1. Genetics and Genomics

Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity

  1. Stephen M Blazie
  2. Seika Takayanagi-Kiya
  3. Katherine A McCulloch
  4. Yishi Jin  Is a corresponding author
  1. Section of Neurobiology, Division of Biological Sciences, University of California San Diego, United States
https://doi.org/10.7554/eLife.68336
Share this article
Cite this article
  1. Stephen M Blazie
  2. Seika Takayanagi-Kiya
  3. Katherine A McCulloch
  4. Yishi Jin
(2021)
Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity
eLife 10:e68336.
https://doi.org/10.7554/eLife.68336
  2. Download BibTeX
  3. Download .RIS

Abstract

The translation initiation complex eIF3 imparts specialized functions to regulate protein expression. However, understanding of eIF3 activities in neurons remains limited despite widespread dysregulation of eIF3 subunits in neurological disorders. Here, we report a selective role of the C. elegans RNA-binding subunit EIF-3.G in shaping the neuronal protein landscape. We identify a missense mutation in the conserved Zinc-Finger (ZF) of EIF-3.G that acts in a gain-of-function manner to dampen neuronal hyperexcitation. Using neuron-type-specific seCLIP, we systematically mapped EIF-3.G-mRNA interactions and identified EIF-3.G occupancy on GC-rich 5′UTRs of a select set of mRNAs enriched in activity-dependent functions. We demonstrate that the ZF mutation in EIF-3.G alters translation in a 5′UTR-dependent manner. Our study reveals an in vivo mechanism for eIF3 in governing neuronal protein levels to control neuronal activity states and offers insights into how eIF3 dysregulation contributes to neurological disorders.

Introduction

Protein synthesis is principally regulated by variations in the translation initiation mechanism, whereby multiple eukaryotic initiation factors (eIF1 through 6) engage elongation-competent ribosomes with the mRNA open reading frame (Sonenberg and Hinnebusch, 2009). eIF3 is the largest translation initiation complex, composed of 13 subunits in metazoans, with versatile functions throughout the general translation initiation pathway (Valášek et al., 2017). Extensive biochemical and structural studies have shown that eIF3 promotes translation initiation by orchestrating effective interactions between the ribosome, target mRNA, and other eIFs (Smith et al., 2016; Cate, 2017). Mutations and misexpression of various subunits of eIF3 are associated with human diseases, such as cancers and neurological disorders (Gomes-Duarte et al., 2018), raising the importance to advance mechanistic understanding of eIF3’s function in vivo.

Recent work has begun to reveal that different eIF3 subunits can selectively regulate translation in a manner depending on cell type, mRNA targets, and post-translational modification. Interaction of eIF3 RNA-binding subunits with specific 5′UTR stem-loop structures of mRNAs can trigger a translational switch for cell proliferation in human 293 T cells (Lee et al., 2015), and can also act as a translational repressor, such as the case for human Ferritin mRNA (Pulos-Holmes et al., 2019). Under cellular stress, such as heat shock, the eIF3 complex circumvents cap-dependent protein translation initiation and recruits ribosomes directly to m6A marks within the 5′UTR of mRNAs encoding stress response proteins (Meyer et al., 2015). Other specialized translation mechanisms appear to involve activities of particular eIF3 subunits that were previously hidden from view. For example, human eIF3d possesses a cryptic mRNA cap-binding function that is activated by phosphorylation and stimulates pre-initiation complex assembly on specific transcripts (Lee et al., 2016; Lamper et al., 2020), while eIF3e specifically regulates metabolic mRNA translation (Shah et al., 2016). These findings hint that many other eIF3-guided mechanisms of cell-specific translational control await discovery.

In the nervous system, emerging evidence suggests that eIF3 subunits may have critical functions. Knockdown of multiple eIF3 subunits impairs expression of dendrite pruning factors in developing sensory neurons of Drosophila (Rode et al., 2018). In mouse brain, eIF3h directly interacts with collybistin, a conserved neuronal Rho-GEF protein underlying X-linked intellectual disability with epilepsy (Sertie et al., 2010; Machado et al., 2016). In humans, altered expression of the eIF3 complex in the substantia nigra and frontal cortex correlates with Parkinson’s Disease progression (Garcia-Esparcia et al., 2015). Downregulation of mRNAs encoding eIF3 subunits is observed in a subset of motor neurons in amyotrophic lateral sclerosis patients (Cox et al., 2010). Furthermore, a single-nucleotide polymorphism located in the intron of human eIF3g elevates its mRNA levels and is associated with narcolepsy (Holm et al., 2015). While these data suggest that eIF3 function in neurons is crucial, mechanistic understanding will require experimental models enabling in vivo investigation of how eIF3 affects protein translation with neuron-type specificity.

Protein translation in C. elegans employs all conserved translation initiation factors. We have investigated the mechanisms of protein translation in response to neuronal overexcitation using a gain-of-function (gf) ion channel that arises from a missense mutation in the pore-lining domain of the acetylcholine receptor subunit ACR-2 (Jospin et al., 2009). The cholinergic motor neurons (ACh-MNs) in the ventral cord of acr-2(gf) mutants experience constitutive excitatory inputs, which gradually diminish pre-synaptic strength and cause animals to display spontaneous seizure-like convulsions and uncoordinated locomotion (Jospin et al., 2009; Zhou et al., 2017). acr-2(gf) induces activity-dependent transcriptome changes (McCulloch et al., 2020). However, it is unclear how protein translation conducts the activity-dependent proteome changes that sustain function of these neurons.

Here, we demonstrate that C. elegans EIF-3.G/eIF3g regulates the translation efficiency of select mRNAs in ACh-MNs. We characterized a mutation (C130Y) in the zinc-finger of EIF-3.G that suppresses behavioral deficits of acr-2(gf) without disrupting general protein translation. By systematic profiling of EIF-3.G and mRNA interactions in ACh-MNs, we identified preferential binding of EIF-3.G to long and GC-rich 5'UTRs of mRNAs, many of which encode modulators of ACh-MN activity. We further provided in vivo evidence that EIF-3.G regulates the expression of two of its mRNA targets dependent on their 5′UTRs. Our findings illustrate the selectivity of EIF-3.G in augmenting mRNA translation to mediate neuronal activity changes.

Results

A missense mutation in EIF-3.G ameliorates convulsion behaviors caused by cholinergic hyperexcitation

We previously characterized numerous mutations that suppress convulsion and locomotion behaviors of acr-2(gf) animals (McCulloch et al., 2017). One such suppressor mutation, ju807, was found to contain a single nucleotide alteration in eif-3.G, encoding subunit G of the EIF-3 complex (Figure 1A; see Materials and methods). C. elegans EIF-3.G is composed of 262 amino acids, sharing overall 35% or 32% sequence identity with human eIF3g and S. cerevisiae TIF35 orthologs, respectively (Figure 1—figure supplement 1A). Both biochemical and structural data show that eIF3g/TIF35 proteins bind eIF3i/TIF34 through a domain in the N-terminus (Figure 1B; Valášek et al., 2017). eIF3g/EIF-3.G also has a predicted CCHC zinc finger followed by an RNA recognition motif (RRM) at the C-terminus (Figure 1B and Figure 1—figure supplement 1A). The ju807 mutation changes the second cysteine of the CCHC motif (Cys130, corresponding to Cys160 in human eIF3g) to tyrosine (Figure 1B). Hereafter, we designate eif-3.G(ju807) as eif-3.G(C130Y).

Figure 1 with 3 supplements see all
Download asset Open asset
eif-3.G(C130Y) suppresses acr-2(gf) convulsion behavior in the cholinergic motor neurons.

(A) Illustration of the genomic locus of eif-3.G: Peif-3.G denotes the promoter, blue boxes are exons for coding sequences and gray for 3′UTR. Arrowhead indicates guanine to adenine change in ju807; and short line below represents a 19 bp deletion in ju1327, designated eif-3.G(0), that would shift the reading frame at aa109, resulting in a premature stop (asterisk) after addition of 84aa of no known homology. (B) Illustration of EIF-3.G: shaded blue represents EIF-3.I binding region, ZF for Zinc Finger, RRM for RNA Recognition Motif. Below is a multi-species alignment of the zinc finger domain with bold residues as the CCHC motif and gray for conserved residues. ju807 causes a C130Y substitution (black arrow). C127Y (red arrow, ju1840) was generated with CRISPR editing. C. elegans (C. e.; NP_001263666.1), S. cerevisiae (S. c.; NP_010717.1), D. melanogaster (D. m.; NP_570011.1), X. laevis (X. l.; NP_001087888.1), and H. sapiens (H.s.; AAC78728.1). (C) Quantification of convulsion frequencies of animals of indicated genotypes, with the strains (left to right) as: N2, MT6241, CZ21759, CZ28495, CZ21759, CZ22977. Ex[eif-3.G(C130Y)] transgenes (juEx7015/juEx7016) expressed full-length genomic DNA cloned from eif-3.G(ju807). (D) Illustration of eif-3.G expression constructs: top shows the transgene expressing genomic eif-3.G(+ for wild type and C130Y for ju807) with the endogenous eif-3.G promoter and 3′UTR, and coding exons in blue; bottom shows cell-type expression of eif-3.G cDNA driven by tissue-specific promoters (Pmyo-3- body muscle, Punc-25- GABAergic motor neurons, Punc-17β - cholinergic motor neurons). (E) Quantification of convulsion frequencies shows that convulsion behavior of eif-3.G(C130Y); acr-2(gf) double mutants is rescued by transgenes that overexpress eif-3.G(+) genomic DNA or an eif-3.G(+) cDNA in the ACh-MNs, but not in the GABAergic motor neurons or body muscle. Strains (left to right)- N2, CZ21759, CZ23125/ CZ23126, CZ22980/ CZ22981, CZ23791/ CZ23880, CZ22982/ CZ22983, CZ27881/ CZ27882. (F) Quantification of convulsion frequencies in animals of the indicated genotypes (left to right)- N2, CZ22917, MT6241, CZ21759, CZ28495, CZ21759, CZ21759, CZ23310, CZ26828. Data in (D-F) are shown as mean ± SEM and sample size is indicated within or above each bar. Statistics: (***) p<0.001, (ns) not significant by one-way ANOVA with Bonferroni’s post hoc test.

Figure 1—source data 1

Source data for Figure 1C.

Quantification of convulsions per 60 s in strains of the indicated genotypes.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig1-data1-v2.xlsx
Figure 1—source data 2

Source data for Figure 1E.

Quantification of convulsions per 60 s in the indicated strains.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig1-data2-v2.xlsx
Figure 1—source data 3

Source data for Figure 1F.

Quantification of convulsions per 60 s in strains. Strain name or genotype is indicated in top row.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig1-data3-v2.xlsx

Compared to acr-2(gf) single mutants, eif-3.G(C130Y); acr-2(gf) animals exhibited nearly wild-type movement and strongly attenuated convulsion behavior (Figure 1C; Videos 1–3). acr-2(gf) animals carrying heterozygous eif-3.G(C130Y/+) showed partial suppression of convulsions (Figure 1C). Overexpression of wild type eif-3.G full-length genomic DNA in eif-3.G(C130Y); acr-2(gf) double mutants restored convulsions to levels similar to eif-3.G(C130Y/+); acr-2(gf) (Figure 1D–E; Materials and methods). Overexpression of eif-3.G(C130Y) full-length genomic DNA in acr-2(gf) single mutants also partially suppressed convulsions (Figure 1C–D). In wild-type animals, overexpression of eif-3.G(+) or eif-3.G(C130Y) caused no observable effects on locomotion. These data show that eif-3.G(C130Y) acts in a semi-dominant manner to ameliorate convulsion and uncoordinated locomotion behaviors of acr-2(gf). To further test that altering the EIF-3.G zinc finger motif accounts for the observed suppression of acr-2(gf), we edited the first cysteine of the CCHC motif (Cys127) to tyrosine using CRISPR-Cas9, and found that eif-3.G(C127Y) suppressed acr-2(gf) convulsions to levels identical to eif-3.G(C130Y) (Figure 1B–C). This data provides support for the importance of the EIF-3.G zinc finger in regulation of ACh-MN activity. Hereafter, we focused our analysis on eif-3.G(C130Y).

Video 1
Download asset
N2 [Wild type] C. elegans movement on solid nematode growth media.
Video 2
Download asset
MT6241 [acr-2(gf)] C. elegans movement on solid nematode growth media.
Video 3
Download asset
CZ21759 [eif-3.G(C130Y); acr-2(gf)] C. elegans movement on solid nematode growth media.

We next determined in which cell types eif-3.G(C130Y) functions using cell-specific expression analysis (Figure 1D; also see Materials and methods). acr-2(gf) phenotypes arise from a hyperactive ACR-2-containing ion channel expressed in the ventral cord cholinergic motor neurons (ACh-MNs) (Jospin et al., 2009). We found that overexpressing eif-3.G(+) cDNA in ACh-MNs (Punc-17β) restored convulsions of eif-3.G(C130Y); acr-2(gf) animals to a similar degree as those expressing full-length eif-3.G(+) under the endogenous promoter (Peif-3.G) (Figure 1E). In contrast, overexpression of eif-3.G(+) cDNA in either ventral cord GABAergic neurons (GABA-MNs, Punc-25) or body muscle (Pmyo-3) in eif-3.G(C130Y); acr-2(gf) animals caused no detectable effects (Figure 1E). Co-expression of eif-3.G(+) in both ACh-MNs and GABA-MNs showed similar effects on eif-3.G(C130Y); acr-2(gf) animals to that from expressing eif-3.G(+) in ACh-MNs alone (Figure 1E). Thus, eif-3.G(C130Y) functions in ACh-MN to modulate acr-2(gf) behaviors.

EIF-3.G(C130Y) selectively affects translation in ACh-MNs

eif-3.G(C130Y) single mutants exhibit normal development, locomotion, and other behaviors (such as male mating and egg-laying) indistinguishably from wild-type animals (Figure 1F, Video 4). Axon morphology and synapse number of ACh-MNs were also normal in eif-3.G(C130Y) animals (Figure 1—figure supplement 2A–B). To dissect how the C130Y mutation affects EIF-3.G function, we next generated a genetic null mutation (ju1327) using CRISPR editing (Figure 1A and Figure 1—figure supplement 1A; designated eif-3.G(0), see Materials and methods). Homozygous eif-3.G(0) animals arrested development at L1 stage, consistent with EIF-3 complex members being required for C. elegans development (Kamath et al., 2003). eif-3.G(0/+); acr-2(gf) animals were indistinguishable from acr-2(gf) single mutants (Figure 1F). We additionally tested null mutations in EIF-3.E and EIF-3.H, two essential subunits of EIF-3 complex, and found that acr-2(gf) animals carrying heterozygous null mutations in either eif-3 subunit gene showed convulsions similar to eif-3.G(0/+); acr-2(gf) (Figure 1—figure supplement 3A). Moreover, hemizygous eif-3.G(C130Y/0) animals are healthy at all stages and suppress behaviors of acr-2(gf) to levels comparable to eif-3.G(C130Y) (Figure 1F). Reducing one copy of eif-3.H(+) or eif-3.E(+) in eif-3.G(C130Y); acr-2(gf) animals also did not modify the suppression effect of eif-3.G(C130Y) (Figure 1—figure supplement 3A). These observations suggest that eif-3.G(C130Y) retains sufficient function of wild-type eif-3.G, and likely affects a regulatory activity that is not dependent on EIF-3 subunit dosage.

Video 4
Download asset
CZ22197 [eif-3.G(C130Y)] C. elegans movement on solid nematode growth media.

