A subcellular map of the human kinome
- The MOE Key Laboratory of Biosystems Homeostasis & Protection, Zhejiang Provincial Key Laboratory for Cancer Molecular Cell Biology, and Innovation Center for Cell Signaling Network, Life Sciences Institute, Zhejiang University, China
- Cancer Center, Zhejiang University, China
- College of Biology and Pharmacy, Yulin Normal University, China
- State Key Laboratory of Membrane Biology, Beijing Key Laboratory of Cardiometabolic Molecular Medicine, Institute of Molecular Medicine, Peking University, China
- Department of Hepatobiliary and Pancreatic Surgery, Zhejiang Provincial Key Laboratory of Pancreatic Disease, The First Affiliated Hospital, School of Medicine, Zhejiang University, China
- Department of Ophthalmology, The Children’s Hospital, School of Medicine, and National Clinical Research Center for Child Health, Zhejiang University, China
- Institute of Biochemistry II, Goethe University Frankfurt-Medical Faculty, University Hospital, Germany
- Institute of Aging Research, Hangzhou Normal University, China
Figures
Figure 1 with 1 supplement
Mapping subcellular localizations of the kinome.
(A) Coverage of the kinome (pie graph) and kinase families (bar graph) by the plasmid library. (B) Composition of the kinome library. Species origins (left), epitope tags (middle), and tag positions …
-
Figure 1—source data 1
Raw data for Figure 1 and Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Mapping subcellular localizations of the kinome.
(A) Distribution of the kinome plasmid library on the kinome tree. Each red dot represents a kinase in the library. (B) Ratio of N-terminal- and C-terminal-tagged kinases in each kinase family. (C) …
Figure 2 with 1 supplement
Kinome Atlas (KA) complements current databases for kinome localization.
(A) Coverage of the kinome by COPARTMENTS, Human Protein Atlas (HPA), and KA in Venn diagram. (B) Subcellular localization of six kinases first annotated by KA. (C, D) Comparison of annotations in …
-
Figure 2—source data 1
Raw data for Figure 2 and Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Kinome Atlas (KA) complements current databases for kinome localization.
(A) Comparison of specific localizations in KA with high-confidence localizations in COMPARTMENTS. Distributions of matched and unmatched localizations are shown by bar graph. (B) The heatmap …
Figure 3 with 1 supplement
Kinome Atlas (KA) identified unknown localizations for kinases.
(A, B) New plasma membrane-localized kinases identified by KA. Original mapping data (A) and confirmation by cellular fractionation (B). W: whole cell lysate; M: membrane; C: cytosol. Equal loading …
-
Figure 3—source data 1
Uncropped western blot for Figure 3.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig3-data1-v2.jpg
-
Figure 3—source data 2
Raw data for Figure 3.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig3-data2-v2.xlsx
Figure 3—figure supplement 1
Kinome Atlas (KA) identified unknown localizations for kinases.
(A) C-terminal tagged SGK3 colocalizes with EEA1 in HeLa cells. (B) PRKD3, STK16, MAP3K12, and MAP3K13 are not secreted. HEK293T cells were transfected. Both culture medium and cell lysates were …
-
Figure 3—figure supplement 1—source data 1
Uncropped western blot for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig3-figsupp1-data1-v2.jpg
Figure 4 with 1 supplement
Phase separation assembles kinase condensates.
(A) Sub-nuclear patterns of kinases in Kinome Atlas (KA). (B) Hex disrupts puncta localization of kinases. Transfected HeLa cells were treated with 10% 1,6-hexanediol (Hex) for 1 min as indicated. …
Figure 4—figure supplement 1
Phase separation assembles kinase condensates.
(A) Nuclear peripheral kinases visualized by Airyscan high-resolution microscopy. Transfected HeLa cells were stained with anti-HA for the kinase and anti-Lamin A/C for nuclear envelope. (B) …
-
Figure 4—figure supplement 1—source data 1
Uncropped western blot for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig4-figsupp1-data1-v2.jpg
Figure 5 with 1 supplement
Kinome Atlas (KA) identified novel mitochondrial kinases.
(A) Comparison of MitoCarta2.0 and KA. (B) FASTK and PAK5 are not mitochondrial. N- and C-terminal tagged kinases were expressed in HeLa cells and stained. (C) Mitochondrial kinases identified by …
-
Figure 5—source data 1
Uncropped western blot for Figure 5.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig5-data1-v2.jpg
Figure 5—figure supplement 1
Kinome Atlas (KA) identified novel mitochondrial kinases.
