Nuclear hormone receptor NHR-49 acts in parallel with HIF-1 to promote hypoxia adaptation in Caenorhabditis elegans
- Graduate Program in Medical Genetics, University of British Columbia, Canada
- British Columbia Children's Hospital Research Institute, Canada
- Centre for Molecular Medicine and Therapeutics, The University of British Columbia, Canada
- Department of Medical Genetics, University of British Columbia, Canada
- Department of Biochemistry, University of Washington School of Medicine, United States
- Department of Pediatrics, University of Pittsburgh School of Medicine, United States
- Departments of Developmental Biology and Cell Biology and Physiology, University of Pittsburgh School of Medicine, United States
Figures
Figure 1
nhr-49 regulates fmo-2 induction following exposure to hypoxia.
(A) The graph indicates fold changes of mRNA levels (relative to unexposed wild-type) in L4 wild-type, nhr-49(nr2041), and hif-1(ia4) animals exposed to room air (21% O2) or 0.5% O2 for 3 hr (n = …
Figure 2 with 1 supplement
nhr-49 and hif-1 act in parallel hypoxia response pathways at two stages of the worm life cycle.
(A) The graph shows the average population survival of wild-type, nhr-49(nr2041), hif-1(ia4), and nhr-49(nr2041);hif-1(ia4) worm embryos exposed for 24 hr to 0.5% O2 and then allowed to recover at …
Figure 2—figure supplement 1
nhr-49 and hif-1 mutants do not display major developmental defects in normoxia, and NHR-49::GFP is induced by hypoxia.
(A) The graph shows the average developmental success of wild-type, nhr-49(nr2041), hif-1(ia4), and nhr-49(nr2041);hif-1(ia4) embryos kept in 21% O2 for 65 hr, and counted as the ability to reach at …
Figure 3 with 2 supplements
RNA-seq reveals an nhr-49-dependent transcriptional program in hypoxia.
(A, B) Venn diagrams show the overlap of genes regulated by hypoxia (3 hr 0.5% O2; vs. normoxia 21% O2) in wild-type, nhr-49(nr2041), and hif-1(ia4) animals. Numbers indicate the number of …
Figure 3—figure supplement 1
RNA-seq reveals several discrete hypoxia-responsive transcriptional programs.
(A) The figure shows a multidimensional scaling (MDS) plot of the distances between gene expression profiles. Distances on the MDS plot correspond to the root-mean-square average of the largest 200 …
Figure 3—figure supplement 2
nhr-49 regulates acs-2 induction following exposure to hypoxia.
(A) The graph shows the average fold changes of mRNA levels (relative to unexposed wild-type) in L4 wild-type, nhr-49(nr2041), and hif-1(ia4) animals exposed to 0.5% O2 for 3 hr (n = 3). *p<0.05, …
Figure 4 with 1 supplement
nhr-49 is required to induce autophagy in response to hypoxia.
(A, B) The figure shows representative micrographs (A) and whole-worm GFP quantification (B) of lgg-1p::gfp adult animals fed EV, nhr-49, hif-1, hpk-1, or nhr-67 RNAi in room air or following 4 hr …
Figure 4—figure supplement 1
Mutants of downstream transcriptional targets of nhr-49 in hypoxia do not display functional defects in normoxia, and autophagy genes are regulated by and act in the nhr-49 hypoxia response pathway.
(A) The graph shows the average population survival of wild-type, nhr-49(nr2041), fmo-2(ok2147), acs-2(ok2457), and fmo-2(ok2147);acs-2(ok2457) embryos kept in 21% O2 for 65 hr, and counted as the …
Figure 5
nhr-49 is sufficient to promote survival in hypoxia and induce some hypoxia response genes.
(A) The graph shows the average population survival of wild-type, nhr-49(nr2041), and nhr-49(et13) worm embryos following 48 hr exposure to 0.5% O2, then allowed to recover at 21% O2 for 42 hr, and …
Figure 6 with 1 supplement
nhr-67 is a negative regulator of the nhr-49-dependent hypoxia response pathway.