We considered that EIF-3.G(C130Y) could alter EIF-3.G protein levels in ACh-MNs. To test this, we generated single-copy chromosomal integrated transgenes expressing EIF-3.G(WT) or EIF-3.G(C130Y) tagged with GFP at the N-terminus under the control of the endogenous eif-3.G promoter (Materials and methods and Supplementary file 1). Fluorescence from both GFP::EIF-3.G(WT) and GFP::EIF-3.G(C130Y) was observed in all somatic cells (Figure 1—figure supplement 1B). In ACh-MNs, both proteins showed cytoplasmic localization (Figure 2B). The GFP::EIF-3.G(WT) transgene rescued eif-3.G(0) to adults (Supplementary file 1) and also restored convulsion behavior in the eif-3.G(C130Y); acr-2(gf) background (Figure 2A). In contrast, the GFP::EIF-3.G(C130Y) transgene reduced convulsion behavior in the acr-2(gf) background. Furthermore, we introduced the GFP::EIF-3.G(C130Y) transgene into the eif-3.G(0); acr-2(gf) background and observed that this transgene rescued the arrested larvae to adults and nearly abolished convulsion behavior (Figure 2A). This analysis shows that GFP::EIF-3.G(WT) and GFP::EIF-3.G(C130Y) retain function and lends further support that eif-3.g(C130Y) is responsible for the suppression of acr-2(gf). Quantification of GFP levels in the ACh-MNs showed equivalent intensity and localization of GFP::EIF-3.G (WT and C130Y) between wild type and acr-2(gf) animals (Figure 2B), indicating that EIF-3.G(C130Y) does not increase EIF-3.G protein stability.

Figure 2
Download asset Open asset
eif-3.G(C130Y) involves a selective function of EIF-3.G on translational control.

(A) Quantification of convulsion frequency in animals expressing GFP::EIF-3.G(WT) or GFP::EIF-3.G(C130Y) under Peif-3.G in the indicated genetic backgrounds; and the strains (left to right) are: MT6241, CZ24729, CZ24652, CZ28497, CZ21759, CZ28107. Error bars represent ± SEM with n = 15 per sample. (***) P< 0.001, (ns) not significant, by one-way ANOVA with Bonferroni’s post-hoc test. (B) EIF-3.G(WT) and EIF-3.G(C130Y) show comparable expression in ACh-MNs. Left are representative single-plane confocal images of EIF-3.G(WT)::GFP or EIF-3.G(C130Y)::GFP driven by the Peif-3.G promoter as single-copy transgenes in L4 animals (head to the left). Red circles mark the soma of VA10, VB11, and DB7 ACh-MN, based on co-expressing a Pacr-2-mcherry marker. Scale bar = 4 µm. Right: Mean GFP fluorescence intensities (AU) in ACh-MN soma in animals of the indicated genotypes (n = 8). Each data point represents the mean intensity from VA10, VB11, and DB7 neurons in the same animal and normalized to the mean GFP::EIF-3.G intensity in a wildtype background. Error bars represent ± SEM; (ns) not significant by one-way ANOVA with Sidak’s multiple comparisons test. (C) Representative polysome profile traces from total mRNA-protein extracts of wild type and eif-3.G(C130Y) single mutant animals. Vertical lines (marked by *) within traces indicate the boundaries of fraction collection. (D) Polysome::monosome (P/M) ratios calculated based on the area under the respective curves for polysomal and monosome (80S) fractions using two replicates of polysome profiles from total extracts of indicated genotypes. (ns) not significant by one-way ANOVA with Bonferroni’s post-hoc test.

Figure 2—source data 1

Source data for Figure 2A.

Quantification of convulsions per 60 s in the indicated strains.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig2-data1-v2.xlsx
Figure 2—source data 2

Source data for Figure 2B.

Quantification of relative fluorescence intensity in the indicated strains.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig2-data2-v2.xlsx
Figure 2—source data 3

Source data for Figure 2C.

Quantification of polysome to monosome ratios in wildtype(N2) and strains of the indicated genotypes.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig2-data3-v2.xlsx

We further assessed whether eif-3.G(C130Y) alters global translation by performing polysome profile analysis using whole C. elegans lysates of L4 stage animals. Both the distribution and ratio of monosomes and polysomes were similar among wild type, eif-3.G(C130Y), acr-2(gf) and eif-3.G(C130Y); acr-2(gf) animals (Figure 2C–D), indicating that eif-3.G(C130Y) possesses normal function in the majority of tissues. It is possible that eif-3.G(C130Y) suppresses acr-2(gf) by simply reducing ACR-2 translation. We tested this by examining a functional GFP-tagged ACR-2 single-copy insertion transgene (oxSi39). We observed both the levels of ACR-2::GFP fluorescence and post-synaptic localization in ACh-MNs were comparable between wild type and eif-3.G(C130Y) animals (Figure 1—figure supplement 3B). These data support the conclusion that eif-3.G(C130Y) preferentially affects EIF-3’s function in ACh-MNs.

The activity of EIF-3.G(C130Y) requires its RRM

The RRM located at the C-terminus of eIF3g has been shown to bind RNA in a non-specific manner (Hanachi et al., 1999). To address the role of the RRM in EIF-3.G’s function, we generated a transgene expressing EIF-3.G(∆RRM) (Figure 3; Supplementary file 1). Expressing EIF-3.G(∆RRM) under the endogenous promoter Peif-3.G in a wild-type background did not alter development or locomotion, and also did not rescue eif-3.G(0) developmental arrest, supporting the essentiality of the EIF-3.G RRM. We then generated a transgene expressing EIF-3.G(C130Y) lacking the RRM domain (C130Y ∆RRM) in neurons of the acr-2(gf) background (Figure 3). In contrast to full-length eif-3.G(C130Y), eif-3.G(C130Y ∆RRM) did not alter convulsion behavior of acr-2(gf) mutants (Figure 3B), indicating that eif-3.G(C130Y) function requires its RRM.

Figure 3
Download asset Open asset
eif-3.G(C130Y) requires the RNA-binding domain (RRM) to suppress acr-2(gf) behaviors.

Top illustration of the EIF-3.G protein showing the EIF-3.I binding region (blue), zinc finger (ZF), RRM (dark grey), Q191* mutation in the EIF-3.G(∆RRM) transgene, RNP motifs (purple), and the RFF residues (bold dark blue) changed to alanine in the eif-3.G(RFF/AAA) construct. Below is an illustration of C. elegans EIF-3.I pointing to the position of E252R within the fourth WD40 domain. Bottom graph is quantification of convulsion frequency in acr-2(gf) animals expressing eif-3.G and eif-3.I variants in the nervous system (Prgef-1). The strains (left to right) are: MT6241, CZ23203/ CZ23204, CZ28152/ CZ28153, CZ23304/ CZ23305, CZ28152/ CZ28153, CZ28057/ CZ28058, CZ28064/ CZ28065. Bars represent mean convulsion frequency ± SEM and sample sizes are indicated within or above bars. (***) p< 0.001, (ns) not significant, by one-way ANOVA with Bonferroni’s post-hoc test.

Figure 3—source data 1

Source data for Figure 3.

Quantification of convulsions per 60 s in the indicated strains.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig3-data1-v2.xlsx

Studies on S. cerevisiae TIF35/EIF3.G have shown that its RRM promotes scanning of the translation pre-initiation complex through structured 5′UTRs (Cuchalová et al., 2010). Specifically, alanine substitution of three residues in the two ribonucleoprotein (RNP) motifs (K194 in RNP2 and L235 and F237 in RNP1) in TIF35 reduced translation of mRNA reporters carrying 5′UTRs with hairpin structures, without altering the biochemical RNA-binding activity of EIF-3.G/TIF35. Equivalent amino acid residues in C. elegans EIF-3.G correspond to R185, F225, F227, which are conserved in human (R242, F282, F284) (Figure 3; Figure 1—figure supplement 1A). To determine whether these residues affect EIF-3.G’s function, we expressed C. elegans eif-3.G cDNA with the corresponding amino acids mutated to alanine, designated eif-3.G(RFF/AAA), in acr-2(gf) animals. We detected partial suppression of convulsion behavior in acr-2(gf) animals (Figure 3).

It was also reported that a missense mutation (Q258R) in yeast EIF-3.I/TIF34, located in the sixth WD40 repeat, reduced the rate of pre-initiation complex scanning through 5′UTRs (Cuchalová et al., 2010). To test if C. elegans eif-3.I shares similar activities, we made a mutant EIF-3.I(E252R), equivalent to yeast TIF34 (Q258R) (Figure 3). In acr-2(gf) animals, overexpressing eif-3.I(E252R), but not wild-type eif-3.I(+), caused suppression of convulsions to a similar degree as that by the eif-3.G(RFF/AAA) transgene (Figure 3). These analyses suggest that attenuation of acr-2(gf)-induced neuronal overexcitation may involve regulation of protein translation through modification of 5′UTR scanning rates during translation initiation.

Both EIF-3.G(WT) and EIF-3.G(C130Y) associate with mRNA 5′UTRs in the cholinergic motor neurons

EIF-3.G may interact with specific mRNAs in the nervous system to regulate cholinergic activity. Therefore, we next searched for mRNAs that are associated with EIF-3.G(WT) and EIF-3.G(C130Y) in the ACh-MNs using single-end enhanced crosslinking and immunoprecipitation (Van Nostrand et al., 2017). We generated single-copy transgenes expressing 3xFLAG-tagged EIF-3.G(WT), EIF-3.G(C130Y), or EIF-3.G(∆RRM) in the ACh-MNs of acr-2(gf) animals, with EIF-3.G(∆RRM) serving to detect indirect crosslinking events. We confirmed that the truncated EIF-3.G(∆RRM) transgene was expressed, but at reduced levels compared to the EIF-3.G(WT) and EIF-3.G(C130Y) transgenes (Figure 4—figure supplement 1A). Following cross-linking and immunoprecipitation using anti-FLAG antibodies, we obtained a comparable amount of immunoprecipitated GFP::EIF-3.G proteins and obtained more reads from seCLIP on animals expressing each GFP::EIF-3.G transgene than on control animals lacking any transgene (IgG(-); see Supplementary file 4). There was a strong correlation between read clusters detected among sets of two biological replicates (Figure 4—figure supplement 1B). We defined EIF-3.G-RNA crosslink sites as clusters of at least 20 high-quality reads with at least 1.5 fold change enrichment over the input control (see Materials and methods and Supplementary file 5). We further defined specific footprints of EIF-3.G(WT) and EIF-3.G(C130Y) by subtracting clusters detected with EIF-3.G(∆RRM) (Supplementary file 6, also see Materials and methods). The EIF-3.G-specific footprints were primarily located within or near the 5′UTRs of protein-coding genes (5′UTR proximal) (Figure 4A–B). In total, we detected 231 5′UTR proximal footprints of EIF-3.G(WT) or EIF-3.G(C130Y), which mapped to 225 different genes (Figure 4C). The number of reads comprising EIF-3.G(WT) or EIF-3.G(C130Y) footprints was similar (e.g. egl-30; Figure 4B) for most of these genes. While some footprints were differentially detected between EIF-3.G(WT) and EIF-3.G(C130Y), this was almost invariably due to small differences in seCLIP signal intensity (read cluster size) between samples close to the 20 reads threshold (Figure 4C), and we therefore did not further pursue its significance.

Figure 4 with 2 supplements see all
Download asset Open asset
Both EIF-3.G(WT) and EIF-3.G(C130Y) associate with mRNA 5′UTRs in the cholinergic motor neurons.

(A) Pie charts displaying the proportion of EIF-3.G(WT) and EIF-3.G(C130Y) footprints located within each gene feature. (B) seCLIP read density track of EIF-3.G(WT) and EIF-3.G(C130Y) footprints on the 5′UTR of egl-30, compared to the EIF-3.G(∆RRM) control. (C) Scatter plot comparing the signal intensity, in reads per million (RPM), of all 231 5′UTR proximal footprints detected in EIF-3.G(WT) or EIF-3.G(C130Y). (D) Plots show the cumulative coverage of all 5′UTR proximal (top) or 3′UTR (bottom) footprints of EIF-3.G(WT) or EIF-3.G(C130Y) relative to the start codon (top) or stop codon (bottom) position. Coverage is presented as reads per million (RPM). (E–F) Box plots comparing length and GC-content of all 5′UTR sequences of EIF-3.G target mRNAs with annotations (n = 179) to all 5′UTRs in the acr-2(gf) cholinergic neuronal transcriptome (n = 4573). Boxes are 5–95 percentile with outliers aligned in red. Statistics: (***) p< 0.001, (**) p< 0.01 by two-tailed Mann-Whitney test.

Figure 4—source data 1

Source data for Figure 4A.

Number of read clusters representing footprints of EIF-3.G(WT) or EIF-3.G(C130Y) mapping to 5′UTR proximal or 3′UTR regions.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig4-data1-v2.xlsx
Figure 4—source data 2

Source data for Figure 4C.

seCLIP reads for EIF-3.G(WT) and EIF-3.G(C130Y) 5’UTR proximal footprints represented as log2(reads per million).

https://cdn.elifesciences.org/articles/68336/elife-68336-fig4-data2-v2.xlsx
Figure 4—source data 3

Source data for Figure 4D.

Cumulative EIF-3.G(WT) and EIF-3.G(C130Y) footprint coverage per base distance from the start codon (5’UTR proximal footprints) or stop codon (3’UTR footprints) represented as reads per million.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig4-data3-v2.xlsx
Figure 4—source data 4

Source data for Figure 4E.

Length of 5’UTRs in mRNAs expressed in the ACh-MN transcriptome and EIF-3.G targets.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig4-data4-v2.xlsx
Figure 4—source data 5

Source data for Figure 4F.

Percent GC of 5’UTRs in mRNAs expressed in the ACh-MN transcriptome and EIF-3.G targets.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig4-data5-v2.xlsx

In line with a recent report that the human eIF3 complex remains attached to 80S ribosomes in early elongation (Wagner et al., 2020), we observed the bulk of read clusters comprising EIF-3.G(WT) and EIF-3.G(C130Y) footprints mapping between (-)150 to (+)200 nucleotides of the start codon (Figure 4D). In contrast, the majority of signals comprising 3’UTR footprints of EIF-3.G(WT) and EIF-3.G(C130Y) were dispersed along the first 200 nucleotides downstream of the stop codon (Figure 4D). Overall, the footprint map shows that both EIF-3.G(WT) and EIF-3.G(C130Y) predominantly bind to similar locations within or near the 5′UTRs of 225 genes in the ACh-MNs, hereafter named EIF-3.G targets. Taken together with our finding that eif-3.G(C130Y) requires its RRM to suppress acr-2(gf), the seCLIP analysis suggests that the C130Y mutation does not dramatically alter the ability of EIF-3.G to associate with these mRNAs in the ACh-MNs.

EIF-3.G preferentially interacts with long and GC-rich 5′UTR sequences

5′UTR sequences are widely involved in gene-specific regulation of translation (Pelletier and Sonenberg, 1985; Leppek et al., 2018). We next assessed whether the selective role of EIF-3.G in protein translation might correlate with specific sequence features in the mRNA targets expressed in ACh-MNs by examining the length and GC-content of their 5′UTRs. In C. elegans, about 70% of mRNAs are known to undergo trans-splicing, and 5′UTRs of mRNAs with trans-splice leaders are usually short, with a median length of 29nt. We compared the EIF-3.G target gene list with a database containing a compilation of C. elegans trans-splice events from ENCODE analyses (Allen et al., 2011). We found that 133 of the 225 (59%) EIF-3.G targets are annotated to undergo trans-splicing, which is comparable to that of transcriptome-wide (Allen et al., 2011; Figure 4—figure supplement 2A), suggesting that trans-splicing events may not contribute to EIF-3.G’s selectivity on mRNA targets. Interestingly, we found that the trans-spliced 5′UTRs of these 133 transcripts are significantly longer (median length = 43nt), compared with all trans-spliced 5′UTRs in the C. elegans transcriptome (median length = 29nt; n = 6,674) (Figure 4—figure supplement 2B). To assess the GC content for EIF-3.G mRNA targets, we then applied a threshold to the cholinergic neuronal transcriptome of acr-2(gf) (McCulloch et al., 2020) defining a 5′UTR as at least 10 nucleotides upstream of ATG, and also selected the longest 5′UTR isoform per gene to avoid redundant analysis of target genes (see Materials and methods). Using this criterion, we identified a 5′UTR for 4573 different genes in the cholinergic transcriptome and for 179 of the 232 EIF-3.G targets in the ACh-MNs. The median 5′UTR among the 179 EIF-3.G target mRNAs was significantly longer (93 nt) and GC-enriched (42%), compared to the cholinergic transcriptome median (69 nt and 39% GC; n = 10,962; Figure 4E–F). We further analyzed the distribution of GC sequences in 5′UTRs, and observed non-random positioning such that some genes were relatively GC-rich near the start codon (e.g. zip-2 and sec-61) and others had enrichment closer to the distal 5' end (e.g. pdf-1 and kin-10), suggesting that discrete sequence elements in EIF-3.G associated transcripts may regulate translation (Figure 4—figure supplement 2C).

