/Dally-like. They make use of the double mutants to show that Dally/Dlp are required for stabilisation of Ihog in the wing imaginal disc. Here it would be essential to strengthen the statement that Ihog is stabilised by glypicans. Can the authors provide supporting evidence e.g. biochemical ones?

Next, in an exquisite set of experiments, the authors demonstrate that the FN1 and FN2 domains are required for glypican stabilisation. The Western blot analysis – to demonstrate the different weight of the constructs- needs improvement or at least the authors need to provide alternative evidence.

The authors then analyse the interaction of Ihog with Hh and glypicans by using specific constructs with point-mutation in the FN1 or FN2 domain. This is an excellent set of data and shows very convincingly that FN1 (D558N, N559S, E561Q) is vital for Hh retention but not for interaction with glypicans. These experiments show that specific amino-acids of FN1 interact with glypicans, and these are different from those that carry out the Ihog -Hh interaction.

Next, the authors investigate the implication in Hh gradient formation. Again, the set of experiments is well documented. However, in Figure 4F, the authors show the activation of Ptc directly at the border zone. To my understanding, the interaction with Hh should not be permitted in this experiment and target genes should not be induced. So, it is unclear to me why the authors observe restricted but quite strong Ptc expression. The authors need to explain this observation. Would an independent TC approach help to elucidate signalling capability of Ihog-FN1***?

The authors claim that the stabilisation of Ihog-bearing cytonemes is glypican-dependent. The movies and the still pictures present in Figure 5 are challenging to interpret. The clone sizes are variable, and the authors claim that larger and smaller clones show different results. Furthermore, it is unclear to me why the authors use for this experiment the ttv/botv mutant instead of the dally/dlp mutant. The author should add these experiments or explain why this is not possible.

The videos accompanying Figure 6 are compelling and show the role of Ihog domains in the regulation of cytoneme dynamics, however, require a better explanation.

The discussion is well structured. However, there is data showing that glypicans can regulate secretion and stability of Hh. The authors need to discuss these findingsReviewer #2:

This manuscript interrogates function of Ihog and Boi adhesion molecules in cytoneme-based transport of the Hedgehog morphogen in Drosophila. The cell biology of how cytonemes are regulated to deliver morphogen signals is not yet well understood, so the work addresses an important topic that will be of interest to a broad audience. However, much of the study refines previous work from the same group to provide only a modest advance in understanding of how Ihog impacts cytoneme behavior.

The authors use genetic strategies in Drosophila to investigate how Ihog and Boi influence cytoneme dynamics. They find that the two proteins act differently with regard to cytoneme function. Boi effects are not exhaustively analyzed, but a number of genetic experiments are performed to interrogate Ihog. The authors reveal that the extracellular domains of Ihog interact with the glypicans Dally and Dlp to stabilize cytonemes that originate from Ihog over-expressing cells. Knockdown of Ihog does not alter cytoneme dynamics.

The most novel aspect of the study – that Boi functions differently than Ihog in cytonemes – is, unfortunately, not expanded upon. Some experiments lack controls or are presented in a manner that prevents clear interpretation of results. Thus, the study appears too preliminary for publication at this time.

Key points to be addressed:

Figure 1: Null alleles and RNAi silencing are used interchangeably to reduce Ihog, Boi, Dally and Dlp function in vivo. Results between methods are directly compared. Oftentimes, controls are not included to confirm the level of knockdown following RNAi. If possible use null alleles due to consistency. However, if this is not possible due to experimental reasons, give an explanation and state impact in the discussion.

Ihog levels decrease following loss of Dally or Dlp and Boi levels appear to increase following knockdown of Ihog, Dally, or Dlp. These stability changes have previously been reported. The mechanism is not clear, so should have been investigated here – especially the increased Boi protein level. How does this occur? Is stabilization occurring at the protein level or is gene expression changing? Is this a compensatory upregulation?

Based upon the supplement for Figure 2, it looks like the Ihog truncation mutants show variable stability. Might this be affecting the extent to which they alter Dally or Dlp stability? The western blot data are presented as crops of single bands adjacent to crops of a molecular weight ladder. Blots should be shown as intact images, preferable with all variants compared across a single gel with a loading control. As presented, relative stability/expression levels are impossible to assess.

Figures 3-4: Ihog mutant transgenes are tagged with either HA or RFP. Best to be consistent with tags when mutant function is being directly compared. Given that the HA tag is a small epitope and the RFP is a protein tag, they may differentially alter protein functionality. To be consistent it would be preferable to use the same tags. However, if this is not possible due to experimental reasons, the technical implication can also be mentioned in the discussion.

Figure 5: Investigation of histoblast cytonemes reaching into ttv, botv mutant clones: The ability of cytonemes to invade double mutant clones is altered only under the engineered situation of glypican dysfunction combined with Ihog over-expression. From this, it is concluded that Ihog is acting with glypicans to stabilize cytonemes. This may be the case, but they ability to see it only under an engineered situation of compound mutation plus Ihog over-expression leads this review to question the physiological relevance of the observation. Of similar concern is that the authors state the ability of Ihog over-expressing cell cytonemes to cross small vs. large ttv, botv clones differs. The difference is very difficult to appreciate from the results presented.