(A) The graph shows the average transcript levels in counts per million (CPM) of nhr-67 mRNA in L4 wild-type, nhr-49(nr2041), and hif-1(ia4) animals exposed to 0.5% O2 for 3 hr or kept at 21% O2 (n …
Figure 6—figure supplement 1
nhr-67 is functionally required for survival in hypoxia and acts in the nhr-49 pathway.
(A) The graph shows the average fold changes of mRNA levels (relative to wild type) in L4 wild-type and nhr-49(et13) animals (n = 3; ordinary one-way ANOVA corrected for multiple comparisons using …
Figure 7 with 1 supplement
hpk-1 is a positive regulator within the nhr-49-dependent hypoxia response pathway.
(A–D) Representative micrographs and quantification of intestinal GFP levels in fmo-2p::gfp (A, B) and acs-2p::gfp (C, D) adult animals fed EV, nhr-49, hif-1, or hpk-1 RNAi following 4 hr exposure …
Figure 7—figure supplement 1
hpk-1 is required for fmo-2 induction, and hpk-1 mutants do not display functional defects in normoxia.
(A, B) Representative micrographs (A) and quantification (B) of intestinal GFP levels in fmo-2p::gfp;nhr-49(et13) adult animals fed EV, nhr-49, hif-1, or hpk-1 RNAi kept in 21% O2 (three or more …
Figure 8 with 1 supplement
NHR-49 is induced in hypoxia in an hpk-1-dependent fashion.
(A) The graph shows the average fold changes of mRNA levels (relative to unexposed wild type) in L4 wild-type animals exposed to 0.5% O2 for 3 hr (n = 3 or 4; ordinary one-way ANOVA corrected for …
Figure 8—figure supplement 1
hpk-1 is not transcriptionally regulated in hypoxia.
(A) Representative micrographs show hpk-1p::gfp adult worms in 21% O2 or following 4 hr exposure to 0.5% O2 and 1 hr recovery in 21% O2. (B) Quantification of whole-worm GFP levels in hpk-1p::gfp …
Figure 9
Model of the new NHR-49 hypoxia response pathway and its interaction with HIF-1 signalling.
The proposed model of how NHR-49 regulates a new hypoxia response parallel to HIF-1. During normoxia, the transcription factor NHR-67 negatively regulates NHR-49. However, during hypoxia, NHR-49 …
Author response image 1
qRT-PCR reveals that increase of autophagy gene expression is not significant.
The graph indicates fold changes of mRNA levels in L4 stage wild-type animals exposed to room air (21% O2) or 0.5% O2 for 3 hr (n = 3). Statistics: two-way ANOVA corrected for multiple comparisons …
Author response image 2
Tissue specific RNAi experiments resulted in highly variable hypoxia resistance.
The graph shows average population survival of rde-1(ne219) (control, RNAi deficient), OLB11 (rde-1(ne219);(pOLB11(elt-2p::rde-1) + pRF4(rol-6(su1006))); intestine-specific RNAi; McGhee et al., …
Author response image 3
Analysis of nhr-67 and nhr-49 expression.