The incidence of long and GC-enriched 5′UTRs among EIF-3.G associated transcripts led us to speculate a major function of EIF-3.G, in addition to its necessity in general translation initiation, is in the selective regulation of translation. To extend our findings beyond C. elegans, we asked if the preferential association of EIF-3.G with these complex 5′UTRs could be conserved in mammals. We analyzed the published eIF3g PAR-CLIP sequencing data from HEK293 cells (Lee et al., 2015) by comparing the 5′UTR lengths of human eIF3g target genes to all genes with 5′UTRs annotated in the hg38 genome. We found that human transcripts associated with eIF3g contained significantly longer and GC-enriched 5′UTRs than average (Figure 4—figure supplement 2D–E). This analysis lends support for a conserved, specialized role of eIF3g in the translation of transcripts harboring complex 5′UTRs.

EIF-3.G target mRNAs encode proteins that exhibit activity-dependent expression

To address whether EIF-3.G target mRNAs may preferentially affect specific biological processes, we performed Gene Ontology and KEGG pathway analysis. Significant GO term (Ashburner et al., 2000) enrichment was identified in neuropeptide signaling genes (GO:0050793; 15 genes), which are known to affect acr-2(gf) behavior (Stawicki et al., 2013; McCulloch et al., 2020), and in stress response genes (GO: 0006950; 28 genes), which could modulate neuronal homeostasis or function under circuit activity changes (Figure 5A). We also found many EIF-3.G target genes involved in protein translation and protein metabolism processes (GO:0019538; 29 genes; Figure 5A). Additional enrichment was associated with metabolic components, kinase signaling, and calcium and synaptic signaling pathways (Figure 5A). Calcium and synaptic signaling genes included the CAMKII unc-43, and the G-proteins egl-30 and goa-1, which are all known to regulate ACh-MN synaptic activity (Miller et al., 1999; Richmond, 2005; Treinin and Jin, 2020).

Figure 5
Download asset Open asset
Gene network analyses of EIF-3.G target mRNAs show enrichment in activity-dependent expression.

(A) Cytoscape network of EIF-3.G target genes with enriched GO terms (neuropeptide signaling, response to stress, and protein translation and protein metabolism) or KEGG pathways (calcium and synaptic signaling, metabolic components, MAPK-signaling, and mRNA surveillance). Enrichment p-values are derived from statistical analysis of our EIF-3.G targets (n = 225) in the PANTHER database (Mi et al., 2019). (B) EIF-3.G target genes exhibiting significant transcript level changes in acr-2(gf) versus wild-type animals as determined from transcriptome sequencing of cholinergic neurons by McCulloch et al. PT and PM refers to protein translation and protein metabolism. Differential expression was assessed using DeSeq2 (Love et al., 2014) with significance thresholds of (*) p<0.05 and (**) p<0.01.

Figure 5—source data 1

Source data for Figure 5B.

Foldchange in transcript expression in the cholinergic neuronal transcriptome of acr-2(gf) and wild-type animals.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig5-data1-v2.xlsx

To determine if expression of EIF-3.G target mRNAs is regulated in an activity-dependent manner, we next incorporated differential transcript expression data between wild type and acr-2(gf) from a cholinergic neuron transcriptome dataset (McCulloch et al., 2020). We found that 83% of EIF-3.G target mRNAs in the ACh-MNs are present in the cholinergic neuron transcriptome. Among the 45 genes exhibiting significant expression changes dependent on acr-2(gf) (Figure 5B), nearly all neuropeptide signaling transcripts (12 of 15) as well as three stress response genes were upregulated in acr-2(gf) (Figure 5B). Genes encoding metabolic components were variably upregulated (e.g. Glycine decarboxylate/gldc-1, aconitase/aco-1) and downregulated (e.g. glycogen phosphorylase/pygl-1, aldehyde dehydrogenase/alh-9) (Figure 5B). These data support the idea that wild type EIF-3.G imparts translational control to activity-dependent expression changes and that EIF-3.G(C130Y) may exert specific regulation to alter their protein expression in ACh-MNs of acr-2(gf).

EIF-3.G modulates translation of HLH-30 and NCS-2 in hyperactive ACh-MNs

To experimentally validate that EIF-3.G regulates protein expression from its target mRNAs in the ACh-MNs, we next surveyed a number of candidate genes, chosen mainly based on the availability of transgenic reporters that contain endogenous 5′UTRs (Supplementary file 1). We identified two genes (hlh-30 and ncs-2) whose expression in ACh-MNs of acr-2(gf) animals shows dependency on EIF-3.G. hlh-30 produces multiple mRNA isoforms (Figure 6A), which encode the C. elegans ortholog of the TFEB stress response transcription factor with broad neuroprotective roles (Decressac et al., 2013; Polito et al., 2014; Lin et al., 2018). We observed strong seCLIP signals corresponding to EIF-3.G(WT) and EIF-3.G(C130Y) footprints in the 5′UTR of long isoform d, but not in isoform a (Figure 6B). The hlh-30d mRNA isoform has a 5′UTR of 190nt with 43% GC. Using computational RNA structure prediction (RNAfold), we found that the long hlh-30d 5′UTR forms strong stem-loop structures (∆G = −40.78 kcal/mol) that could affect HLH-30 translation. We examined expression of an HLH-30::EGFP fosmid reporter wgIs433, which encompasses the entire hlh-30 genomic region with cis-regulatory elements for all mRNA isoforms (Sarov et al., 2006; Figure 6C). HLH-30::GFP was observed throughout the nervous system and primarily localized to cytoplasm in all genetic backgrounds tested. We observed significantly enhanced HLH-30::GFP signals in the ACh-MNs of acr-2(gf) animals, compared to those in wild type (Figure 6C). While eif-3.G(C130Y) did not alter HLH-30::GFP, it reduced fluorescence intensity in acr-2(gf) to wild type levels (Figure 6C). As hlh-30 transcripts were detected at similar levels in ACh-MNs of wild type and acr-2(gf) animals (McCulloch et al., 2020), the enhanced HLH-30::GFP signal in acr-2(gf) likely reflects elevated translation upon neuronal activity changes, which is augmented by EIF-3.G. To strengthen this idea, we introduced an unc-13 null allele, which blocks presynaptic release (Richmond et al., 1999) to the above analyzed compound genetic mutants. We found that unc-13(0) abolished the enhanced HLH-30::GFP expression caused by acr-2(gf) (Figure 6C). Additionally, we tested a transgenic HLH-30a::GFP reporter expressing hlh-30a cDNA driven by the 2 kb sequence upstream of that isoform (Figure 6—figure supplement 1).

Figure 6 with 1 supplement see all
Download asset Open asset
EIF-3.G(C130Y) impairs HLH-30 expression in ACh-MNs of acr-2(gf) animals.

(A) Gene models of hlh-30 isoforms a (pink), b (blue), and d (green), with presumptive promoters for each isoform depicted as right-pointing arrows and the 5′UTR of isoform d in green to the right of its promoter. (B) seCLIP read density tracks of footprints on the 5′ end of hlh-30 isoform b and d (left) and the 5′ end of hlh-30 isoform a (right) in each indicated EIF-3.G dataset. Purple arrows show footprints on the 5′UTR of hlh-30 isoform d. (C) Top: Illustration of the wgIs433 fosmid locus with hlh-30 coding exons in black and 5′UTR of isoform d in green to the right of the promoter. Bottom: Representative single-plane confocal images of the fosmid translational reporter wgIs433[hlh-30::EGFP::3xFLAG] in ACh-MNs in animals of indicated genotypes. Quantification of GFP intensity is shown on the right (n = eight for each genotype). Animals are oriented with anterior to the left. Scale bar = 4 µm. Red dashes indicate labeled ACh-MN soma. Each data point is the average fluorescence intensity quantified from the three ACh-MN soma per animal and normalized to the mean intensity obtained from wgIs433 in the wild type background. Statistics: (***) p< 0.001, (ns) not significant, one-way Anova with Bonferroni’s post hoc test.

Figure 6—source data 1

Source data for Figure 6C.

Quantification of relative fluorescence intensity in strains of the indicated genotypes.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig6-data1-v2.xlsx

We found that HLH-30a::GFP intensity was comparable between acr-2(gf) and eif-3.G(C130Y); acr-2(gf) (Figure 6D). These data strengthen the conclusion that enhanced HLH-30 translation in acr-2(gf) partly involves the complex 5′UTR of hlh-30d.

The Neuronal Calcium Sensor protein encoded by ncs-2 promotes calcium-dependent signaling in ACh-MNs (Zhou et al., 2017). We identified strong and specific association of EIF-3.G(WT) and EIF-3.G(C130Y) overlapping the 5′UTR of ncs-2 (Figure 7A). To evaluate NCS-2 expression, we examined a single-copy translational reporter (juSi260) expressing NCS-2::GFP under its endogenous promoter (Zhou et al., 2017; Figure 7B). NCS-2::GFP localized primarily to the neuronal processes in ventral nerve cord, because of the N-terminal myristoylation motif. Quantification of NCS-2::GFP showed that the fluorescence intensity in eif-3.G(C130Y); acr-2(gf) double mutants was significantly reduced, compared to those in wild type, eif-3.G(C130Y), and acr-2(gf) (Figure 7B). ncs-2 mRNA is SL1 trans-spliced, and the mature 5′UTR has 37 nt that is especially abundant in GC nucleotides (47% GC) (Figure 7B). Moreover, the ncs-2 5′UTR sequence is highly conserved with other nematode species (Figure 7—figure supplement 1A). By RNAfold prediction, we found this sequence could form a strong stem-loop structure (∆G = −5.10 kcal/mol). To test if NCS-2::GFP expression was regulated specifically through its 5′UTR, we replaced it with the 5′UTR of eif-3.G, which is comparatively reduced in GC-content (37% GC) and with much less folding stability (∆ = −1.95 kcal/mol) (Figure 7C). The eif-3.G 5′UTR is also less conserved across nematodes compared to that of ncs-2 (Figure 7—figure supplement 1A). We found that the NCS-2::GFP reporter with the 5′UTR of eif-3.G was expressed at similar levels in all genetic backgrounds (Figure 7C).

Figure 7 with 1 supplement see all
Download asset Open asset
Regulation of NCS-2 expression by EIF-3.G depends on its GC-rich 5′UTR.

(A) Illustration of the ncs-2 genomic region. Dark blue represents 5′UTR, green boxes are coding exons, and gray is the 3′UTR. The inset below shows the read density track of seCLIP footprints on the 5′ region of ncs-2 mRNA. (B) Top: Schematic of the NCS-2(cDNA)::GFP translation reporter, including its 5′UTR (dark blue), driven by the 4 kb promoter Pncs-2. The 5′UTR sequences are GC rich (purple). Bottom: Representative single-plane confocal images of NCS-2::GFP in ventral nerve chord processes in young adult animals of the indicated genotypes. GFP intensity quantification is shown to the right. (C) Top: The ncs-2(5′UTR mutant)::GFP translational reporter has the 5′UTR of eif-3.G (red boxed sequence) replacing the ncs-2 5′UTR, driven by Pncs-2. Bottom: Representative single-plane confocal images of ventral nerve chord processes expressing the NCS-2(5′UTR mutant)::GFP translation reporter in young adult animals of the indicated genotypes. GFP intensity quantification is shown to the right. For (B) and (C), data points are normalized to the average fluorescence intensity of the respective translation reporter in the wild-type background. ROIs used for fluorescence quantification are boxed. Scale bar = 15 µm. Statistics: (**) P< 0.01, (ns) not significant by one-way Anova with Bonferroni’s post hoc test.

Figure 7—source data 1

Source data for Figure 7B.

Quantification of relative fluorescence intensity in strains of the indicated genotypes.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig7-data1-v2.xlsx
Figure 7—source data 2

Source data for Figure 7C.

Quantification of relative fluorescence intensity in the indicated strains.

https://cdn.elifesciences.org/articles/68336/elife-68336-fig7-data2-v2.xlsx

To further determine the effects of the ncs-2 5′UTR in protein translation with neuronal type resolution, we generated a reporter in which the GFP coding sequence was fused in-frame after the first four amino acids of NCS-2, which retains the ncs-2 5′UTR but disrupts the myristoylation motif, thereby enabling visualization of NCS-2 in ACh-MNs (Figure 7—figure supplement 1B). Quantification of GFP fluorescence in the cell bodies of VA10, VB11, and DB7 ACh-MN showed significantly reduced expression in eif-3.G(C130Y); acr-2(gf) animals (Figure 7—figure supplement 1B). In contrast, a similar reporter but with the 5′UTR of eif-3.G displayed similar GFP levels in all genetic backgrounds (Figure 7—figure supplement 1C). Therefore, we conclude that eif-3.G regulates NCS-2 expression in the ACh-MNs through a mechanism involving its 5′UTR sequence.

Discussion

The eIF3 complex has been extensively studied for its essential roles in general translation initiation (Cate, 2017; Valášek et al., 2017). However, recent work gives support to the idea that eIF3 is also key to many of the specialized translational control mechanisms needed for tissue plasticity in vivo (Lee et al., 2015; Shah et al., 2016; Rode et al., 2018; Lamper et al., 2020). Our work expands the landscape of eIF3’s regulatory functions, revealing an in vivo role of the eIF3g subunit in stimulating the translation of proteins that mediate neuronal activity changes.

EIF-3.G ensures the efficient translation of mRNAs with GC-rich 5′UTRs

Our study is the first application of seCLIP-seq to map transcriptome-wide protein binding sites in a specific neuronal subtype (ACh-MNs) in C. elegans. With stringent thresholding, we identified 225 genes with strong EIF-3.G occupancy at mRNA 5′ ends. We find that EIF-3.G generally associates with mRNAs harboring long and GC-rich 5′UTRs, implying its RNA-binding function is selective for stimulating translation initiation on 5′ leaders prone to secondary structure or other forms of translation regulation. Our data provide in vivo support to the finding that yeast eIF3g/TIF35 promotes scanning through 5′UTRs with stem-loop structures (Cuchalová et al., 2010). The RRM of yeast eIF3g/TIF35 also promotes re-initiation of 40S ribosomes upon terminating at uORF stop codons on GCN4, thereby allowing efficient induction of genes whose translation is regulated by uORFs (Cuchalová et al., 2010). We did not observe uORFs in the 5′UTRs of ncs-2 or hlh-30, suggesting that at least for these mRNAs, eif-3.G(C130Y) involves reduced scanning through secondary structures or other yet undefined regulatory sequence elements.

It is worth noting that we also found EIF-3.G footprints in 3′UTRs, which could reflect molecular crosstalk between translation initiation and 3′UTR factors, given their proximity in the closed loop translation model (Imataka et al., 1998; Wells et al., 1998). EIF-3.G might anchor the closed-loop mRNA form that stimulates multiple rounds of translation, as was shown to be the case with eIF3h (Choe et al., 2018). It is also possible that EIF-3.G cooperates with 3′UTR interacting factors that regulate gene expression, as several C. elegans translation initiation factors co-immunoprecipitated with the miRISC complex (Zhang et al., 2007) and accumulating evidence supports interplay between various translation factors and RISC proteins that mediate translational repression by microRNAs (Ricci et al., 2013; Fukaya et al., 2014; Gu et al., 2014). Thus, further analysis is needed to examine the biological meaning of EIF-3.G association with 3′UTRs.

