T-cell receptor (TCR) signaling promotes the assembly of RanBP2/RanGAP1-SUMO1/Ubc9 nuclear pore subcomplex via PKC-θ-mediated phosphorylation of RanGAP1
- MOE Key Laboratory of Gene Function and Regulation, Guangdong Province Key Laboratory of Pharmaceutical Functional Genes, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, China
- Center for Cancer Immunotherapy, La Jolla Institute for Immunology, United States
Figures
Figure 1 with 1 supplement
TCR stimulation promotes PKC-θ colocalization with the NPC and PKC-θ deficiency decreases nuclear import of importin-β1 and Ran and NPC association with importin-β1.
(A, B) Subcellular fractionation of Jurkat E6.1 cells stimulated for 0–15 min with anti-CD3 plus anti-CD28 (A) or with superantigen (SEE)-pulsed Raji B cells (B) and immunodetection with the …
-
Figure 1—source data 1
Uncropped western blot for Figure 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig1-data1-v3.pdf
-
Figure 1—source data 2
Row data for Figure 1 and for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig1-data2-v3.xlsx
Figure 1—figure supplement 1
PKC-θ translocates to the NE following TCR stimulation and PKC-θ deficiency decreases nuclear import of importin β1 and Ran and NPC association with importin β1.
(A) Transmission electron microscopy (TEM) images of PKC-θ labeled by antibody-conjugated gold particles in Jurkat E6.1 cells stimulated for 0–15 min with anti-CD3 plus anti-CD28. The areas outlined …
-
Figure 1—figure supplement 1—source data 1
Uncropped western blot for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig1-figsupp1-data1-v3.pdf
Figure 2 with 1 supplement
PKC-θ association with both RanGAP1 and RanGAP1-SUMO1 requires PKC-θ sumoylation.
(A) Scheme for in vitro protein direct binding assay. (B) Analysis of direct association between RanGAP1 and PKC-θ using approach in (A). GST-fusion proteins were detected by Coomassie blue staining …
-
Figure 2—source data 1
Uncropped western blot for Figure 2.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig2-data1-v3.pdf
Figure 2—figure supplement 1
PKC-θ binds to and colocalizes with RanGAP1 in NE.
(A) Association of PKC-θ with the indicated GST-fusion proteins representing different NPC components demonstrated by a pull-down assay from unstimulated Jurkat E6.1 cell. The recombinant proteins …
-
Figure 2—figure supplement 1—source data 1
Uncropped western blot for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig2-figsupp1-data1-v3.pdf
-
Figure 2—figure supplement 1—source data 2
Row data for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig2-figsupp1-data2-v3.xlsx
Figure 3 with 1 supplement
PKC-θ deficiency inhibits RanGAP1 sumoylation and its incorporation into the NPC and TCR-induced nuclear import of c-Jun in mature T cells.
(A, B) Confocal imaging of RanGAP1 (red) and lamin B1 (green) localization in representative unstimulated WT or Prkcq−/− mouse primary T cells (A), or in representative unstimulated Jurkat E6.1 …
-
Figure 3—source data 1
Uncropped western blot for Figure 3.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig3-data1-v3.pdf
-
Figure 3—source data 2
Row data for Figure 3 and for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig3-data2-v3.xlsx
Figure 3—figure supplement 1
PKC-θ deficiency inhibits RanGAP1 sumoylation and its incorporation into the NPC, but does not affect TCR-induced phosphorylation of c-Jun.
(A) Immunoblot analysis of the association between RanGAP1-SUMO1 and NPC in Mab414 IPs, and of the indicated proteins expression in WCL from NC and shPKC-θ Jurkat T cells stimulated for 0–15 min …
-
Figure 3—figure supplement 1—source data 1
Uncropped western blot for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig3-figsupp1-data1-v3.pdf
Figure 4 with 1 supplement
PKC-θ-mediated sumoylation of RanGAP1 requires its phosphorylation on Ser504 and Ser506.
(A) Immunoblot analysis of serine-phosphorylated RanGAP1 in Jurkat E6.1 T cells transfected with siNC or siPKC-θ, and left unstimulated or stimulated with anti-CD3 plus anti-CD28. (B) In vitro PKC-θ …
-
Figure 4—source data 1
Uncropped western blot for Figure 4.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig4-data1-v3.pdf
-
Figure 4—source data 2
Row data for Figure 4 and for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig4-data2-v3.xlsx
Figure 4—figure supplement 1
PKC-θ-dependent phosphorylation of RanGAP1.