(A) Confirmation of mitochondrial kinases by co-staining with TOM20. (B) N-terminal truncated isoform of FASTK exhibited mitochondrial localization. FASTK-M35 was transfected in HeLa cells and …
-
Figure 5—figure supplement 1—source data 1
Uncropped western blot for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig5-figsupp1-data1-v2.jpg
-
Figure 5—figure supplement 1—source data 2
Raw data for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig5-figsupp1-data2-v2.xlsx
Figure 6 with 1 supplement
MOK is a mitochondrial intermembrane space (IMS)-localized protein.
(A) Sub-mitochondrial localizations of new mitochondrial kinases. Transfected HeLa cells were stained and imaged by 3D structured illumination microscopy (3D-SIM). (B) MOK2 is imported into …
-
Figure 6—source data 1
Uncropped western blot for Figure 6.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig6-data1-v2.jpg
-
Figure 6—source data 2
Raw data for Figure 6 and Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig6-data2-v2.xlsx
Figure 6—figure supplement 1
MOK is a mitochondrial intermembrane space (IMS)-localized protein.
(A) Domain organization of LIMK2 isoforms. (B) Subcellular localization of LIMK2 isoforms. HeLa cells transfected with LIMK2 isoforms were stained with anti-Flag and anti-TOM20 antibodies. F-actin …
-
Figure 6—figure supplement 1—source data 1
Uncropped western blot for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig6-figsupp1-data1-v2.jpg
Figure 7 with 1 supplement
Knockout (KO) of MOK impairs mitochondrial structure and functions.
(A, B) MOK KO reduced mitochondria cristae. Indicated A375 cells were examined by electron microscopy (A). The length and cristae number of mitochondria (n = 30) were quantified (B). (C, D) MOK KO …
-
Figure 7—source data 1
Uncropped western blot for Figure 7.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig7-data1-v2.jpg
-
Figure 7—source data 2
Raw data for Figure 7 and Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig7-data2-v2.xlsx
Figure 7—figure supplement 1
Knockout of MOK impairs mitochondrial structure and functions.
(A) Confirmation of MOK knockout in A375 cells by genomic DNA sequencing. Indels are labeled in red. Arrowhead indicates predicted Cas9 cutting site. (B) MOK knockdown efficiency in Caki-1 cells as …
-
Figure 7—figure supplement 1—source data 1
Uncropped western blot for Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig7-figsupp1-data1-v2.jpg
-
Figure 7—figure supplement 1—source data 2
Raw data for Figure 7—figure supplement 1J.
- https://cdn.elifesciences.org/articles/64943/elife-64943-fig7-figsupp1-data2-v2.xlsx
Author response image 1
Expression of MOK in human and mouse tissues.
Data was analyzed from the HPA RNA-seq normal tissues project (human) and the Mouse ENCODE transcriptome data.
Author response image 2
Expression of MOK in human cancers in TCGA database as analyzed by FireBrowse (http://firebrowse.org/).
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | Human kinome cDNA | Center for Cancer Systems Biology of Harvard University | hORFeome v3.1 | |
| Gene (Homo sapiens) | Human kinome cDNA | Thermo Fisher | Ultimate ORF Clone LITE Collection | |
| Cell line (Homo sapiens) | HeLa | ATCC | Cat# CCL-2, RRID:CVCL_0030 | |
| Cell line (Homo sapiens) | HEK293T | ATCC | Cat# CRL-11268, RRID:CVCL_1926 | |
| Cell line (Homo sapiens) | A375 | ATCC | Cat# CRL-1619, RRID:CVCL_0132 | |
| Cell line (Homo sapiens) | DU 145 | ATCC | Cat# HTB-81, RRID:CVCL_0105 | |
