1. Microbiology and Infectious Disease
Download icon

Interferon receptor-deficient mice are susceptible to eschar-associated rickettsiosis

  1. Thomas P Burke  Is a corresponding author
  2. Patrik Engström
  3. Cuong J Tran
  4. Ingeborg M Langohr
  5. Dustin R Glasner
  6. Diego A Espinosa
  7. Eva Harris
  8. Matthew D Welch  Is a corresponding author
  1. Molecular and Cell Biology, University of California, Berkeley, United States
  2. Division of Infectious Disease and Vaccinology, School of Public Health, University of California, Berkeley, United States
  3. Department of Pathobiological Sciences, Louisiana State University, United States
Research Article
  • Cited 0
  • Views 614
  • Annotations
Cite this article as: eLife 2021;10:e67029 doi: 10.7554/eLife.67029

Abstract

Arthropod-borne rickettsial pathogens cause mild and severe human disease worldwide. The tick-borne pathogen Rickettsia parkeri elicits skin lesions (eschars) and disseminated disease in humans; however, inbred mice are generally resistant to infection. We report that intradermal infection of mice lacking both interferon receptors (Ifnar1-/-;Ifngr1-/-) with as few as 10 R. parkeri elicits eschar formation and disseminated, lethal disease. Similar to human infection, eschars exhibited necrosis and inflammation, with bacteria primarily found in leukocytes. Using this model, we find that the actin-based motility factor Sca2 is required for dissemination from the skin to internal organs, and the outer membrane protein OmpB contributes to eschar formation. Immunizing Ifnar1-/-;Ifngr1-/- mice with sca2 and ompB mutant R. parkeri protects against rechallenge, revealing live-attenuated vaccine candidates. Thus, Ifnar1-/-;Ifngr1-/- mice are a tractable model to investigate rickettsiosis, virulence factors, and immunity. Our results further suggest that discrepancies between mouse and human susceptibility may be due to differences in interferon signaling.

eLife digest

Tick bites allow disease-causing microbes, including multiple species of Rickettsia bacteria, to pass from arthropods to humans. Being exposed to Rickettsia parkeri, for example, can cause a scab at the bite site, fever, headache and fatigue.

To date, no vaccine is available against any of the severe diseases caused by Rickettsia species. Modelling human infections in animals could help to understand and combat these illnesses. R. parkeri is a good candidate for such studies, as it can give insight into more severe Rickettsia infections while being comparatively safer to handle. However, laboratory mice are resistant to this species of bacteria, limiting their use as models.

To explore why this is the case, Burke et al. probed whether an immune mechanism known as interferon signalling protects laboratory rodents against R. parkeri. During infection, the immune system releases molecules called interferons that stick to ‘receptors’ at the surface of cells, triggering defense mechanisms that help to fight off an invader.

Burke et al. injected R. parkeri into the skin of mice that had or lacked certain interferon receptors, showing that animals without two specific receptors developed scabs and saw the disease spread through their body. Further investigation showed that two R. parkeri proteins, known as OmpB or Sca2, were essential for the bacteria to cause skin lesions and damage internal organs.

Burke et al. then used R. parkeri that lacked OmpB or Sca2 to test whether these modified, inoffensive microbes could act as ‘vaccines’. And indeed, vulnerable laboratory mice which were first exposed to the mutant bacteria were then able to survive the ‘normal’ version of the microbe.

Together, this work reveals that interferon signalling protects laboratory mice against R. parkeri infections. It also creates an animal model that can be used to study disease and vaccination.

Introduction

Obligate cytosolic bacterial pathogens in the family Rickettsiaceae are a diverse group of arthropod-borne microbes that cause severe human disease worldwide, including spotted fever, scrub typhus, and typhus (Bonell et al., 2017; Fang et al., 2017; Sahni et al., 2019). Human disease caused by the tick-borne spotted fever group (SFG) pathogen Rickettsia parkeri is characterized by a necrotic, dry skin lesion (eschar) at the infection site, as well as generalized rash, headache, fatigue, and fever (Paddock et al., 2008). There is no approved vaccine for R. parkeri or for the more virulent rickettsial pathogens that can cause fatal or latent disease (Osterloh, 2017). Moreover, many critical aspects of disease caused by obligate cytosolic bacterial pathogens, including the mechanisms of virulence and immunity, remain unknown. R. parkeri can be handled under biosafety level 2 (BSL2) conditions, and characterizing mouse models to recapitulate major features of human disease would enhance research efforts into understanding rickettsial pathogens and disease (Osterloh, 2017; Grasperge et al., 2012; Sunyakumthorn et al., 2013).

R. parkeri is genetically similar to the more virulent human pathogens R. rickettsii and R. conorii (Roux and Raoult, 2000; Goddard, 2009), and it can be handled under BSL2 conditions. Moreover, mutants can be generated using transposon mutagenesis (Reed et al., 2014; Lamason et al., 2018), and small rodents including mice have been found as seropositive for R. parkeri in the wild (Moraru et al., 2013a; Moraru et al., 2013b; Krawczak et al., 2016; Barbieri et al., 2019). Thus, a mouse model for R. parkeri that recapitulates key features of human infection would greatly enhance investigations into understanding rickettsial disease. However, inbred mice including C57BL/6 and BALB/c develop no or minor skin lesions upon intradermal (i.d.) infection with R. parkeri (Grasperge et al., 2012). Strategies to develop a mouse model, including infecting Toll-like receptor 4 (TLR4)-deficient mice (Grasperge et al., 2012), delivering high doses of bacteria (Londoño et al., 2019), and delivering R. parkeri via a tick vector (Saito et al., 2019), have been examined. However, a model that recapitulates eschar formation and dissemination via needle inoculation with low doses of R. parkeri has remained elusive. A mouse model for R. parkeri that mimics eschar formation and disseminated disease in C57BL/6 mice, the most widely used genetic background with a large variety of available mutants, would aid investigations into rickettsial virulence mechanisms, the host response to infection, and spotted fever disease.

Toward better understanding the host response to R. parkeri infection, we recently investigated the relationship between R. parkeri and interferons (IFNs), which are ubiquitous signaling molecules of the innate immune system that mobilize the cytosol to an antimicrobial state. Type I IFN (IFN-I) generally restricts viral replication, whereas IFN-γ generally restricts intracellular bacterial pathogens (Raniga and Liang, 2018; Billiau and Matthys, 2009; Meunier and Broz, 2016). We observed that mice lacking either gene encoding the receptors for IFN-I (Ifnar1) or IFN-γ (Ifngr1) are resistant to i.v. infection with R. parkeri, whereas double knockout (DKO) Ifnar1-/-;Ifngr1-/- mice succumb (Burke et al., 2020). This demonstrates that IFNs redundantly protect against systemic R. parkeri. However, the i.v. infection route does not recapitulate eschar formation and i.d. infection may more closely mimic infection by tick bite. Further investigations into whether IFNs redundantly protect against R. parkeri in the skin may improve the mouse model for SFG Rickettsia.

A robust mouse model would facilitate investigations into conserved rickettsial virulence factors, whose role in pathogenesis in vivo remain poorly understood. One virulence mechanism shared by divergent cytosolic bacterial pathogens including Rickettsia, Listeria, Burkholderia, Mycobacterium, and Shigella species is the ability to undergo actin-based motility, which facilitates cell to cell spread (Choe and Welch, 2016; Lamason and Welch, 2017). However, the pathogenic role for many actin-based motility factors in vivo remains unknown. R. parkeri actin-based motility differs from that of other pathogens in that it occurs in two phases. The first phase requires the RickA protein, which elicits actin-based motility by activating the host Arp2/3 complex (Gouin et al., 2004; Jeng et al., 2004); however, RickA is dispensable for cell to cell spread in vitro (Reed et al., 2014). The second phase requires the Sca2 protein (Reed et al., 2014; Kleba et al., 2010), which mimics eukaryotic formins to directly nucleate and elongate actin filaments (Reed et al., 2014; Haglund et al., 2010). Sca2 is required for efficient cell to cell spread, although it is not required for replication in epithelial cells or for avoiding antimicrobial autophagy (Reed et al., 2014; Kleba et al., 2010; Haglund et al., 2010; Engström et al., 2019). sca2 mutant R. rickettsii elicit reduced fever in guinea pigs when compared with wild-type (WT) R. rickettsii (Kleba et al., 2010), yet the explanation for reduced fever and the pathogenic role for Sca2 in vivo remains unclear. Additionally, Sca2 is not essential for dissemination of R. parkeri within ticks (Harris et al., 2018).

A second virulence strategy employed by intracellular pathogens is the ability to avoid autophagy, which for R. parkeri requires the abundant, conserved outer membrane protein B (OmpB) (Engström et al., 2019; Engström et al., 2021). ompB mutant R. parkeri are ubiquitylated and restricted by antimicrobial autophagy in mouse macrophages, and OmpB is important for R. parkeri infection of internal organs in WT mice and for causing lethal disease in IFN receptor-deficient mice after i.v. infection (Burke et al., 2020; Engström et al., 2019). However, the role for R. parkeri OmpB upon i.d. infection remains unknown. An improved mouse model may improve our understanding of how conserved virulence factors including Sca2 and OmpB enhance rickettsial pathogenesis.

Here, we use IFN receptor-deficient mice to examine the effects of i.d. inoculation of R. parkeri, mimicking the natural route of infection. We observe skin lesions that appear similar to human eschars, as well as disseminated lethal disease with as few as 10 bacteria. Using this model, we find that Sca2 promotes dissemination and is required for causing lethality and that OmpB contributes to eschar formation and to lethal disease. We demonstrate that immunization with sca2 or ompB mutant R. parkeri protects IFN receptor-deficient mice against subsequent challenge with WT bacteria, revealing live-attenuated vaccine candidates. Our study establishes a mouse model to investigate numerous aspects of Rickettsia pathogenesis, including eschar formation, virulence factors, and immunity. More broadly, this work also reveals that a potent, redundant IFN response protects mice from eschar-associated rickettsiosis.

Results

Ifnar1-/-;Ifngr1-/- mice are susceptible to eschar-associated rickettsiosis

We sought to develop an i.d. murine infection model to better recapitulate the natural route of tick-borne R. parkeri infection. WT, single mutant Tlr4-/-, Ifnar1-/-, or Ifngr1-/-, and DKO Ifnar1-/-;Ifngr1-/- C57BL/6J mice, as well as outbred WT CD-1 mice, were infected i.d. with 107 WT R. parkeri and monitored over time. No or minor dermal lesions appeared at the site of infection in WT, single mutant Tlr4-/-, Ifnar1-/-, or Ifngr1-/- C57BL/6J mice or CD-1 mice (Figure 1, Figure 1—figure supplement 1a). In contrast, DKO Ifnar1-/-;Ifngr1-/- C57BL/6J mice developed delimited skin lesions measuring >1 cm in diameter that were necrotic, hardened, non-pruritic, and surrounded by an indurated red halo (Figure 1b), similar to human eschars (Figure 1c; Paddock et al., 2008; Paddock et al., 2004; Kaskas, 2014; Cragun et al., 2010; Herrick et al., 2016). In some cases, tails of DKO Ifnar1-/-;Ifngr1-/- or single mutant Ifngr1-/- mutant mice became inflamed after i.d. or i.v. infection (Figure 1—figure supplement 1b). These findings demonstrate that interferons redundantly control disease caused by R. parkeri in the skin and that i.d. infection of DKO Ifnar1-/-;Ifngr1-/- mice recapitulates the hallmark manifestation of human disease caused by R. parkeri.