(A) Immunoblot analysis of the serine-phosphorylated RanGAP1 in stably transfected control (NC) or shPKC-θ-expressing Jurkat E6.1 T cells left unstimulated or stimulated with anti-CD3 plus …
-
Figure 4—figure supplement 1—source data 1
Uncropped western blot for Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig4-figsupp1-data1-v3.pdf
Figure 5 with 1 supplement
PKC-θ-mediated phosphorylation of RanGAP1 is required for its association with Ubc9 and RanBP2.
(A, B) Reciprocal IP analysis of the association between HA-tagged wild-type or K524-mutated RanGAP1 and endogenous Ubc9. RanGAP1 expression was analyzed by anti-HA antibody immunoblotting in WCL …
-
Figure 5—source data 1
Uncropped western blot for Figure 5.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig5-data1-v3.pdf
-
Figure 5—source data 2
Row data for Figure 5.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig5-data2-v3.xlsx
Figure 5—figure supplement 1
Characterization of the effect of Ser/Glu mutation on RanGAP1.
(A) Immunoblot analysis of both HA-RanGAP1 and endogenous RanGAP1 in WCL from Figure 5(D), detected by RanGAP1 antibody. (B) Prediction of RanGAP1 stability changes upon mutating Ser504 and Ser506 …
-
Figure 5—figure supplement 1—source data 1
Uncropped western blot for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig5-figsupp1-data1-v3.pdf
Figure 6 with 1 supplement
Wild-type RanGAP1, but not RanGAP1AA, rescues deficient TCR-induced nuclear import of NF-ATc1, NF-κB, AP-1 in RanGAP1 (KD) Jurkat T cells.
(A) Immunoblot analysis of NC (transfected with CRISPR/Cas9 vector expressing a scrambled gRNA) and RanGAP1(KD) (containing an in-frame nucleotide deletion in RanGAP1 gene induced by CRISPR/Cas9 …
-
Figure 6—source data 1
Uncropped western blot for Figure 6.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig6-data1-v3.pdf
-
Figure 6—source data 2
Row data for Figure 6 and for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig6-data2-v3.xlsx
Figure 6—figure supplement 1
RanGAP1 is required for TCR-induced nuclear import of NF-ATc1, NF-κB, and AP-1.
(A) RanGAP1 expression in negative control (NC, cells transfected with scrambled gRNA) Jurkat E6.1 T cells or cells with stable CRISPR/Cas9-edited RanGAP1 knockdown (KD). (B) Sequence alignment of …
-
Figure 6—figure supplement 1—source data 1
Uncropped western blot for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig6-figsupp1-data1-v3.pdf
Figure 7
PKC-θ-RanGAP signaling axis is differentially required in various nuclear transport pathways.
(A) Subcellular fractionation of Jurkat E6.1 cells transfected with siNC or siPKC-θ and stimulated for 0–15 min with anti-CD3 plus anti-CD28, followed by immunodetection with the indicated …
-
Figure 7—source data 1
Uncropped western blot for Figure 7.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig7-data1-v3.pdf
-
Figure 7—source data 2
Row data for Figure 7.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig7-data2-v3.xlsx
Figure 8
RanGAP1EE, but not RanGAP1AA, rescues TCR-induced nuclear import of c-Jun in PKC-θ-deficient cells.
(A) Immunoblot analysis of Jurkat-TAg cells cotransfected with siNC or siPKC-θ plus HA-RanGAP1AA or HA-RanGAP1EE as indicated, which were left unstimulated or stimulated for 15 min with anti-CD3, …
-
Figure 8—source data 1
Uncropped western blot for Figure 8.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig8-data1-v3.pdf
-
Figure 8—source data 2
Row data for Figure 8.
- https://cdn.elifesciences.org/articles/67123/elife-67123-fig8-data2-v3.xlsx
Figure 9
Schematic model of nuclear import regulation by the TCR-PKC-θ-RanGAP1 axis.