| Cell line (Homo sapiens) | MCF10A | ATCC | Cat# CRL-10317, RRID:CVCL_0598 | |
| Cell line (Homo sapiens) | Caki-1 | Liping Xie (Zhejiang University) | ||
| Cell line (Cercopithecus aethiops) | COS-7 | ATCC | Cat# CRL-1651, RRID:CVCL_0224 | |
| Transfected construct (Homo sapiens) | siNT | This paper | Control siRNA target sequence: UUCUCCGAACGUGUCA CGU | |
| Transfected construct (Homo sapiens) | siMOK#1 | This paper | siRNA target sequence: CCUCUUUCCUGGAGUA AAU | |
| Transfected construct (Homo sapiens) | siMOK#2 | This paper | siRNA target sequence: AGUCGAGAGCUAUGAA UUU | |
| Transfected construct (Homo sapiens) | shNT | This paper | Control shRNA target sequence: CCTAAGGTTAAGTCGCCCTCG | |
| Transfected construct (Homo sapiens) | sh-TOM20 | This paper | shRNA target sequence: GGCGTAGACCATCTGACAAAT | |
| Transfected construct (Homo sapiens) | sh-TOM70 | This paper | shRNA target sequence: GCATGCTGTTAGCCGATAAAG | |
| Transfected construct (Homo sapiens) | sh-TIM17A | This paper | shRNA target sequence: GCTGGTATCTTGTTGACAAGA | |
| Transfected construct (Homo sapiens) | sh-TIM50 | This paper | shRNA target sequence: CCTCAAGACCATTGCACTGAA | |
| Transfected construct (Homo sapiens) | sh-TIM23 | This paper | shRNA target sequence: CCAGCCTCTATGCACTATATA | |
| Transfected construct (Homo sapiens) | sh-HSPA9 | This paper | shRNA target sequence: CGTGCTCAATTTGAAGGGATT | |
| Transfected construct (Homo sapiens) | sh-HSP60 | This paper | shRNA target sequence: CCTGCTCTTGAAATTGCCAAT | |
| Transfected construct (Homo sapiens) | sh-MIA40 | This paper | shRNA target sequence: TCTTGACATCTTGACATATAC | |
| Transfected construct (Homo sapiens) | sh-TIM9 | This paper | shRNA target sequence: GCTTGGTCACTTGATTAGAAA | |
| Transfected construct (Homo sapiens) | sh-TIM22 | This paper | shRNA target sequence: GCTTTGACCCTAAGGATCCTT | |
| Transfected construct (Homo sapiens) | sh-OXA1L | This paper | shRNA target sequence: CGAATCAGAGAGGCCAAGTTA | |
| Transfected construct (Homo sapiens) | sh-BCS1L | This paper | shRNA target sequence: CGTCCAGGAATTCATCGATAA | |
| Transfected construct (Homo sapiens) | sh-MOK #1 | This paper | shRNA target sequence: CTGGTTCTCTTGCAC TAATAT | |
| Transfected construct (Homo sapiens) | sh-MOK #2 | This paper | shRNA target sequence: ACCTCTACTAACAACCAATTT | |
| Transfected construct (Homo sapiens) | sh-ATAD3A #1 | This paper | shRNA target sequence: CATCAATGAGATGGTCCACTT | |
| Transfected construct (Homo sapiens) | sh-ATAD3A #2 | This paper | shRNA target sequence: CAAGGACAAATGGAGCAACTT | |
| Transfected construct (Homo sapiens) | sg-MOK KO #1 | This paper | PEP-KO with gRNA sequence: GTACCAGTTATGTAAGTCCC | |
| Transfected construct (Homo sapiens) | sg-MOK KO #2 | This paper | PEP-KO with gRNA sequence: GCAATTGGCAAAATAGGAGA | |
| Transfected construct (Homo sapiens) | sg-BMP2K KI #1 | This paper | PEP-KI with gRNA sequence: GAAATGGAGCAGCACCAAAT | |
| Transfected construct (Homo sapiens) | sg-BMP2K KI #2 | This paper | PEP-KI with gRNA sequence: TAAACAGTAGATACTTCTGA | |
| Transfected construct (Homo sapiens) | sg-MOK KI #1 | This paper | PEP-KI with gRNA sequence: TCTTCCGCCTTTCCGCACTA | |
| Transfected construct (Homo sapiens) | sg-MOK KI #2 | This paper | PEP-KI with gRNA sequence: CACCGTCGTCTCGACTTCGG | |
| Antibody | Mouse monoclonal anti-alpha 1 Sodium Potassium ATPase antibody | Abcam | Cat# ab7671, RRID:AB_306023 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-GM130 antibody | BD Biosciences | Cat# 610823, RRID:AB_398142 | IF (1:1000) |