Figure 1 with 1 supplement see all
I.d. infection of Ifnar1-/-;Ifngr1-/- mice with R. parkeri elicits skin lesions that are grossly similar to human eschars.

(a) Representative images of WT, Ifnar1-/-, Ifngr1-/-, and Tlr4-/- single mutant mice, infected intradermally with 107 WT R. parkeri PFU, at 8 d.p.i. WT mice were injected with PBS. White arrows indicate the infection site on the right flank of the mouse. Scale bar, 1 cm. Data are representative of three independent experiments. (b) Representative images of a DKO Ifnar1-/-;Ifngr1-/- mouse after i.d. inoculation with 107 R. parkeri PFU. Data are representative of three independent experiments. The white arrow indicates the injection site on the right flank of the mouse. Scale bar, 1 cm. (c) Gross pathology of a human R. parkeri infection, reproduced from Figure 2a of Paddock et al., 2008, with permission from Oxford Academic. It is not covered by the CC-BY 4.0 license and further reproduction of this panel would require permission from the copyright holder. (d) Representative images of Ifnar1-/-;Ifngr1-/- mice infected intradermally with the indicated amounts of WT R. parkeri at 9 d.p.i. Scale bar, 1 cm. Data are representative of two independent experiments.

© 2008, Oxford Academic Permissions. Gross pathology of a human R. parkeri infection, reproduced from Figure 2a of Paddock et al., 2008, with permission from Oxford Academic. It is not covered by the CC-BY 4.0 license and further reproduction of this panel would need permission from the copyright holder.

Our previous observations using the i.v. route revealed dose-dependent lethality in Ifnar1-/-;Ifngr1-/- mice, with 107 R. parkeri eliciting 100% lethality and 105 R. parkeri eliciting no lethality (Burke et al., 2020). R. parkeri are present in tick saliva at a concentration of approximately 104 per 1 μl, and approximately 107 R. parkeri are found in tick salivary glands (Suwanbongkot et al., 2019). However, the number of bacteria delivered from tick infestation likely varies depending on many factors, and we therefore sought to examine the effects of different doses of R. parkeri upon i.d. infection of Ifnar1-/-;Ifngr1-/- mice. We observed skin lesion formation at all infectious doses, from 107 to 10 bacteria (Figure 1d), suggesting that i.d. infection of Ifnar1-/-;Ifngr1-/- mice elicits lesions with doses similar to what is delivered by tick infestation.

We next sought to quantitatively evaluate the effects of i.d. infection by monitoring animal weight, body temperature, the degree of lesion formation, and lethality. Intradermally infected DKO Ifnar1-/-;Ifngr1-/ mice lost significant body weight (Figure 2a, Figure 2—figure supplement 1a) and body temperature (Figure 2b; animals were euthanized when body temperature fell below 90°F / 32.2°C) when compared with WT mice, whereas infected single mutant Tlr4-/-, Ifnar1-/-, or Ifngr1-/- mice did not. To evaluate lesion severity, we scored lesions upon infection with different doses of R. parkeri. Whereas 107 bacteria elicited similar responses as 105, 104, 103, and 102 bacteria (Figure 2c), lesions were less severe when mice were infected with 101 bacteria compared with 107 bacteria. If mice survived, lesions healed over the course of approximately 15–40 days post infection (d.p.i.) at all doses (Figure 2—figure supplement 1b).

Figure 2 with 1 supplement see all
I.d. infection of Ifnar1-/-;Ifngr1-/- mice by R. parkeri elicits disseminated, lethal disease.

(a) Weight changes over time in mice infected i.d. with R. parkeri. Data are shown as a percentage change to initial weight. In the left panel, all mice were infected with 107 PFU of R. parkeri: n = 7 (WT), n = 11 (Ifnar1-/-), n = 7 (Ifngr1-/-), n = 9 (DKO Ifnar1-/-;Ifngr1-/-), and n = 4 (Tlr4-/-) individual mice. In the right panel, DKO Ifnar1-/-;Ifngr1-/- mice were infected with the indicated R. parkeri PFU: n = 7 (105), n = 7 (104), n = 8 (103), n = 7 (102), n = 7 (101) individual mice. WT data is the same in both panels. Data for each genotype are combined from two or three independent experiments. (b) Temperature changes over time in mice intradermally infected with 107 R. parkeri PFU. Each line is an individual mouse. Mice were euthanized if their temperature fell below 90°F, as indicated by the dotted line. Data are the combination of three independent experiments with n = 7 (WT) and n = 9 (Ifnar1-/-;Ifngr1-/-) individual mice. (c) Analysis of gross skin pathology after i.d. infection. Ifnar1-/-;Ifngr1-/- mice were infected with the indicated PFU of R. parkeri and monitored over time. WT mice were infected with 107 R. parkeri PFU. Data are the combination of three independent experiments for WT and the 107 dose in Ifnar1-/-Ifngr1-/- mice; data for all other doses are the combination of two independent experiments. n = 9 (107), n = 5 (105), n = 5 (104), n = 8 (103), n = 7 (102), n = 7 (101), and n = 7 (WT) individual mice. (d) Mouse survival after i.d. infection with R. parkeri. In the left panel, all mice were infected with 107 R. parkeri PFU: n = 7 (WT), n = 11 (Ifnar1-/-), n = 7 (Ifngr1-/-), n = 4 Tlr4-/-, and n = 12 (DKO Ifnar1-/-;Ifngr1-/-) individual mice. Data are the combination of three separate experiments for WT, Ifnar1, and DKO Ifnar1-/-;Ifngr1-/- and two separate experiments for Ifngr1-/- and Tlr4-/-. In the right panel, DKO Ifnar1-/-;Ifngr1-/- mice were infected with the indicated amounts of R. parkeri. Data are the combination of two independent experiments: n = 7 (105), n = 7 (104), n = 8 (103), n = 7 (102), and n = 7 (101) individual mice. (e) Bacterial burdens in organs of intradermally infected WT and Ifnar1-/-;Ifngr1-/-mice. Mice were intradermally inoculated with 107 R. parkeri, and spleens and livers were harvested and plated for p.f.u. at 72 h.p.i. Dotted lines indicate the limit of detection. Data are the combination of two independent experiments. n = 4 (WT) and 7 (Ifnar1-/-;Ifngr1-/-) individual mice. Data in (a), (c) are the mean ± SEM. Statistical analyses in (a) used a two-way ANOVA where each group was compared to WT at t = 20 d.p.i. Statistical analyses in (c) used a two-way ANOVA at t = 20 d.p.i. Statistical analyses in (d) used a log-rank (Mantel−Cox) test to compare Ifnar1-/- to DKO Ifnar1-/-;Ifngr1-/- at each dose. Statistical analysis in (e) used a two-tailed Mann–Whitney U test. NS, not significant; **p<<0.01; ***p<0.001; ****p<0.0001.

Figure 2—source data 1

I.d. infection of Ifnar1-/-;Ifngr1-/- mice by R. parkeri elicits disseminated, lethal disease.

https://cdn.elifesciences.org/articles/67029/elife-67029-fig2-data1-v2.xlsx

To investigate whether i.d. infection by R. parkeri caused lethal disease, we monitored mouse survival over time. Upon i.d. delivery of 107 R. parkeri, 8 of 12 Ifnar1-/-;Ifngr1-/- mice exhibited lethargy, paralysis, or body temperatures below 90oF, at which point they were euthanized, whereas delivery of the same dose of bacteria to WT and single mutant mice did not elicit lesions and all survived (Figure 2d). Lower doses of R. parkeri also elicited body weight loss (Figure 2a), body temperature loss (Figure 2—figure supplement 1), and lethal disease (Figure 2d) in Ifnar1-/-;Ifngr1-/- mice. Degrees of lethality between different doses in Ifnar1-/-;Ifngr1-/- mice were not significantly different from one another, and the cause of lethality in this model remains unclear. Nevertheless, these findings reveal that i.d. infection can cause lethal disease in Ifnar1-/-;Ifngr1-/- mice with ~10,000-fold lower dose of bacteria than i.v. infection.

It remained unclear whether i.d. infection could also be used to model dissemination from the skin to internal organs. We therefore evaluated bacterial burdens in spleens and livers of WT and Ifnar1-/-;Ifngr1-/- mice at 5 d.p.i. by measuring R. parkeri plaque-forming units (p.f.u.). Bacteria were not recoverable from spleens and livers of intradermally infected WT mice, suggesting that they did not disseminate from the skin to internal organs in high numbers (Figure 2e). In contrast, bacteria were recovered from spleens and livers of intradermally infected Ifnar1-/-;Ifngr1-/- mice at 5 d.p.i. (Figure 2e). This demonstrates that i.d. infection of Ifnar1-/-;Ifngr1-/- mice with R. parkeri causes systemic infection and can be used as a model for dissemination from the skin to internal organs.

Histology and immunohistochemistry reveal necrosis, inflammation, and bacteria within neutrophils and macrophages

To examine whether lesions in Ifnar1-/-;Ifngr1-/- mice had similar inflammation and necrosis as those observed in human eschars at the tissue and cellular level, we performed histologic evaluation to further characterize the tissue alterations of i.d.-infected Ifnar1-/-;Ifngr1-/- mice and used anti-Rickettsia immunohistochemistry to identify the infected cell types in the skin. WT mice infected i.d. with 103 R. parkeri exhibited no discernible inflammation in the skin at 4, 7, or 12 d.p.i. (Figure 3a). In contrast, at 4 d.p.i., Ifnar1-/-;Ifngr1-/- mice infected with 103 R. parkeri exhibited mild inflammation characterized by dermal inflammatory foci composed of neutrophils and macrophages, with high numbers of intralesional rickettsiae (Figure 3b). By 7 d.p.i., the inflammation throughout the skin was severe, with large coalescing foci of predominantly neutrophils and fewer macrophages within areas of fibrosis, associated with abundant rickettsiae. The epidermis had multifocal coagulative necrosis associated with fibrin thrombosis of the underlying dermal capillaries (Figure 3c). The inflammation was still severe and associated with large numbers of intralesional rickettsiae at 12 d.p.i., accompanied by extensive coagulative necrosis of the skin (Figure 3d). Together, this indicates that R. parkeri causes extensive necrosis and inflammatory cell infiltration of the skin of i.d.-infected Ifnar1-/-;Ifngr1-/- mice, with primary staining within neutrophils and macrophages.

Pathology of infected Ifnar1-/-;Ifngr1-/- mice reveals necrosis, inflammation, and rickettsial staining of macrophage and neutrophils.

(a–d) Representative images of the skin from WT and Ifnar1-/-;Ifngr1-/- mice, infected i.d. with 103 R. parkeri. Top row panels are skin stained with hematoxylin and eosin. Bottom row panels are a nearby Z plane, stained with an anti-Rickettsia antibody (brown). (e) Representative image of lungs from Ifnar1-/-;Ifngr1-/- mice, infected i.d. with 103 R. parkeri at 7 d.p.i. (f) Representative image of brains (choroid plexus) from Ifnar1-/-;Ifngr1-/- mice, infected i.d. with 106 R. parkeri at 7 d.p.i. (g, h) Representative images of livers and spleens from WT and Ifnar1-/-;Ifngr1-/- mice, infected i.v. with 107 R. parkeri at 7 d.p.i. The arrow in (g) for WT mice indicates rickettsial staining within a Kupffer cell. The asterisk for Ifnar1-/-;Ifngr1-/- indicates a granuloma. Scale bars are indicated in each panel. Data are representative of two independent replicates.

