Disruption of PIKFYVE causes congenital cataract in human and zebrafish
Abstract
Congenital cataract, an ocular disease predominantly occurring within the first decade of life, is one of the leading causes of blindness in children. However, the molecular mechanisms underlying the pathogenesis of congenital cataract remain incompletely defined. Through whole-exome sequencing of a Chinese family with congenital cataract, we identified a potential pathological variant (p.G1943E) in PIKFYVE, which is located in the PIP kinase domain of the PIKFYVE protein. We demonstrated that heterozygous/homozygous disruption of PIKFYVE kinase domain, instead of overexpression of PIKFYVEG1943E in zebrafish mimicked the cataract defect in human patients, suggesting that haploinsufficiency, rather than dominant-negative inhibition of PIKFYVE activity caused the disease. Phenotypical analysis of pikfyve zebrafish mutants revealed that loss of Pikfyve caused aberrant vacuolation (accumulation of Rab7+Lc3+ amphisomes) in lens cells, which was significantly alleviated by treatment with the V-ATPase inhibitor bafilomycin A1 (Baf-A1). Collectively, we identified PIKFYVE as a novel causative gene for congenital cataract and pinpointed the potential application of Baf-A1 for the treatment of congenital cataract caused by PIKFYVE deficiency.
Editor's evaluation
This manuscript will be of interest to readers in the field of eye development and pathology and ocular geneticists. Using a zebrafish model, the authors have identified a new autosomal dominant mutation in the kinase domain of the human phosphoinositide kinase gene PIKFYVE and assessed its impact on congenital cataract (clouding of the lens). They demonstrated that heterozygous or homozygous disruption of the PIKFYVE kinase domain, but not the overexpression of PIKFYVE G1943E, led to a cataract defect, suggesting the mechanism of haploinsufficiency rather than dominant-negative inhibition of PIKFYVE activity. The authors have presented strong evidence that mutations in the PIKFYVE kinase domain could lead to congenital cataract. Overall, the same pipeline of in vitro and in vivo genetic approaches could be applied to other human genetic disorders.
https://doi.org/10.7554/eLife.71256.sa0Introduction
Congenital cataract is partial or complete opacification of the lens that occurs at birth or during the first decade of life. It is a common ocular abnormality that causes visual impairment and blindness during infancy (Khokhar et al., 2017), accounting for 5–20% blindness in children worldwide (Sheeladevi et al., 2016). According to the location and shape of the lens opacities, congenital cataract can be divided into seven clinical types: nuclear cataract, polar cataract, lamellar cataract, nuclear with cortical cataract, cortical cataract, sutural cataract, and total cataract (Zhai et al., 2017). Different types of cataracts cause different levels of visual impairment in patients. A variety of factors, including gene variants that affect lens metabolism. are closely associated with cataract (Li et al., 2020), and autosomal dominant congenital cataract is the most common mode of inheritance (Berry et al., 2020a). To date, the occurrence of congenital cataract has been linked with genetic variants in at least 50 genes involved in lens structure and development (Berry et al., 2020b; Shiels and Hejtmancik, 2017), including crystallin genes (CRYAA, CRYAB, CRYBB1, CRYBB2, CRYBB3, CRYBA1/A3, CRYBA2, CRYBA4, CRYGC, CRYGD, and CRYGS) (Bhat, 2003; Zhuang et al., 2019), membrane protein genes (GJA3, GJA8, MIP, and LIM2) (Berry et al., 2000; Beyer et al., 2013; Pei et al., 2020), growth and transcription factor genes (PITX3, MAF, and HSF4) (Anand et al., 2018), beaded filament structural protein genes (BFSP1 and BFSP2) (Song et al., 2009), and other genes (CHMP4B and EPHA2) (Dave et al., 2016; Shiels et al., 2007). Although these findings have made tremendous contributions to our understanding of the genetic etiology of congenital cataract, new causative genes as well as the underlying molecular mechanisms remain to be discovered (Berry et al., 2020a).
In this study, we identified a missense genetic variant (p.G1943E) in the phosphatidylinositol phosphate kinase (PIPK) domain of PIKFYVE (phosphoinositide kinase, FYVE-type zinc finger containing) from a Chinese cataract family. The human PIKFYVE gene encodes a large protein consisting of 2098 amino acids, which contains six evolutionarily conserved domains (Kawasaki et al., 2012), including zinc finger phosphoinositide kinase (FYVE) domain, plextrin homology domain, β-sheet winged helix DNA/RNA-binding motif, cytosolic chaperone CCTγ apical domain-like motif, spectrin repeats (SPEC), and C-terminal fragment PIPK domain (Li et al., 2005; Shisheva, 2008). The N-terminal FYVE domain can bind to PtdIns3P on the membrane, while the C-terminal is the kinase domain which has the catalytic function for the production of PtdIns(3,5)P2 (Shisheva et al., 1999). The in-vivo function of PIKFYVE in the development of lens and its association with congenital cataract have not been documented. Different from previously reported PIKFYVE variants affecting the chaperonin-like domain that cause fleck corneal dystrophy (CFD), a disease characterized by tiny white flecks scattered in corneal stroma (Gee et al., 2015; Kawasaki et al., 2012; Li et al., 2005), the p.G1943E variant in the kinase domain of PIKFYVE was revealed for the first time to cause congenital cataract in human patients. Using zebrafish models, we demonstrated that disruption of the PIPK domain in Pikfyve caused early-onset cataract defect (aberrant accumulation of Rab7+Lc3+ amphisomes in the lens) and treating the pikfyve-deficient embryos with V-ATPase inhibitor bafilomycin A1 (Baf-A1) significantly alleviated the vacuolation defect in the lens of zebrafish mutants.