Figure 6: The apparent functional difference between Ihog and Boi in the ability to stabilize cytonemes is potentially very interesting, but is not investigated, which limits the advance of the current study.Reviewer #3:

The glypicans Dally and Dlp have important roles in morphogen signaling, and this work is of particular interest for me because it significantly advances our understanding of the multiple roles they appear to have in signal processing, signal presentation and signal reception. It is unfortunate that most of the literature has presented results and phenotypes in simplistic or simple-minded ways that do not recognize the different roles or the glypicans, or do not take experimental approaches that might distinguish them. This work of the Guerrero lab is an exception, as it is an important contribution to understanding these different roles, especially given the additional complexity introduced by the role of cytonemes. If its thoroughness and in-depth analysis are typical of work from this lab, so is the challenging presentation that makes understanding it so difficult. My recommendation to the authors is to clearly describe the different roles that have been attributed to the glypicans and for every experiment they present, clearly articulate how the results might implicate or distinguish any or several of them.

Although the figures are excellent, the manuscript is not well-written and would benefit from a complete rewrite, perhaps with the help of a native English-speaker. The following suggested changes should be taken only as examples that demand improvement.

Ln 55 "and it have been described a spatial and temporal correlations between Hh gradient" not grammatically correct.

Ln 91 "Ihog and Boi are also independently needed for the maintenance of normal Hh levels in Hh-producing cells (Yan et al., 2010)." I do not understand the meaning of "independently needed".

Ln 115 "Previous works have already described a genetic interaction between Ihog, Boi and Dlp (Yao et al., 2006)" It would help if the "genetic interactions" were explained. The Yao et al. reference (a Lis Heat Shock study) may be incorrect?

Ln 119 "Conversely, in double ttv-/- botv-/- mutant clones, responsible of synthesizing the Heparan Sulfate chains of the glypicans Dally and Dlp," This sentence reads that the mutant clones are responsible for synthesizing HS?

Ln 124 "this effect on Ihog requires of both Dally and Dlp proteins" Isn't the effect a consequence of lack of Dally and Dlp?

Ln 149 It might help if the term "build up effect" were defined and if were clearly stated that overexpression of Dally/Dlp increases Ihog levels and overexpression of Ihog increases Dally/Dlp levels.

Ln 152 The term "accretion" has a specific meaning relating to time dependence of increase that is not relevant here. Always better to use the simplest possible terms – nothing wrong with "increase"?

ln 168 Previous work from the Guerrero lab showed that extracellular Hh at the apical and basolateral plasma membranes represent different pools with respect to Hh trafficking in the Hh-producing cells. Please clarify which pool (or pools) the Ihog-driven increases represent.

Ln 177" This result, together with the fact that deletion of neither Fn1 nor Fn2 accumulates Dlp and slightly increase Dally levels (Figure 3E,E' and F,F'), suggests the Ihog Fn1-Hh recruitment also needs Ihog-glypican interaction." I do not understand this sentence.

Ln 190 "indicating that the Fn1 amino-acids that interact with glypicans are specific and different from those that carry out the Ihog-Hh interaction" I don't follow why this result shows that the interacting glypican amino acids are specific – not the ones implicated in Hh binding, so clearly different, but why specific?

Ln 213 Figure 3H?

Ln 226 "indicating that might be the presentation of Ptc to the membrane is disturbed" Is this justified given the multiple roles of Ihog/HSPGs in both Hh-producing and Hh-receiving cells?

Ln 235 "normal reception in the first cell row adjacent to the compartment border" Might this be a consequence of the low expression level of ptcGal4 in the first row?

Ln 252 "Ihog-glypicans interactions could be key regulators of cytoneme dynamics and their signaling function" Regulation is not synonymous with requirement and it is my understanding that a the glypicans have been shown to be required.

Ln 260 I am not sure what can be done to help the reader focus on the features of interest in the videos but I found the videos to be difficult if not impossible to evaluate.

Ln 275 "while glypicans might not directly influence cytoneme formation, they have an effect on their dynamics in trans, maybe regulating Ihog presence in opposing cytonemes" It is not apparent to me why the effects on cytoneme presence justifies the proposal that glypicans regulate Ihog in trans.

Ln 304 Isn't it important to distinguish between Ihog at normal levels and the phenotypes associated with Ihog overexpression?

Ln 32 "in the wing imaginal disc long cytonemes are only observed in those cases in which cytonemes are stabilized in histoblasts" Do the authors mean "conditions" (not cases)?

Ln 319 "This unexpected cytoneme behavior indicates that the absence of the Ig domain of Ihog might be affecting an interaction with an unknown extracellular matrix component also necessary for cytoneme stabilization" The authors may want to consider that the observed differences may be a consequence of quantitative rather than qualitative differences.

Ln 325 "ectopic expression of Boi fails to stabilize cytonemes" Better: over-expression of Boi does not stabilize cytonemes?

Ln 332 "Ihog induced cytoneme extension and stability is regulated by Ihog-glypican interactions" Better: Ihog induced cytoneme extension and stability is dependent on Ihog-glypican interactions?