We also examined internal organ tissues of mice infected i.d. by performing immunohistochemistry of brain and lung at 7 d.p.i., as infection of these organs may result in lethality. In the lungs of Ifnar1-/-;Ifngr1-/- mice, inflammatory foci were scattered throughout the parenchyma, with several cells morphologically compatible with neutrophils containing rickettsiae (Figure 3e). In one tissue section, rickettsiae were also evident in some cells lining small vessels and therefore interpreted as endothelial cells. In the brain, rickettsial immunostaining was not observed after i.d. infection with 103 R. parkeri, but infection with a higher dose (106) resulted in low number of rickettsial bacteria in the leptomeninges and the choroid plexus, in regions moderately infiltrated by neutrophils and macrophages (Figure 3f). These data demonstrate that R. parkeri disseminates from the skin to internal organs, where they are again primarily found in macrophages and neutrophils.

Finally, we used histology and immunohistochemistry after i.v. infection to analyze spleens and livers, as R. parkeri is abundant and easily recoverable from these organs after i.v. infection (Burke et al., 2020; Engström et al., 2019). In WT mice, we observed little to no inflammation or lesions. In contrast, both organs of Ifnar1-/-;Ifngr1-/- mice had fibrinoid vascular wall degeneration, endothelial hypertrophy, fibrin thrombi in medium caliber vessels, and marked inflammation that was composed predominantly of macrophages. In WT mice, rickettsiae were infrequent and were found in macrophages in the red pulp of the spleen and scarcely throughout the liver in Kupffer cells (Figure 3g,h; Bonell et al., 2017). In contrast, in Ifnar1-/-;Ifngr1-/- mice, rickettsiae were abundant in the splenic red pulp, primarily infecting histiocytes/macrophages (Figure 3g). In the liver of Ifnar1-/-;Ifngr1-/- mice, rickettsiae were abundant in macrophages within the granulomas (Figure 3h). We did not observe any immunostaining for Rickettsia in endothelial cells or vessels in the spleen or liver after i.v. infection. Together, these findings reveal that macrophages are the primary cell type affected by R. parkeri in the spleen and liver after i.v. infection.

Ifnar1-/-;Ifngr1-/- mice do not succumb to intradermal infection with Sca2 mutant R. parkeri

We next examined whether Ifnar1-/-;Ifngr1-/- mice could be used to characterize R. parkeri virulence factors. Sca2 is a surface protein that mediates actin-based motility in rickettsial pathogens; however, its contribution to virulence in vivo remains unclear. We examined if i.v. and i.d. infections of WT and Ifnar1-/-;Ifngr1-/- mice could reveal a pathogenic role for R. parkeri Sca2. Upon i.v. infection with 5 × 106 bacteria (Figure 4) or 107 bacteria (Figure 4b), we observed that sca2::Tn mutant R. parkeri caused reduced lethality compared to WT bacteria. Similarly, i.d. infection with sca2::Tn mutant bacteria elicited significantly less lethality (Figure 4c) and weight loss (Figure 4d) as compared to WT bacteria and no severe temperature loss (Figure 4—figure supplement 1a). Although we sought to evaluate infection using a sca2 complement strain of R. parkeri, our attempts to generate such a strain were unsuccessful. As an alternative strategy, we examined whether the transposon insertion itself had an effect on R. parkeri survival in vivo. We evaluated infection of an R. parkeri strain that harbors a transposon insertion in MC1_RS08740 (previously annotated as MC1_05535), which has no known role in virulence (Engström et al., 2019). I.v. infection with MC1_RS08740::Tn R. parkeri caused lethality to a similar degree as WT R. parkeri (Figure 4a), demonstrating that the transposon likely does not significantly impact R. parkeri fitness in vivo. Together, these findings suggest that the actin-based motility factor Sca2 is required for causing lethal disease in Ifnar1-/-;Ifngr1-/- mice.

Figure 4 with 3 supplements see all
R. parkeri Sca2 contributes to dissemination from skin to spleens and livers.

(a) Survival of Ifnar1-/-;Ifngr1-/- mice upon i.v. infection with 5 × 106 PFU of R. parkeri. n = 7 (WT), 10 (sca2::Tn), and 7 (MC1_RS08740::Tn R. parkeri) individual mice. Data are the combination of two independent experiments. (b) Survival of Ifnar1-/-;Ifngr1-/- mice upon i.v. infection with 107 R. parkeri. n = 7 (WT) and 10 (sca2::Tn) individual mice. Data are the combination of two independent experiments. (c) Survival of Ifnar1-/-;Ifngr1-/- mice upon i.d. infection with 107 PFU of R. parkeri. n = 6 (WT) and 8 (sca2::Tn) individual mice. Data are the combination of two independent experiments. (d) Weight changes of Ifnar1-/-;Ifngr1-/- mice upon i.d. infection with 107 PFU of R. parkeri. n = 6 (WT) and 8 (sca2::Tn) individual mice. Data are the combination of two independent experiments. (e) Analysis of gross skin pathology after i.d. infection. Ifnar1-/-;Ifngr1-/- mice were infected with 107 PFU of the indicated strains of R. parkeri and monitored over time. n = 9 (WT) and 8 (sca2::Tn) individual mice. Data are the combination of two independent experiments. (f) Representative images of fluorescence in mouse skin after i.d. infection with 106 R. parkeri and delivery of a fluorescent dextran, at 5 d.p.i. Scale bars, 1 cm. The larger black dashed circle represents the area that was measured for fluorescence for each sample, as indicated in (g) (~80,000 pixels). The smaller, black-dashed circle represents of the injection site area that was measured for fluorescence for each sample, as indicated in Figure 4—figure supplement 1 (~7800 pixels). (g) Quantification of fluorescence in mouse skin after i.d. infection. Mice were infected with 107 R. parkeri, and 150 µl fluorescent dextran was intravenously delivered at 5 d.p.i. Skin was harvested 2 hr later, and fluorescence was measured using a fluorescence imager. Data indicate measurements of larger areas of skin, as indicated in (f) by the larger black circle. n = 6 (WT R. parkeri) and n = 6 (sca2::Tn R. parkeri) individual Ifnar1-/-;Ifngr1-/- mice; n = 6 (WT R. parkeri) individual WT mice. For each experiment, the average of uninfected samples was normalized to 100; each sample was divided by the average for uninfected mice and multiplied by 100; the dotted horizontal line indicates 100 arbitrary units, corresponding to uninfected (unin.) mice. Data are the combination of two independent experiments. (h) Quantification of Listeria monocytogenes abundance in organs of WT C57BL/6J mice upon i.v. infection with 104 bacteria, at 72 h.p.i. Data are the combination of two independent experiments. n = 6 (WT), n = 7 (ΔactA) individual mice. (i) Quantification of R. parkeri abundance in spleens and livers of WT C57BL/6J mice upon i.v. infection, at 72 h.p.i. Data are the combination of two independent experiments. n = 10 (WT) and 10 (Sca2::Tn) individual mice. (j) Quantification of R. parkeri abundance in organs upon i.d. infection with 107 PFU of R. parkeri. n = 7 (WT) and 7 (sca2::Tn) individual mice. Data are the combination of two independent experiments. Data for WT R. parkeri in Ifnar1-/-;Ifngr1-/- mice are the same as in Figure 2e. (k) Quantification of R. parkeri abundance in organs upon i.d. infection with 105 PFU of R. parkeri. n = 7 (WT) and 6 (sca2::Tn). Data are the combination of two independent experiments. Solid horizontal bars in (g) indicate means; solid horizontal bars in (h–k) indicate medians; error bars indicate SEM. Statistical analyses for survival in (a–c) used a log-rank (Mantel–Cox) test. Statistical analysis in (d) used a two-way ANOVA at t = 20. Statistical analysis in (e) used a two-way ANOVA from 0 to 10 d.p.i. Statistical analyses in (g) used a two-tailed Student’s T test. Statistical analyses in (h–k) used a two-tailed Mann–Whitney U test. The fold change in (hk) indicates differences of medians. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.

Figure 4—source data 1

R. parkeri Sca2 contributes to dissemination from skin to spleens and livers.

https://cdn.elifesciences.org/articles/67029/elife-67029-fig4-data1-v2.xlsx

Ifnar1-/-;Ifngr1-/- mice exhibit similar skin lesion formation and vascular damage upon i.d. infection with WT and sca2::Tn R. parkeri

We next examined whether Sca2 facilitates R. parkeri dissemination throughout the skin and whether Sca2 is required for lesion formation. Unexpectedly, upon i.d. inoculation, Ifnar1-/-;Ifngr1-/- mice infected with sca2::Tn mutant bacteria developed skin lesions that were of similar severity to lesions caused by WT R. parkeri; however, the lesions elicited by sca2 mutant bacteria appeared significantly earlier than lesions caused by WT bacteria (Figure 4e). Further examinations will be required to better evaluate this observation; however, it may suggest that actin-based motility enables R. parkeri to avoid a rapid onset of inflammation in the skin. To evaluate R. parkeri dissemination within the skin, we used a fluorescence-based assay that measures vascular damage as a proxy for pathogen dissemination (Glasner et al., 2017). Mice were intradermally infected with WT and sca2::Tn R. parkeri. At 5 d.p.i., fluorescent dextran was intravenously delivered, and fluorescence was measured at the infection site (Figure 4f, representative small black circle) and in the surrounding area (Figure 4f, representative large black circle). No significant differences were observed when comparing WT and sca2::Tn R. parkeri infections in Ifnar1-/-Ifngr1-/- mice using an infectious dose of 107 R. parkeri in the larger surrounding area (Figure 4g) or at the site of infection (Figure 4—figure supplement 2a). Similar results were observed upon infection with 106 or 105 bacteria (Figure 4—figure supplement 2b,c). However, significantly more fluorescence was observed in the skin of infected Ifnar1-/-;Ifngr1-/- mice as compared to WT mice (Figure 4g), demonstrating that interferons protect against increased vascular permeability during R. parkeri infection. Fluorescence was also measured in spleens and livers; however, no differences between control or experiment groups was observed, suggesting that this assay as described is most appropriate for the skin. Together, the gross pathological analysis and fluorescence-based assay suggest that Sca2 likely does not significantly enhance R. parkeri spread throughout the skin during i.d. infection of Ifnar1-/-;Ifngr1-/- mice.

R. parkeri Sca2 promotes dissemination from the skin to spleens and livers

Among the factors that mediate actin-based motility, the Listeria monocytogenes actin-based motility factor ActA is one of the best understood. ActA enables L. monocytogenes to spread from cell to cell (Choe and Welch, 2016; Lamason and Welch, 2017), escape antimicrobial autophagy (Cheng et al., 2018; Mitchell et al., 2018; Yoshikawa et al., 2009b; Yoshikawa et al., 2009a), proliferate in mouse organs after i.v. infection (Auerbuch et al., 2001; Le Monnier et al., 2007), and cause lethal disease in mice (Goossens et al., 1992; Brundage et al., 1993). We initially hypothesized that R. parkeri Sca2 plays a similar pathogenic role in vivo to ActA, which we found is required for bacterial survival in spleens and livers upon i.v. delivery (Figure 4h), in agreement with previous experiments (Auerbuch et al., 2001; Le Monnier et al., 2007). However, when we examined bacterial burdens upon i.v. infection of Ifnar1-/-;Ifngr1-/- mice with R. parkeri, similar amounts of WT and sca2::Tn bacteria were recovered in spleens (Figure 4i). We were also surprised to find that significantly more sca2::Tn than WT R. parkeri were recovered in livers (Figure 4i). The explanation for higher sca2::Tn burdens in livers remains unclear. Nevertheless, these data reveal that Sca2 is likely not essential for R. parkeri survival in blood, invasion of host cells, or intracellular survival in spleens and livers.

