Structural intermediates observed only in intact Escherichia coli indicate a mechanism for TonB-dependent transport
- Department of Chemistry and Center for Membrane Biology, University of Virginia, United States
Figures
Figure 1
Electron paramagnetic resonance (EPR) spectra obtained in vivo from spin labeled core sites on extracellular face of the BtuB.
The spin labeled side chain (A) R1 was attached to sites on the extracelluar core of BtuB shown in (B). BtuB is shown in both extracellular (top) and side views (PDB ID: 1NQH), with the core in …
Figure 2 with 1 supplement
Substrate-dependent shifts are detected at the apex of substrate binding loop 3 (SB3) in whole cells.
A side view of BtuB (A) with the locations of site 90 in SB3 of the core domain (yellow) and site 188 near the apex of the 3/4 extracellular loop (light blue). (B) Background corrected double …
Figure 2—figure supplement 1
Raw and background corrected double electron-electron resonance (DEER) data for V90R1-T188R1.
In (A) raw DEER data, V(t)/V(0), along with the background form factor that was subtracted (straight red lines). In (B) raw DEER data as a function of substrate (vitamin B12) concentration (see …
Figure 3 with 4 supplements
Substrate-dependent conformational shifts are limited to substrate binding loop 3 (SB3) and are altered by mutation of the R14-D316 ionic lock.
(A) Top view of BtuB (PDB ID: 1NQH) showing the locations of the hatch sites relative to the reference site, 188, in the 3/4 extracellular loop. In (B) the location of the R14-D316 ionic interaction …
Figure 3—figure supplement 1
Raw and background corrected double electron-electron resonance (DEER) data for loop-core spin pairs.
In (A) data obtained without the R14A mutation and (B) data with the R14A mutation. Data for the apo state is shown in blue and the data for the vitamin B12 bound state is shown in red. For each of …
Figure 3—figure supplement 2
The substrate-dependent movement in substrate binding loop 3 (SB3) promoted by the R14A mutation is observed at site 237.
Shown in (A) is a side view of sites 90 and 237 (PDB ID:1NQH). In (B) is shown the distribution for the V90R1-S237R1 spin pair in the absence and presence of R14A with and without vitamin B12, where …
Figure 3—figure supplement 3
Both wild-type (WT) BtuB and BtuB mutant R14A support growth in minimal media containing vitamin B12.
Using an approach described previously (Lathrop et al., 1995), RK5016 cells (-argH, - btuB, -metE) expressing (A) WT BtuB or (B) BtuB mutant R14A were grown in minimal media plates supplemented with …
Figure 3—figure supplement 4
Time domain (left), dipolar (middle), and distance (right) data obtained for the V90R1-T188R1 pair with the R14A mutation at various time points show relative stability of these distance components.
The initial apo (blue) and vitamin B12 (red) traces were processed and frozen more quickly than in other figures, and it can be seen that the starting distribution, particularly for the apo …
Figure 4 with 1 supplement
The substrate-induced changes in substrate binding loop 3 (SB3) are altered or absent in proteoliposomes.
Background corrected double electron-electron resonance (DEER) signals (left) and distance distributions (right) for the V90R1-T188R1 and S93R1-T188R1 pairs involving SB3 in the absence and presence …
Figure 4—figure supplement 1
Raw double electron-electron resonance (DEER) data for the V90R1-T188R1 and S93R1-T188R1 spin pairs purified and reconstituted into 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC).
Solid red lines indicate the background form factors that were used to obtain the background corrected data shown in Figure 4.
Figure 5 with 1 supplement
R14A, D316A, or D316A-R14A have similar effects on the conformation of SB3.
In (A) is shown the structure of BtuB highlighting the positions of the R14 and D316 side chains and the location of the Ton box (from PDB ID: 1NQG). Background corrected double electron-electron …
Figure 5—figure supplement 1
Raw double electron-electron resonance (DEER) data for the V90R1-T188R1 spin pair in the presence of the R14A, D316A, and R14A/D316A mutations.
Solid red lines indicate the background form factors that were used to obtain the background corrected data shown in Figure 5.
Figure 6
Conformational shifts in substrate binding loop 3 (SB3) with release of R14-D316 ionic lock.