Ln 341 "These data indicate that wild-type cells do not require these adhesion molecules to produce dynamic cytonemes." Because the data and phenotypes are based on experimental conditions that what might be revealing quantitative parameters, I do not agree that this strong conclusion is justified.

Figure 7 I do not understand why this model focuses only on the receiving cell when so much of the presented data is for the producing cells.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Glypicans define unique roles for the Hedgehog co-receptors Boi and Ihog in cytoneme-mediated gradient formation" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors and the evaluation has been overseen by Didier Stainier as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Stacey K Ogden (Reviewer #2).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. All reviewers found that the manuscript was significantly improved, but also made some additional suggestions which we would like you to consider.Reviewer #1:

In general, the revised version of the manuscript has improved substantially. The structure is clear, and the experiments are ordered in a logical way. The re-organisation of the results has improved readability. The authors have introduced new figures and eliminated those which were unnecessary. Overall, I think this is an excellent manuscript, with only a few further suggestions.

For me, the main question remains: is iHog (specifically via the FNIII domains) directly involved in cytoneme stabilisation or indirectly via stabilisation of Hh and/or Glypicans. I feel this is an important question to discuss as in the iHog-/- situation, Glypican level on the basolateral side are reduced, which is also the side at which the cytonemes form. In contrast, in Boc mutants, glypicans still accumulate at the basal side, and therefore cytoneme formation is unaltered.

It is very much appreciated that most RNAi experiments have been removed or exchanged by induced null clones. This gives the experimental setting a compelling flow. The improved Western blot analysis is convincing (Figure 2 suppl. 1).

The authors have now tagged all constructs with RFP. This is an enormous effort and very much appreciated. The interpretation that the Fn2-RFP domain is more required explicitly for Dally interaction is good – while Fn1 is equally needed for both Dally and Dlp interaction.Reviewer #2:

The revised manuscript is significantly improved over the initial submission. The authors have addressed reviewer comments with new experiments, and the conclusions of the study are now well supported. I think the more in depth investigation of the differences between ihog and boi have significantly improved the study, and I support its publication in eLife.

Reviewer #3:

This revised manuscript is much improved and contributes a clear and important advance.

https://doi.org/10.7554/eLife.64581.sa1

Author response

Reviewer #1:

Specific comments:

First, the authors describe the interaction between Ihog and Dally/Dally-like. They make use of the double mutants to show that Dally/Dlp are required for stabilisation of Ihog in the wing imaginal disc. Here it would be essential to strengthen the statement that Ihog is stabilised by glypicans. Can the authors provide supporting evidence e.g. biochemical ones?

We have tried to perform π assays between Ihog and glypicans, but we did not succeed to get a biochemical interaction. Although other groups identified a structural region located on the surface of Dlp important to mediate its role in Hh signaling, apparently the core of the purified Dlp protein did not interact appreciably with Hh or with a Hh: Ihog complex (Kim et al., 2011).

In addition, based on our results about the Ihog stabilizing effects observed in double mutant clones for ttv/btv and dally/dlp (Figure 1), we think possible that for the interaction between Ihog and glypicans to be mediated through the sugar chains of HS. These type of interactions may not be very stable and, therefore, difficult to obtain positive results through π assays.

Next, in an exquisite set of experiments, the authors demonstrate that the FN1 and FN2 domains are required for glypican stabilisation. The Western blot analysis – to demonstrate the different weight of the constructs- needs improvement or at least the authors need to provide alternative evidence.

We have done new Western blots showing clearly the different molecular weights of the Ihog mutant constructs. In the revised version of the manuscript a better Western blot is now shown in Figure 2—figure supplement 1.

Next, the authors investigate the implication in Hh gradient formation. Again, the set of experiments is well documented. However, in Figure 4F, the authors show the activation of Ptc directly at the border zone. To my understanding, the interaction with Hh should not be permitted in this experiment and target genes should not be induced. So, it is unclear to me why the authors observe restricted but quite strong Ptc expression. The authors need to explain this observation. Would an independent TC approach help to elucidate signalling capability of Ihog-FN1***?

We thank the Referee for his/her comments on this point. We have repeated the experiments several times to make sure of the activation of Ptc in the first cell row that we had presented in the original version of the manuscript. From the data obtained we conclude that this construct is acting as dominant negative, blocking all Hh responses (Ptc, En and Ci). We have also observed that after Ihog-ΔFN1and Ihog-FN1*** expression the endogenous Ihog protein is much decreased. Although there is still a very mild activation of Ptc in the first cell row, we have not given much importance to this small activation that could be caused by the possible presence of Boi.

The authors claim that the stabilisation of Ihog-bearing cytonemes is glypican-dependent. The movies and the still pictures present in Figure 5 are challenging to interpret. The clone sizes are variable, and the authors claim that larger and smaller clones show different results. Furthermore, it is unclear to me why the authors use for this experiment the ttv/botv mutant instead of the dally/dlp mutant. The author should add these experiments or explain why this is not possible.