| Antibody | Rabbit polyclonal anti-UTP25 antibody | Dr. Jinrong Peng (Zhejiang University) | IF (1:200) | |
| Antibody | Rabbit polyclonal anti-Lamin A/C (H-110) antibody | Santa Cruz Biotechnology | Cat# sc-20681, RRID:AB_648154 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-Lamin A/C (636) antibody | Santa Cruz Biotechnology | Cat# sc-7292, RRID:AB_627875 | IF (1:1000) |
| Antibody | Rabbit monoclonal anti-Catalase (D4P7B) antibody | Cell Signaling Technology | Cat# 12980, RRID:AB_2798079 | IF (1:100) |
| Antibody | Rabbit polyclonal anti-Pericentrin antibody | Covance | Cat# PRB-432C-200, RRID:AB_291635 | IF (1:500) |
| Antibody | Rabbit monoclonal anti-EEA1 (C45B10) antibody | Cell Signaling Technology | Cat# 3288, RRID:AB_2096811 | IF (1:100) |
| Antibody | Rabbit monoclonal anti-TOM20 (F-10) antibody | Santa Cruz Biotechnology | Cat# sc-17764, RRID:AB_628381 | IF (1:1000) |
| Antibody | Mouse polyclonal anti-TOM20 (FL-145) antibody | Santa Cruz Biotechnology | Cat# sc-11415, RRID:AB_2207533 | IF (1:1000) |
| Antibody | Rabbit monoclonal anti-HSP60 (D6F1) antibody | Cell Signaling Technology | Cat# 46611, RRID:AB_2799305 | WB (1:1000), IF (1:500) |
| Antibody | Mouse monoclonal anti-ENDOG (B-2) antibody | Santa Cruz Biotechnology | Cat# sc-365359, RRID:AB_10843802 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-MT-CO2 antibody | Abcam | Cat# ab110258, RRID:AB_10887758 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-LAMP1 antibody | Santa Cruz Biotechnology | Cat# sc-20011, RRID:AB_626853 | IF (1:500) |
| Antibody | Mouse monoclonal anti-HSP90 antibody | BD Biosciences | Cat# 610418, RRID:AB_397798 | WB (1:5000) |
| Antibody | Rabbit monoclonal anti-pErk1/2 (Thr202/Tyr204) antibody | Cell Signaling Technology | Cat# 4370, RRID:AB_2315112 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-Thiophosphate ester antibody | Abcam | Cat# ab133473, RRID:AB_2737094 | WB (1:5000) |
| Antibody | Rabbit monoclonal anti-PARP (46D11) antibody | Cell Signaling Technology | Cat# 9532, RRID:AB_659884 | WB (1:2000) |
| Antibody | Rabbit polyclonal anti-RPS6KA6 antibody | Sigma-Aldrich | Cat# HPA002852, RRID:AB_1079854 | IF (1:100) |
| Antibody | Rabbit polyclonal anti-MOK antibody | Sigma-Aldrich | Cat# HPA027292, RRID:AB_10600989 | WB (1:1000) |
| Antibody | Mouse monoclonal ANTI-FLAG M2 antibody | Sigma-Aldrich | Cat# F3165, RRID:AB_259529 | IF (1:1000) |
| Antibody | Rabbit monoclonal anti-DYKDDDDK Tag (D6W5B) antibody | Cell Signaling Technology | Cat# 14793, RRID:AB_2572291 | IF (1:500) |
| Antibody | Mouse monoclonal anti-Flag M2-Peroxidase-HRP conjugated antibody | Sigma-Aldrich | Cat# A8592, RRID:AB_439702 | WB (1:5000) |
| Antibody | Rabbit monoclonal anti-HA-Tag (C29F4) antibody | Cell Signaling Technology | Cat# 3724, RRID:AB_1549585 | IF (1:500) |
| Antibody | Mouse monoclonal anti-Myc-Tag (9B11) antibody | Cell Signaling Technology | Cat# 2276, RRID:AB_331783 | IF (1:500) |
| Antibody | Rabbit polyclonal anti-GFP antibody | Abcam | Cat# ab6556, RRID:AB_305564 | WB (1:2000) |
| Antibody | Mouse monoclonal anti-β-actin antibody | Proteintech | Cat# 66009–1-Ig, RRID:AB_2687938 | WB (1:5000) |
| Antibody | Mouse monoclonal anti-Tubulin (clone B5-1-2) antibody | Sigma-Aldrich | Cat# T6074, RRID:AB_477582 | WB (1:5000), IF (1:1000) |
| Antibody | Mouse monoclonal anti- γ-Tubulin (clone GTU88) antibody | Sigma-Aldrich | Cat# T5326, RRID:AB_532292 | IF (1:500) |