(A) View of BtuB (PDB ID: 2GSK) in complex with the C-terminal domain of TonB (purple) showing the core (yellow) and barrel (light blue) with the substrate binding loop SB3 (magenta), and the Ton …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | RK5016 (A derivative of MC4100 with the genotype araD139 Δ(argF-lac)169 flbB5301 ptsF25 relA1 rpsL150 rbsR22 deoC1 gyrA219 non-9 metE70 argH1 btuB461 recA56) | Robert Kadner (University of Virginia) | PMID:2982793 | E. coli strain lacking chromosomal gene for BtuB This strain was authenticated using phenotype assays |
| Strain, strain background (Escherichia coli) | RI90 (araD139 Δ(araABC-leu)7679 galU galK Δ(lac)X74 rpsL thi phoR Δara714 leu+, dsbA:: Kanr) | Coli Genetic Stock Center (Yale University, New Haven, CT) | PMID:8917542 | E. coli DsbA null strain This strain was authenticated using phenotype assays |
| Recombinant DNA reagent | pAG1 (plasmid) | Robert Kadner (University of Virginia) | pUC8 with btuB ORF (2.4 kb) and regulatory region | Plasmid containing WT BtuB gene |
| Recombinant DNA reagent | pAG1 with single point mutations in BtuB (L63C, S65C, N72C, S93C and S237C) | Applied Biological Materials (Richmond, BC, Canada) | Plasmids used to construct and express BtuB with single mutations | |
| Sequence-based reagent | BtuB D316A-FP | This paper | PCR primers | (5’ – 3’) GGTGCGGGTGTCGCCTGGCAGAAACAGACTAC |
| Sequence-based reagent | BtuB D316A-RP | This paper | PCR primers | (5’ – 3’) GTAGTCTGTTTCTGCCAGGCGACACCCGCACC |
| Sequence-based reagent | BtuB R14A-FP | This paper | PCR primers | (5’ – 3’) GTTACTGCTAACGCTTTTGAACAGCCGCGCA |
| Sequence-based reagent | BtuB R14A-RP | This paper | PCR primers | (5’ – 3’) TGCGCGGCTGTTCAAAAGCGTTAGCAGTAAC |
| Sequence-based reagent | BtuB V90C-FP | Nilaweera et al., Biophys. J. 117, 1476–1484. PMID:31582182 | PCR primers | (5’ – 3’) GAATCTGGCGGGGTGTAGTGGTTCTGCCG |
| Sequence-based reagent | BtuB V90C-RP | Nilaweera et al., Biophys. J. 117, 1476–1484. PMID:31582182 | PCR primers | (5’ – 3’) CGGCAGAACCACTACACCCCGCCAGATTC |
| Sequence-based reagent | BtuB T188C-FP | Nilaweera et al., Biophys. J. 117, 1476–1484. PMID:31582182 | PCR primers | (5’ – 3’) ACCGGATGCCAAGCGCAGACAGATAACGATGG |
| Sequence-based reagent | BtuB T188C-RP | Nilaweera et al., Biophys. J. 117, 1476–1484. PMID:31582182 | PCR primers | (5’ – 3’) GCGCTTGGCATCCGGTATTACCATAGGCAACAAC |
| Chemical compound, drug | OG (octylglucoside or n-octyl-β-D-glucopyranoside) | Chem-Impex, international (Wood Dale, IL) | Cat# 00234 | Detergent for BtuB reconstitution |
| Chemical compound, drug | Vitamin B12(CN-Cbl, Cyanocobalamin) | Sigma Aldrich | Cat# V2876 | Substrate for BtuB |
| Chemical compound, drug | 1-Palmitoyl-2-oleoyl-glycero-3-phosphocholine | Avanti Polar Lipids, (Alabaster, AL) | POPC Cat#8 50457 | Lipid used for membrane reconstitution of BtuB |
| Chemical compound, drug | (1-Oxy-2,2,5,5-tetramethylpyrrolinyl-3-methyl)methanethiosulfonate | Cayman Chemical, Ann Arbor Michigan | MTSSL Cat# 16463 | Reagent for spin labeling protein cysteine residues |
| Software, algorithm | LongDistances (v. 932) | Christian Altenbach (UCLA) | LabVIEW software routine for the analysis of pulse EPR data | Used to examine DEER data |
| Software, algorithm | DeerAnalysis (v. 2019) | Gunnar Jeschke (ETH Zürich) | MATLAB routine for the analysis of pulse EPR data | Used to examine DEER data |
| Software, algorithm | MMM (v. 2018.2) | Gunnar Jeschke (ETH Zürich) | MATLAB routine for the determination of spin label rotamers and predicted label-label distances | Used in this study to predict distance distributions from crystal structures and in silico BtuB structures for simulated annealing |
| Software, algorithm | Xplor-NIH (v. 3.2) | Charles Schwieters, Marius Clore (NIH, NIDDK) | Used for simulated annealing to generate structures consistent with DEER data | |
| Software, algorithm | MATLAB (v. 2020a) | MathWorks, Inc (Natick, MA) | Program needed to execute DeerAnalysis and MMM | |
| Software, algorithm | Pymol (v. 2.4.0a0) | Schrödinger, LLC (New York, NY) | Program for molecular graphics |
Additional files
-
Source data 1
Unprocessed EPR data.
- https://cdn.elifesciences.org/articles/68548/elife-68548-data1-v4.zip
-
Supplementary file 1
Table showing the results of fitting double electron-electron resonance (DEER) data for V90R1-T188R1 taken at increasing concentrations of substrate to a two-component model.
- https://cdn.elifesciences.org/articles/68548/elife-68548-supp1-v4.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/68548/elife-68548-transrepform-v4.docx