(Left) The graph shows the quantification of GFP levels in nhr67p::gfp animals in normoxia or following 4 hr exposure to 0.5% O2 and 1 hr recovery in 21% O2, on control empty vector RNAi (EV(RNAi)), …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | OP50 | Caenorhabditis Genetics Center (CGC) | ||
| Strain, strain background (E. coli) | HT115 | Caenorhabditis Genetics Center (CGC) | ||
| Genetic reagent (Caenorhabditis elegans) | N2 | Caenorhabditis Genetics Center (CGC) (Brenner, 1974) | ||
| Genetic reagent (C. elegans) | nhr-49(nr2041) I | PMID:15719061 (Van Gilst et al., 2005a) | STE68; RRID:WB-STRAIN:WBStrain00034504 | |
| Genetic reagent (C. elegans) | eavEx20[fmo-2p::gfp+rol-6(su1006)] | PMID:29508513 (Goh et al., 2018) | VE40 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; eavEx20[fmo-2p::gfp+rol-6(su1006)] | This study | STE129 | |
| Genetic reagent (C. elegans) | hif-1(ia4) V | PMID:11427734 (Jiang et al., 2001) | ZG31; RRID:WB-STRAIN:WBStrain00040824 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; hif-1(ia4) V | This study | STE130 | |
| Genetic reagent (C. elegans) | fmo-2(ok2147) IV | PMID:26586189 (Leiser et al., 2015) | VC1668; RRID:WB-STRAIN:WBStrain00036780 | |
| Genetic reagent (C. elegans) | acs-2(ok2457) V | PMID:21704635 (Zhang et al., 2011) | RB1899 | |
| Genetic reagent (C. elegans) | fmo-2(ok2147) IV; acs-2(ok2457) V | This study | STE131 | |
| Genetic reagent (C. elegans) | nhr-49(et13) I | PMID:27618178 (Lee et al., 2016) | STE110 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I;glmEx5 [nhr-49p::nhr-49::gfp+myo-2p::mCherry] | PMID:34156142 (Naim et al., 2021) | AGP33a | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; glmEx9 [gly-19p::nhr-49::gfp+myo-2p::mCherry] | PMID:34156142 (Naim et al., 2021) | AGP65 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041)I; glmEx11 [col-12p::nhr-49::gfp+myo-2p::mCherry] | PMID:34156142 (Naim et al., 2021) | AGP53 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041)I; glmEx13 [rgef-1p::nhr-49::gfp+myo-2p::mCherry] | PMID:34156142 (Naim et al., 2021) | AGP51 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041)I; glmEx8 [myo-3p::nhr-49::gfp+myo-2p::mCherry] | PMID:34156142 (Naim et al., 2021) | AGP63 | |
| Genetic reagent (C. elegans) | wbmEx57 [acs-2p::gfp+rol-6(su1006)] | PMID:25723162 (Burkewitz et al., 2015) | WBM170 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; wbmEx57 [acs-2p::gfp+rol-6(su1006)] | PMID:25723162 (Burkewitz et al., 2015) | WBM169 | |
| Genetic reagent (C. elegans) | glmEx5 (nhr-49p::nhr-49::gfp+myo-2p::mCherry) | PMID:25474470 (Ratnappan et al., 2014) | AGP25f | |
| Genetic reagent (C. elegans) | hif-1(ia4) V; glmEx5 (nhr-49p::nhr-49::gfp+myo-2p::mCherry) | This study | STE140 | |
| Genetic reagent (C. elegans) | hpk-1(pk1393) X; glmEx5 (nhr-49p::nhr-49::gfp+myo-2p::mCherry) | This study | STE142 | |
| Genetic reagent (C. elegans) | hpk-1(pk1393) X | PMID:12618396 (Raich et al., 2003) | EK273; RRID:WB-STRAIN:WBStrain00007138 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; hpk-1(pk1393) X | This study | STE132 | |
| Genetic reagent (C. elegans) | hif-1(ia4) V; hpk-1(pk1393) X | This study | STE133 | |
| Genetic reagent (C. elegans) | nhr-49(et13) I; eavEx20[fmo-2p::gfp+rol-6(su1006)] | PMID:29508513 (Goh et al., 2018) | STE117 | |
| Genetic reagent (C. elegans) | artEx12 [hpk-1p::gfp+rol-6(su1006)] | PMID:29036198 (Das et al., 2017) | AVS394 | |
| Genetic reagent (C. elegans) | dpy-5(e907) I; sEx14068 [rCes atg-2::GFP+pCeh361] | PMID:15338614 (McKay et al., 2003) | BC14068 | |