The EIF-3.G zinc finger conveys a selective function to translation initiation

The function of the zinc finger of eIF3g remains undefined. Through analysis of EIF-3.G(C130Y), our data provides in vivo insights that the zinc finger contributes to translation efficiency of mRNAs harboring complex 5′UTRs. We establish that EIF-3.G(C130Y) behaves as a genetic gain-of-function mutation without disrupting EIF-3 assembly or otherwise impairing general translation, measured by both polysome levels and the health of cells, tissues, and animals. Additionally, mutating a different cysteine within the zinc finger (C127Y) causes equivalent effects, further strengthening the important role of the entire zinc finger. The effect of EIF-3.G(C130Y) on acr-2(gf) behaviors depends on the RRM, suggesting that association with mRNA after assembly of the pre-initiation complex is required for EIF-3.G(C130Y) function. While we did not observe significant mis-positioning of EIF-3.G-mRNA interactions by EIF-3.G(C130Y), we acknowledge that seCLIP may not have the resolution required to reveal subtle differences in crosslinking sites caused by the C130Y alteration. Together, our data is consistent with a model where EIF-3.G(C130Y) imposes a translational stall after EIF-3 complex assembly and mRNA recruitment. In this view, we speculate that the zinc finger of EIF-3.G mediates interactions with other proteins, such as the ribosome, that critically regulate translation events after mRNA binding. In support of this model, yeast eIF3g/TIF35 was found to directly bind to small ribosomal protein RPS-3, though the molecular basis for mediating this interaction is not identified (Cuchalová et al., 2010). Further studies are required to address the precise molecular mechanism by which the EIF-3.G zinc finger imparts regulatory control over translation initiation.

EIF-3.G targets the translation of mRNAs that modulate neuronal function

Our study was driven by the genetic evidence that eif-3.G(C130Y) ameliorates convulsion behavior caused by the hyperactive ion channel ACR-2(GF). We show that EIF-3.G(C130Y) retains essential EIF-3.G function, yet it alters protein translation on select mRNAs in hyperactive ACh-MNs, as evidenced by its effects on NCS-2 and HLH-30 expression. We previously reported that complete loss-of-function of ncs-2 strongly suppresses acr-2(gf) behaviors to a similar degree as eif-3.G(C130Y) (Zhou et al., 2017). However, 50% reduction of ncs-2 expression does not cause detectable consequences and complete loss-of-function in hlh-30 also has no effects in either wild type or acr-2(gf). Thus, the small reduction of NCS-2 and HLH-30 waged by eif-3.G(C130Y) is unlikely to account for the full extent of phenotypic suppression of acr-2(gf). Our seCLIP data also revealed EIF-3.G interactions with many other genes that differentially impact acr-2(gf) behavior (e.g. neuropeptide flp-18, endopeptidase egl-3) and cholinergic activity (e.g. G proteins goa-1, egl-30). Interestingly, many of the pre-synaptic genes that regulate acr-2(gf) behavior, such as unc-13/Munc13, unc-17/VAChT (Zhou et al., 2013; Takayanagi-Kiya et al., 2016; McCulloch et al., 2017), do not have EIF-3.G footprints. Thus, our data is consistent with a model where eif-3.G(C130Y) ameliorates behaviors of acr-2(gf) through the cumulative changes of select ACh-MN activity regulators.

eif-3.G function may be specialized for activity-dependent gene expression

The eIF3 complex is widely implicated in brain disorders, and deregulated eIF3g is specifically linked to narcolepsy (Gomes-Duarte et al., 2018). However, given the essential role of eIF3 in protein translation in all tissues, investigation of its functions in the nervous system remains limited. Our results reveal that EIF-3.G permits normal activity-dependent protein expression changes, and suggest that dysregulated EIF-3.G might potentiate aberrant neuronal behavior in disorders such as epilepsy by altering the neuronal protein landscape. It is worth noting that pore-lining mutations in human nicotinic receptors that occur at similar positions as acr-2(gf) are causally linked to epilepsy (Xu et al., 2011). We speculate that EIF-3.G may be a potential target for intervention of disorders involving abnormal neurological activity.

In summary, our findings echo the general notion that fine-tuning the activity of essential cellular machinery, such as ribosomes and translation complexes holds the key to balance cellular proteome under dynamic environmental challenges or disease conditions. Emerging studies from cell lines show that stress conditions can induce post-translational modification of eIF3 subunits (Lamper et al., 2020) or cap-independent interactions with mRNAs to modify proteomes (Meyer et al., 2015). Through characterization of the G subunit of eIF3, we reveal the first mechanistic insights into how the eIF3 complex regulates neuronal activity. It is likely that individual eIF3 subunits could each possess unique functions relevant in certain contexts, altogether providing the eIF3 complex with extensive utility to remodel the proteome in response to changing cellular environments.

Materials and methods

Key resources table
Reagent type
(species) or resource		DesignationSource or referenceIdentifiersAdditional information
Antibodyanti-FLAG (Rabbit)Sigma-AldrichCat# F7425, RRID:AB_439687WB (1:2000)
Antibodyanti-Actin clone C4 (Mouse monoclonal)MP BiomedicalsCat# 08691002, RRID:AB_2335304WB (1:2000)
AntibodyAnti-FLAG M2 Magnetic BeadsSigma-AldrichCat# M8823, RRID:AB_2637089IP
Recombinant protein reagentCas9-NLS (purified protein)UC Berkely QB3
Genetic reagent
(C. elegans)		+CGCRRID:CGC_N2
Genetic reagent
(C. elegans)		acr-2(n2420) XJospin et al., 2009MT6241
Genetic reagent
(C. elegans)		eif-3.G(ju807) IIThis workCZ22197Figure 1F
Genetic reagent
(C. elegans)		eif-3.G(ju1840) IIThis workCZ28494Figure 1C
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) XThis workCZ21759Figure 1C
Genetic reagent
(C. elegans)		eif-3.G(ju1840) II; acr-2(n2420) XThis workCZ28495Figure 1C
Genetic reagent
(C. elegans)		eif-3.G(ju1327) / mnC1 IIThis workCZ22974Figure 1F
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7015This workCZ22976Figure 1C
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7016This workCZ22977Figure 1C
Genetic reagent
(C. elegans)		eif-3.G(ju807) I;acr-2(n2420) X; juEx7045This workCZ23125Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7046This workCZ23126Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7019This workCZ22980Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7020This workCZ22981Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7439This workCZ23791Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7440This workCZ23880Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7021This workCZ22982Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx7022This workCZ22983Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx8062This workCZ27881Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; juEx8063This workCZ27882Figure 1E
Genetic reagent
(C. elegans)		eif-3.G(ju1327) /mnC1 II; acr-2(n2420) XThis workCZ23310Figure 1F
Genetic reagent
(C. elegans)		eif-3.G(ju807) / eif-3.G(ju1327) IIThis workCZ25714Figure 1F
Genetic reagent
(C. elegans)		eif-3.G(ju807) / eif-3.G(ju1327) II; acr-2(n2420) XThis workCZ26828Figure 1F
Genetic reagent
(C. elegans)		juSi320 IVThis workCZ24063Figure 2B; Figure 1—figure supplement 1B
Genetic reagent
(C. elegans)		eif-3.G(ju1327) /mnC1 II; juSi320 IVThis workCZ24079Figure 2A
Genetic reagent
(C. elegans)		juSi320 IV; acr-2(n2420) XThis workCZ24729Figure 2A
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; juSi320 IV; acr-2(n2420) XThis workCZ28107Figure 2A
Genetic reagent
(C. elegans)		juSi331 IVThis workCZ24651Figure 2B; Figure 1—figure supplement 1B
Genetic reagent
(C. elegans)		juSi331 IV; acr-2(n2420) XThis workCZ24652Figure 2A
Genetic reagent
(C. elegans)		eif-3.G(ju1327) / mnC1 II; juSi331 IV; acr-2(n2420) XThis workCZ28497Figure 2A
Genetic reagent
(C. elegans)		juIs14 IVWang et al., 2017CZ631
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; juIs14 IVThis workCZ24161Figure 1—figure supplement 2
Genetic reagent
(C. elegans)		juIs14 IV; acr-2(n2420) XMcCulloch et al., 2020CZ5808
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; juIs14 IV; acr-2(n2420) XThis workCZ8905Figure 1—figure supplement 2A
Genetic reagent
(C. elegans)		nuIs94Hallam et al., 2000KP2229
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; nuIs94This workCZ24021Figure 1—figure supplement 2B
Genetic reagent
(C. elegans)		acr-2(n2420) X; nuIs94This workCZ5815Figure 1—figure supplement 2B
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420)X; nuIs94This workCZ24021Figure 1—figure supplement 2B
Genetic reagent
(C. elegans)		eif-3.E(ok2607) I / hT2 I,III; acr-2(n2420) XThis workCZ27434Figure 1—figure supplement 3A
Genetic reagent
(C. elegans)		eif-3.E(ok2607) I / hT2 I, III; eif-3.G(ju807) II; acr-2(n2420) XThis workCZ27433Figure 1—figure supplement 3A
Genetic reagent
(C. elegans)		eif-3.H(ok1353) I / hT2 I, III; acr-2(n2420) XThis workCZ27435Figure 1—figure supplement 3A
Genetic reagent
(C. elegans)		eif-3.H(ok1353) I / hT2 I, III; eif-3.G(ju807) II; acr-2(n2420) XThis workCZ27436Figure 1—figure supplement 3A
Genetic reagent
(C. elegans)		oxSi39 IVQi et al., 2013CZ12338
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; oxSi39 IVThis workCZ23854Figure 1—figure supplement 3B
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7056This workCZ23203Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7057This workCZ23204Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8100This workCZ28152Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8101This workCZ28153Figure 3
Genetic reagent
(C. elegans)		juEx7113This workCZ26777Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7114This workCZ23304Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7115This workCZ23305Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8095This workCZ28066Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8096This workCZ28067Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8087This workCZ28057Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8088This workCZ28058Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8089This workCZ28064Figure 3
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx8090This workCZ28065Figure 3
Genetic reagent
(C. elegans)		unc-119(tm4063) III; wgIs433Sarov et al., 2006OP433
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; unc-119(tm4063)III; wgIs433This workCZ28145Figure 6C
Genetic reagent
(C. elegans)		acr-2(n2420) X; unc-119(tm4063) III; wgIs433This workCZ27913Figure 6C
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; unc-119(tm4063) III; acr-2(n2420) X; wgIs433This workCZ27914Figure 6C
Genetic reagent
(C. elegans)		sqIs17Dittman and Kaplan, 2006MAH240
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; sqIs17This workCZ28334Figure 6—figure supplement 1
Genetic reagent
(C. elegans)		acr-2(n2420) X; sqIs17This workCZ28212Figure 6—figure supplement 1
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; sqIs17This workCZ28218Figure 6—figure supplement 1
Genetic reagent
(C. elegans)		unc-13(s69) I; wgIs433This workCZ28491Figure 6C
Genetic reagent
(C. elegans)		unc-13(s69) I; acr-2(n2420) X; wgIs433This workCZ28492Figure 6C
Genetic reagent
(C. elegans)		unc-13(s69) I; eif-3.G(ju807); acr-2(n2420) X; wgIs433This workCZ28493Figure 6C
Genetic reagent
(C. elegans)		juSi260 ncs-2(tm1943) IZhou et al., 2017CZ22459
Genetic reagent
(C. elegans)		juSi260 ncs-2(tm1943) I; eif-3.G(ju807) IIThis workCZ23225Figure 7B
Genetic reagent
(C. elegans)		juSi260 ncs-2(tm1943) I; acr-2(n2420) XThis workCZ22345Figure 7B
Genetic reagent
(C. elegans)		juSi260 ncs-2(tm1943) I; eif-3.G(ju807) II; acr-2(n2420) XThis workCZ28110Figure 7B
Genetic reagent
(C. elegans)		juSi391 ncs-2(tm1943) IThis workCZ28213Figure 7C
Genetic reagent
(C. elegans)		juSi391 ncs-2(tm1943) I; eif-3.G(ju807) IIThis workCZ28340Figure 7C
Genetic reagent
(C. elegans)		juSi391 ncs-2(tm1943) I;acr-2(n2420) XThis workCZ28252Figure 7C
Genetic reagent
(C. elegans)		juSi391 ncs-2(tm1943) I;eif-3.G(ju807) II; acr-2(n2420) XThis workCZ28253Figure 7C
Genetic reagent
(C. elegans)		juSi392 ncs-2(tm1943) IThis workCZ28277Figure 7—figure supplement 1B
Genetic reagent
(C. elegans)		juSi392 ncs-2(tm1943) I;eif-3.G(ju807) IIThis workCZ28312Figure 7—figure supplement 1B
Genetic reagent
(C. elegans)		juSi392 ncs-2(tm1943) I; acr-2(n2420) XThis workCZ28291Figure 7—figure supplement 1B
Genetic reagent
(C. elegans)		juSi392 ncs-2(tm1943) I; eif-3.G(ju807) II; acr-2(n2420) XThis workCZ28292Figure 7—figure supplement 1B
Genetic reagent
(C. elegans)		juSi393 ncs-2(tm1943) IThis workCZ28278Figure 7—figure supplement 1C
Genetic reagent
(C. elegans)		juSi393 ncs-2(tm1943) I; eif-3.G(ju807) IIThis workCZ28311Figure 7—figure supplement 1C
Genetic reagent
(C. elegans)		juSi393 ncs-2(tm1943) I; acr-2(n2420) XThis workCZ28293Figure 7—figure supplement 1C
Genetic reagent
(C. elegans)		juSi393 ncs-2(tm1943) I; eif-3.G(ju807) II; acr-2(n2420) XThis workCZ28294Figure 7—figure supplement 1C
Genetic reagent
(C. elegans)		juEx2045---CZ9635
Genetic reagent
(C. elegans)		hlh-30(tm1978) IVCGCCZ23321
Genetic reagent
(C. elegans)		hlh-30(tm1978) IV; acr-2(n2420) XThis workCZ28174Related to Figure 6C
Genetic reagent (C. elegans)eif-3.G(ju807) II; hlh-30(tm1978) IV; acr-2(n2420) XThis workCZ28175Related to Figure 6C
Genetic reagent
(C. elegans)		eif-3.G(ju1327) II /mnC1; juSi363 IV; acr-2(n2420) XThis workCZ26759Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		eif-3.G(ju1327) II / mnC1 II; juSi366 IV; acr-2(n2420) XThis workCZ26760Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		juSi364 IV; acr-2(n2420) XThis workCZ26494Figure 4—figure supplement 1A
Genetic reagent (C. elegans)eif-3.G(ju807)II juSi364 IV; acr-2(n2420) XThis workCZ26243Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		juSi365 IVThis workCZ26588Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; juSi365 IV; acr-2(n2420) XThis workCZ26565Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		juSi365 IV; acr-2(n2420) XThis workCZ26566Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		juSi368 IVThis workCZ26656Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		juSi368 IV; acr-2(n2420) XThis workCZ26623Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; juSi368 IV; acr-2(n2420) XThis workCZ26480Related to Figure 4—figure supplement 1A
Genetic reagent
(C. elegans)		wgIs506Sarov et al., 2006OP506Supplementary file 1
Genetic reagent (C. elegans)acr-2(n2420) X; wgIs506This workCZ27926Supplementary file 1
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; wgIs506This workCZ27927Supplementary file 1
Genetic reagent
(C. elegans)		dhc-1::GFP(it45) ILapierre et al., 2013OD2955Supplementary file 1
Genetic reagent
(C. elegans)		dhc-1::GFP(it45) I; acr-2(n2420) XThis workCZ27858Supplementary file 1
Genetic reagent (C. elegans)dhc-1::GFP(it45) I; eif-3.G(ju807) II; acr-2(n2420) XThis workCZ27859Supplementary file 1
Genetic reagent
(C. elegans)		wgIs432Sarov et al., 2006OP432Supplementary file 1
Genetic reagent
(C. elegans)		acr-2(n2420) X; wgIs432This workCZ27915Supplementary file 1
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; wgIs432This workCZ28021Supplementary file 1
Genetic reagent
(C. elegans)		wgIs638Sarov et al., 2006OP638Supplementary file 1
Genetic reagent
(C. elegans)		unc-119(tm4063) III;acr-2(n2420) X; wgIs638This workCZ28108Supplementary file 1
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; wgIs638This workCZ27916Supplementary file 1
Genetic reagent
(C. elegans)		let-607(tm1423) I; unc-119(ed3) III; vrIs121Sarov et al., 2006YL651Supplementary file 1
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; let-607(tm1423) I; unc-119(ed3) III; vrIs121This workCZ28143Supplementary file 1
Genetic reagent
(C. elegans)		acr-2(n2420) X; let-607(tm1423) I;unc-119(ed3) III; vrIs121This workCZ28119Supplementary file 1
Genetic reagent
(C. elegans)		eif-3.G(ju807) II; acr-2(n2420) X; let-607(tm1423) I; unc-119(ed3) III; vrIs121This workCZ28111Supplementary file 1
Genetic reagent
(C. elegans)		juIs172CGCEE86
Genetic reagent
(C. elegans)		egl-30(md186) I;dpy-20(e1282ts) IV; syIs105CGCPS4263
Genetic reagent
(C. elegans)		juEx7964McCulloch et al., 2020CZ27420
Genetic reagent
(C. elegans)		acr-2(n2420) X; juEx7964McCulloch et al., 2020CZ27217
Genetic reagent
(C. elegans)		eif-3.G(C130Y) II; acr-2(n2420) X; juEx7964This workCZ28109Supplementary file 1
Recombinant DNA reagent (plasmid)pCZGY2729Andrusiak et al., 2019RRID:Addgene_135096Site-specific insertion using CRISPR/Cas9 editing of C. elegans ChrIV
Recombinant DNA reagent (plasmid)pCZGY2750Andrusiak et al., 2019RRID:Addgene_135094Expresses Cas9 and sgRNA for editing of C. elegans ChrIV
Recombinant DNA reagent (plasmid)pCZGY2727This workSite-specific insertion using CRISPR/Cas9 editing of C. elegans ChrI
Recombinant DNA reagent (plasmid)pCZGY2748This workExpresses Cas9 and sgRNA for editing of C. elegans ChrI

C. elegans genetics

Request a detailed protocol

All C. elegans strains were maintained at 20°C on nematode growth media (NGM) plates seeded with OP50 bacteria (Brenner, 1974). Compound mutants were generated using standard C. elegans genetic procedures and strain genotypes are listed in key resource table and Supplementary file 1. Primers for genotyping are in Supplementary file 2.

