KSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transition
- Eppley Institute, University of Nebraska Medical Center, United States
- Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, United States
- Department of Pathology and Microbiology, University of Nebraska Medical Center, United States
- Hubrecht Institute, Royal Netherlands Academy of Arts and Sciences (KNAW) and UMC Utrecht, Netherlands
- Department of Oral Biology, University of Nebraska Medical Center, United States
Figures
Figure 1 with 2 supplements
EPSTI1 translation is regulated by KSR1.
(A) Representative polysome profiles from control and KSR1 knockdown (KSR1 RNAi) HCT116 and HCT15 cells. Sucrose gradient fractions 3–5 denote the low-molecular-weight complexes (monosomes) and the …
Figure 1—figure supplement 1
Three independent replicates of the polysome profiles from control and KSR1 knockdown (shKSR1) HCT116 and HCT15 cells.
Figure 1—figure supplement 2A and 1B were used as representative images for Figure 1A.
Figure 1—figure supplement 2
EPSTI1 is translationally regulated by KSR1.
(A) Scatter plot of polysome-associated mRNA to total mRNA log2 fold-changes upon KSR1 knockdown in HCT116 (top) and HCT15 (bottom) with RNA-seq. The statistically significant genes in the absence …
Figure 2
KSR1 or ERK inhibition suppresses EPSTI1 protein expression in cell lines and organoids.
(A) Cell lysates prepared from control, KSR1 CRISPR-targeted (KSR1 CRISPR) and CRISPR-targeted HCT116 and HCT15 cells expressing KSR1 (KSR1 CRISPR+ KSR1) analyzed for EPSTI1 protein expression by …
Figure 3
EPSTI1 is overexpressed in cancer cell lines and organoids and promotes anchorage-independent growth.
(A) Anchorage-independent cell viability was analyzed in HCT116 and HCT15 cells plated on poly-(HEMA)-coated plates was measured using CellTiter-Glo following CRISPR-targeting (KSR1 CRISPR) and …
Figure 4
KSR1 or EPSTI1 promote migration and invasion in CRC cells.
(A) Control, CRISPR-targeted (KSR1 CRISPR) and CRISPR-targeted HCT116 cells expressing KSR1 (KSR1 CRISPR+ KSR1) (upper) and control or EPSTI1 knockdown HCT116 cells (lower) were evaluated in a …
Figure 5 with 1 supplement
KSR1 and EPSTI1 promote cadherin switching.
(A) Western blot analysis of the cell lysates prepared from control, and two clones of CRISPR-targeted HCT116, SW480, and HCT15 cells (KSR1 CRISPR) for the E-cadherin, Slug, and EPSTI1. (B) Western …
Figure 5—figure supplement 1
KSR1 and EPSTI1 promote the cadherin switch.
(A) Western blot analysis of the cell lysates prepared from control, and two clones of CRISPR-targeted HCT116 (KSR1 CRISPR) for (Top- upper) E-cadherin and Vimentin, and (bottom-lower) Cell lysates …
Figure 6 with 1 supplement
EPSTI1 rescues cadherin switching and invasive behavior to KSR1 knockout cells.
(A) EPSTI1 protein expression was assessed by western blotting in control, KSR1-targeted (KSR1 CRISPR) HCT116, SW480, and HCT15 cells with and without EPSTI1 (FLAG-EPSTI1) expression. Cells were …
Figure 6—figure supplement 1
EPSTI1 rescues cadherin switching and invasive behavior to KSR1 knockout cells.
Cell proliferation growth curves in control (blue), KSR1 CRISPR (red) HCT116 (A) and SW480 (B) with and without EPSTI1 (green) or KSR1 expression (orange) (n = 4; ns, non-significant, statistical …
Figure 7
EPSTI1 expression in KSR1 KO CRC cells and HCEC cells induces N-cadherin expression and restores anchorage-independent growth in CRC cells.