We next evaluated the role for Sca2 in R. parkeri dissemination by measuring p.f.u. in spleens and livers following i.d. infection of Ifnar1-/-;Ifngr1-/- mice. After i.d. infection, sca2::Tn mutant bacteria were ~20-fold reduced in their abundance in spleens and ~2-fold reduced in their abundance in livers as compared to WT R. parkeri (Figure 4j). Similar results were seen upon i.d. infection with lower doses of sca2::Tn and WT bacteria (Figure 4k). Together, these results suggest that Sca2 is required for R. parkeri dissemination from the skin to internal organs.

R. parkeri actin-based motility does not contribute to avoiding innate immunity in vitro

Sca2-mediated actin-based motility is required for efficient plaque formation and cell to cell spread by R. parkeri in vitro (Reed et al., 2014; Kleba et al., 2010). However, it remains unclear if Sca2 enables R. parkeri to escape detection or restriction by innate immunity. The actin-based motility factor ActA enables L. monocytogenes to avoid autophagy (Yoshikawa et al., 2009b; Yoshikawa et al., 2009a), and the antimicrobial guanylate binding proteins (GBPs) inhibit Shigella flexneri actin-based motility (Piro et al., 2017). We therefore sought to evaluate whether Sca2-mediated actin-based motility enables R. parkeri to evade innate immunity in vitro. We found that the sca2::Tn mutant grew similarly to WT bacteria in endothelial cells (Figure 4—figure supplement 3a), consistent with previous reports in epithelial cells (Reed et al., 2014; Kleba et al., 2010). We also examined whether Sca2 contributed to R. parkeri survival or growth in bone marrow-derived macrophages (BMDMs), which can restrict other R. parkeri mutants that grow normally in endothelial cells (Engström et al., 2019). However, no significant difference in bacterial survival was observed between WT and sca2::Tn bacteria in BMDMs in the presence or absence of IFN-β (Figure 4—figure supplement 3b). WT and sca2 mutant R. parkeri also elicited similar amounts of host cell death (Figure 4—figure supplement 3c) and IFN-I production (Figure 4—figure supplement 3d). Moreover, we found that the anti-rickettsial factor GBP2 localized to the surface of sca2::Tn mutant R. parkeri at similar frequency as with WT bacteria in the presence or absence of IFN-β (Figure 4—figure supplement 3e,f). Together, these data suggest that Sca2 does not significantly enhance the ability of R. parkeri to evade interferon-stimulated antimicrobial genes or inflammasomes in vitro.

Ifnar1-/-;Ifngr1-/- mice exhibit less severe skin lesions upon infection with a highly attenuated R. parkeri mutant

Because sca2 mutant R. parkeri showed no defect in eschar formation compared to WT, it remained unclear whether skin lesion formation in Ifnar1-/-;Ifngr1-/- mice was influenced by bacterial virulence factors. We therefore investigated i.d. infection with ompB::TnSTOP R. parkeri, which harbors both a transposon and a stop codon in ompB but no other mutations as determined by whole genome sequencing (Engström et al., 2019). ompB mutant R. parkeri are severely attenuated in mice, as evaluated by measuring p.f.u. in organs of WT mice after i.v. infection (Engström et al., 2019) or by measuring lethality in Ifnar1-/-;Ifngr1-/- mice after i.v. infection (Burke et al., 2020). In contrast with WT bacteria, i.d. infection of Ifnar1-/-;Ifngr1-/- mice with ompB::TnSTOP R. parkeri caused no lethality (Figure 5a) or weight loss (Figure 5b). The ompB::TnSTOP mutant R. parkeri also caused significantly less severe skin lesions than WT bacteria (Figure 5c). These findings suggest that Ifnar1-/-;Ifngr1-/- mice can be used as a model to identify bacterial genes important for eschar formation.

ompB mutant R. parkeri elicit no lethality and reduced skin lesion formation in Ifnar1-/-;Ifngr1-/-mice.

(a) Survival of Ifnar1-/-;Ifngr1-/- mice upon i.d. infection with 107 PFU of R. parkeri. n = 6 (WT) and 8 (ompB::TnSTOP) individual mice. Data are the combination of two independent experiments. Data for WT are the same as in Figure 4c. (b) Weight changes of Ifnar1-/-;Ifngr1-/- mice upon i.d. infection with 107 PFU of R. parkeri. n = 6 (WT) and 8 (ompB::TnSTOP) individual mice. Data are the combination of two independent experiments. Data for WT are the same as in Figure 4d. (c) Analysis of gross skin pathology after i.d. infection. Ifnar1-/-;Ifngr1-/- mice were infected with 107 of the indicated strains of R. parkeri and monitored over time. n = 9 (WT) and 8 (ompB::TnSTOP) individual mice. Data are the combination of two independent experiments. Data for WT are the same as in Figure 4e. Error bars indicate SEM. Statistical analyses in (a) used a log-rank (Mantel–Cox) test. Statistical analysis in (b) used a two-way ANOVA from 0 to 20 d.p.i. Statistical analysis in (c) used a two-way ANOVA from 0 to 10 and 20 d.p.i.; **p<0.01; ***p<0.001.

Figure 5—source data 1

ompB mutant R. parkeri elicit no lethality and reduced skin lesion formation in Ifnar1-/-;Ifngr1-/-mice.

https://cdn.elifesciences.org/articles/67029/elife-67029-fig5-data1-v2.xlsx

Immunizing Ifnar1-/-;Ifngr1-/- mice with attenuated R. parkeri mutants protects against subsequent rechallenge

There is currently no available vaccine to protect against SFG Rickettsia, which can cause severe and lethal human disease (Osterloh, 2017; Dantas-Torres, 2007), and identifying mouse models that develop protective immunity to R. parkeri would aid investigations into identifying live attenuated vaccine candidates. We therefore examined whether immunization with attenuated R. parkeri mutants would protect against subsequent re-challenge with a lethal dose of WT bacteria. Ifnar1-/-;Ifngr1-/- mice were immunized i.v. with 5 × 106 sca2::Tn or ompB::TnSTOP R. parkeri and 40 d later were re-challenged i.v. with 107 WT R. parkeri, which is approximately 10 times a 50% lethal dose (LD50) (Burke et al., 2020). All mice immunized with sca2 or ompB mutant R. parkeri survived, whereas all naïve mice succumbed to i.v. challenge by 6 d.p.i. (Figure 6a). Upon i.v. rechallenge, mice immunized with ompB and sca2 mutants also did not lose significant weight (Figure 6b) or body temperature (Figure 6c). We next examined whether immunized mice were protected from i.d. rechallenge. Ifnar1-/-;Ifngr1-/- mice were immunized with ompB or sca2 mutant R. parkeri by i.d. infection or with sca2 mutant R. parkeri by i.v infection and rechallenged 40 d later by i.d. infection with 105 WT bacteria. Immunized mice were protected from lethal disease (Figure 6d) and had less severe skin lesions than naïve mice (Figure 6e). These data indicate that attenuated R. parkeri mutants elicit robust protective immune responses, and that Ifnar1-/-;Ifngr1-/- mice may serve as tools to develop live attenuated R. parkeri vaccine candidates.

ompB and sca2 mutant R. parkeri elicit immunity in Ifnar1-/-Ifngr1-/- mice.

(a) Survival of immunized and naïve Ifnar1-/-;Ifngr1-/- mice upon i.v. R. parkeri infection. Immunized mice were first infected with 5 × 106 PFU of sca2::Tn or 107 PFU of ompB:TnSTOP R. parkeri and were re-challenged 40 d later with 107 WT R. parkeri. n = 6 (naïve); n = 5 (sca2::Tn immunized); n = 5 (ompB::TnSTOP immunized) individual mice. Data are the combination of two independent experiments. (b) Weight changes over time in mice infected i.d. with 107 R. parkeri. Data are representative of two independent experiments. n = 3 (naïve); n = 3 (sca2::Tn immunized); n = 3 (ompB::Tnstop immunized) individual mice. Each line represents an individual mouse. (c) Temperature changes over time in mice infected i.d. with 107 R. parkeri. Data are representative from two independent experiments. n = 3 (naïve); n = 3 (sca2::Tn immunized); n = 3 (ompB::TnSTOP immunized) individual mice. Each line represents an individual mouse. (d) Survival of naïve or immunized Ifnar1-/-;Ifngr1-/- mice that were infected i.d. with 105 R. parkeri. (e) Skin lesion pathology of naïve or immunized Ifnar1-/-;Ifngr1-/- mice that were infected i.d. with 105 R. parkeri; n = 7 (naïve); n = 8 (sca2::Tn i.d. immunized); n = 5 (sca2::Tn i.v. immunized); n = 8 (ompB::TnSTOP) individual mice. Statistical analyses in (a, d) used a log-rank (Mantel–Cox) test to compare each group of immunized mice to naïve mice; **p<0.01. Statistical analysis in (e) used a two-way ANOVA from 0 to 10 and 20 d.p.i.; **p<0.01; ***p<0.001.

Figure 6—source data 1

ompB and sca2 mutant R. parkeri elicit immunity in Ifnar1-/-Ifngr1-/- mice.

https://cdn.elifesciences.org/articles/67029/elife-67029-fig6-data1-v2.xlsx

Discussion

In this study, we find that IFN-I and IFN-γ redundantly protect inbred mice from eschar-associated rickettsiosis and disseminated disease by R. parkeri. Eschar formation is a hallmark clinical feature of human disease caused by R. parkeri (Paddock et al., 2008; Paddock et al., 2004), and thus these findings suggest that the striking difference between human and mouse susceptibilities to R. parkeri may be due to IFN signaling in the skin. Using this mouse model, we uncover a role for R. parkeri Sca2 in dissemination, for OmpB in skin lesion formation, and for both proteins in causing lethal disease. We further demonstrate that attenuated R. parkeri mutants elicit long-lasting immunity, revealing live attenuated vaccine candidates. Obligate cytosolic bacterial pathogens cause a variety of severe human diseases on six continents (Bonell et al., 2017; Abdad et al., 2018), and the animal model described here will facilitate future investigations into rickettsial virulence factors, the host response to infection, and the molecular determinants of human disease.

Our observation that i.d. infection of DKO Ifnar1-/-;Ifngr1-/- mice causes eschar formation highlights the critical importance of interferons in restricting R. parkeri in mice and may reveal a key molecular determinant of human disease. IFN-γ restricts virulent rickettsial species in vitro and in mice, including R. prowazekii (Turco and Winkler, 1983), R. conorii (Feng et al., 1994; Li et al., 1987; Manor and Sarov, 1990), and R. australis (Walker et al., 2001). Moreover, IFN-I has modest anti-rickettsial activity towards R. prowazekii, R. conorii, and R. rickettsii in cell lines in vitro (Turco and Winkler, 1990; Colonne et al., 2011; Hanson, 1991). However, the contribution made by IFN-I in restricting Rickettsia species besides R. parkeri in mice remains unknown (Osterloh, 2017). Importantly, the gross similarities we observe between human eschars (Paddock et al., 2008; Herrick et al., 2016) and skin lesions in Ifnar1-/-;Ifngr1-/- mice may indicate that the IFN response in humans is less well adapted to control R. parkeri than that in mice. Cytokine profiling and mRNA transcript analysis of human rickettsial infections reveals IFN-I and IFN-γ activation (Cillari et al., 1996; Jia et al., 2020; de Sousa et al., 2007); however, it remains unclear whether human interferon-stimulated genes (ISGs) are as protective as mouse ISGs. Future investigations into the ISGs that restrict R. parkeri in mouse versus human cells may improve our understanding of human susceptibility to SFG Rickettsia.