For this work, we have considered unnecessary to induce dally/dlp double mutant clones in the histoblast nests, since it is an experiment difficult to do by life imaging. Additionally, we had previously demonstrated in wing imaginal discs the requirement of the HSPG (Bischoff et al., 2013) and of Dally and Dlp (González-Mendez et al., 2017) for the ectopic Ihog stabilizing effect on cytonemes. Therefore, we have eliminated the trans interaction of HSPG and Ihog for cytoneme stability shown originally in Figure 5.

The videos accompanying Figure 6 are compelling and show the role of Ihog domains in the regulation of cytoneme dynamics, however, require a better explanation.

We have tried to better label the presentation of the videos. We have included the appropriated labeling in the movies and we have also included the measurements of cytoneme dynamics in all mutant conditions in a new Figure 5 figure supplement 2.

The discussion is well structured. However, there is data showing that glypicans can regulate secretion and stability of Hh. The authors need to discuss these findings

In the new version of the manuscript we have discussed the functions of Dally and Dlp in Hh secretion and stability. As far as we know, the specific role of Dally in the stability of Hh in the A compartment was first proposed by Han et al., (2004) and in the P compartment by Bilioni et al., (2013). The specific role of Dlp in Hh secretion interacting with Dispatched was proposed by Callejo et al., (2011).

Reviewer #2:

The authors use genetic strategies in Drosophila to investigate how Ihog and Boi influence cytoneme dynamics. They find that the two proteins act differently with regard to cytoneme function. Boi effects are not exhaustively analyzed, but a number of genetic experiments are performed to interrogate Ihog. The authors reveal that the extracellular domains of Ihog interact with the glypicans Dally and Dlp to stabilize cytonemes that originate from Ihog over-expressing cells. Knockdown of Ihog does not alter cytoneme dynamics.

The most novel aspect of the study – that Boi functions differently than Ihog in cytonemes – is, unfortunately, not expanded upon.

We thank the Referee for this comment that has allowed us to further explore these differential functions of Boi and Ihog in Hh signaling. Since we agreed with the referee that this was the most novel aspect of our work, we reoriented the writing of the manuscript basing it on the new results about the differential roles of Boi and Ihog on Hh signaling. Accordingly, we have also changed the title of the manuscript in this regard.

Some experiments lack controls or are presented in a manner that prevents clear interpretation of results. Thus, the study appears too preliminary for publication at this time.

We agree with the Referee that the presentation of some of the results appeared too preliminary. We have tried to improve the presentation of our data by expanding further our results and introducing the appropriated controls and quantifications. We hope that this revised version of the manuscript has been improved in all these aspects.

Key points to be addressed:

Figure 1: Null alleles and RNAi silencing are used interchangeably to reduce Ihog, Boi, Dally and Dlp function in vivo. Results between methods are directly compared. Oftentimes, controls are not included to confirm the level of knockdown following RNAi. If possible use null alleles due to consistency. However, if this is not possible due to experimental reasons, give an explanation and state impact in the discussion.

Since the Referee’s concern is appropriate, we have eliminated the knockdowns following RNAi expression in Figure 1. We have now induced null clones and analyzed the expression of Ihog and Boi in all cases. Therefore, the old Figure 1 figure supplementary 1 has been eliminated in the revised version of the manuscript.

However, the expression of RNAis to silence Ihog and Boi were used in the new Figures 5 and 6. The controls to confirm the knockdown of Ihog and Boi following expression of the RNAis are now shown in Figure 5 figure supplementary 1.

Ihog levels decrease following loss of Dally or Dlp and Boi levels appear to increase following knockdown of Ihog, Dally, or Dlp. These stability changes have previously been reported. The mechanism is not clear, so should have been investigated here – especially the increased Boi protein level. How does this occur? Is stabilization occurring at the protein level or is gene expression changing? Is this a compensatory upregulation?

In fact, we had previously investigated the cause of the slight increase of Boi levels after knocking down Ihog. We had found that it was at the protein level because no boi transcriptional changes were observed using a transcriptional reporter. This is possibly due to compensatory upregulation, but we have not investigated this further.

Based upon the supplement for Figure 2, it looks like the Ihog truncation mutants show variable stability. Might this be affecting the extent to which they alter Dally or Dlp stability?

All Ihog mutant forms show similar levels of expression with the exception of IhogΔIg, which shows lower levels but still accumulate Hh, Dlp and Dally as the full length Ihog. However, the cytonemes are as dynamic as the expression of Ihog FN2 mutants. Therefore, we still think that the differential effects on Dally and Dlp after expressing all mutant forms are specific.

The western blot data are presented as crops of single bands adjacent to crops of a molecular weight ladder. Blots should be shown as intact images, preferable with all variants compared across a single gel with a loading control. As presented, relative stability/expression levels are impossible to assess.

We have done new Western blots, which are presented in the new Figure 2 figure supplement 1.

Figures 3-4: Ihog mutant transgenes are tagged with either HA or RFP. Best to be consistent with tags when mutant function is being directly compared. Given that the HA tag is a small epitope and the RFP is a protein tag, they may differentially alter protein functionality. To be consistent it would be preferable to use the same tags. However, if this is not possible due to experimental reasons, the technical implication can also be mentioned in the discussion.