Identification of eif-3.G(ju807)

Request a detailed protocol

We employed a custom workflow on the GALAXY platform to identify SNPs unique to strains containing suppressor mutations of acr-2(gf), compared to the N2 reference strain (McCulloch et al., 2017). Following SNP mapping using genetic recombinants, we located ju807 to eif-3.G on chromosome II. We then performed transgenic expression experiments and found that both over-expression and single-copy expression of eif-3.G(+) in ju807; acr-2(gf) animals restored convulsions.

Quantification of convulsion behavior

Request a detailed protocol

Convulsions were defined as contractions that briefly shorten animal body length, as previously reported (Jospin et al., 2009; Video 2). L4 larvae were cultured overnight on fresh NGM plates seeded with OP50 bacteria at 20°C. The following day, each young adult was moved to a fresh seeded plate, and after climatized for 90 s, convulsions were counted over a subsequent 90 s. The average convulsion frequency represented data over 60 s. All statistical tests were performed using GraphPad Prism6 software and p-values <0.05 were considered significant.

CRISPR-mediated genome editing

Request a detailed protocol

We used a previously described method (Dickinson et al., 2013) with minor modifications to generate eif-3.G(ju1327) deletion allele. Briefly, we designed sgRNA target sequence CAATTCACAAGAAATCGCGC, and cloned it into a Cas9-sgRNA expression construct pSK136 (derived from pDD162, with site-directed mutagenesis). A DNA mixture containing 50 ng/µl pSK136, 1 ng/µl Pmyo-2::mCherry (pCFJ90), and 50 ng/µl 100 bp ladder (Invitrogen, Carlsbad, CA) was microinjected into N2 adults. We screened F2 progenies from F1 animals carrying the co-injection marker for deletions in eif-3.G and identified a 19 bp deletion, designated ju1327. Heterozygous ju1327 was twice outcrossed to N2 and then crossed to the mnC1 balancer for stable strain maintenance (CZ22974).

The eif-3.G(ju1840) allele, which causes a C127Y mutation in EIF-3.G, was generated using a co-CRISPR genome editing method with unc-58(gf) as a selection marker (Paix et al., 2017). We microinjected a Cas9 complex containing the sgRNA sequence GGTCGTTTCCTTTGCAATGA, a DNA repair template incorporating TAT (encoding Y127) in place of TGC (C127), and a previously described sgRNA and repair template for unc-58(gf) into N2 adult hermaphrodites. We genotyped for eif-3.G(ju1840) among heterozygous unc-58(gf) F1 progeny and subsequently identified F2 animals homozygous for eif-3.G(ju1840) and unc-58(+).

Molecular biology and transgenesis

Request a detailed protocol

All transgene constructs were cloned using the Gateway cloning system (Invitrogen, Carlsbad, CA) or Gibson Assembly (NEB, Ipswich, MA), unless otherwise noted. Primers used in their construction are detailed in Supplementary file 3. For single-copy insertion transgenes, we used a previously described CRISPR/Cas9 method to integrate a single genomic copy on chromosome IV (Andrusiak et al., 2019). For extrachromosomal transgenes, we microinjected a DNA mixture containing 2 ng/µl transgene plasmid, 2.5 ng/µl pCFJ90(Pmyo-2::mCherry), and 50 ng/µl 100 bp ladder (Invitrogen, Carlsbad, CA) into young adults, following standard procedure (Mello et al., 1991).

To generate the eif-3.G(+) or eif-3.G(C130Y) genomic constructs (pCZGY3006 or pCZGY3007), we amplified a 2223 bp region from genomic DNA of N2 or CZ21759 eif-3.G(C130Y); acr-2(gf), respectively, which includes 1714 bp upstream of the start codon of isoform A (F22B5.2a.1) and 331 bp downstream of the stop codon, and cloned the amplicon into the PCR8 vector (Invitrogen, CA).

To generate all eif-3.G cDNA expression clones, we made mixed-stage cDNA libraries with poly-dT primer for N2 or CZ21759 using Superscript III (ThermoFisher Scientific, San Diego, CA). We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway cloning destination vectors (pCZGY1091 for Punc-17β, pCZGY925 for Pmyo-3, pCZGY66 for Prgef-1, and pCZGY80 for Punc-25).

We used PCR site-directed mutagenesis, in which the nucleotide changes are introduced by the primers to generate the Prgef-1::eif-3.G(∆RRM) and Prgef-1::eif-3.G(C130Y ∆RRM) constructs (pCZGY3026 and pCZGY3027, respectively) with primers YJ11561 and YJ11562 on the templates pCZGY2715 and pCZGY2716, respectively. The Prgef-1::eif-3.G(RFF/AAA) construct (pCZGY3512) was generated by two rounds site directed PCR mutagenesis on pCZGY3010, first using primers YJ12463 and YJ12464, then primers YJ12465 and YJ12466. To generate Pref-1::eif-3.I(+) (pCZGY3508), we amplified eif-3.I cDNA from N2 cDNA libraries using primers YJ12453 and YJ12454, and used Gibson Assembly to clone into the pCZGY66 backbone containing Prgef-1. We then performed site-directed mutagenesis on pCZGY3508 using primers YJ12457 and YJ12458 to generate the Prgef-1::eif-3.I(Q252R) construct (pCZGY3509).

We generated the GFP::EIF-3.G clones pCZGY3018 and pCZGY3019 via Gibson assembly, using eif-3.G(+) or eif-3.G(C130Y) cDNA amplified using primers YJ12604 and YJ12605, and the GFP-coding DNA amplified using primers YJ12602 and YJ12603.

To generate Punc-17β::EIF-3.G::3xFLAG::SL2::GFP constructs (pCZGY3538 for WT, pCZGY3539 for C130Y, and pCZGY3540 for ∆RRM) used in seCLIP experiments, Punc-17β promoter was amplified from pCZGY1091 using primers YJ12164 and YJ12418, each eif-3.G cDNA (wild type, C130Y, or ∆RRM) was amplified with an N-terminal 3xFLAG sequence from subclones using the primers YJ12419 and YJ12420, SL2 trans-splice sequence was amplified from N2 genomic DNA using primers YJ12421 and YJ12422, and GFP was amplified from pCZGY3018 using primers YJ12423 and YJ12424. These fragments were then Gibson Assembled into the pCZGY2729 backbone (RRID:Addgene_135096), which facilitates CRISPR/Cas9 single copy insertion on chromosome IV (Andrusiak et al., 2019).

All ncs-2 transgenes were similarly cloned using primers for Gibson assembly into pCZGY2727. To generate the Pncs-2::5′UTR mutant::ncs-2 cDNA construct (pCZGY3526), we amplified Pncs-2 from N2 gDNA using primers YJ12554 and YJ12555. A fragment containing SL1 trans-spliced eif-3.G 5′UTR incorporated in the forward primer, ncs-2 cDNA, GFP, and the ncs-2 3′UTR was amplified from CZ22459 gDNA using primers YJ12556 and YJ12557. The Pncs-2::GFP(+) construct (pCZGY3533) was cloned by amplifying Pncs-2 through the first four codons of ncs-2 CDS from N2 gDNA using primers YJ12554 and YJ12579, and GFP and the ncs-2 3′UTR from CZ22459 gDNA using YJ12580 and YJ12557. The Pncs-2::5′UTR mutant::GFP construct (pCZGY3534) was cloned by amplifying Pncs-2 from N2 gDNA using primers YJ12554 and YJ12555, and the eif-3.G 5′UTR, the first four codons of the ncs-2 CDS, GFP, and the ncs-2 3′UTR from CZ22459 gDNA using primers YJ12581 and YJ12557.

Fluorescence microscopy and GFP intensity quantification

Request a detailed protocol

L4 or young adult animals were immobilized in 1 mM levamisole in M9 and mounted on microscope slides with 2% agar. All images were collected on a Zeiss LSM800 confocal microscope, unless specified, with identical image acquisition settings: 1.25 µm pixel size with 0.76 µs pixel time, 50 µm pinhole, with genotype-blinding to observer when possible. The positions of VA10, VB11, and DB7 cholinergic motor neurons were identified using juEx2045(Pacr-2-mCherry), based on their stereotypical patterning in the posterior ventral nerve cord. These neurons were chosen for quantification because they were consistently visible in single focal plane images. All quantification of GFP intensity in these neurons was performed using the Integrated Density function in ImageJ (Schindelin et al., 2012). We acquired the mean integrated density from the VA10, VB11, and DB7 cell bodies, subtracted background intensity from an equivalent area, and the resulting values were then normalized to the mean area of the cell bodies of the same animal. We similarly quantified fluorescence intensities in the ventral nerve cord of animals expressing GFP-tagged full-length ncs-2 cDNA, except integrated densities were obtained from one ROI per image (red boxes in Figure 7B and C). All data was normalized to the mean fluorescence intensity of the transgene in the wildtype background. All statistical analysis was performed with GraphPad Prism6 software.

Axon commissures, observed as fluorescent structures extending from the ventrally located neuron cell body to the dorsal body wall, shown in Figure 1—figure supplement 2A were visualized with juIs14[Pacr-2::GFP] and manually quantified. Imaging shown in Figure 1—figure supplement 2B was performed using a Zeiss Axioplan two microscope installed with Chroma HQ filters and a 63x objective lens. Synaptic puncta labeled by nuIs94[SNB-1::GFP], were manually quantified in the region anterior to the ventral nerve chord between VD6 and VD7.

Polysome profiling

Request a detailed protocol

We prepared C. elegans lysates and sucrose gradients using the protocol described in Ding and Grosshans, 2009. To synchronize animals, gravitated adults were treated with 20% Alkaline Hypochlorite Solution and embryos were plated on four 30 cm NGM plates seeded with OP50, and grown to the L4 stage at 20°C. Approximately 200 µl packed L4 C. elegans were harvested by centrifugation in M9 media at 1500 RPM, washed three times in ice-cold M9 media supplemented with 1 mM cycloheximide, then once more in lysis buffer base solution (140 mM KCl, 20 mM Tris-HCl (pH 8.5), 1.5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 1 mM cycloheximide) followed by snap freezing in liquid nitrogen. The frozen pellets were resuspended in 450 µl lysis buffer (140 mM KCl, 20 mM Tris-HCl (pH 8.5), 1.5 mM MgCl2, 0.5% NP-40, 2% PTE, 1% sodium deoxycholate, 1 mM DTT, 1 mM cycloheximide, 0.4 units/µl RNAsin) and crushed to a fine powder with a mortar and pestle pre-cooled with liquid nitrogen. Protein lysate concentrations were then determined using a Bradford assay (Bio-Rad, Hercules, CA). Fifteen to 60% sucrose gradients were prepared in 89 mm polypropylene centrifuge tubes (Beckman Coulter) using standard settings on a Foxy Jr. density gradient fractionation system (Teledyne ISCO, Lincoln, NE) and lysate volumes corresponding to equal protein amounts between samples were loaded on top of the gradients. Loaded gradients were then spun in an Optima L-80 ultracentrifuge (Beckman Coulter) at 36,000 rpm at 4°C for 3 hr. Fractions were then collected and RNA absorbance was continuously acquired using a UA-6 detector (Teledyne ISCO, Lincoln, NE) with a 70% sucrose chase solution. We calculated the area under the curve (AUC) for monosome (80S) and polysome absorbance traces using the Simpson’s rule method in SciPy (Virtanen et al., 2020) and used the AUC values to calculate the polysome to monosome ratios.

Western blot analysis

Request a detailed protocol

A total of 500 µl of mixed staged worms were resuspended in lysis buffer (140 mM KCl, 20 mM Tris-HCl (pH 8.5), 1.5 mM MgCl2, 0.5% NP-40, 1% sodium deoxycholate, 1 mM DTT) supplemented with protease inhibitors (Complete Ultra Tablets, Roche), frozen in liquid nitrogen, and crushed to a fine powder. The lysates were clarified by centrifugation at max speed in a tabletop centrifuge and protein levels were quantified using a Bradford assay (Bio-Rad, Hercules, CA). The resulting protein lysates were then boiled in Laemmli buffer with 10% 2-mercaptoethanol, run on SDS-PAGE gels, and transferred to PVDF blots, which were probed with anti-FLAG (F7425, RRID:AB_439687) or anti-Actin (clone C4, RRID:AB_2335304) antibodies.

seCLIP library preparation and sequencing

Request a detailed protocol

We performed single-end enhanced CrossLink and ImmunoPrecipitation (seCLIP) experiments according to the published protocol in Van Nostrand et al., 2017, with the following adjustments to ensure efficient immunoprecipitation yield from C. elegans lysates. Mixed stage animals were grown on ~12 NGM plates (30 cm) and washed twice with M9, spinning at 1500 rpm between washes. Animals were then resuspended in 5 ml M9 media and rocked on a rotator for 10 min to remove gut bacteria, followed by one more wash with M9 at 1500 rpm. The animals were spread on one NGM plate (30 cm) and then UV-crosslinked with a Spectrolinker XL-1000 (Spectronics, New Cassel, NY) using energy setting 3 kJ/m2 according to Broughton and Pasquinelli, 2013. Afterwards, animals were resuspended in 4 ml lysis buffer [150 mM NaCl, 1 M HEPES, 100 mM DTT, 6.25 µl RNAsin (Promega) per 10 ml, 10% glycerol, 10% Triton X-100, one protease inhibitor tablet per 10 ml] and split into two tubes for each replicate. The resuspension was disrupted on an XL-2000 Sonicator (QSonica, Newtown, CT) with seven pulses (powersetting = 11, 10 s each, 50 s on ice in between) and immediately spun at 4750 RPM for 5 min at 4°C. All subsequent steps, beginning with RNAse A treatment of the supernatant, was performed according to the seCLIP protocol (Van Nostrand et al., 2017), except that high-salt and low-salt wash buffers were replaced with a single buffer (2M NaCl, 1M HEPES, 30% glycerol, 1% Triton X-100, one protease inhibitor tablet per 10 mL) optimized for anti-FLAG RNA IP from C. elegans lysates (Blazie et al., 2015). Immunoprecipitation was performed with anti-FLAG beads (Sigma, RRID:AB_2637089). cDNA libraries were prepared from both the immunoprecipitated mRNA (CLIP) as well as the sample before immunoprecipitation (INPUT), such that crosslink sites can be defined by read enrichment in the CLIP sample over input as described (Van Nostrand et al., 2017). seCLIP libraries were validated using the D1000 high sensitivity screen tape system (Agilent, La Jolla, CA) and quantified using a Qubit instrument (Thermo Fisher, San Diego, CA) before pooling and sequencing on HiSeq4000 (Illumina, San Diego, CA) at the IGM Genomics Center, University of California San Diego.

seCLIP sequence mapping

Request a detailed protocol

After demultiplexing barcoded reads, we used the CLIPPER software pipeline (Lovci et al., 2013) to trim barcodes, remove PCR duplicate reads, filter reads mapping to repetitive elements, and map the remaining reads to the C. elegans reference genome (ce10). The total number of uniquely mapped reads obtained after filtering is in Supplementary file 4. A large proportion of reads obtained from the ∆RRM and IgG samples mapped to repetitive elements and were discarded, explaining the smaller number of uniquely mapped reads in these samples. In seCLIP, RNA-binding sites are defined as read clusters enriched in the crosslink immunoprecipitated sample (CLIP) over the input control (INPUT) (Van Nostrand et al., 2017), which are comprehensively identified across each dataset using CLIPPER. Read clusters were reproducibly identified from independent biological replicates of seCLIP, except in the ∆RRM control reflecting background, supporting the specificity of our data (Figure 4—figure supplement 1).