Human eschars resulting from R. parkeri infection are characterized by necrosis of the epidermis, vasculitis of small- to medium-sized dermal vessels, fibrin thrombi, infiltration by macrophages and neutrophils, and infection of macrophage/mononuclear cells (Paddock et al., 2008; Herrick et al., 2016). Eschars elicited by R. parkeri in non-human primates revealed similar histological findings and also bacteria within macrophages and neutrophils (Banajee et al., 2015). Similar histological findings were noted in guinea pigs after intraperitoneal infection with R. parkeri, as well as infection of mononuclear cells (Paddock et al., 2017). In Ifnar1-/-;Ifngr1-/- mice, we observed necrosis, vasculitis, fibrin thrombi, and rickettsial staining that coincided primarily with infiltrating macrophages and neutrophils. We note that R. parkeri primary targeting of macrophages and neutrophils differs from cell types infected by R. rickettsii, which primarily targets endothelial cells (Walker and Ismail, 2008), and therefore infection of Ifnar1-/-;Ifngr1-/- mice with R. parkeri is likely not an appropriate model for lethal Rocky Mountain spotted fever disease. One contrasting finding in eschars of Ifnar1-/-;Ifngr1-/- mice as compared to humans is the number of bacteria observed - we find that the pathogen is numerous throughout the skin of Ifnar1-/-;Ifngr1-/- mice, but their numbers are fewer in reported human eschar biopsies (Paddock et al., 2008; Herrick et al., 2016). This discrepancy may be due to differences in infection kinetics or in interferon-mediated restriction of bacteria. Nevertheless, our pathological findings of infected interferon-receptor deficient mice are similar in many ways to the previous findings in humans, primates, and mice. Our results suggest that interferon receptor-deficient mice may be useful tools for modeling eschar-associated rickettsiosis at the cellular level.

Investigating the IFN response in the skin may also lead to a better understanding of other arthropod-borne diseases. One example may be scrub typhus, caused by Orientia tsutsugamushi (Rajapakse et al., 2017), a prevalent but poorly understood tropical disease endemic to Southeast Asia (Bonell et al., 2017; Kelly et al., 2015; Richards and Jiang, 2020). O. tsutsugamushi elicits eschar formation in humans, but inbred mice do not recapitulate eschar formation during O. tsutsugamushi infection (Sunyakumthorn et al., 2013), similar to R. parkeri. A second example may be Borrelia burgdorferi, a tick-borne pathogen that causes a skin rash at the site of tick bite as a hallmark feature of Lyme disease (Bratton et al., 2008), the most prevalent tick-borne disease in the United States (Bratton et al., 2008; Schwartz et al., 2008). Existing mouse models also do not recapitulate skin rash formation following B. burgdorferi infection (Barthold et al., 1990; Wang et al., 2001). Lastly, other rickettsial pathogens including R. conorii, R. typhi, and R. akari cause no or limited disease in WT C57BL/6 mice (Osterloh, 2017; Anderson and Osterman, 1980; Eisemann et al., 1984; Osterloh et al., 2016) and it remains unclear if interferons redundantly protect mice from these pathogens. Further investigations into how IFNs protect the skin from arthropod-borne pathogens may reveal critical aspects of the innate immune response to zoonotic disease.

Our study further highlights the utility of mouse models that mimic natural routes of infection. Our observation that i.d. infection can cause lethal disease with as few as 10 bacteria, ~ 10,000 fewer bacteria than i.v. infection (Burke et al., 2020), suggests that R. parkeri may be highly adapted to reside in the skin. However, this model could be further improved by investigating the role for tick vector components in pathogenesis. Saliva from ticks, mosquitos, and sand flies enhances pathogenesis of arthropod-borne bacterial, viral, and parasitic pathogens (Pingen et al., 2017; Lestinova et al., 2017; Šimo et al., 2017), and non-human primates inoculated with R. parkeri exhibit altered inflammatory responses when administered after tick-bite (Banajee et al., 2015). This may suggest a potential role for tick vector components such as tick saliva in R. parkeri pathogenesis. Developing improved murine infection models that mimic the natural route of infection, including with tick saliva or the tick vector, is critical to better understand the virulence and transmission of tick-borne pathogens.

Many Rickettsia species, as well as many facultative cytosolic pathogens including L. monocytogenes, undergo actin-based motility to spread from cell to cell. For L. monocytogenes, the actin-based motility factor ActA enables the pathogen to survive in vivo, as actA mutant bacteria are over 1,000-fold attenuated by measuring lethality (Goossens et al., 1992; Brundage et al., 1993) and by enumerating bacteria in spleens and livers of mice after i.v. infection (Auerbuch et al., 2001; Le Monnier et al., 2007). However, the pathogenic role for actin-based motility in the Rickettsiae has remained unclear. We find that Sca2 is not required for intracellular survival in organs upon i.v. infection of Ifnar1-/-;Ifngr1-/- mice, but rather, is required for dissemination from skin to internal organs and lethality upon i.d. infection. Consistent with an important role for Sca2 in pathogenesis, a previous study reported that i.v. infection of guinea pigs with sca2 mutant R. rickettsii did not elicit fever (Kleba et al., 2010). Our results suggest that Sca2-mediated actin-based motility by Rickettsia may facilitate dissemination in host reservoirs, although we cannot rule out other roles for Sca2 that do not involve actin assembly. R. prowazekii and R. typhi, which cause severe human disease, encode a fragmented sca2 gene (Ngwamidiba et al., 2005), and undergo no or dramatically reduced frequency of actin-based motility, respectively (Teysseire et al., 1992; Heinzen et al., 1993). Although it remains unclear why some Rickettsia species lost the ability to undergo actin-based motility, Sca2 is dispensable for R. parkeri dissemination in the tick vector (Harris et al., 2018), suggesting that actin-based motility may play a specific role in dissemination within mammalian hosts.

We find that sca2 or ompB mutant R. parkeri elicit a robust protective immune response in Ifnar1-/-;Ifngr1-/- mice. These findings complement previous observations that sca2 mutant R. rickettsii elicits antibody responses in guinea pigs (Kleba et al., 2010), and expands upon these findings by demonstrating protection from rechallenge and revealing additional vaccine candidates. There are currently limited vaccine candidates that protect against rickettsial disease (Osterloh, 2017). Identifying new vaccine candidates may reveal avenues to protect against tick-borne infections and aerosolized Rickettsia, which are extremely virulent and potential bioterrorism agents (Walker, 2009), as well as against Brill-Zinsser disease, caused by latent R. prowazekii (Osterloh, 2017). Future studies exploring whether attenuated R. parkeri mutants provide immunity against other Rickettsia species are warranted to better define the mechanisms of protection. These findings on immunity may also help develop R. parkeri as an antigen delivery platform. R. parkeri resides directly in the host cytosol for days and could potentially be engineered to secrete foreign antigens for presentation by major histocompatibility complex I. In summary, the mouse model described here will facilitate future investigations into numerous aspects of R. parkeri infection, including actin-based motility and immunity, and may serve as model for other arthropod-borne pathogens.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Biological sample (Mus musculus)WT C57Bl/6JJackson labsStock #: 000664
Biological sample (Mus musculus)DKO Ifnar1-/-;Ifngr1-/-Jackson labsStock #: 029098
Biological sample (Mus musculus)B6.129S2-Ifnar1tm1Agt/Mmjax; aka Ifnar1-/-Jackson labsStock #: 32045-JAXRRID:MMRRC_032045-JAX
Biological sample (Mus musculus)B6.129S7-Ifngr1tm1Agt/J; akaIfngr1-/-Jackson labsStock #: 003288
AntibodyI7205 anti-Rickettsia (Rabbit polyclonal)Dr. Ted HackstadtIHC (1:1000);IF (1:1000)
Biological sample (Rickettsia parkeri)WT R. parkeri strain PortsmouthOriginally from Dr. Chris Paddock (CDC)
Biological sample (Rickettsia parkeri)Sca2::Tn R. parkeriWelch lab (UC Berkeley)PMID:24361066
Biological sample (Rickettsia parkeri)OmpB::TnSTOPR. parkeriWelch lab (UC Berkeley)PMID:31611642

Bacterial preparations

Request a detailed protocol

R. parkeri strain Portsmouth was originally obtained from Dr. Christopher Paddock (Centers for Disease Control and Prevention). To amplify R. parkeri, confluent monolayers of female African green monkey kidney epithelial Vero cells (obtained from UC Berkeley Cell Culture Facility, tested for mycoplasma contamination, and authenticated by mass spectrometry) were infected with 5 × 106 R. parkeri per T175 flask. Vero cells were grown in DMEM (Gibco 11965–092) containing 4.5 g l–1 glucose and 2% fetal bovine serum (FBS; GemCell). Infected cells were scraped and collected at five or 6 d.p.i. when ~90% of cells were rounded due to infection. Scraped cells were then centrifuged at 12,000 g for 20 min at 4°C. Pelleted cells were resuspended in K-36 buffer (0.05 M KH2PO4, 0.05 M K2HPO4, 100 mM KCl, 15 mM NaCl, pH 7) and dounced for ~40 strokes at 4°C. The suspension was then centrifuged at 200 g for 5 min at 4°C to pellet host cell debris. Supernatant containing R. parkeri was overlaid on a 30% MD-76R (Merry X-Ray) gradient solution in ultracentrifuge tubes (Beckman/Coulter Cat 344058). Gradients were centrifuged at 18,000 r.p.m. in an SW-28 ultracentrifuge swinging bucket rotor (Beckman/Coulter) for 20 min at 4°C. These ‘30% prep’ bacterial pellets were resuspended in brain heart infusion (BHI) media (BD, 237500), aliquoted, and stored at −80°C. Titers were determined by plaque assays by serially diluting the R. parkeri in six-well plates containing confluent Vero cells. Plates were spun for 5 min at 300 g in an Eppendorf 5810 R centrifuge and at 24 hr post infection (h.p.i.); the media from each well was aspirated, and the wells were overlaid with 4 ml/well DMEM with 5% FBS and 0.7% agarose (Invitrogen, 16500–500). At 6 d.p.i., an overlay of 0.7% agarose in DMEM containing 2.5 % neutral red (Sigma, N6264) was added. Plaques were then counted 24 hr later. For infections with ompB mutant bacteria, the ompBSTOP::Tn mutant was used, which contains a transposon and an upstream stop codon in ompB, as previously described (Engström et al., 2019).

Deriving bone marrow macrophages

Request a detailed protocol

For obtaining bone marrow, male or female mice were euthanized, and femurs, tibias, and fibulas were excised. Bones were sterilized with 70% ethanol and washed with BMDM media (20% FBS (HyClone), 0.1% β-mercaptoethanol, 1% sodium pyruvate, 10% conditioned supernatant from 3T3 fibroblasts, in DMEM (Gibco) with 4.5 g l–1 glucose and 100 μg/ml streptomycin and 100 U/ml penicillin), and ground with a mortar and pestle. Bone homogenate was passed through a 70 μm nylon cell strainer (Thermo Fisher Scientific, 08-771-2) for particulate removal. Filtrates were then centrifuged at 290 g in an Eppendorf 5810 R centrifuge for 8 min, supernatant was aspirated, and the pellet was resuspended in BMDM media. Cells were plated in 30 ml BMDM media in non-TC-treated 15 cm petri dishes at a ratio of 10 dishes per two femurs/tibias and incubated at 37°C. An additional 30 ml of BMDM media was added 3 d later. At 7 d the media was aspirated, 15 ml cold PBS (Gibco, 10010–023) was added, and cells were incubated at 4°C with for 10 min. BMDMs were scraped from the plate, collected in a 50 ml conical tube, and centrifuged at 290 g for 5 min. PBS was aspirated, and cells were resuspended in BMDM media with 30% FBS and 10% DMSO at 107 cells/ml. One milliliter of aliquots was stored at –80°C for 24 hr in Styrofoam boxes and then moved to long-term storage in liquid nitrogen.