Upon TCR stimulation, PKC-θ phosphorylates RanGAP1 to increase its association with Ubc9, thereby enhancing the sumoylation of RanGAP1, which is required for assembly of the …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C57BL/6 (Prkcq−/−) | A gift from D. Littman (Wang et al., 2015) | PMID:26390157 | |
| Cell line (Homo-sapiens) | Jurkat, Clone E6-1 | ATCC | TIB-152 | |
| Cell line (Homo-sapiens) | Jurkat-TAg | Cellosaurus | CVCL_C831 RRID:CVCL_C831 | |
| Antibody | Goat polyclonal anti-PKC-θ | Santa Cruz Biotechnology | Cat #: sc-1875, RRID:AB_675806 | IF (1:200) |
| Antibody | Mouse monoclonal anti-RanGAP1 | Santa Cruz Biotechnology | Cat #: sc-28322, RRID:AB_2176987 | WB (1:1000) |
| Antibody | Mouse monoclonal anti-importin β1 | Santa Cruz Biotechnology | Cat #: sc-137016, RRID:AB_2133993 | WB (1:1000) IF (1:200) |
| Antibody | Mouse monoclonal anti- Ran | Santa Cruz Biotechnology | Cat #: sc-271376, RRID:AB_10610890 | WB (1:1000) IF (1:200) |
| Antibody | Mouse monoclonal anti- RanBP2 | Santa Cruz Biotechnology | Cat #: sc-74518, RRID:AB_2176784 | WB (1:1000) |
| Antibody | Mouse monoclonal anti- Ubc9 | Santa Cruz Biotechnology | Cat #: sc-271057, RRID:AB_10610674 | WB (1:1000) |
| Antibody | Mouse monoclonal anti- NF-ATc1 | Santa Cruz Biotechnology | Cat #: sc-7294, RRID:AB_2152503 | WB (1:1000) |
| Antibody | Mouse monoclonal anti-c-Myc | Santa Cruz Biotechnology | Cat #: sc-40, RRID:AB_2857941 | WB (1:1000) IF (1:200) |
| Antibody | Mouse monoclonal anti- actin | Santa Cruz Biotechnology | Cat #: sc-8432, RRID:AB_626630 | WB (1:1000) |
| Antibody | Mouse monoclonal anti-p-Ser/Phosphoserine | Santa Cruz Biotechnology | Cat #: sc-81516, RRID:AB_1128626 | WB (1:1000) |
| Antibody | Goat polyclonal anti-Lamin B1 | Santa Cruz Biotechnology | Cat #: sc-30264, RRID:AB_2136305 | WB (1:1000) IF (1:200) |
| Antibody | Rabbit monoclonal anti-p65(NF-κB) | Santa Cruz Biotechnology | Cat #: sc-109, RRID:AB_632039 | WB (1:1000) IF (1:200) |
| Antibody | Mouse monoclonal anti-Histone 1 | Santa Cruz Biotechnology | Cat #: sc-8030, RRID:AB_675641 | WB (1:500) |
| Antibody | Rabbit monoclonal anti-c-Jun | Cell Signaling Technology | Cat #: 9165, RRID:AB_2130165 | WB (1:1000) IF (1:200) |
| Antibody | Mouse monoclonal anti-Dis3 | Santa Cruz Biotechnology | Cat #: sc-398663 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-c-Fos | Cell Signaling Technology | Cat #: 2250, RRID:AB_2247211 | WB (1:1000) IF (1:200) |
| Antibody | Rabbit monoclonal anti-phospho-Ser/Thr | Cell Signaling Technology | Cat #: 9631, RRID:AB_330308 | WB (1:1000) |
| Antibody | Mouse monoclonal anti-phospho-ERK1/2 | Cell Signaling Technology | Cat #: 9106, RRID:AB_331768 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-Na/K-ATPas | Cell Signaling Technology | Cat #: 3010, RRID:AB_2060983 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-GAPDH | Cell Signaling Technology | Cat #: 2118, RRID:AB_561053 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-CRM1 | Cell Signaling Technology | Cat #: 46249, RRID:AB_2799298 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-Histone 2B | Cell Signaling Technology | Cat #: 12364, RRID:AB_2714167 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-Histone 3 | Cell Signaling Technology | Cat #: 4499, RRID:AB_10544537 | WB (1:1000) |
| Antibody | Rabbit monoclonal anti-NF-ATc1 | Abcam | Cat #: ab25916, RRID:AB_448901 | IF (1:200) |
| Antibody | Rabbit monoclonal anti-RanGAP1 | Abcam | Cat #: ab92360, RRID:AB_10564003 | IF (1:200) |