| Antibody | Goat polyclonal anti-Rabbit IgG(H + L)-Alexa Fluor 488 conjugated antibody | Thermo Fisher Scientific | Cat# A-11034, RRID:AB_2576217 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Mouse IgG(H + L)-Alexa Fluor 488 conjugated antibody | Thermo Fisher Scientific | Cat# A-11029, RRID:AB_2534088 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Rabbit IgG(H + L)-Alexa Fluor 594 conjugated antibody | Thermo Fisher Scientific | Cat# A-11037, RRID:AB_2534095 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Mouse IgG(H + L)-Alexa Fluor 594 conjugated antibody | Thermo Fisher Scientific | Cat# A-11032, RRID:AB_2534091 | IF (1:1000) |
| Antibody | Goat polyclonal anti-Rabbit IgG(H + L)-Alexa Fluor 647 conjugated antibody | Thermo Fisher Scientific | Cat# A-21244, RRID:AB_2535812 | IF (1:1000) |
| Sequence-based reagent | TOM20 RT-F | This paper | AGGGCGTAGACCATCTGACA | |
| Sequence-based reagent | TOM20 RT-R | This paper | TTCAGCCAAGCTCTGAGCAC | |
| Sequence-based reagent | TOM70 RT-F | This paper | AGACGTGCAAAAGCCCATGA | |
| Sequence-based reagent | TOM70 RT-R | This paper | AAGCATGGGCTGGGAAATGA | |
| Sequence-based reagent | TIM17A RT-F | This paper | GGGAGGGCTGTTTTCCATGA | |
| Sequence-based reagent | TIM17A RT-R | This paper | GGAGGGGTCTTCTGCAAACT | |
| Sequence-based reagent | TIM50 RT-F | This paper | TGCACGAGGTTGGCGA | |
| Sequence-based reagent | TIM50 RT-R | This paper | TGTATGTCCGGCGCAACTG | |
| Sequence-based reagent | TIM23 RT-F | This paper | AGGGGCACTTTGGGCTAATAC | |
| Sequence-based reagent | TIM23 RT-R | This paper | TATCCCTCGAAGACCACCTGT | |
| Sequence-based reagent | HSPA9 RT-F | This paper | CCTACGGCCTGGACAAGAAG | |
| Sequence-based reagent | HSPA9 RT-R | This paper | CTTGTGCTTGCGCTTGAACT | |
| Sequence-based reagent | HSP60 RT-F | This paper | CTTTTAGCCGATGCTGTGGC | |
| Sequence-based reagent | HSP60 RT-R | This paper | TTGGCTATAGAGCGTGCCAG | |
| Sequence-based reagent | MIA40 RT-F | This paper | CTATTGCCGGCAGGAAGGG | |
| Sequence-based reagent | MIA40 RT-R | This paper | GGCATGGGCAGTTCCAGTTA | |
| Sequence-based reagent | TIM9 RT-F | This paper | ACAGAGACCTGCTTTTTGGACT | |
| Sequence-based reagent | TIM9 RT-R | This paper | GCCAGGGCTTCATTCTGCTG | |
| Sequence-based reagent | TIM21 RT-F | This paper | CCTGAGACAGCGGGTTCC | |
| Sequence-based reagent | TIM21 RT-R | This paper | AAGACAAATCCTCCCACGCA | |
| Sequence-based reagent | OXA1L RT-F | This paper | CTCGCAATGGCTTGGGAAAC | |
| Sequence-based reagent | OXA1L RT-R | This paper | CTCAGGTACTGCTGTGGGTG | |
| Sequence-based reagent | BCS1L RT-F | This paper | ATGGCGTCCCTTTGGCTATC | |
| Sequence-based reagent | BCS1L RT-R | This paper | AGTCGGTCATCAGAGAGGCT | |
| Sequence-based reagent | MOK RT-F | This paper | TGAGCTAATACGAGGGAGAAGA | |
| Sequence-based reagent | MOK RT-R | This paper | TACTCCAGGAAAGAGGGGCT | |
| Sequence-based reagent | ATAD3A RT-F | This paper | GCCTCCTGCTCTTTGTGGAT | |
| Sequence-based reagent | ATAD3A RT-R | This paper | AACTGCTCTGGTTGGTTGCT | |
| Sequence-based reagent | ACTB RT-F | This paper | CTCGCCTTTGCCGATCC | |
| Sequence-based reagent | ACTB RT-R | This paper | GAATCCTTCTGACCCATGCC | |
| Commercial assay or kit | Seahorse XF Cell Mito Stress Test Kit | Agilent Technologies | Cat# 103015-100 | |
| Commercial assay or kit | ATP detection kit | Beyotime Biotechnology | Cat# S0026 | |
| Chemical compound, drug | ProLong Gold Antifade Mountant with DAPI | Thermo Fisher Scientific | Cat# P36931 | |