EIF-3.G footprint identification from mapped seCLIP reads

Request a detailed protocol

We defined EIF-3.G footprints as seCLIP read clusters appearing in both replicates with 20 reads and 1.5 fold-change enrichment over the INPUT control in at least one replicate. Footprints matching these criteria in the IgG (no transgene) and the EIF-3.G(∆RRM) control samples were considered background and subtracted from the EIF-3.G(WT) and EIF-3.G(C130Y) datasets (Supplementary files 5 and 6). We annotated footprints to their gene features (eg. 5′UTR, CDS) using a script (Yee, 2021; https://github.com/byee4/annotator) that overlaps read clusters with the C. elegans genome annotation WS235. We grouped all clusters annotated in the CDS and 5'UTR into one category (5'UTR proximal), since clusters mapping in CDS were almost always located within 200nts of a 5'UTR (Figure 4D).

Gene ontology and KEGG pathway analysis

Request a detailed protocol

GO analysis was performed using 225 EIF-3.G target genes as input to the biological process annotation set within the Gene Ontology Resource tool (Ashburner et al., 2000). A total 211 gene names were recognized by the database and GO term enrichment was defined using a threshold of p< 0.05. Pathway analysis of EIF-3.G target genes was performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation tool within the DAVID bioinformatics resource (Jiao et al., 2012) using default settings.

Analysis of activity-dependent expression changes among EIF-3.G target mRNAs in cholinergic neurons

Request a detailed protocol

We studied activity-dependent transcript expression changes among the EIF-3.G target genes (n = 225) by re-analyzing the cholinergic neuron-specific transcriptomes reported in McCulloch et al., 2020 using the Galaxy platform (Afgan et al., 2018). We downloaded raw FASTA reads from transcriptome sequencing of wild type and acr-2(gf) animals (n = two replicates each; accession #’s SRR10320705, SRR10320706, SRR10320707, SRR10320707) and mapped them to the C. elegans reference genome (ce10) using BWA (Li and Durbin, 2009). Differential expression among the EIF-3.G target genes was quantified using Feature Counts (Liao et al., 2014) and DeSeq2 (Love et al., 2014).

in silico analysis of 5′UTR sequence features, secondary structure, and conservation

Request a detailed protocol

We downloaded all C. elegans transcript 5'UTRs (WS271) from Parasite Biomart (Howe et al., 2016), and calculated 5′UTR lengths as the sequence between the 5' distal end and the start codon of each transcript. To have meaningful length calculation, we only considered 5′UTRs annotated with at least 10nt and restricted our analysis to the longest 5′UTR isoform for each gene to avoid considering multiple transcripts of the same gene. By these criteria we identified 5′UTRs for 10,962 WS271 protein coding transcripts and 179 transcripts with EIF-3.G footprints. We used the same criteria to determine features of the acr-2(gf) cholinergic transcriptome 5′UTRs (McCulloch et al., 2020) for the analysis shown in Figure 4E–F.

For the analysis shown in Figure 4—figure supplement 2D–E, the genomic coordinates of human gene 5′UTRs were downloaded from Ensembl and used to obtain 5′UTR sequences from the human genome reference sequence (hg38). eIF3g footprints from HEK293 cells were previously described (Lee et al., 2015). We defined our analysis of 5′UTR sequences using the same criteria described for C. elegans and the data show the comparison between 5′UTRs of 255 genes with human eIF3g footprints and 19,914 total genes in the human genome annotation (hg38).

To calculate GC-enrichment, we used BEDTools (Quinlan and Hall, 2010) to generate a FASTA of 5′UTR sequences from their genomic coordinates and used Biopython (Cock et al., 2009; https://github.com/biopython/biopython) to calculate the total %GC in their sequences (Figure 4F) as well as %GC within 10nt bins incremented from the start codon ATG for the analysis shown in Figure 4—figure supplement 2C.

To predict secondary structures of the 5′ ends of hlh-30d, ncs-2, and eif-3.G mRNAs, we used the RNAfold Web Server (Gruber et al., 2008) with default settings. To better understand the contribution of gene-specific 5'UTR sequences, we excluded the SL1 sequences of ncs-2 and eif-3.G from folding predictions. The free energies (∆G) for each sequence reported in our results were derived from the reported thermodynamic ensemble. Data showing conservation of eif-3.G and ncs-2 5′UTR sequences compared with 135 nematode species (phyloP135way scores) was obtained from the UCSC Genome Browser with the genomic position along the sequence of each 5′UTR as input.

Data availability

Raw and processed seCLIP datasets from this study have been uploaded to the Gene Expression Omnibus (GEO) under accession number GSE152704.

The following data sets were generated
    1. Blazie SM
    2. Takayanagi-Kiya S
    3. McCulloch KA
    4. Jin Y
    (2021) NCBI Gene Expression Omnibus
    ID GSE152704. seCLIP of C. elegans EIF-3.G in the cholinergic motor neurons.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE152704
The following previously published data sets were used
    1. McCulloch KA
    2. Zhou K
    3. Jin Y
    (2019) NCBI Gene Expression Omnibus
    ID GSE139212. Neuronal transcriptome analyses reveal novel neuropeptide modulators of excitation and inhibition imbalance in C. elegans.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE139212

References

    1. Brenner S
    (1974)
    The genetics of Caenorhabditis elegans
    Genetics 77:71–94.
    1. Cate JH
    (2017) Human eIF3: from 'blobology' to biological insight
    Philosophical Transactions of the Royal Society B: Biological Sciences 372:20160176.
    https://doi.org/10.1098/rstb.2016.0176
    1. Richmond J
    (2005) Synaptic function
    WormBook : The Online Review of C. elegans Biology 1:14.
    https://doi.org/10.1895/wormbook.1.69.1

Decision letter

  1. Anne E West
    Reviewing Editor; Duke University School of Medicine, United States
  2. Piali Sengupta
    Senior Editor; Brandeis University, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This study takes advantage of unbiased genetics to discover functions of EIF-3.G in neuronal protein synthesis. This is especially interesting and timely given the connection of the eIF3 complex with various diseases of the nervous system and a previous lack of detailed understanding of how EIF-3.G specifically plays a role in translation control.

Decision letter after peer review:

Thank you for submitting your article "Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Piali Sengupta as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) The ∆RRM construct, which is a deletion, may have secondary effects on folding/stability of the encoded protein. Given that this EIF-3.G variant is used as an important control for seCLIP studies, the reviewers recommend that the authors confirm the RRM deletion mutant protein is at least expressed at similar levels as the EIF-3.G wild type and C130Y variants.

2) The reviewers encourage the authors to provide data ensuring the phenotype from the forward screen is due to the eif-3.g mutation either by i) using CRISPR to engineer a revertant of the C130Y eif-3.g mutation and asking whether this abolishes the phenotype, or alternately, ii) using the GFP tagged single copy insertion C130Y expressing strain in combination with any CRISPR mutant that disrupts the native eif-3.g locus.

3) The reviewers felt the CLIP data were an important part of the story and debated whether or not additional validations of these findings were needed. In the end the reviewers request only that the authors state whether additional GFP reporters in addition to hlh-30 and ncs-2 were tested to give the readers a sense of the potential false positive rate.

4) All of the reviewers thought that the following experimental suggestion would substantially strengthen the paper if the strains were easily available for testing. However if this study would substantially delay the publication of this work, it was not deemed essential. "It is interesting that eif-3.g(C130Y) decreases translation of hlh-30 and ncs-2 only in acr-2(gf) mutants. Is this a direct consequence of elevated neural activity in Ach MNs? For example, does silencing of these neurons attenuate the ability of eif-3.g(C130Y) to decrease ncs-2 GFP reporter translation?"

5) The reviewers had many questions about the ife-1 section of the study and felt that it was underdeveloped with respect to the rest of the paper. They suggest the authors consider removing this work from the current study and develop it further for a future publication.

6) All of the reviewers comments have been included below to provide feedback to the authors. However, only the 5 points above were determined by the consensus of the reviewers to be the major points that required addressing in the revision.

Reviewer #1:

In general, I found this study to be both interesting and timely given the connection of the eIF3 complex with various diseases of the nervous system and a lack of detailed understanding of how EIF-3.G specifically plays a role in translation control. Moreover, the experiments are generally sound, rigorous, and conclusions made from the interpretation of the data are reasonable and not over-stated.

Strengths:

– The genetic screen identifying the mutation in the Zinc Finger domain provided the basis for a new line of inquiry into the role of this domain in translational control.

– The first use of the single-end enhanced CLIP protocol in C. elegans, which will be highly useful for those studying RNA binding proteins in this model organism

– Initial insights into the features associated with EIF-3.G regulation of translation and its link to target mRNAs that themselves control neuronal activity.

Weaknesses:

– Despite initial insights into the possible mechanism of action, it is still unclear how the mutation in the Zinc Finger domain or the Zinc Finger domain itself is acting to modulate translation of specific mRNAs.

– The authors propose a model that structured 5'UTRs are likely playing a key role in the regulation of translation by EIF-3.G, but further experiments would be required to more strongly confirm this model.

Overall, I found the quality of the science and the data presented to be very high. I have only two primary suggestions for experiments that I feel would strengthen the conclusions of the current manuscript.

1) The ∆RRM construct, which is a deletion, may have secondary effects on folding/stability of the encoded protein. Given that this EIF-3.G variant is used as an important control for seCLIP studies, I think it would be useful to check that this RRM deletion mutant protein is at least expressed at similar levels as the EIF-3.G wild type and C130Y variants. Since the authors already have FLAG-tagged versions of all three proteins for their CLIP experiments, it should not be too much work to perform a Western blot to compare protein levels.

2) The connection to structured 5'UTRs is intriguing but could be further strengthened by an experiment that more explicitly tests the role of secondary structure. For example, in addition to the UTR swapping experiments performed by the authors, it would also be informative to introduce mutations at nucleotides engaged in base-pairing interactions to see if eliminating these interactions influences regulation. If effects are observed, subsequent compensatory mutations that re-introduce base-pairing should be performed to revert back to patterns observed with the native 5'UTR.

Reviewer #2:

In this manuscript, Blazie et al. examine the neuronal function of EIF-3.G, a RNA-binding subunit of the translation initiation complex eIF3. First, they recover a semi-dominant gain-of-function mutation in eif-3.g (a C130Y point mutation in its zinc finger domain) in a screen for suppressors of cholinergic motor neuron hyperactivity. The authors show that the eif-3.g(C130Y) phenotype can be reversed by expression of wild-type eif-3.g in Ach motor neurons and that the WT and C130Y mutant express at equal levels. The authors then show that loss of ife-1 suppresses the eif-3.g(c130y) effect and that eif-3.g's function vitally depends on its RRM domain. They then use transgenic expression of Flag-tagged-eif-3.g to profile eif-3.g binding to mRNAs in the Ach motor neurons. This reveals binding of eif-3.g to 5'UTR-proximal regions of mRNAs, particular in long, GC-rich 5'UTRs. The authors note that eif-3.g-bound mRNAs include several that show acr-2(gf)-dependent transcription, with an enrichment of genes involved in neuropeptide signaling and other categories. They then focus on two specific targets of eif-3.g. First, they show that hlh-30 translation is increased by acr-2(gf), which can be suppressed by eif-3.g(c130y). Second, they show that ncs-2 translation is unaffected by acr-2(gf), but reduced by eif-3.g(c130y) in an acr-2(gf) background.

This paper takes advantage of unbiased genetics to determine a function for eif-3.g in neuronal protein synthesis regulation. Its strengths are that it develops a new system in which eif-3.g can be studied, identifies neuronal targets of eif-3.g, and demonstrates a neuronal function for this important translational regulator. Its weaknesses are that it doesn't fully resolve how eif-3.g regulates Ach motor neuron excitability or bind together an understanding of how eif-3.g regulates its targets in a manner that depends on acr-2(gf).

In this manuscript, Blazie et al. examine the neuronal function of EIF-3.G, a RNA-binding subunit of the translation initiation complex eIF3. First, they recover a semi-dominant gain-of-function mutation in eif-3.g (a C130Y point mutation in its zinc finger domain) in a screen for suppressors of cholinergic motor neuron hyperactivity. The authors show that the eif-3.g(C130Y) phenotype can be reversed by expression of wild-type eif-3.g in Ach motor neurons and that the WT and C130Y mutant express at equal levels. The authors then show that loss of ife-1 suppresses the eif-3.g(c130y) effect and that eif-3.g's function vitally depends on its RRM domain. They then use transgenic expression of Flag-tagged-eif-3.g to profile eif-3.g binding to mRNAs in the Ach motor neurons. This reveals binding of eif-3.g to 5'UTR-proximal regions of mRNAs, particular in long, GC-rich 5'UTRs. The authors note that eif-3.g-bound mRNAs include several that show acr-2(gf)-dependent transcription, with an enrichment of genes involved in neuropeptide signaling and other categories. They then focus on two specific targets of eif-3.g. First, they show that hlh-30 translation is increased by acr-2(gf), which can be suppressed by eif-3.g(c130y). Second, they show that ncs-2 translation is unaffected by acr-2(gf), but reduced by eif-3.g(c130y) in an acr-2(gf) background.

This paper takes advantage of unbiased genetics to determine a function for eif-3.g in neuronal protein synthesis regulation. Its strengths are that it develops a new system in which eif-3.g can be studied, identifies neuronal targets of eif-3.g, and demonstrates a neuronal function for this important translational regulator. Its weaknesses are that it doesn't fully resolve how eif-3.g regulates Ach motor neuron excitability or bind together an understanding of how eif-3.g regulates its targets in a manner that depends on acr-2(gf).

1) The study provides a characterization of a new eif-3.g allele, which is interesting. However, the study does not come full circle and clarify how the eif-3.g mutation alters cholinergic neuron excitability. Nor does it show in a mechanistic sense how eif-3.g function depends on neuronal activity. It would be helpful if the authors could point to any efforts that they've made to revert the phenotype of eif-3.g via overexpression of eif-3.g(c130y)-downregulated target genes. If they were able to show such an effect, this would greatly enhance the study.

2) It is interesting that eif-3.g(C130Y) decreases translation of hlh-30 and ncs-2 only in acr-2(gf) mutants. Is this a direct consequence of elevated neural activity in Ach MNs? For example, does silencing of these neurons attenuate the ability of eif-3.g(C130Y) to decrease ncs-2 GFP reporter translation?