Infections in vitro

Request a detailed protocol

HMEC-1 cells (obtained from the UC Berkeley Cell Culture Facility and authenticated by short-tandem-repeat analysis) were passaged two to three times weekly and grown at 37°C with 5% CO2 in DMEM containing 10 mM L-glutamine (Sigma, M8537), supplemented with 10% heat-inactivated FBS (HyClone), 1 μg/ml hydrocortisone (Spectrum Chemical, CO137), 10 ng/ml epidermal growth factor (Thermo Fisher Scientific, CB40001; Corning cat. no. 354001), and 1.18 mg/ml sodium bicarbonate. HMEC media was prepared every 1–2 months and aliquoted and stored at 4°C. To prepare HMEC-1 cells for infection, cells were treated with 0.25% trypsin-EDTA (Thermo Fisher Scientific); the number of cells was counted using a hemocytometer (Bright-Line), and 3 × 104 cells were plated into 24-well plates 48 hr prior to infection.

To plate macrophages for infection, BMDM aliquots were thawed on ice, diluted into 9 ml of DMEM, centrifuged at 290 g for 5 min in an Eppendorf 5810 R centrifuge, and the pellet was resuspended in 10 ml BMDM media without antibiotics. 5 × 105 cells were plated into 24-well plates. Approximately 16 hr later, ‘30 % prep’ R. parkeri were thawed on ice and diluted into fresh BMDM media to either 106 p.f.u./ml or 2 × 105 p.f.u./ml. Media was then aspirated from the BMDMs and replaced with 500 µl media containing R. parkeri, and plates were spun at 300 g for 5 min in an Eppendorf 5810 R centrifuge. Infected cells were incubated in a humidified CEDCO 1600 incubator set to 33°C and 5% CO2. Recombinant mouse IFN-β (PBL, 12405–1) was added directly to infected cells after infection.

For measuring p.f.u., supernatants from infected BMDMs were aspirated, and each well was washed twice with 500 µl sterile milli-Q-grade water. After adding 1 ml of sterile milli-Q water to each well, macrophages were lysed by repeated pipetting. Serial dilutions of lysates were added to confluent Vero cells in 12-well plates. Plates were spun at 300 g using an Eppendorf 5810 R centrifuge for 5 min at room temperature and incubated at 33°C overnight. At ~16 h.p.i., media was aspirated and replaced with 2 ml/well of DMEM containing 0.7% agarose and 5% FBS (GemCell). At ~6 d.p.i., 1 ml of DMEM containing 0.7% agarose, 1% FBS (GemCell), 200 µg/ml amphotericin B (Invitrogen, 15290–018), and 2.5 % neutral red (Sigma) was added to each well. Plaques were then counted after 24 hr.

Microscopy, LDH, and IFN-I experiments were performed as described (Burke et al., 2020).

Animal experiments

Request a detailed protocol

Animal research was conducted under a protocol approved by the University of California, Berkeley Institutional Animal Care and Use Committee (IACUC) in compliance with the Animal Welfare Act and other federal statutes relating to animals and experiments using animals (Welch lab animal use protocol AUP-2016-02-8426). The University of California, Berkeley IACUC is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International and adheres to the principles of the Guide for the Care and use of Laboratory Animals (National Research Council, 2011). Mouse infections were performed in a biosafety level two facility. All animals were maintained at the University of California, Berkeley campus, and all infections were performed in accordance with the approved protocols. Mice were between 8 and 20 weeks old at the time of initial infection. Mice were selected for experiments based on their availability, regardless of sex. The sex of mice used for survival after i.d. infection and raw data for mouse experiments is provided in the Source Data for each figure. A statistical analysis was not performed to predetermine sample size prior to initial experiments. Initial sample sizes were based on availability of mice and the capacity to process or measure samples within a given time. After the first experiment, a Power Analysis was conducted to determine subsequent group sizes. All mice were of the C57BL/6J background, except for outbred CD-1 mice. All mice were healthy at the time of infection and were housed in microisolator cages and provided chow, water, and bedding. No mice were administered antibiotics or maintained on water with antibiotics. Experimental groups were littermates of the same sex that were randomly assigned to experimental groups. For experiments with DKO mice deficient in Ifnar1 and Ifngr1, mice were immediately euthanized if they exhibited severe degree of infection, as defined by a core body temperature dropping below 90°F or lethargy that prevented normal movement.

Mouse genotyping

Request a detailed protocol

Single mutant Tlr4-/- (Hoshino et al., 1999, Ifnar1-/- Müller et al., 1994, Ifngr1-/- Huang et al., 1993), DKO Ifnar1-/-;Ifngr1-/-, and WT C57BL/6J mice were previously described and originally obtained from Jackson Laboratories. CD-1 mice were obtained from Charles River. For genotyping, ear clips were boiled for 15 min in 60 µl of 25 mM NaOH, quenched with 10 µl Tris–HCl pH 5.5, and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers. Primers used were: Ifnar1 forward (F): CAACATACTACAACGACCAAGTGTG; Ifnar1 WT reverse (R): AACAAACCCCCAAACCCCAG; Ifnar1-/- R: ATCTGGACGAAGAGCATCAGG; Ifngr1 (F): CTCGTGCTTTACGGTATCGC; Ifngr1 (R): TCGCTTTCCAGCTGATGTACT; WT Tlr4 (F): CACCTGATACTTAATGCTGGCTGTAAAAAG; WT Tlr4 (R): GGTTTAGGCCCCAGAGTTTTGTTCTTCTCA; Tlr4-/- (F): TGTTGCCCTTCAGTCACAGAGACTCTG; and Tlr4-/- (R): TGTTGGGTCGTTTGTTCGGATCCGTCG.

Mouse infections

Request a detailed protocol

For mouse infections, R. parkeri was prepared by diluting 30%-prep bacteria into cold sterile PBS on ice. Bacterial suspensions were kept on ice during injections. For i.d. infections, mice were anaesthetized with 2.5% isoflurane via inhalation. The right flank of each mouse was shaved with a hair trimmer (Braintree CLP-41590), wiped with 70% ethanol, and 50 µl of bacterial suspension in PBS was injected intradermally using a 30.5-gauge needle. Mice were monitored for ~3 min until they were fully awake. No adverse effects were recorded from anesthesia. For i.v. infections, mice were exposed to a heat lamp while in their cages for approximately 5 min and then each mouse was moved to a mouse restrainer (Braintree, TB-150 STD). The tail was sterilized with 70% ethanol, and 200 µl of bacterial suspension in sterile PBS was injected using 30.5-gauge needles into the lateral tail vein. Body temperatures were monitored using a rodent rectal thermometer (BrainTree Scientific, RET-3).

For fluorescent dextran experiments, mice were intravenously injected with 150 µl of 10 kDa dextran conjugated with Alexa Fluor 680 (D34680; Thermo Fisher Scientific) at a concentration of 1 mg/ml in sterile PBS (Glasner et al., 2017). As a negative control, mice with no R. parkeri infection were injected with fluorescent dextran. As an additional negative control, uninfected mice were injected intravenously with PBS instead of fluorescent dextran. At 2 hr post-injection, mice were euthanized with CO2 and cervical dislocation, doused with 70% ethanol, and skin surrounding the injection site (approximately 2 cm in each direction) was removed. Connective tissue between the skin and peritoneum was removed, and skin was placed hair-side-up on a 15 cm Petri dish. Skin was imaged with an LI-COR Odyssey CLx (LI-COR Biosciences), and fluorescence was quantified using ImageStudioLite v5.2.5. The skin from mice with no injected fluorescent dextran was used as the background measurement. Skin from mice injected with fluorescent dextran but no R. parkeri was normalized to an arbitrary number (100), and R. parkeri-infected samples were normalized to this value (R. parkeri-infected/uninfected × 100). The number of pixels at the injection site area was maintained across experiments (7,800 for small area and 80,000 for the large area).

All mice in this study were monitored daily for clinical signs of disease throughout the course of infection, such as hunched posture, lethargy, scruffed fur, paralysis, facial edema, and lesions on the skin of the flank and tail. If any such manifestations were observed, mice were monitored for changes in body weight and temperature. If a mouse displayed severe signs of infection, as defined by a reduction in body temperature below 90°F or an inability to move normally, the animal was immediately and humanely euthanized using CO2 followed by cervical dislocation, according to IACUC-approved procedures. Pictures of skin and tail lesions were obtained with permission from the Animal Care and Use Committee Chair and the Office of Laboratory and Animal Care. Pictures were captured with an Apple iPhone 8, software v13.3.1.

For harvesting spleens and livers, mice were euthanized at the indicated pre-determined times and doused with ethanol. Mouse organs were extracted and deposited into 50 ml conical tubes containing 4 ml sterile cold PBS for the spleen and 8 ml PBS for the liver. Organs were kept on ice and were homogenized for ~10 s using an immersion homogenizer (Fisher, Polytron PT 2500E) at ~22,000 r.p.m. Organ homogenates were spun at 290 g for 5 min to pellet the cell debris (Eppendorf 5810 R centrifuge). Twenty microliters of organ homogenates was then serial diluted into 12-well plates containing confluent Vero cells. The plates were then spun at 260 g for 5 min at room temperature (Eppendorf 5810 R centrifuge) and incubated at 33°C. To reduce the possibility of contamination, organ homogenates were plated in duplicate and the second replicate was treated with 50 µg/ml carbenicillin (Sigma) and 200 µg/ml amphotericin B (Gibco). The next day, at approximately 16 h.p.i., the cells were gently washed by replacing the existing media with 1 ml DMEM containing 2% FBS (GemCell). The media were then aspirated and replaced with 2 ml/well of DMEM containing 0.7% agarose, 5% FBS, and 200 µg/ml amphotericin B. When plaques were visible at 6 d.p.i., 1 ml of DMEM containing 0.7% agarose, 1% FBS, and 2.5% neutral red (Sigma) was added to each well, and plaques were counted at 24 h.p.i.

Histology

Request a detailed protocol

For histology, spleens and livers were harvested from infected mice and immediately stored in 10% neutral buffered formalin (Sigma HT501128). Histology was performed by HistoWiz Inc (http://histowiz.com) using a standard operating procedure and fully automated workflow. Samples were processed, embedded in paraffin, and sectioned at 4 μm thickness. BOND Polymer Refine Detection (Leica Biosystems) was used according to manufacturer’s protocol. After staining with hematoxylin and eosin, sections were dehydrated and film coverslipped using a TissueTek-Prisma and Coverslipper (Sakura). Whole slide scanning (40×) was performed on an Aperio AT2 (Leica Biosystems). Histological consultation was blindly performed by a pathologist. Immunohistochemistry was performed with a rabbit anti-Rickettsia I7205 antibody (1:500 dilution; gift from Ted Hackstadt). Shareable links for all histology and immunohistochemistry data are available upon request to the authors.

Statistical analysis

Request a detailed protocol

Statistical parameters and significance are reported in the figure legends. For comparing two sets of data, a two-tailed Student’s T test was performed. For comparing two sets of in vivo p.f.u. data, Mann–Whitney U tests were used. For comparing two survival curves, log-rank (Mantel–Cox) tests were used. For comparing curves of two samples (mouse health, weight, and temperature), two-way ANOVAs were used. For two-way ANOVAs, if a mouse was euthanized prior to the statistical end point, the final value that was recorded for the mouse was repeated until the statistical endpoint. For two-way ANOVAs, if a measurement was not recorded for a timepoint, the difference between values at adjacent time points was used. Data were determined to be statistically significant when p<0.05. Asterisks denote statistical significance as: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001, compared to indicated controls. Error bars indicate standard deviation (SD) for in vitro experiments and standard error of the mean (SEM) for in vivo experiments. All other graphical representations are described in the figure legends. Statistical analyses were performed using GraphPad PRISM v7.0.