Following the Referee’s suggestion and to be consistent with the use of the same tag in all the constructs, we made another ΔFn2 transgene tagged to RFP. Besides, Dfn2HA and DFn2-RFP behave similarly regarding the effects concerning Hh interaction, gradient formation and cytoneme dynamics. However, following the quantification of the effects on the accumulation of Dally and Dlp we found that the Fn2-RFP domain is more specifically required for Dally interaction while Fn1 is equally needed for both Dally and Dlp interaction. Only the results obtained using the DFn2-RFP and not of DFn2-HA are presented in the revised version of the manuscript.

Figure 5: Investigation of histoblast cytonemes reaching into ttv, botv mutant clones: The ability of cytonemes to invade double mutant clones is altered only under the engineered situation of glypican dysfunction combined with Ihog over-expression. From this, it is concluded that Ihog is acting with glypicans to stabilize cytonemes. This may be the case, but they ability to see it only under an engineered situation of compound mutation plus Ihog over-expression leads this review to question the physiological relevance of the observation. Of similar concern is that the authors state the ability of Ihog over-expressing cell cytonemes to cross small vs. large ttv, botv clones differs. The difference is very difficult to appreciate from the results presented.

We agree with the referee that the presentation of the results in the old Figure 5 was a bit confusing. Since we had previously demonstrated in wing imaginal discs the requirement of the HSPG (Bischoff et al., 2013) and of the Dally and Dlp (González-Mendez et al., 2017) for the Ihog stabilizing effect on cytonemes, we have eliminated the interaction of HSPG and Ihog shown in the old Figure 5. Obviously, it would have been better to induce dally/dlp double mutant clones in the histoblast nests, but this is an experiment difficult to do by life imaging.

Figure 6: The apparent functional difference between Ihog and Boi in the ability to stabilize cytonemes is potentially very interesting, but is not investigated, which limits the advance of the current study.

We thank the Referee for his/her suggesting and agree that the apparent functional difference between Ihog and Boi was potentially very interesting. We have explored further the interaction of Boi with the glypicans and obtained interesting results that made us to describe the different requirements of Boi and Ihog for the formation of the Hh gradient. The revised version of the manuscript is centered on these results.

Reviewer #3:

Although the figures are excellent, the manuscript is not well-written and would benefit from a complete rewrite, perhaps with the help of a native English-speaker.

We thank the Referee for his/her comments and for the enormous effort in correcting our manuscript. We agree that the original manuscript was not clearly written, the results were not very well organized, and some figures were presented a bit preliminary. We hope that the revised version of the manuscript is improved. We have reorganized our results, introduced new figures and eliminated what was considered unnecessary.

Ln 55 "and it have been described a spatial and temporal correlations between Hh gradient" not grammatically correct

It has been corrected

Ln 91 "Ihog and Boi are also independently needed for the maintenance of normal Hh levels in Hh-producing cells (Yan et al., 2010)." I do not understand the meaning of "independently needed"

It has been corrected

Ln 115 "Previous works have already described a genetic interaction between Ihog, Boi and Dlp (Yao et al., 2006)" It would help if the "genetic interactions" were explained. The Yao et al. reference (a Lis Heat Shock study) may be incorrect?

We have changed the sentence and corrected the error in the reference.

Ln 119 "Conversely, in double ttv-/- botv-/- mutant clones, responsible of synthesizing the Heparan Sulfate chains of the glypicans Dally and Dlp," This sentence reads that the mutant clones are responsible for synthesizing HS?

The sentence has been corrected.

Ln 124 "this effect on Ihog requires of both Dally and Dlp proteins" Isn't the effect a consequence of lack of Dally and Dlp?

The mistake has been corrected.

Ln 149 It might help if the term "build up effect" were defined and if were clearly stated that overexpression of Dally/Dlp increases Ihog levels and overexpression of Ihog increases Dally/Dlp levels

We agree and the term “build up” has been eliminated in the revised version.

Ln 152 The term "accretion" has a specific meaning relating to time dependence of increase that is not relevant here. Always better to use the simplest possible terms – nothing wrong with "increase"?

Accretion has been changed for increase or accumulation in all places.

ln 168 Previous work from the Guerrero lab showed that extracellular Hh at the apical and basolateral plasma membranes represent different pools with respect to Hh trafficking in the Hh-producing cells. Please clarify which pool (or pools) the Ihog-driven increases represent.

We thank the referee for enquiring about the apica/lbasal distribution of the Hh pathway components. The analysis of the differential apical o basal accumulation of Dally and Dlp in the disc epithelium after the ectopic expression of Ihog and Boi indicates, together with the rest of the data, a differential requirement of these two proteins: Ihog more basal and in cytonemes while Boi more apical and not able to regulate cytoneme dynamics. These experiments indicate a unique function of each of the two Hh co-receptors, being Ihog the one needed for cytoneme-mediated long-range Hh gradient formation.