| Genetic reagent (C. elegans) | dpy-5(e907) I; sEx13567 [rCes lgg-1::GFP+pCeh361] | PMID:15338614 (McKay et al., 2003) | BC13567 | |
| Genetic reagent (C. elegans) | dpy-5(e907) I; sEx10273 [rCes epg-3::GFP+pCeh361] | PMID:15338614 (McKay et al., 2003) | BC10273 | |
| Genetic reagent (C. elegans) | adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)] | PMID:17785524 (Kang et al., 2007) | DA2123 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)] | This study | STE143 | |
| Genetic reagent (C. elegans) | hif-1(ia4) V; adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)] | This study | STE144 | |
| Genetic reagent (C. elegans) | lgg-2(tm5755) IV | PMID:24374177 (Manil-Ségalen et al., 2014) | RD220 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; lgg-2(tm5755) IV | This study | STE145 | |
| Genetic reagent (C. elegans) | epg-6(tm8366) III | This study, non-outcrossed mutant obtained from NBRP; PMID:19934255 | STE147 | |
| Genetic reagent (C. elegans) | nhr-49(nr2041) I; epg-6(tm8366) III | This study | STE146 | |
| Sequence-based reagent | Source BioScience | PMID:11099033 | RNAi clones | |
| Sequence-based reagent | fmo-2_F | This paper | qPCR primer | GGAACAAGCGTGTTGCTGT |
| Sequence-based reagent | fmo-2_R | This paper | qPCR primer | GCCATAGAGAAGACCATGTCG |
| Sequence-based reagent | acs-2_F | This paper | qPCR primer | AGTGAGACTTGACAGTTCCG |
| Sequence-based reagent | acs-2_R | This paper | qPCR primer | CTTGTAAGAGAGGAATGGCTC |
| Sequence-based reagent | nhr-49_F | This paper | qPCR primer | TCCGAGTTCATTCTCGACG |
| Sequence-based reagent | nhr-49_R | This paper | qPCR primer | GGATGAATTGCCAATGGAGC |
| Sequence-based reagent | hpk-1_F | This paper | qPCR primer | TGTCAAAGTGAAGCCGCTGG |
| Sequence-based reagent | hpk-1_R | This paper | qPCR primer | CGGCGCCAGTTCGTGTAGTA |
| Sequence-based reagent | nhr-67_F | This paper | qPCR primer | GAGGATGATGCGACGAGTAG |
| Sequence-based reagent | nhr-67_R | This paper | qPCR primer | TGGTCTTGAAGAGGAAGGGGA |
| Sequence-based reagent | act-1_F | This paper | qPCR primer | GCTGGACGTGATCTTACTGATTACC |
| Sequence-based reagent | act-1_R | This paper | qPCR primer | GTAGCAGAGCTTCTCCTTGATGTC |
| Sequence-based reagent | tba-1_F | This paper | qPCR primer | GTACACTCCACTGATCTCTGCTGACAAG |
| Sequence-based reagent | tba-1_R | This paper | qPCR primer | CTCTGTACAAGAGGCAAACAGCCATG |
| Sequence-based reagent | ubc-2_F | This paper | qPCR primer | AGGGAGGTGTCTTCTTCCTCAC |
| Sequence-based reagent | ubc-2_R | This paper | qPCR primer | CGGATTTGGATCACAGAGCAGC |
| Sequence-based reagent | oac-14_F | This paper | qPCR primer | TTCCAGCGACTTTTCTTTCG |
| Sequence-based reagent | oac-14_R | This paper | qPCR primer | CCCAGGATTGCTTCAATCAG |
| Sequence-based reagent | cyp-13A11_F | This paper | qPCR primer | ACACGTGGACACTTCACTATG |
| Sequence-based reagent | cyp-13A11_R | This paper | qPCR primer | TTCCGATACACTGTCGAGGTC |
| Sequence-based reagent | cyp-25A3_F | This paper | qPCR primer | agaatcgttgctccaaaacac |
| Sequence-based reagent | cyp-25A3_R | This paper | qPCR primer | ttcaaaatctccaggaacagg |
| Sequence-based reagent | ugt-20_F | This paper | qPCR primer | CCGACAAATCCCAGAGAGACA |
| Sequence-based reagent | ugt-20_R | This paper | qPCR primer | TGTCCAAAAAGAAGTACTCAACG |
| Sequence-based reagent | atg-2_F | This paper | qPCR primer | AGATGTCCGCCATAGTCTGC |
| Sequence-based reagent | atg-2_R | This paper | qPCR primer | TCTTCCTGAGCAGCGAGTTC |
| Sequence-based reagent | epg-9_F | This paper | qPCR primer | CGACGAAAACCGAGATTCCC |