| Antibody | Rabbit polyclonal anti-RPL26 | Abcam | Cat #: ab59567, RRID:AB_945306 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-RPS3 | Abcam | Cat #: ab181992 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-NXF1 | Abcam | Cat #: ab129160, RRID:AB_11142853 | WB (1:2000) |
| Antibody | Mouse monoclonal anti- Mab414 | BioLegend | Cat #: 902901, RRID:AB_2565026 | WB (1:1000) IF (1:200) |
| Antibody | Rat monoclonal anti-mouse CD3 | BioLegend | Cat #: 100202, RRID:AB_312659 | 5 μg/ml |
| Antibody | Syrian Hamster monoclonal anti-mouse CD28 | BioLegend | Cat #: 102102, RRID:AB_312867 | 2 μg/ml |
| Antibody | Mouse monoclonal anti-Human CD3(OKT3) | BioLegend | Cat #: 317302, RRID:AB_571927 | 5 μg/ml |
| Antibody | Mouse monoclonal anti-Human CD28(CD28.2) | BioLegend | Cat #: 302902, RRID:AB_314304 | 2 μg/ml |
| Antibody | Alexa Fluor 488-coupled chicken anti-mouse IgG | Invitrogen | Cat #: A-21200, RRID:AB_2535786 | IF (1:2000) |
| Antibody | Alexa Fluor 594-coupled chicken anti-mouse IgG | Invitrogen | Cat #: A-21201, RRID:AB_141630 | IF (1:2000) |
| Antibody | Alexa Fluor 594-coupled chicken anti-rabbit IgG | Invitrogen | Cat #: A-21442, RRID:AB_141840 | IF (1:2000) |
| Antibody | Alexa Fluor 488-coupled donkey anti-goat IgG | Invitrogen | Cat #: A-11055, RRID:AB_2534102 | IF (1:2000) |
| Other | Cell Tracker Blue | Invitrogen | Cat #: C2110 | IF: 10 μM |
| Recombinant DNA reagent | pcDNA3.1( ) (plasmid) | Invitrogen | Cat #: V79020 | |
| Recombinant DNA reagent | pGEX-4T-2 | GE | Cat #: 27-4581-01 | |
| Recombinant DNA reagent | pFlag-CMV2 | Sigma | Cat #: E7396 | |
| Recombinant DNA reagent | pMXs-IRES-GFP Retroviral Vector | Cell Biolabs | Cat #: RTV-013 | |
| Recombinant DNA reagent | LentiCRISPRv2 | Addgene | Cat #: 52961 | |
| Sequence-based reagent | RanGAP1-F | NM_001278651.2 | CGGGATCCATGGCCTCGGAAGACATTGCCAAGC | Primer for PCR |
| Sequence-based reagent | RanGAP1-R | NM_001278651.2 | ATAAGAATGCGGCCGCCTAGACCTTGTACAGCGTCTGCAGC | Primer for PCR |
| Sequence-based reagent | RanGAP1-S34A-F | NM_001278651.2 | CAAGAGCCTCAAACTCAACGCCGCAGAAGATGCTAAAGATG | Primer for PCR |
| Sequence-based reagent | RanGAP1-T419A-F | NM_001278651.2 | CTGGACCCTAACGCCGGGGAGCCAGCTC | Primer for PCR |
| Sequence-based reagent | RanGAP1-S478A-F | NM_001278651.2 | CCTTCCTAAAGGTGTCAGCCGTGTTCAAGGACGAAG | Primer for PCR |
| Sequence-based reagent | RanGAP1-S504A-F | NM_001278651.2 | GAAGGCTTTCAACGCCTCGTCCTTCAAC | Primer for PCR |
| Sequence-based reagent | RanGAP1-S506A-F | NM_001278651.2 | CTTTCAACTCCTCGGCCTTCAACTCCAAC | Primer for PCR |
| Sequence-based reagent | RanGAP1-S504A/S506A-F | NM_001278651.2 | CTGATGCAGAAGGCTTTCAACGCCAGCGCCTTCAA CTCCAACACCTTCC | Primer for PCR |
| Sequence-based reagent | RanGAP1-S504E/S506E-F | NM_001278651.2 | CTGATGCAGAAGGCTTTCAACGAGAGCGAGTTCAAC TCCAACACCTTCC | Primer for PCR |
| Sequence-based reagent | RanGAP1-K524R-F | NM_001278651.2 | CATGGGTCTGCTCAGGAGTGAAGACAAG | Primer for PCR |
| Sequence-based reagent | RanGAP1 sgRNA | NM_001278651.2 | CACCGCAGAGGGAGTGCCACT | CRISPR-Cas9 guides |
| Sequence-based reagent | shPKC-θ | NM_006257.5 | GAGTATGTCGAATCAGAGA | dsRNA for RNAi |
| Sequence-based reagent | siPKC-θ | Previous study in lab (Wang et al., 2015) | GCUUGUAACUUGAGAUCUA | dsRNA for RNAi |
| Sequence-based reagent | siRanGAP1-1 | NM_001278651.2 | GGAGUGUUGACAACCCAAA | dsRNA for RNAi |
| Sequence-based reagent | siRanGAP1-2 | NM_001278651.2 | GUGAGCUGCUCCGCCAUUAAA | dsRNA for RNAi |
| Software algorithm | Fiji/Image-J | MPI-CBG, Dresden/ National Institutes of Health (NIH) | PMID:22743772 RRID:SCR_002285 | Image processing and analysis |
| Software algorithm | Graphpad Prism v6 | Graphpad | RRID:SCR_002798 | Graphs and statistical analysis |