Ln 177" This result, together with the fact that deletion of neither Fn1 nor Fn2 accumulates Dlp and slightly increase Dally levels (Figure 3E,E' and F,F'), suggests the Ihog Fn1-Hh recruitment also needs Ihog-glypican interaction." I do not understand this sentence.

We have changed the sentence, since the results about the role of Fn1 and Fn2 in the glypican interactions are clearer in the new version of the manuscript.

Ln 190 "indicating that the Fn1 amino-acids that interact with glypicans are specific and different from those that carry out the Ihog-Hh interaction" I don't follow why this result shows that the interacting glypican amino acids are specific – not the ones implicated in Hh binding, so clearly different, but why specific?

We have changed this confusing sentence.

Ln 213 Figure 3H?

The numbers that correspond to each figure have been changed.

Ln 226 "indicating that might be the presentation of Ptc to the membrane is disturbed" Is this justified given the multiple roles of Ihog/HSPGs in both Hh-producing and Hh-receiving cells?

Since the result on Hh gradient was analyzed expressing the constructs in the A compartment we cannot argue about their effect in the Hh presenting cells.

Ln 235 "normal reception in the first cell row adjacent to the compartment border" Might this be a consequence of the low expression level of ptcGal4 in the first row?

We have repeated the experiments several times to make sure of the activation of Ptc in the first cell row that we had presented in the original version of the manuscript. From the data obtained we conclude that this construct is acting as dominant negative, blocking all Hh responses (Ptc, En and Ci). We have also observed that after Ihog-ΔFN1and Ihog-FN1*** expression the endogenous Ihog protein is much decreased. Although there is still a very mild activation of Ptc in the first cell row, we have not given much importance to this small activation that could be caused by the possible presence of Boi. The panels of the corresponding old version of the figure have been changed and new data have been introduced in a new Figure 4.

Ln 252 "Ihog-glypicans interactions could be key regulators of cytoneme dynamics and their signaling function" Regulation is not synonymous with requirement and it is my understanding that a the glypicans have been shown to be required.

Our experiments shown in the old Figure 5 indicated that cytonemes were still formed in the absence of glypicans but they were required for Ihog induced cytoneme stabilization. Therefore, we can only say that Ihog-glypicans interactions could be key regulators of cytoneme dynamics and their signaling function.

Ln 260 I am not sure what can be done to help the reader focus on the features of interest in the videos but I found the videos to be difficult if not impossible to evaluate.

We have tried to better label the presentation of the videos. We have included the appropriated labeling in the movies with arrows to follow cytoneme dynamics and we have also included the measurements of cytoneme dynamics in all mutant conditions in a new Figure 5 figure supplement 2.

Ln 275 "while glypicans might not directly influence cytoneme formation, they have an effect on their dynamics in trans, maybe regulating Ihog presence in opposing cytonemes" It is not apparent to me why the effects on cytoneme presence justifies the proposal that glypicans regulate Ihog in trans.

The role of glypicans as regulators of Ihog presence in cytonemes in trans has been eliminated from the results and discussion. The old Figure 5 showed that cytonemes were formed and navigated with a normal dynamics when encounter double ttv/btv mutant clones (we called this a trans interaction). Since we consider that the cis and trans interaction of Ihog and glypicans is confusing and it is not the main message of our work we decided to eliminate these data. Besides, that the HSPG were required in trans for the presence of ectopic Ihog in cytonemes in wing discs was already demonstrated in Bischoff et al., 2013.

Ln 304 Isn't it important to distinguish between Ihog at normal levels and the phenotypes associated with Ihog overexpression?

All cytonemes labelled with GMA-GFP are also marked with Ihog-RFP or with the different Ihog-RFP mutant forms in the same vidoe (González-Méndez, Seijo-Barandiarán and Guerrero, 2017). Unfortunately, it is impossible to distinguish between cytonemes expressing Ihog at normal levels and cytonemes overexpressing the Ihog or the Ihog mutant forms in the same video.

Ln 32 "in the wing imaginal disc long cytonemes are only observed in those cases in which cytonemes are stabilized in histoblasts" Do the authors mean "conditions" (not cases)?

The Referee is right, we meant conditions.

Ln 319 "This unexpected cytoneme behavior indicates that the absence of the Ig domain of Ihog might be affecting an interaction with an unknown extracellular matrix component also necessary for cytoneme stabilization" The authors may want to consider that the observed differences may be a consequence of quantitative rather than qualitative differences.

It may be possible that the effect on dynamics could be a consequence of the lower expression levels of this Ig domain deficient construct. We have introduced this possibility in the discussion of the new version of the manuscript.

Ln 325 "ectopic expression of Boi fails to stabilize cytonemes" Better: over-expression of Boi does not stabilize cytonemes?

It has been changed.

Ln 332 "Ihog induced cytoneme extension and stability is regulated by Ihog-glypican interactions" Better: Ihog induced cytoneme extension and stability is dependent on Ihog-glypican interactions?

The sentence has been corrected.

Ln 341 "These data indicate that wild-type cells do not require these adhesion molecules to produce dynamic cytonemes." Because the data and phenotypes are based on experimental conditions that what might be revealing quantitative parameters, I do not agree that this strong conclusion is justified.