Data availability

All data sets generated or analyzed during this study are included in the manuscript and supporting files.

References

    1. Hoshino K
    2. Takeuchi O
    3. Kawai T
    4. Sanjo H
    5. Ogawa T
    6. Takeda Y
    7. Takeda K
    8. Akira S
    (1999)
    Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product
    Journal of Immunology 162:3749–3752.
    1. Kaskas NM
    (2014) Rickettsia parkeri: Eschar diagnosis
    Journal of the American Academy of Dermatology 71:E87–E89.
    https://doi.org/10.1016/j.jaad.2014.03.024

Decision letter

  1. Kim Orth
    Reviewing Editor; HHMI/University of Texas Southwestern Medical Center, United States
  2. Dominique Soldati-Favre
    Senior Editor; University of Geneva, Switzerland

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

Acceptance summary:

This manuscript provides a murine model of Rickettsia parkeri infection, specifically for eschar formation upon rickettsiae infection. The researchers employed employed an intradermal (i.d.) infection model for infection using mice that were deficient in two interferon receptors (Ifnar-/-Ifngr-/-). Their study further describe new molecular mechanisms for rickettsiae infection during eschar formation, thereby, advancing our understanding on Rickettsia-Host Cell interaction.

https://doi.org/10.7554/eLife.67029.sa1

Author response

We thank the eLife editors for inviting this resubmission and the Review Commons reviewers for their thoughtful comments and suggestions on how to improve the manuscript. We also thank the reviewers for describing the study as “highly significant,” “rigorous and reliable as described and can be reproduced by others,” and as “relevant to investigators working in the field of rickettsial diseases and to a broader audience studying mechanisms of intracellular parasitism and host responses.”

As proposed in our revision plan and suggested by all three reviewers, we have now performed histology in infected wild type and in interferon receptor-deficient mice at multiple time points of multiple organs. We also performed immunohistochemistry to identify the infected cell types in the skin, brain, lung, spleen and liver. Importantly, our findings are consistent with the histological findings observed in human eschars and with the observed infection of neutrophils and macrophages in R. parkeri-infected non-human primates and in mice. We feel these experiments have improved the manuscript and added to the strong significance of our findings to the field. We have also addressed all of the additional minor points raised by the reviewers.

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

“Rickettsial eschars are hallmarks of less severe spotted fever diseases. The underlying mechanisms involved in the formation of the eschar caused by pathogenic rickettsiae remains unknown. The authors of this manuscript studied this interesting research question by using Ifnar-/-Ifngr-/- mice and Sca2 or OmpB mutant of R. parkeri. R. parkeri probably is the best rickettsial species to study rickettsial eschar due to the clinical features of R. parkeri rickettsioses and the biosafety level required to work with it. The data presented in the manuscript are very promising. The conclusions are supported by the presented results. For the first time, this study recapitulated human eschar-like skin lesion observed in patients with R. parkeri rickettsioses in the mouse models. More interestingly, mice inoculated with Sca2 mutant of R. parkeri i.d. had less disseminated rickettsiae in tissues, which helps us to understand the mechanisms by which pathogenic rickettsiae cause systemic infection after the arthropod bite.”

Minor comments:

“(1) Figure 2D, it looks likely the lethality of mice i.d. infection with R. parkeri is not dose dependent. For example, mice inoculated with 104 showed greater lethality compared to 107. The authors might want to explain it in the Discussion.”

The reviewer is correct in observing that the lethality between different doses of R. parkeri in Ifnar-/Ifngr-/- mice after intradermal infection is not dose dependent with the current number of mice used per group. We do not understand the reason for this, and more broadly we do not understand the mechanism of lethality. We speculate that there could be a bottleneck that limits bacterial burdens; however, answering this question will require future investigations into the mechanisms of lethality that we feel are beyond the scope of this study. To address the reviewer’s point, we now include this statement: “Degrees of lethality between different doses in Ifnar-/-Ifngr-/- mice were not significantly different from one another, and the cause of lethality in this model remains unclear.”

“(2) Line 202, innate immunity in vitro might need to be revised.”

We agree that the previous description was vague. We changed the description to be more specific and it now reads: “…Sca2 does not significantly enhance the ability of R. parkeri to evade interferon-stimulated genes or inflammasomes in vitro.

“(3) It is unclear what is the unit of the inoculum in animal experiments, PFU?”

Yes, it is PFU. We have now indicated this in the figure legends.

“(4) Line 36, in the study of "Reference 16", C3H/HeN mice, not B6 mice, were used.”

We thank the reviewer for noticing this error and we have changed the text to C3H/HeN.

“(5) The conclusion on eschar will be greatly strengthened if histological analysis is included, particularly whether dermis necrosis is present or not.”

In the revised manuscript we include the results of histology on the skin of wild type and Ifnar-/Ifngr-/- mice at 4, 7, and 12 d post infection (d.p.i.). We also used immunohistochemistry to identify the infected cell types. Images were blindly analyzed by Dr. Inge Langohr, a pathologist with expertise in characterizing rickettsial lesions. These experiments revealed significant epidermal and dermal necrosis, especially at 12 d.p.i., similar to what has been described in R. parkeri-infected humans and non-human primates.

“(6) Line 357, it is not clear what "spinfection" means.”

We have changed this to “infection” for clarity.

“Reviewer #1 (Significance (Required)):

Several approaches employed in the study are new to the field of animal models of the rickettsioses. For example, fluorescent dextran was used to investigating the vascular damage in skin at the inoculation site; body temperature for mice infected with R. parkeri. Overall, the study is highly significant since it has answered the important questions in the research area of spotted fever rickettsioses and employed appropriate approaches. No major concerns were noticed.”

We thank the reviewer for appreciating the significance of this work.

Referees cross commenting

I agree with other reviewers' comments. Thanks for the invite.”

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

“The manuscript utilizes a new model of spotted fever rickettsiosis. Using this model, the authors have determined that knockout of the sca2 or ompB gene attenuates Rickettsia parkeri, and vaccination with the attenuated rickettsiae provides protection against virulent challenge. However, the model is far less than ideal as it has eliminated important effectors of immunity.”

We thank the reviewer for their comments, and we hope to have thoroughly addressed their concerns. In regard to the effects of interferons on long-lasting immunity to R. parkeri, we note to the reviewer that we observed that immunized Ifnar-/-Ifngr-/- mice were completely and robustly protected from rechallenge. No lethality and no loss of body weight or temperature was observed after a rechallenge dose of 10x the LD-50. These data reveal that interferons are dispensable for long-lasting immunity to R. parkeri in inbred mice and are not important effectors of adaptive immunity to R. parkeri. This is thus the first model that can be used to investigate the factors required for adaptive immunity to R. parkeri in mice.

If the reviewer’s comment is not referring to long-lasting adaptive immunity to R. parkeri but is instead referring to the general concept of using immunocompromised mice as animal models, we note that immunocompromised mice are used as models for a variety of pathogens, including many Rickettsia species (reviewed in Osterloh, Med Microbiol Immunol 2017), and Ifnar-/-Ifngr-/- mice specifically are used as models for Zika and Dengue virus infections. Unlike many other immunocompromised mice, Ifnar-/-Ifngr-/- mice do not require maintenance on antibiotics and they have no noticeable differences to wild type mice in regard to breeding or growth, thus they are well-suited as an inbred model for R. parkeri.

“Manuscript also fails to recognize that there is a Amblyomma maculatum tick transmitted model of Rickettsia parkeri infection that causes an eschar and disseminated pathology”.

We believe the reviewer is referring to Saito et al., 2019, and we thank the reviewer for bringing this work to our attention. We had previously not acknowledged this work because we were unaware of it, as the paper did not initially appear in our PubMed searches. We now cite and discuss this work and compare our findings in light of the previous findings.

If the reviewer is instead referring to Banajee et al., 2015, in the previous version of the manuscript in lines 266-269 we cited and acknowledged this reported tick transmission model in non-human primates.

As noted by Reviewer 3, our model with needle inoculation is significantly less time consuming and expensive than a tick transmission model. The eschars we observe in Ifnar-/-Ifngr-/- mice appear more similar to human eschars than those reported in non-human primates (Banajee et al) or any other mouse model. Moreover, needle inoculation makes it feasible to precisely measure the number of bacteria that are administered, which is not true with ticks. Lastly, our model reveals eschars in the C57BL/6 mouse strain, which have many genetic mutants available. Thus, our model provides many significant advantages over the tick model in C3H/HeN mice or non-human primates, including cost, time, reproducibility, availability of genetic mutants, and recapitulating lesions similar to human eschars.

“The model that they have used is inadequately characterized. The cutaneous lesion was not evaluated histologically to determine if it features the actual characteristics of an eschar.”

We thank the reviewer for this suggestion. As mentioned above in the response to reviewer #1, we have now performed histology and immunohistochemistry on the skin as well as on lungs and brain of WT and Ifnar-/-Ifngr-/- mice at 4, 7, and 12 dpi following i.d. infection with different doses of R. parkeri. We also performed a similar analysis of the spleens and livers after i.v. infection.

“Although bacteria were found in the liver and spleen, in which macrophages are significant target, there was no evaluation of the vital organs including lung and brain nor demonstration of the target cells or pathologic lesions.”

As mentioned above, we have now performed histology and immunohistochemistry of the skin, brain, and lung to identify the infected cell types after i.d. infection. We also performed these analyses with spleens and lungs after i.v. infection. Regardless of the administrative route or the organ, neutrophils and macrophages are the primary cell types with rickettsial immunostaining. In one tissue section in the lung, bacteria appeared to be in endothelial cells.

In previous work from our lab (Engström et al., 2019), we found that lungs of wild type mice contained similar number of infectious R. parkeri as the spleen and liver after intravenous infection. Thus, in order to be able to process more samples quickly, we did not include lungs in the experiments in which plaque forming units were quantified. In unreported data, we also found that organs including the brain, kidneys, and heart had few recoverable PFUs.

“Unfortunately, the assay of vascular permeability was applied only to the inoculation site and not to the disseminated visceral organs such as lung and brain.”

We have performed the vascular permeability assay using internal organs alongside the skin; however, little/no fluorescence was observed in any sample. We were unable to distinguish differences between control groups or between control and experimental groups in organs from mice that were treated and untreated with the fluorescent dextran. Thus, we were unfortunately not able to apply the described vascular damage assay to organs other than the skin. We now indicate this in the revised text.

Reviewer #2 (Significance (Required)):

“The authors all have misrepresented the eschar as a critically important lesion whereas the patients usually do not even know i's presence until they began to develop systemic symptoms and it is a detected by a physician examining the patient.”

We did not intend to suggest that the eschar is either more or less critically important than other features of rickettsial disease. We simply described the eschar as a “hallmark feature” of eschar-associated rickettsiosis. Additionally, as the reviewer notes, patients report systemic symptoms, and our model elicits systemic disease by R. parkeri in mice. Thus, the model we describe recapitulates both of the disease manifestations mentioned by the reviewer.

“On line 30 the authors state that mice are the natural reservoir of Rickettsia parkeri. The references cited describe the failure of acquisition by feeding ticks, meaning that it is not a true reservoir. The reference describing animals with antibodies merely indicates exposure to a spotted fever group

Rickettsia not sufficient evidence of a role as a reservoir.”