3) A couple of extra genetic controls would bolster the paper: (i) using CRISPR to engineer a revertant of the C130Y eif-3.g mutation and asking whether this abolishes the phenotype; and (ii) overexpressing eif-3.g(C130Y) in Ach MNs and asking whether this is sufficient to induce the phenotype.

4) The use of neuronal cell type-specific seCLIP is exciting, but only 2 replicates were conducted and there is no systematic validation of the detected binding sites. RT-qPCR should be used to validate detected binding sites on a handful of targets.

5) For Figure 4E-F and related analyses: the authors are comparing the eif-3.g targets to the full transcriptome to determine notable properties of the eif-3.g-bound gene set. I believe that for these analyses it would be more appropriate to compare the eif-3.g-bound gene set to the set of ACH MN-expressed genes (which the authors have measured in a previous study). In its current form, it is unclear whether the length and GC content of the eif-3.g-bound genes is a general property of cholinergic neuron gene expression. The same idea also applies to the GO analyses.

6) Related to the length of the eif-3.g-bound 5'UTRs, longer RNA sequences have a higher probability of having a detected binding site (i.e. the number of detected binding sites along any region of DNA/RNA should scale with length). It is not clear whether the authors correct for this in their analysis.

Reviewer #3:

The authors demonstrate the cholinergic motor neurons (ACh-MN)-specific function of EIF-3.G in a previously well-developed C. elegans model of acetylcholine receptor-2 gain-of function [acr-2(gf)], showing spontaneous seizure-like convulsions. C130Y mutation of the zinc finger domain in EIF-3.G ameliorates hyperactivity induced by acr-2(gf), while it does not affect global translation, neuronal development, and synaptic formation. EIF-3.G preferentially associates with long and GC-enriched 5'UTR genes involved in the regulation of ACh-MN synaptic activity and modulates neuronal protein synthesis in an activity-dependent manner.

The authors provide strong genetic evidence that the eif-3. g(C130Y) allele suppresses the convulsion phenotype in acr-2(gf) in a semi-dominant, gain-of-function manner in the ACh-MN neuron. The analyses using homozygous and heterozygous forms of the allele, as well as transgenic rescue experiments were expertly performed, and the data were well described. This study documents a comprehensive and detailed insight into neuronal activity-dependent mRNA translation using diverse approaches

1. The statistical representation in Figure 1E is somewhat misguided. In order to show that eif3.G increases convulsion in acr-2 (gf); eif-3.G(C130Y) in an ACh-MN-specific manner, the statistical analysis of the right 4 samples should be done with WT or (-), not with Ex[eif-3.G(+)].

2. The statement 'Both GFP::EIF-3.G(WT) and EIF-3G(C130Y) showed cytoplasmic fluorescence throughout somatic cells and across all developmental stages' is not well-presented in Figure 1—figure supplement 1B, since only the wild-type and one developmental stage (L4) was shown. It is also unclear if the bright puncta across the animal actually correspond to Peif-3.g::GFP or is a result of autofluorescence from the gut. It will be useful to include arrows and insets to highlight the pattern of interest (e.g., cytoplasmic, specific somatic tissues). To elaborate on the tissue specificity suggested in Figure 1E, whether EIF-3.G WT and C130Y are expressed in ACh-MN neuron should be discussed – This will differentiate whether the C130Y effect is cell-autonomous or non-autonomous. The authors also referred to Figure supplement 1B and Figure 2B as assessments of EIF-3.G protein stability – Expression pattern/localization would be more appropriate than protein stability here.

3. In Figure 3A, the potential involvement of ife-1 (one of the eIF4E homologs) in eif-3.g(C130Y) suppression of acr-2(gf) is interesting. Some experiments are needed to discern the direct/indirect nature of this genetic interaction.

A. Does ife-1(0) cause convulsion in eif-3.G(C130Y) alone (acr-2 wild-type)?

B. Does ife-1(0) alter eif-3.G WT and C130Y expression?

C. ife-1 was shown to be predominantly expressed in the germline where it is important for germ cell development (Henderson et al., Journal of Cell Science 2009; Amiri et al., Development 2001). Moreover, the protein is undetectable by western blot from germline-deficient glp-4(bn2) animal (Amiri et al. 2001), potentially indicating exclusive germline expression. Thus, it will be important to look at whether IFE-1 is co-expressed with EIF-3.G WT and C130Y in the soma and ACh-MN.

4. EIF-3.G preference for long 5' UTR with high GC content was nicely dissected from the seCLIP data in Figure 4. For consistency, the authors could provide information of 5'UTR length and GC content between upregulated and downregulated genes in acr-2(gf) over WT, shown in Figure 5B. hlh-30 and ncs-2 were further linked to eif-3.g-mediated suppression of acr-2(gf) by examining their expression using GFP reporters in Figures 6 and 7. Polysome profiling can be done to differentiate the effect of C130Y on the translation efficiency of these transcripts, as opposed to their transcription and protein stability. It would also be informative to show the preference of these genes for C. elegans eIF4E homologs, IFE-1, IFE-2, and IFE-4.

5. A heatmap in Figure 4—figure supplement 2C needs hierarchical clustering, even though genes in the map are already clustered top to bottom by increasing positional GC-density near the start codon. It may help extract additional meaningful information. The authors also need to point out the genes described in the text (pmt-2, let-607, unc-43, and gsa-1).

6. The statistical representation in the graph in Figure 6D needs to be corrected.

https://doi.org/10.7554/eLife.68336.sa1

Author response

Essential revisions:

1) The ∆RRM construct, which is a deletion, may have secondary effects on folding/stability of the encoded protein. Given that this EIF-3.G variant is used as an important control for seCLIP studies, the reviewers recommend that the authors confirm the RRM deletion mutant protein is at least expressed at similar levels as the EIF-3.G wild type and C130Y variants.

We appreciate the reviewers’ comment. As suggested by Reviewer #1, we carried out western blot analysis on protein extracts made from the three transgenic lines. We present this data in the revised Figure 4—figure supplement 1A, which shows that the EIF-3.G(∆RRM) truncated protein is expressed, but at reduced levels compared to EIF-3.G(WT) and EIF-3.G(C130Y). It is important to note that during seCLIP we immunoprecipitated the truncated EIF-3.G(∆RRM) protein at the same level as full-length EIF-3.G(WT) and EIF-3.G(C130Y) proteins. We obtained nearly 3 times more reads from seCLIP of 3XFLAG::EIF-3.G(∆RRM) animals (543,913 reads) than from N2 animals that lack any transgene (192,259 reads; IgG(-) negative control in Supplementary File 4).

Together, these data support that the 3XFLAG::EIF-3.G(∆RRM) transgene is expressed and serves as an effective reagent to detect RNAs specifically bound by the RRM of EIF-3.G(WT and C130Y).

We describe the results in the revised results (lines 220-226) and methods (lines 652-661).

2) The reviewers encourage the authors to provide data ensuring the phenotype from the forward screen is due to the eif-3.g mutation either by i) using CRISPR to engineer a revertant of the C130Y eif-3.g mutation and asking whether this abolishes the phenotype, or alternately, ii) using the GFP tagged single copy insertion C130Y expressing strain in combination with any CRISPR mutant that disrupts the native eif-3.g locus.

We appreciate the suggestion. While our attempt to edit C130Y back to wild type EIF-3.G was not successful, likely due to inefficiency of sgRNAs, we generated animals expressing the GFP-tagged EIF-3.G(C130Y) single copy transgene in a eif-3.G(0) background (following the suggestion ii). We found that GFP::EIF-3.G(C130Y) rescued the early larval arrest phenotype of eif-3.G(0), supporting its functionality, and additionally suppressed acr-2(gf) convulsion behavior at levels similar to endogenous eif-3.G(C130Y). The new results are shown in Figure 2A and described in the revised text (lines 158-163).

We performed an additional experiment to change the first cysteine (C127) of the zinc finger CCHC motif to tyrosine and found that eif-3.G(C127Y) behavior was identical to eif-3.G(C130Y). This result is shown in revised Figure 1 and discussed in the text (lines 107-113, 432-434, and 528-535).

Together, these results strengthen our conclusion that the suppression of acr2(gf) by eif-3.g(C130Y) isolated from the forward screen is due to the C130Y mutation in eif-3.G, and the integrity of the Zinc Finger domain is important for EIF-3.G function.

3) The reviewers felt the CLIP data were an important part of the story and debated whether or not additional validations of these findings were needed. In the end the reviewers request only that the authors state whether additional GFP reporters in addition to hlh-30 and ncs-2 were tested to give the readers a sense of the potential false positive rate.

We agree with the comment, and have revised our manuscript to include additional details on how our test of other GFP reporters led us to focus on hlh-30 and ncs-2. We screened ten GFP reporter lines and found six lines with detectable expression in ACh-MNs. In addition to NCS-2 and HLH-30, we characterized effects of acr-2(gf) and eif-3.G(C130Y) on four other reporter lines (for genes ZIP-2, ATF-7, LET607, and FLP-12). We have now documented these observations in the revised Supplementary File 1 and in lines 325-328 of the revised text.

4) All of the reviewers thought that the following experimental suggestion would substantially strengthen the paper if the strains were easily available for testing. However if this study would substantially delay the publication of this work, it was not deemed essential. "It is interesting that eif-3.g(C130Y) decreases translation of hlh-30 and ncs-2 only in acr-2(gf) mutants. Is this a direct consequence of elevated neural activity in Ach MNs? For example, does silencing of these neurons attenuate the ability of eif-3.g(C130Y) to decrease ncs-2 GFP reporter translation?"

We thank the reviewers for raising this point. We have examined HLH-30::GFP reporter translation in an unc-13(0) background, which is deficient for the synaptic priming factor and severely impairs synaptic transmission in all neurons (Richmond et al., 1999) and abolishes acr-2(gf) convulsion behavior (Zhou et al., 2013). We found that unc-13(0) prevents enhanced HLH-30 expression in acr-2(gf) single mutants and also attenuates the ability of eif-3.G(C130Y) to decrease HLH-30 expression in acr2(gf). This new data suggests that the observed eif-3.G(C130Y) is specific for elevated neuronal activity in ACh MNs. This analysis is now reported in Figure 6C and lines 347350 of the revised text.

5) The reviewers had many questions about the ife-1 section of the study and felt that it was underdeveloped with respect to the rest of the paper. They suggest the authors consider removing this work from the current study and develop it further for a future publication.

We agree with reviewers’ suggestion, and have removed this data from the revised manuscript.

Reviewer #1:

[…] Overall, I found the quality of the science and the data presented to be very high. I have only two primary suggestions for experiments that I feel would strengthen the conclusions of the current manuscript.

1) The ∆RRM construct, which is a deletion, may have secondary effects on folding/stability of the encoded protein. Given that this EIF-3.G variant is used as an important control for seCLIP studies, I think it would be useful to check that this RRM deletion mutant protein is at least expressed at similar levels as the EIF-3.G wild type and C130Y variants. Since the authors already have FLAG-tagged versions of all three proteins for their CLIP experiments, it should not be too much work to perform a Western blot to compare protein levels.

We thank the reviewer for suggesting this important control. As responded to essential point 1: we have performed western blots as suggested. The results are shown in (Figure 4—figure supplement 1A). While we found that by western blotting the 3XFLAG::EIF-3.G(∆RRM) transgene is expressed at reduced levels compared to that of the EIF-3.G(WT) and EIF-3.G(C130Y) transgenes, we immunoprecipitated EIF3.G(∆RRM) at roughly equivalent levels to EIF-3.G(WT) and EIF-3.G(C130Y) during seCLIP due to the saturating effect of overnight immunoprecipitation. Furthermore, replicate seCLIP experiments using the EIF-3.G(∆RRM) transgene generated roughly three times the number of reads compared to seCLIP from the no transgene control (Supplementary File 4). We hope the reviewer agrees that the EIF-3.G(∆RRM) transgene serves as an effective control in our seCLIP analysis to identify binding sites specific to the RRM of EIF-3.G.

We describe the results in the revised results (lines 220-226) and methods (lines 652-661).

2) The connection to structured 5'UTRs is intriguing but could be further strengthened by an experiment that more explicitly tests the role of secondary structure. For example, in addition to the UTR swapping experiments performed by the authors, it would also be informative to introduce mutations at nucleotides engaged in base-pairing interactions to see if eliminating these interactions influences regulation. If effects are observed, subsequent compensatory mutations that re-introduce base-pairing should be performed to revert back to patterns observed with the native 5'UTR.

We agree with the reviewer on the idea to strengthen the connection of structured 5’UTRs in regulating translation levels by eif-3.G(C130Y). We selected the ncs-2 5’UTR to test the idea. Using RNAfold, we identified a potential stem-loop/hairpin near the initiation codon ATG. While we used mutagenesis to alter this potential structure, after analyzing a number of transgenic lines, we encountered an unexpected outcome that the mutated 5’UTR led to mis-expression in other tissues. We speculate that these nucleotides may critically contribute to tissue-specific gene expression patterns in addition to the regulation of NCS-2 translation via EIF-3.G. Therefore, we did not further pursue this approach, although we will continue to investigate mechanistic basis of the 5’UTR-mediated regulation by EIF-3.G in our future studies.

Reviewer #2:

[…] 1) The study provides a characterization of a new eif-3.g allele, which is interesting. However, the study does not come full circle and clarify how the eif-3.g mutation alters cholinergic neuron excitability. Nor does it show in a mechanistic sense how eif-3.g function depends on neuronal activity. It would be helpful if the authors could point to any efforts that they've made to revert the phenotype of eif-3.g via overexpression of eif-3.g(c130y)-downregulated target genes. If they were able to show such an effect, this would greatly enhance the study.

We thank the reviewer for this suggestion and agree that showing such an effect would enhance our study. We generated strains overexpressing transgenes of the EIF3.G target genes ncs-2, flp-18, and sbt-1, but none of the transgenes reverted convulsion behavior in eif-3.G(C130Y); acr-2(gf) double mutants. These observations are in-line with our previous and recent publications (Stawicki et al., 2013, and McCulloch et al., 2020) showing that it takes co-expression of multiple insulin genes or multiple flp and nlp genes to affect acr-2(gf). Our data supports eif-3.G(C130Y) modulation of convulsion behavior as the result of altered expression of many genes that together affect ACh-MN activity.

2) It is interesting that eif-3.g(C130Y) decreases translation of hlh-30 and ncs-2 only in acr-2(gf) mutants. Is this a direct consequence of elevated neural activity in Ach MNs? For example, does silencing of these neurons attenuate the ability of eif-3.g(C130Y) to decrease ncs-2 GFP reporter translation?

We appreciate the reviewer’s suggestion for testing this model. As responded above in essential point 4: We found that unc-13(0) prevents HLH-30 upregulation in acr-2(gf) and attenuates the ability of eif-3.G(C130Y) to decrease HLH-30 expression in acr-2(gf). The new data suggests that the observed eif-3.G(C130Y) is specific for elevated neuronal activity in ACh MNs, and is shown in Figure 6C and described in the revised text (lines 347-350).

3) A couple of extra genetic controls would bolster the paper: (i) using CRISPR to engineer a revertant of the C130Y eif-3.g mutation and asking whether this abolishes the phenotype; and (ii) overexpressing eif-3.g(C130Y) in Ach MNs and asking whether this is sufficient to induce the phenotype.

We thank the reviewer for proposing these controls. As responded above in essential point 2: We took the reviewers suggestion (point ii) and expressed the GFP::EIF-3.G(C130Y) transgene in the eif-3.G(0) background, which is deficient of endogenous EIF-3.G, and found that it strongly suppresses acr-2(gf) convulsions. This result is reported in Figure 2A and described in the revised text (lines 158-163).

In addition, we used CRISPR editing to change the first cysteine of the EIF-3.G zinc finger CCHC motif to tyrosine (C127Y) and found that it affects acr-2(gf) behavior to the same extent as eif-3.G(C130Y), suggesting acr-2(gf) behavior is generally affected by altered EIF-3.G zinc finger function. The new result is reported in Figure 1C and in the revised manuscript (lines 107-113, 432-434, and 528-535).

Together, these results further support the conclusion that eif-3.G(C130Y) is the mutation causing suppression of acr-2(gf).