Maybe this sentence is not justified. However, if this is the case, we do not think that it would be a major problem. The dynamic of cytonemes could be modulated by multiple intrinsic and extrinsic factors.

Figure 7 I do not understand why this model focuses only on the receiving cell when so much of the presented data is for the producing cells.

We do not agree with the Referee in this point. The work is focused on both receiving and producing cells.

The effect on glypicans is analyzed in both compartments, in random clones or using ApGal4. The effect on Hh in the P compartment was also analyzed using ApGal4. The effect on dynamics is presented using Hh Gal4 but the effect is similar when using Ptc-Gal4. Finally, the effect on Hh reception was done expressing the Ihog mutants in the receiving cells. Altogether these results show that ectopic Ihog induced cytoneme

stability is dependent on Ihog-glypican interactions and that the two Ihog FNIII domains (which are also responsible for the Ihog-glypicans interaction) have a predominant role in this stabilization.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Reviewer #1:

For me, the main question remains: is iHog (specifically via the FNIII domains) directly involved in cytoneme stabilisation or indirectly via stabilisation of Hh and/or Glypicans. I feel this is an important question to discuss as in the iHog-/- situation, Glypican level on the basolateral side are reduced, which is also the side at which the cytonemes form. In contrast, in Boc mutants, glypicans still accumulate at the basal side, and therefore cytoneme formation is unaltered.

We conclude that the FNIII domains of Ihog recruit glypicans at the basolateral side of the epithelium where cytonemes are formed. This Ihog interaction with glypicans could regulate cytoneme behavior and these interactions provide glypican specificity for Hh signaling as well as a key function for Hh gradient formation.

https://doi.org/10.7554/eLife.64581.sa2

Article and author information

Author details

  1. Eléanor Simon

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Experimental Data, Data interpretation, Methodology, in vivo imaging, Writing and editing
    Contributed equally with
    Carlos Jiménez-Jiménez
    Competing interests
    No competing interests declared

  2. Carlos Jiménez-Jiménez

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Experimental data, Data interpretation, Formal analysis and quantification, in vivo imaging, Validation, Methodology, Writing - review and editing
    Contributed equally with
    Eléanor Simon
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9848-184X

  3. Irene Seijo-Barandiarán

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Experimental data, Data Interpretation, Methodology, in vivo imaging, Writing - review and editing
    Competing interests
    No competing interests declared

  4. Gustavo Aguilar

    1. Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    2. Growth and Development, University of Basel, Biozentrum, Switzerland
    Contribution
    Experimental data, Tool generation, Data interpretation, Writing - review and editing
    Competing interests
    No competing interests declared

  5. David Sánchez-Hernández

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Experimental data and tool generation
    Competing interests
    No competing interests declared

  6. Adrián Aguirre-Tamaral

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Formal analysis and quantifications
    Competing interests
    No competing interests declared

  7. Laura González-Méndez

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Experimental data
    Competing interests
    No competing interests declared

  8. Pedro Ripoll

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Genetic tools, Writing - review and editing
    Competing interests
    No competing interests declared
    Additional information
    Retired CSIC Research Professor

  9. Isabel Guerrero

    Tissue and Organ Homeostasis, Centro de Biología Molecular "Severo Ochoa" (CSIC-UAM), Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, Spain
    Contribution
    Study design, Methodology, Formal analysis, Resources, Supervision, Funding acquisition, Validation, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    iguerrero@cbm.csic.es
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6761-1218

Funding

Ministerio de Economía y Competitividad (BFU2014-59438-P)

  • Eléanor Simon
  • Irene Seijo-Barandiarán
  • Gustavo Aguilar
  • David Sánchez-Hernández
  • Adrián Aguirre-Tamaral
  • Laura González-Méndez
  • Isabel Guerrero

Ministerio de Ciencia, Innovación y Universidades (BFU2017-83789-P)

  • Eléanor Simon
  • Carlos Jiménez-Jiménez
  • David Sánchez-Hernández
  • Laura González-Méndez
  • Isabel Guerrero

Ministerio de Ciencia, Innovación y Universidades (RED2018-102411-T)

  • Isabel Guerrero

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We are grateful to Ana-Citlali Gradilla and Nicole Gorfinkiel for their invaluable advice and comments on the manuscript and to Marcus Bischoff for his expertise and advice in setting up the in vivo imaging of the abdominal histoblasts in our lab and for hosting IS-B to learn to do it. We thank T Kornberg, X Zheng, P Beachy, M Bischoff, JP Vincent, and R Holmgren for stocks and reagents and to X Zheng for her help in the characterization of Ihog mutant constructs. We also thanks Transgenesis and Confocal Facilities of the CBMSO and Bloomington and Vienna stock centers for fly stocks. This work was supported by grants BFU2014-59438-P and BFU2017-83789-P and TENTACLES consortium RED2018-102411-T to IG from the Spanish Ministry of Science, Innovation and Universities and by institutional grants from the Fundación Areces and from Banco de Santander to the CBMSO. FPI fellowship from the Spanish Ministry of Science, Innovation and Universities supported CJ (BFU2017-83789-P), AA-T (BFU2014-59438-P), and IS-B (BFU2011-25987). ‘Fellowships for Excellence’ from the International PhD Program in Molecular Life Sciences of the Biozentrum, University of Basel supported GA.