| Sequence-based reagent | epg-9_R | This paper | qPCR primer | TGAGCCAGCGATTGTTTGTG |
| Sequence-based reagent | lgg-2_F | This paper | qPCR primer | GCAGTTTACCACTTATGGATCGC |
| Sequence-based reagent | lgg-2_R | This paper | qPCR primer | CGTTCATTGACGAGCAGGAAG |
| Sequence-based reagent | atg-13_F | This paper | qPCR primer | AAGCAGCTGAAAACTGCTCC |
| Sequence-based reagent | atg-13_R | This paper | qPCR primer | CGGAGAACGAATTGACGTGTT |
| Sequence-based reagent | Random primers | Invitrogen | 48190-011 | |
| Sequence-based reagent | dNTPs | Fermentas | R0186 | |
| Chemical compound, drug | Carbenicillin | BioBasic | CDJ469 | |
| Chemical compound, drug | IPTG | Santa Cruz | sc-202185B | CAS 367-93-1 |
| Chemical compound, drug | Tetracycline | BioBasic | TB0504 | |
| Chemical compound, drug | RNAseOUT | Invitrogen | 10777-019 | |
| Chemical compound, drug | Fast SYBR Master Mix | Life Technologies | 4385612 | |
| Chemical compound, drug | Levamisole | Sigma | L9756 | |
| Chemical compound, drug | H2S | AirGas, Seattle, WA | X02NI99CP581327 | |
| Chemical compound, drug | 5000 ppm O2 balanced with N2 | Praxair Canada | NI OX5000C−T | |
| Software, algorithm | ImageJ | PMID:22930834 | https://imagej.nih.gov/ij/index.html | |
| Software, algorithm | Trimmomatic version 0.36 | PMID:24695404 | RRID:SCR_011848 | |
| Software, algorithm | Salmon version 0.9.1 | PMID:28263959 | RRID:SCR_017036 | https://combine-lab.github.io/salmon/ |
| Software, algorithm | tximport | PMID:26925227 | RRID:SCR_016752 | https://github.com/mikelove/tximport |
| Software, algorithm | edgeR | PMID:19910308 | RRID:SCR_012802 | http://bioconductor.org/packages/edgeR/ |
| Software, algorithm | eVITTA | PMID:34019643 | https://tau.cmmt.ubc.ca/eVITTA/ |
Additional files
-
Supplementary file 1
Summary of statistics of embryo hypoxia survival experiments.
Statistical comparison of each genotype’s ability to reach at least L4 following 24 hr exposure to 0.5% O2 as embryo and then allowed to recover at 21% O2 for 65 hr compared to worm embryos kept in 21% O2 for 65 hr (two-way ANOVA corrected for multiple comparisons using the Tukey method).
- https://cdn.elifesciences.org/articles/67911/elife-67911-supp1-v2.docx
-
Supplementary file 2
Summary of statistics of larval hypoxia survival experiments.
Statistical comparison of each genotype’s ability to reach at least L4 stage from L1 stage following 48 hr exposure to 0.5% O2 as embryos compared to animals kept in 21% O2 for 48 hr.
- https://cdn.elifesciences.org/articles/67911/elife-67911-supp2-v2.docx
-
Supplementary file 3
Lists of genes regulated by hypoxia in various genotypes.
(a) List of the 83 genes significantly upregulated more than twofold in 21% O2 vs. 0.5% O2 in wild-type and hif-1(ia4) animals, but not in nhr-49(nr2041) animals, i.e., nhr-49-dependent, hif-1-independent genes. (b) List of 139 genes significantly upregulated more than twofold in 21% O2 vs. 0.5% O2 in wild-type and nhr-49(nr2041) animals, but not in hif-1(ia4) animals, i.e., hif-1-dependent, nhr-49-independent genes. (c) List of 264 genes significantly upregulated more than twofold in 21% O2 vs. 0.5% O2 via RNA-seq in wild-type, nhr-49(nr2041), and hif-1(ia4).
- https://cdn.elifesciences.org/articles/67911/elife-67911-supp3-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/67911/elife-67911-transrepform1-v2.docx
-
Source data 1
Source data for all indicated figures.
- https://cdn.elifesciences.org/articles/67911/elife-67911-data1-v2.xlsx