(A) RT-qPCR analysis of EPSTI1 mRNA (left) and N- cadherin (right) in HCT116 and SW480 cells following KSR1 disruption with and without expression of EPSTI1 (FLAG-EPSTI1) in KSR1 KO cells. (n = 3), …
Author response image 1
RT-qPCR analysis of EPSTI1 and HPRT1 mRNA levels from LMW (fractions 3-5) and HMW (fractions 6-8) of the control and KSR1 knockdown HCT116 and HCT15 cells (n=3; **, P<0.05; ***, P<0.001; ns, non-significant).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | Colorectal carcinoma, epithelial | ATCC | HCT116 (ATCC, Cat# CCL-247, RRID: CVCL_0291) | |
| Cell line (Homo sapiens) | Colorectal carcinoma, epithelial | ATCC | HCT15 (ATCC, Cat# CCL-225, RRID: CVCL_0292) | |
| Cell line (Homo sapiens) | Colorectal adenocarcinoma, epithelial | ATCC | SW480 (ATCC, Cat# CCL-228, RRID: CVCL_0546) | |
| Cell line (Homo sapiens) | Immortalized colon epithelial | Obtained from Dr. Jerry Shay | HCEC | |
| Cell line (Homo sapiens) | Kidney; epithelial fibroblast (fetus) | ATCC | HEK-293T (ATCC Cat# CRL-3216, RRID: CVCL_0063) | |
| Cell line (Homo sapiens) | Kidney; epithelial fibroblast (fetus) | Obtained from Rob Kortum | Phoenix-GP | Available at ATCC (Cat# CRL-321) |
| Transfected construct (Homo sapiens) | siRNA to non-targeting control | Dharmacon | Cat# D-001810-01-20 | UGGUUUACAUGUCGACUAA |
| Transfected construct (Homo sapiens) | siRNA to EPSTI1 | Dharmacon | Cat# 015094-09-0020 | GAACAGAGCUAAACCGGUU |
| Transfected construct (Homo sapiens) | siRNA to EPSTI1 | Dharmacon | Cat# 015094-12-0020 | UCUGGAGGCUGUUGGAAUA |
| Transfected construct (Homo sapiens) | Con shRNA#1 | Fisher et al., 2015 | pLKO.1 MC1 puro | CAACAAGATGAAGAGCACCAA |
| Transfected construct (Homo sapiens) | KSR1 shRNA#1 | Fisher et al., 2015 | pLKO.1 KSR.1 puro | GTGCCAGAAGAGCATGATTTT |
| Transfected construct (Homo sapiens) | KSR1 shRNA#2 | Fisher et al., 2015 | pLKO.1 KSR.2 puro | GCTGTTCAAGAAAGAGGTGAT |
| Transfected construct (Homo sapiens) | CON sgRNA#1 | This paper | pCAG-SpCas9-GFP-U6-gNC1 | GTATTACTGATATTGGTGGG |
| Transfected construct (Homo sapiens) | KSR1 sgRNA#1 | This paper | pCAG-SpCas9-GFP-U6-gCR1.1 | GTGCCAGAAGAGCATGATTTT |
| Transfected construct (Homo sapiens) | KSR1 sgRNA#2 | This paper | pCAG-SpCas9-GFP-U6-gCR1.2 | GTGCCAGAAGAGCATGATTTT |
| Recombinant DNA reagent | FLAG-KSR1 (plasmid) | Fisher et al., 2015 | MSCV-KSR1-IRES-GFP | |
| Recombinant DNA reagent | FLAG-EPSTI1 (plasmid) | This paper | MSCV-FLAG-EPSTI1-IRES-GFP | MGC Human EPSTI1 Sequence-Verified cDNA (Cat# MHS6278-202832484) cloned into MSCV-IRES-GFP construct |
| Recombinant DNA reagent | N-cad OE (plasmid) | Gift from Dr. Keith Johnson | N-cadherin-mGFP | |
| Sequence-based reagent | EPSTI1 (PCR primer) | IDT | Cat# Hs.PT.58.50471678 | Forward primer 5’-GTGAATTACTGGAACTGAAACGG-3’Reverse primer 5’ TCCAACAGCCTCCAGATTG 3’ Tm 55 °C, Exon Location 10–11 |
| Sequence-based reagent | N-cadherin (PCR primer) | IDT | Cat# Hs.PT.58.26024443 | Forward primer 5’-GTTTGCCAGTGTGACTCCA-3’Reverse primer 5’-CATACCACAAACATCAGCACAAG-3’Tm 55 °C, Exon Location 13–14 |