Senior Editor

  1. Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany

Reviewing Editor

  1. Steffen Scholpp, University of Exeter, United Kingdom

Version history

  1. Received: November 3, 2020
  2. Accepted: August 4, 2021
  3. Accepted Manuscript published: August 6, 2021 (version 1)
  4. Version of Record published: September 1, 2021 (version 2)

Copyright

© 2021, Simon et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 910
    Page views
  • 172
    Downloads
  • 8
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Eléanor Simon
  2. Carlos Jiménez-Jiménez
  3. Irene Seijo-Barandiarán
  4. Gustavo Aguilar
  5. David Sánchez-Hernández
  6. Adrián Aguirre-Tamaral
  7. Laura González-Méndez
  8. Pedro Ripoll
  9. Isabel Guerrero
(2021)
Glypicans define unique roles for the Hedgehog co-receptors boi and ihog in cytoneme-mediated gradient formation
eLife 10:e64581.
https://doi.org/10.7554/eLife.64581

Categories and tags

Research organism

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology

    Genetically engineered mesenchymal stem cells as a nitric oxide reservoir for acute kidney injury therapy

    Haoyan Huang, Meng Qian ... Zongjin Li
    Research Article Updated

    Nitric oxide (NO), as a gaseous therapeutic agent, shows great potential for the treatment of many kinds of diseases. Although various NO delivery systems have emerged, the immunogenicity and long-term toxicity of artificial carriers hinder the potential clinical translation of these gas therapeutics. Mesenchymal stem cells (MSCs), with the capacities of self-renewal, differentiation, and low immunogenicity, have been used as living carriers. However, MSCs as gaseous signaling molecule (GSM) carriers have not been reported. In this study, human MSCs were genetically modified to produce mutant β-galactosidase (β-GALH363A). Furthermore, a new NO prodrug, 6-methyl-galactose-benzyl-oxy NONOate (MGP), was designed. MGP can enter cells and selectively trigger NO release from genetically engineered MSCs (eMSCs) in the presence of β-GALH363A. Moreover, our results revealed that eMSCs can release NO when MGP is systemically administered in a mouse model of acute kidney injury (AKI), which can achieve NO release in a precise spatiotemporal manner and augment the therapeutic efficiency of MSCs. This eMSC and NO prodrug system provides a unique and tunable platform for GSM delivery and holds promise for regenerative therapy by enhancing the therapeutic efficiency of stem cells.

    1. Biochemistry and Chemical Biology
    2. Cell Biology

    The FAM104 proteins VCF1/2 promote the nuclear localization of p97/VCP

    Maria Körner, Susanne R Meyer ... Alexander Buchberger
    Research Article Updated

    The ATPase p97 (also known as VCP, Cdc48) has crucial functions in a variety of important cellular processes such as protein quality control, organellar homeostasis, and DNA damage repair, and its de-regulation is linked to neuromuscular diseases and cancer. p97 is tightly controlled by numerous regulatory cofactors, but the full range and function of the p97–cofactor network is unknown. Here, we identify the hitherto uncharacterized FAM104 proteins as a conserved family of p97 interactors. The two human family members VCP nuclear cofactor family member 1 and 2 (VCF1/2) bind p97 directly via a novel, alpha-helical motif and associate with p97-UFD1-NPL4 and p97-UBXN2B complexes in cells. VCF1/2 localize to the nucleus and promote the nuclear import of p97. Loss of VCF1/2 results in reduced nuclear p97 levels, slow growth, and hypersensitivity to chemical inhibition of p97 in the absence and presence of DNA damage, suggesting that FAM104 proteins are critical regulators of nuclear p97 functions.

    1. Cell Biology
    2. Neuroscience

    Removal of extracellular human amyloid beta aggregates by extracellular proteases in C. elegans

    Elisabeth Jongsma, Anita Goyala ... Collin Yvès Ewald
    Research Article Updated

    The amyloid beta (Aβ) plaques found in Alzheimer’s disease (AD) patients’ brains contain collagens and are embedded extracellularly. Several collagens have been proposed to influence Aβ aggregate formation, yet their role in clearance is unknown. To investigate the potential role of collagens in forming and clearance of extracellular aggregates in vivo, we created a transgenic Caenorhabditis elegans strain that expresses and secretes human Aβ1-42. This secreted Aβ forms aggregates in two distinct places within the extracellular matrix. In a screen for extracellular human Aβ aggregation regulators, we identified different collagens to ameliorate or potentiate Aβ aggregation. We show that a disintegrin and metalloprotease a disintegrin and metalloprotease 2 (ADM-2), an ortholog of ADAM9, reduces the load of extracellular Aβ aggregates. ADM-2 is required and sufficient to remove the extracellular Aβ aggregates. Thus, we provide in vivo evidence of collagens essential for aggregate formation and metalloprotease participating in extracellular Aβ aggregate removal.