| Chemical compound, drug | Alexa Fluor 488 phalloidin | Thermo Fisher Scientific | Cat# A12379 | IF (1:1000) |
| Chemical compound, drug | MitoTracker Green FM | Thermo Fisher Scientific | Cat# M7514 | |
| Chemical compound, drug | CM-H2DCFDA | Thermo Fisher Scientific | Cat# C6827 | |
| Chemical compound, drug | MitoTracker Red CMXRos | Thermo Fisher Scientific | Cat# M7512 | |
| Chemical compound, drug | Pfu Turbo DNA Polymerase | Agilent Technologies | Cat# 600252-52 | |
| Chemical compound, drug | Streptavidin Resin | Agilent Technologies | Cat# 240105--51 | |
| Chemical compound, drug | 1,6-Hexanediol | Sigma-Aldrich | Cat# 8043081000 | |
| Chemical compound, drug | EDTA-free Protease Inhibitor Cocktail | Sigma-Aldrich | Cat# S8830 | |
| Chemical compound, drug | ANTI-FLAG M2 agarose beads | Sigma-Aldrich | Cat# F2426 | |
| Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat# 107689 | |
| Chemical compound, drug | Diamide | Sigma-Aldrich | Cat# D3648 | |
| Chemical compound, drug | Biotin | Sigma-Aldrich | Cat# B4501 | |
| Chemical compound, drug | Vacuolin-1 | Sigma-Aldrich | Cat# V7139 | |
| Chemical compound, drug | Digitonin | Sangon Biotech | Cat# DG1152 | |
| Chemical compound, drug | ATP-γ-S | Abcam | Cat# ab138911 | |
| Chemical compound, drug | p-Nitrobenzyl mesylate (PNBM) | Abcam | Cat# ab138910 | |
| Software, algorithm | GraphPad Prism | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | Image-Pro Plus 6.0 | Image-Pro Plus | RRID:SCR_016879 | |
| Software, algorithm | VENNY2.1 | https://bioinfogp.cnb.csic.es/tools/venny/index.html | Coverage of the kinome by KA and databases were analyzed by VENNY2.1 | |
| Software, algorithm | KinMap | PMID:28056780 | Kinome Atlas were presented on kinome tree using KinMap The localization and enrichment levels were reflected by colors and sizes of circles | |
| Software, algorithm | SMART | http://smart.embl.de/ | Domain architecture of each kinase is analyzed by SMART | |
| Software, algorithm | IUPred2A | https://iupred2a.elte.hu/ | Intrinsic disorder tendency is predicted by IUPred2A | |
| Software, algorithm | PLAAC | http://plaac.wi.mit.edu/ | Prion-like domains (PrD.like, red) of each kinase are predicted by PLAAC |
Additional files
-
Supplementary file 1
Human kinome and the kinome plasmid library, related to Figure 1A, B, Figure 1—figure supplement 1A, B, and Figure 2A.
- https://cdn.elifesciences.org/articles/64943/elife-64943-supp1-v2.xlsx
-
Supplementary file 2
Summary of the Kinome Atlas, related to Figure 1E–G, Figure 1—figure supplement 1D, and Figure 2—figure supplement 1C.
- https://cdn.elifesciences.org/articles/64943/elife-64943-supp2-v2.xlsx
-
Supplementary file 3
Coverage of the kinome by Kinome Atlas (KA) and databases, related to Figure 2A.
- https://cdn.elifesciences.org/articles/64943/elife-64943-supp3-v2.xlsx
-
Supplementary file 4
Kinome Atlas (KA) in comparison with COMPARTMENTS, related to Figure 2C, D.
- https://cdn.elifesciences.org/articles/64943/elife-64943-supp4-v2.xlsx
-
Supplementary file 5
Kinome Atlas (KA) in comparison with Human Protein Atlas (HPA), related to Figure 2E, F, Figure 2—figure supplement 1D, E.
- https://cdn.elifesciences.org/articles/64943/elife-64943-supp5-v2.xlsx
-
Supplementary file 6
Analysis of kinases uniquely annotated by Kinome Atlas (KA), related to Figure 2G,H and Figure 3.
- https://cdn.elifesciences.org/articles/64943/elife-64943-supp6-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64943/elife-64943-transrepform-v2.docx