| Sequence-based reagent | HPRT1 (PCR primer) | IDT | Cat# Hs.PT.58v.45621572 | Forward Primer: 5’ GTATTCATTATAGTCAAGGGCATATCC 3’Reverse Primer: 5’AGATGGTCAAGGTCGCAAG 3’Tm 60 °C, Exon Location 8–9 |
| Sequence-based reagent | ZEB1 (PCR primer) | IDT | Cat# Hs.PT.58.39178574 | Forward primer 5’-GAGGAGCAGTGAAAGAGAAGG-3’Reverse primer 5’-TACTGTACATCCTGCTTCATCTG-3’Tm 60 °C, Exon Location 3–5 |
| Sequence-based reagent | SLUG (PCR primer) | IDT | Cat# Hs.PT.58.50471678 | Forward primer 5’-AGGACACATTAGAACTCACACG-3’Reverse primer 5’-CAGATGAGCCCTCAGATTTGAC-3’Tm 55 °C, Exon Location 2–3 |
| Antibody | Anti-KSR1, Rabbit polyclonal | Abcam | Cat# ab68483 | WB (1:1000) |
| Antibody | Anti-EPSTI1, Rabbit polyclonal | Proteintech | Cat# 11627–1-AP, RRID: AB_2877786 | WB (1:1000) |
| Antibody | Anti-N-cadherin | Gift from Dr. Keith Johnson | Cat# 13A9 | WB (1:20) |
| Cell Signaling | Cat# 13116, RRID: AB_2687616 | WB (1:1000) | ||
| Antibody | Anti-E-cadherin | Gift from Dr. Keith Johnson | Cat# 4A2 | WB (1:10) IF (1:1) |
| Cell Signaling | Cat# 3195, RRID: AB_2291471 | WB (1:1000) | ||
| Antibody | Anti-Slug, Rabbit monoclonal | Cell Signaling Technology | Cat# 9585, RRID:AB_2239535 | WB (1:1000) |
| Antibody | Anti-Lamin β2, Rabbit monoclonal | Abclonal | Cat# A6483, RRID: AB_2767083 | WB (1:2000) |
| Antibody | Anti-β actin, Mouse monoclonal | Santa Cruz | Cat# 47778, RRID:AB_2714189 | WB (1:2000) |
| Antibody | Anti-phospho RSK S380, Rabbit polyclonal | Cell Signaling Technology | Cat# 9341, RRID: AB_330753 | WB (1:500) |
| Antibody | Anti-Total RSK, Rabbit monoclonal | Cell Signaling Technology | Cat# 9355, RRID: AB_659900 | WB (1:1000) |
| Antibody | Anti-phospho p70S6K T389, Rabbit polyclonal | Cell Signaling Technology | Cat# 9206 RRID: AB_2285392 | WB (1:500) |
| Antibody | Anti-total p70S6K, Rabbit polyclonal | Cell Signaling Technology | Cat# 9202, RRID: AB_331676 | WB (1:1000) |
| Antibody | Anti-SNAIL, Rabbit monoclonal | Cell Signaling Technology | Cat# 3879, RRID: AB_2255011 | WB (1:1000) |
| Antibody | Anti-Vimentin, Rabbit monoclonal | Cell Signaling Technology | Cat# 5741, RRID:AB_10695459 | WB (1:1000) |
Additional files
-
Supplementary file 1
Genes translationally altered by KSR1.
Translational efficiency of mRNAs (58 decreased; 40 increased) upon KSR1 knockdown in HCT116 and HCT15 cells, related to Figure 1B.
- https://cdn.elifesciences.org/articles/66608/elife-66608-supp1-v2.xlsx
-
Supplementary file 2
KSR1-dependent genes predicted in mesenchymal-up signature identified by GSEA.
GSEA for the subset of translationally controlled genes involved in ‘Hallmark EMT signature’, ‘Jechlinger EMT Up’, and ‘Gotzmann EMT up’ in a KSR1-dependent manner.
- https://cdn.elifesciences.org/articles/66608/elife-66608-supp2-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/66608/elife-66608-transrepform1-v2.docx
-
Source data 1
Translational efficiency of mRNAs significantly altered by KSR1 analyzed using Anota2seq.
- https://cdn.elifesciences.org/articles/66608/elife-66608-data1-v2.xlsx