We thank the reviewer for making this important distinction and we have altered the text to read:

“…small rodents including mice have been found as seropositive for R. parkeri in the wild.”

“In response to the request for my expertise, I have contributed a large amount of data to understanding mechanisms of immunity to rickettsiae and have developed several useful animal models of Rickettsial diseases. I also have expertise on clinical aspects of spotted fever group rickettsioses, including the eschar.”

Referees cross commenting

“This is not the first Mouse model of rickettsiosis to contain an eschar. There is a model of Rickettsia parkeri transmitted by Amblyomma maculatum ticks in which eschars occur.”

As noted above by us and also by Reviewer 3, we cited and discussed the tick transmission model in non-human primates (Banajee et al., 2015) in the Discussion. We also now cite and discuss Saito et al., 2019. We note that the lesions we observe in Ifnar-/-Ifngr-/- appear more necrotic and of similar size as the human eschars than those in reported in macaques in previous reports. Lastly, we note to the reviewer the many advantages of our i.d. infection model, including how it will make these experiments more widely accessible, more reproducible, less expensive, faster, will enable the infection of mice with various genetic modifications, and results in a skin lesion most similar to the human lesion.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

“This manuscript reports novel observations pertinent to development in inbred mice of an eschar lesion and generalized lethal infection following intradermal infection with Rickettsia parkeri, the mice are deficient in two types of interferon receptors. This is a new observation for the murine system and expands the existing repertoire of model infections for tick-borne rickettsiae. This study also reports that Sca2-mediated actin-based motility is required for R. parkeri dissemination and provides indirect evidence that OmpB protein is involved in eschar formation, thus corroborating previous knowledge about these major surface exposed antigens of rickettsiae and host cell interactions and host responses to these organisms.”

“The study is rigorous and reliable as described and can be reproduced by others given availability of adequate funding, access to similar facilities, strains of mice and rickettsial mutants, and technical personnel with similar skills and training. There are no ethical or technical concerns.”

We thank the reviewer for their thoughtful comments and for appreciating the advantages of this model.

“The main limitation of the manuscript is due to the fact that histological and immunohistochemical analysis of the eschar was not performed; therefore, it is not clear if pathological processes and features of this lesion formation are the same or related to the human pathology.”

We thank the reviewer for this suggestion. As mentioned above in the responses to Reviewers #1 and #2, we have now performed histological and immunohistochemical analyses of the skin and internal organs and had the images blindly analyzed by Dr. Inge Langohr, a pathologist who is an expert in lesions elicited by rickettsial pathogens. The features of the lesions, including necrosis, inflammation, and infected cell types, are similar to those observed in R. parkeri-infected humans and non-human primates.

“Similarly, in an attempt to generalize (as the authors try very hard), it is not clear how these observations will be relevant to rickettsial pathogens which are responsible for more severe forms of rickettsioses (such as R. rickettsii and R. prowazekii) but are not known to cause eschar formation as a part of their clinical manifestations.”

Our findings with Sca2 are in agreement with findings in R. rickettsii Sca2 in guinea pigs (Kleba et al., 2010), which showed that Sca2 was required for eliciting fever and an antibody response. Our work also expands on these findings by showing that sca2 mutants immunize against rechallenge and by finding reduced bacterial burdens in internal organs after intradermal infection with sca2 mutant bacteria. Thus, we believe that studying R. parkeri genes in Ifnar-/-Ifngr-/- mice can serve as a model to better understand conserved virulence genes in diverse rickettsial pathogens.

Beyond virulence genes, we note that our model also recapitulates systemic disease including dissemination to internal organs. Thus, it provides a platform to study disease manifestations beyond the eschar that may be relevant to other rickettsial pathogens including R. rickettsii and R. prowazekii.

Some other virulent rickettsial pathogens cause limited/no disease in WT C57BL/6 mice, including R. akari, R. conorii, R. typhi, and O. tsutsugamushi (reviewed in Osterloh, Med Microbiol Immunol 2017). Thus, Ifnar-/-Ifngr-/- mice may potentially serve as models for these pathogens. We now include this point in the Discussion.

“The other deficiency is due to a limited description of the Sca2 and OmpB mutants used in this study. It was necessary to locate and review previous publications by this group in order to understand the experiments conducted here and their interpretation. It would be useful to the readers if this information (a better more complete description of the mutants and their properties) is summarized in this manuscript.”

We have now provided a more complete description of the mutants in the Introduction and Results.

Reviewer #3 (Significance (Required)):

“The study is relevant to investigators working in the field of rickettsial diseases and to a broader audience studying mechanisms of intracellular parasitism and host responses.

The study argues that difference(s) in dermal IFN signaling mechanism(s) distinguish human and murine susceptibility to R. parkeri infection. This is a very useful speculation; however, a better and deeper discussion would be helpful to demonstrate the relevance of these observations and their connection(s) to events occurring during the course of human infections. Regrettably, there are almost no citations of classic or current literature addressing these aspects of rickettsial pathogenesis and the role of IFN-dependent mechanisms beyond self-citations. Overall, the discussion includes four relatively short paragraphs, each addressing different directions of possible research, which indicates ample possible utility of this murine model; however, a more coherent and convincing discussion is desirable.”

We thank the reviewer for the suggestion, and we have now expanded the Discussion to address the role for IFN-dependent mechanisms in humans and mice during rickettsial infections, including classic and current literature citations.

Referees cross commenting

“I agree with the Reviewer #2 that per se this is not the first murine model reproducing eschar upon A. maculatum transmission; however, this is the first model that allows to monitor eschar formation using needle inoculation. This model can be widely used; while many labs maybe limited by their facility setup and can't afford/conduct tick transmission experiments. The authors acknowledged existing of the tick transmission model and discuss inclusion of this option in their future experiments.”

We thank the reviewer for recognizing the many advantages of this model.

https://doi.org/10.7554/eLife.67029.sa2

Article and author information

Author details

  1. Thomas P Burke

    Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing
    For correspondence
    tburke@berkeley.edu
    Competing interests
    None
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1385-8757
  2. Patrik Engström

    Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Resources, Writing – review and editing
    Competing interests
    none
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3092-8216
  3. Cuong J Tran

    1. Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    2. Division of Infectious Disease and Vaccinology, School of Public Health, University of California, Berkeley, Berkeley, United States
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    None
  4. Ingeborg M Langohr

    Department of Pathobiological Sciences, Louisiana State University, Baton Rouge, United States
    Contribution
    Formal analysis, Investigation, Writing – review and editing
    Competing interests
    None
  5. Dustin R Glasner

    Division of Infectious Disease and Vaccinology, School of Public Health, University of California, Berkeley, Berkeley, United States
    Present address
    Department of Laboratory Medicine, University of California, San Francisco, San Francisco, United States
    Contribution
    Investigation, Resources
    Competing interests
    None
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9821-6683
  6. Diego A Espinosa

    Division of Infectious Disease and Vaccinology, School of Public Health, University of California, Berkeley, Berkeley, United States
    Present address
    Metagenomi, Emeryville, United States
    Contribution
    Investigation, Resources
    Competing interests
    None
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4364-5031
  7. Eva Harris

    Division of Infectious Disease and Vaccinology, School of Public Health, University of California, Berkeley, Berkeley, United States
    Contribution
    Resources, Supervision
    Competing interests
    None
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7238-4037
  8. Matthew D Welch

    Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Conceptualization, Funding acquisition, Project administration, Supervision, Writing – review and editing
    For correspondence
    welch@berkeley.edu
    Competing interests
    None
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2537-6349

Funding

National Institute of Allergy and Infectious Diseases (R01AI109044)

  • Matthew D Welch

National Institute of Allergy and Infectious Diseases (R21AI138550)

  • Matthew D Welch

National Institute of Allergy and Infectious Diseases (R01AI124493)

  • Eva Harris

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Neil Fisher for editing this manuscript. PE was supported by postdoctoral fellowships from the Sweden-America Foundation. MDW was supported by NIH/NIAID grants R01AI109044 and R21AI138550. DRG, DAE, and EH were partially supported by NIH/NIAID grant R01 AI24493 (EH).

Ethics

Animal research was conducted under a protocol approved by the University of California, Berkeley Institutional Animal Care and Use Committee (IACUC) in compliance with the Animal Welfare Act and other federal statutes relating to animals and experiments using animals (Welch lab animal use protocol AUP-2016-02-8426). The University of California, Berkeley IACUC is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International and adheres to the principles of the Guide for the Care and use of Laboratory Animals. Mouse infections were performed in a biosafety level 2 facility. All animals were maintained at the University of California, Berkeley campus, and all infections were performed in accordance with the approved protocols. Mice were immediately euthanized if they exhibited severe degree of infection, as defined by a core body temperature dropping below 90 F or lethargy that prevented normal movement.

Senior Editor

  1. Dominique Soldati-Favre, University of Geneva, Switzerland

Reviewing Editor

  1. Kim Orth, HHMI/University of Texas Southwestern Medical Center, United States

Publication history

  1. Received: January 30, 2021
  2. Accepted: July 31, 2021
  3. Accepted Manuscript published: August 23, 2021 (version 1)
  4. Version of Record published: September 9, 2021 (version 2)

Copyright

© 2021, Burke et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 614
    Page views
  • 54
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Biochemistry and Chemical Biology
    2. Microbiology and Infectious Disease
    Giulia Bandini et al.
    Research Article Updated

    Fucose is a common component of eukaryotic cell-surface glycoconjugates, generally added by Golgi-resident fucosyltransferases. Whereas fucosylated glycoconjugates are rare in kinetoplastids, the biosynthesis of the nucleotide sugar GDP-Fuc has been shown to be essential in Trypanosoma brucei. Here we show that the single identifiable T. brucei fucosyltransferase (TbFUT1) is a GDP-Fuc: β-D-galactose α-1,2-fucosyltransferase with an apparent preference for a Galβ1,3GlcNAcβ1-O-R acceptor motif. Conditional null mutants of TbFUT1 demonstrated that it is essential for both the mammalian-infective bloodstream form and the insect vector-dwelling procyclic form. Unexpectedly, TbFUT1 was localized in the mitochondrion of T. brucei and found to be required for mitochondrial function in bloodstream form trypanosomes. Finally, the TbFUT1 gene was able to complement a Leishmania major mutant lacking the homologous fucosyltransferase gene (Guo et al., 2021). Together these results suggest that kinetoplastids possess an unusual, conserved and essential mitochondrial fucosyltransferase activity that may have therapeutic potential across trypanosomatids.

    1. Microbiology and Infectious Disease
    Michael J Sheedlo et al.
    Research Article

    Legionella pneumophila is an opportunistic pathogen that causes the potentially fatal pneumonia known as Legionnaires' Disease. The pathology associated with infection depends on bacterial delivery of effector proteins into the host via the membrane spanning Dot/Icm type IV secretion system (T4SS). We have determined sub-3.0 Å resolution maps of the Dot/Icm T4SS core complex by single particle cryo-EM. The high-resolution structural analysis has allowed us to identify proteins encoded outside the Dot/Icm genetic locus that contribute to the core T4SS structure. We can also now define two distinct areas of symmetry mismatch, one that connects the C18 periplasmic ring (PR) and the C13 outer membrane cap (OMC) and one that connects the C13 OMC with a 16-fold symmetric dome. Unexpectedly the connection between the PR and OMC is DotH, with five copies sandwiched between the OMC and PR to accommodate the symmetry mismatch. Finally, we observe multiple conformations in the reconstructions that indicate flexibility within the structure.