4) The use of neuronal cell type-specific seCLIP is exciting, but only 2 replicates were conducted and there is no systematic validation of the detected binding sites. RT-qPCR should be used to validate detected binding sites on a handful of targets.

We agree that a validation of seCLIP targets using an RT-qPCR approach would improve confidence in our seCLIP results. However, as most of the targets show broad expression in multiple tissues, including intestine, the RNA isolated from the entire worm have very low or little representation of neuronal transcripts. This is why we chose to examine GFP reporter expression for EIF-3.G target genes. As responded to the essential point 3, we screened ten reporters of EIF-3.G target genes reporters (including hlh-30 and ncs-2), and found six showing detectable expression in ACh-MNs. As with NCS-2 and HLH-30, we found that ATF-7 and LET-607 expression in the ACh-MNs is reduced specifically in the eif-3.G(C130Y); acr-2(gf) background. We have added our observations of these reporters in the revised Supplementary File 1.

5) For Figure 4E-F and related analyses: the authors are comparing the eif-3.g targets to the full transcriptome to determine notable properties of the eif-3.g-bound gene set. I believe that for these analyses it would be more appropriate to compare the eif-3.g-bound gene set to the set of ACH MN-expressed genes (which the authors have measured in a previous study). In its current form, it is unclear whether the length and GC content of the eif-3.g-bound genes is a general property of cholinergic neuron gene expression. The same idea also applies to the GO analyses.

We thank the reviewer for this suggestion. In our revised Figures 4E-F, we now show that the length and GC-content of 5’UTRs among EIF-3.G targets (n=179) is significantly longer than that of the cholinergic transcriptome (n= 4,573; McCulloch et al., 2020). The results are described in the revised text (lines 270-278).

6) Related to the length of the eif-3.g-bound 5'UTRs, longer RNA sequences have a higher probability of having a detected binding site (i.e. the number of detected binding sites along any region of DNA/RNA should scale with length). It is not clear whether the authors correct for this in their analysis.

The reviewer raises a valid concern that the number of seCLIP detected binding sites should scale with transcript length. Our initial detection of read clusters comprising EIF-3.G footprints in 5’UTRs was independent of their length. This is because we grouped all clusters located in either the CDS or 5’UTR into one category (5’UTR proximal), since CDS clusters in our seCLIP data were almost always located within 200nts of a 5’UTR (Figure 4D). We now clearly state this detail in the revised methods (lines 717-719).

It is also important to note that we identified one cluster per gene on average for each EIF-3.G transgene (Supplementary File 5). Furthermore, we identified EIF-3.G binding sites in many small transcripts such as neuropeptide genes, which are among the shortest transcripts in the C. elegans transcriptome and were among the most highly enriched in our dataset of EIF-3.G targets (Figure 5A). Together, these data suggest that EIF-3.G binding sites are detected independent of transcript length.

Reviewer #3:

[…] 1. The statistical representation in Figure 1E is somewhat misguided. In order to show that eif3.G increases convulsion in acr-2 (gf); eif-3.G(C130Y) in an ACh-MN-specific manner, the statistical analysis of the right 4 samples should be done with WT or (-), not with Ex[eif-3.G(+)].

Thank you for pointing us to this error. We have now corrected Figure 1E with statistical analysis against the WT control instead of with Ex[eif-3.G(+)].

2. The statement 'Both GFP::EIF-3.G(WT) and EIF-3G(C130Y) showed cytoplasmic fluorescence throughout somatic cells and across all developmental stages' is not well-presented in Figure 1—figure supplement 1B, since only the wild-type and one developmental stage (L4) was shown. It is also unclear if the bright puncta across the animal actually correspond to Peif-3.g::GFP or is a result of autofluorescence from the gut. It will be useful to include arrows and insets to highlight the pattern of interest (e.g., cytoplasmic, specific somatic tissues). To elaborate on the tissue specificity suggested in Figure 1E, whether EIF-3.G WT and C130Y are expressed in ACh-MN neuron should be discussed – This will differentiate whether the C130Y effect is cell-autonomous or non-autonomous. The authors also referred to Figure supplement 1B and Figure 2B as assessments of EIF-3.G protein stability – Expression pattern/localization would be more appropriate than protein stability here.

We thank the reviewer for pointing out the issue and for suggestions. We have added new images of L4 animals expressing GFP::EIF-3.G(WT) and GFP::EIF-G(C130Y) to the revised manuscript (Figure 1—figure supplement 1B), which shows that both GFP::EIF-3.G(WT) and GFP::EIF-3.G(C130Y) show indistinguishable tissue expression pattern through somatic cells.

We revised our description of the data in the revised text (lines 153-155) to

“Fluorescence from both GFP::EIF-3.G(WT) and GFP::EIF-3.G(C130Y) was observed

in all somatic cells (Figure 1—figure supplement 1B). In ACh-MNs, both proteins showed cytoplasmic localization (Figure 2B).”

We also edited the Figure 1—figure supplement 1B legend in the revised text (lines 958-962) to make clear that the bright punctae observed across the animal midbody are auto-fluorescent gut granules.

In addition, our conclusions regarding EIF-3.G protein stability now refer exclusively to the analysis in Figure 2B (lines 163-166 of the revised text).

3. In Figure 3A, the potential involvement of ife-1 (one of the eIF4E homologs) in eif-3.g(C130Y) suppression of acr-2(gf) is interesting. Some experiments are needed to discern the direct/indirect nature of this genetic interaction.

A. Does ife-1(0) cause convulsion in eif-3.G(C130Y) alone (acr-2 wild-type)?

B. Does ife-1(0) alter eif-3.G WT and C130Y expression?

C. ife-1 was shown to be predominantly expressed in the germline where it is important for germ cell development (Henderson et al., Journal of Cell Science 2009; Amiri et al., Development 2001). Moreover, the protein is undetectable by western blot from germline-deficient glp-4(bn2) animal (Amiri et al. 2001), potentially indicating exclusive germline expression. Thus, it will be important to look at whether IFE-1 is co-expressed with EIF-3.G WT and C130Y in the soma and ACh-MN.

We thank the reviewer for posing these questions. As recommended in the editorial summary, we have removed data pertaining to ife genes. We will keep reviewer’s questions in mind in our future analyses of these genes.

4. EIF-3.G preference for long 5' UTR with high GC content was nicely dissected from the seCLIP data in Figure 4. For consistency, the authors could provide information of 5'UTR length and GC content between upregulated and downregulated genes in acr-2(gf) over WT, shown in Figure 5B. hlh-30 and ncs-2 were further linked to eif-3.g-mediated suppression of acr-2(gf) by examining their expression using GFP reporters in Figures 6 and 7. Polysome profiling can be done to differentiate the effect of C130Y on the translation efficiency of these transcripts, as opposed to their transcription and protein stability. It would also be informative to show the preference of these genes for C. elegans eIF4E homologs, IFE-1, IFE-2, and IFE-4.

We appreciate this suggestion. We performed an analysis of 5’UTR length and GC-content among GO categories as well as up- and down-regulated genes, but did not observe significant correlation between them and therefore did not include this data.

We performed qRT-PCR for ncs-2 and hlh-30 transcripts from polysome fractions prepared from whole worm lysates, as the reviewer suggested. Unfortunately, we did not obtain meaningful results from this analysis, partly due to technical limitation as polysome profiles from whole worm lysates lack specificity to the ACh-MNs where eif3.G(C130Y) acts to suppress acr-2(gf).

5. A heatmap in Figure 4 —figure supplement 2C needs hierarchical clustering, even though genes in the map are already clustered top to bottom by increasing positional GC-density near the start codon. It may help extract additional meaningful information. The authors also need to point out the genes described in the text (pmt-2, let-607, unc-43, and gsa-1).

We thank the reviewer for suggesting this analysis. We have added hierarchical clustering to the heatmap in Figure 4—figure supplement 2C, which has highlighted interesting examples of GC-density positioning for the genes (zip-2, sec-61, pdf-1, and kin-10). We now discuss in the revised text (lines 278-283) and point out genes described in the text within the figure as suggested.

6. The statistical representation in the graph in Figure 6D needs to be corrected.

Thank you! We have corrected the statistical representation in the revised Figure 6D.

https://doi.org/10.7554/eLife.68336.sa2

Article and author information

Author details

  1. Stephen M Blazie

    Section of Neurobiology, Division of Biological Sciences, University of California San Diego, La Jolla, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6701-6275

  2. Seika Takayanagi-Kiya

    Section of Neurobiology, Division of Biological Sciences, University of California San Diego, La Jolla, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared

  3. Katherine A McCulloch

    Section of Neurobiology, Division of Biological Sciences, University of California San Diego, La Jolla, United States
    Contribution
    Data curation, Writing - review and editing
    Competing interests
    No competing interests declared

  4. Yishi Jin

    Section of Neurobiology, Division of Biological Sciences, University of California San Diego, La Jolla, United States
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Project administration, Writing - review and editing
    For correspondence
    yijin@ucsd.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9371-9860

Funding

National Institutes of Health (NS R37 035546)

  • Yishi Jin

University of California, San Diego (NS007220)

  • Stephen M Blazie

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Brian Yee, Eric Van Nostrand, Gabriel Pratt, and Gene Yeo for advice on adapting the seCLIP protocol to C. elegans and technical support with seCLIP data analysis; Timothy Shaw and Jens Lykke-Andersen for sharing equipment and invaluable assistance with polysome profile analysis; Yan Zhao, Ann Zhou and Ippei Ozaki for assistance in constructing expression clones and strains; Yunbo Li for advice on protein analysis; Malena Hansen, Josh Kaplan, and Keming Zhou for transgenes, Kenneth Miller for Punc-17β plasmid. Some strains used in this study were provided by the Caenorhabditis Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). We acknowledge WormBase and UCSC Genome databases for genomic information resource. We thank Andrew D Chisholm and members of our laboratory for critical reading of the manuscript. S B was a trainee on the UCSD T32 training grant (NS007220). This work is funded by NIH grant (NS R37 035546 to Y J).

Senior Editor

  1. Piali Sengupta, Brandeis University, United States

Reviewing Editor

  1. Anne E West, Duke University School of Medicine, United States

Version history

  1. Received: March 11, 2021
  2. Preprint posted: March 16, 2021 (view preprint)
  3. Accepted: July 28, 2021
  4. Accepted Manuscript published: July 29, 2021 (version 1)
  5. Version of Record published: August 10, 2021 (version 2)

Copyright

© 2021, Blazie et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,243
    Page views
  • 203
    Downloads
  • 5
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Stephen M Blazie
  2. Seika Takayanagi-Kiya
  3. Katherine A McCulloch
  4. Yishi Jin
(2021)
Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity
eLife 10:e68336.
https://doi.org/10.7554/eLife.68336

Categories and tags

Research organism

Further reading

    1. Epidemiology and Global Health
    2. Genetics and Genomics

    Within-host diversity improves phylogenetic and transmission reconstruction of SARS-CoV-2 outbreaks

    Arturo Torres Ortiz, Michelle Kendall ... Louis Grandjean
    Research Article

    Accurate inference of who infected whom in an infectious disease outbreak is critical for the delivery of effective infection prevention and control. The increased resolution of pathogen whole-genome sequencing has significantly improved our ability to infer transmission events. Despite this, transmission inference often remains limited by the lack of genomic variation between the source case and infected contacts. Although within-host genetic diversity is common among a wide variety of pathogens, conventional whole-genome sequencing phylogenetic approaches exclusively use consensus sequences, which consider only the most prevalent nucleotide at each position and therefore fail to capture low frequency variation within samples. We hypothesized that including within-sample variation in a phylogenetic model would help to identify who infected whom in instances in which this was previously impossible. Using whole-genome sequences from SARS-CoV-2 multi-institutional outbreaks as an example, we show how within-sample diversity is partially maintained among repeated serial samples from the same host, it can transmitted between those cases with known epidemiological links, and how this improves phylogenetic inference and our understanding of who infected whom. Our technique is applicable to other infectious diseases and has immediate clinical utility in infection prevention and control.

    1. Cancer Biology
    2. Genetics and Genomics

    Complementary CRISPR screen highlights the contrasting role of membrane-bound and soluble ICAM-1 in regulating antigen specific tumor cell killing by cytotoxic T cells

    Ann-Kathrin Herzfeldt, Marta Puig Gamez ... Lee Kim Swee
    Research Article

    Cytotoxic CD8+ T lymphocytes (CTLs) are key players of adaptive anti-tumor immunity based on their ability to specifically recognize and destroy tumor cells. Many cancer immunotherapies rely on unleashing CTL function. However, tumors can evade killing through strategies which are not yet fully elucidated. To provide deeper insight into tumor evasion mechanisms in an antigen-dependent manner, we established a human co-culture system composed of tumor and primary immune cells. Using this system, we systematically investigated intrinsic regulators of tumor resistance by conducting a complementary CRISPR screen approach. By harnessing CRISPR activation (CRISPRa) and CRISPR knockout (KO) technology in parallel, we investigated gene gain-of-function as well as loss-of-function across genes with annotated function in a colon carcinoma cell line. CRISPRa and CRISPR KO screens uncovered 187 and 704 hits respectively, with 60 gene hits overlapping between both. These data confirmed the role of interferon‑γ (IFN-γ), tumor necrosis factor α (TNF-α) and autophagy pathways and uncovered novel genes implicated in tumor resistance to killing. Notably, we discovered that ILKAP encoding the integrin-linked kinase-associated serine/threonine phosphatase 2C, a gene previously unknown to play a role in antigen specific CTL-mediated killing, mediate tumor resistance independently from regulating antigen presentation, IFN-γ or TNF-α responsiveness. Moreover, our work describes the contrasting role of soluble and membrane-bound ICAM-1 in regulating tumor cell killing. The deficiency of membrane-bound ICAM-1 (mICAM-1) or the overexpression of soluble ICAM-1 (sICAM-1) induced resistance to CTL killing, whereas PD-L1 overexpression had no impact. These results highlight the essential role of ICAM-1 at the immunological synapse between tumor and CTL and the antagonist function of sICAM-1.

    1. Genetics and Genomics
    2. Neuroscience

    Methylglyoxal-derived hydroimidazolone, MG-H1, increases food intake by altering tyramine signaling via the GATA transcription factor ELT-3 in Caenorhabditis elegans

    Muniesh Muthaiyan Shanmugam, Jyotiska Chaudhuri ... Pankaj Kapahi
    Research Article

    The Maillard reaction, a chemical reaction between amino acids and sugars, is exploited to produce flavorful food ubiquitously, from the baking industry to our everyday lives. However, the Maillard reaction also occurs in all cells, from prokaryotes to eukaryotes, forming Advanced Glycation End-products (AGEs). AGEs are a heterogeneous group of compounds resulting from the irreversible reaction between biomolecules and α-dicarbonyls (α-DCs), including methylglyoxal (MGO), an unavoidable byproduct of anaerobic glycolysis and lipid peroxidation. We previously demonstrated that Caenorhabditis elegans mutants lacking the glod-4 glyoxalase enzyme displayed enhanced accumulation of α-DCs, reduced lifespan, increased neuronal damage, and touch hypersensitivity. Here, we demonstrate that glod-4 mutation increased food intake and identify that MGO-derived hydroimidazolone, MG-H1, is a mediator of the observed increase in food intake. RNAseq analysis in glod-4 knockdown worms identified upregulation of several neurotransmitters and feeding genes. Suppressor screening of the overfeeding phenotype identified the tdc-1-tyramine-tyra-2/ser-2 signaling as an essential pathway mediating AGEs (MG-H1) induced feeding in glod-4 mutants. We also identified the elt-3 GATA transcription factor as an essential upstream regulator for increased feeding upon accumulation of AGEs by partially controlling the expression of tdc-1 gene. Further, the lack of either tdc-1 or tyra-2/ser-2 receptors suppresses the reduced lifespan and rescues neuronal damage observed in glod-4 mutants. Thus, in C. elegans, we identified an elt-3 regulated tyramine-dependent pathway mediating the toxic effects of MG-H1 AGE. Understanding this signaling pathway may help understand hedonistic overfeeding behavior observed due to modern AGEs-rich diets.