Results
The congenital cataract family and clinical characteristics
We recruited a large Chinese Korean family affected with congenital cataract, which consists of 31 family members including 12 affected individuals across four generations (Figure 1A). All the family members were Chinese Korean except one married-in individual (III-8) who was Han Chinese. There was no consanguineous marriage in this family. Bilateral cataract was observed in every generation of the pedigree and affected parents transmitted the disease to both males and females, suggesting an autosomal dominant inheritance. No other ocular and systemic abnormalities were found in these patients. Clinical information was obtained from all patients except two deceased individuals (Table 1). Seven of the 10 living patients were diagnosed as cataract in their first decade of life, with the smallest age of diagnosis at 2 years old. The best corrected visual acuity (BCVA) of these patients ranged from 20/125 to 20/20. The proband (III-9) showed nuclear pulverulent cataract in both eyes (Figure 1B) with vision loss (OD: 20/40, OS: 20/66) since childhood. The mother (II-4) of the proband also had nuclear pulverulent cataract in both eyes, while his father (II-3) had no cataract in either eye. The son (IV-5) of the proband had Y-sutural cataract. Among the other affected members of this family, individuals II-8, III-5, III-6, and IV-3 presented nuclear pulverulent opacity in both eyes, whereas individual III-1 and his son (IV-1) showed peripheral cortical punctate opacity in both eyes. All patients of this family did not show any abnormities in fundus photography and optical coherence tomography (OCT) examinations.

Pedigree structure and ocular manifestations of the cataract family.
(A) Pedigree of the family with congenital cataract. Squares denote males and circles denote females; Symbols crossed by a line indicate deceased individuals. Filled symbols indicate affected individuals, while open symbols indicate unaffected individuals. All affected family members had bilateral congenital cataract. The arrow denotes the proband. The individuals marked with an asterisk (∗) are analyzed by whole-exome sequencing. Genotypes of the PIKFYVE variant (p.G1943E) are indicated below each symbol (+, wild-type allele; −, p.G1943E variant allele). (B) Slit-lamp photographs showing the transparent lens of an unaffected individual (IV-6) and the nuclear pulverulent cataract in the left eye of the proband (III-9).
Clinical characteristics of living patients in the cataract family.
Patient | Gender | Age at diagnosis (years) | BCVA before surgery (OD, OS) | Cataract type (OU) | Surgery (Y/N) | BCVA after surgery (OD, OS) |
---|---|---|---|---|---|---|
Ⅱ-1 | F | 9 | – | – | Y | 20/160, 20/125 |
Ⅱ-4 | F | 12 | 20/40, 20/32 | Nuclear pulverulent | N | NA |
Ⅱ-8 | M | 4 | 20/100, LP | Nuclear pulverulent | Y | 20/40, FC |
Ⅲ-1 | M | 47 | 20/25, 20/20 | Peripheral cortical punctate | N | NA |
Ⅲ-5 | M | 6 | 20/40, 20/40 | Nuclear pulverulent | Y | 20/20, 20/20 |
Ⅲ-6 | M | 7 | 20/40, 20/50 | Nuclear pulverulent | Y | 20/16, 20/16 |
Ⅲ-9 | M | 6 | 20/40, 20/66 | Nuclear pulverulent | Y | 20/28, 20/25 |
Ⅳ-1 | M | 22 | 20/20, 20/20 | Peripheral cortical punctate | N | NA |
Ⅳ-3 | M | 3 | 20/30, 20/25 | Nuclear pulverulent | N | NA |
Ⅳ-5 | M | 2 | 20/125, 20/125 | Nuclear and Y-sutural | N | NA |
-
BCVA: best corrected visual acuity; OD: eye, oculus dexter; OS: eye, oculus sinister; OU: eye, oculus uterque; Y: yes; N: no; F: female; M: male; LP: light perception; FC: finger counting; —: unknown; NA: not applicable.
Identification of a pathogenic genetic variant in PIKFYVE in the cataract family
To identify the pathogenic variant responsible for congenital cataract in this family, we performed whole-exome sequencing (WES) analysis of four selected family members including three affected members (II-1, III-9, and IV-5) and one unaffected member (II-5; Figure 1A). Overall, 101,852–102,401 sequence variants were identified in each individual. Nonsynonymous or splicing-site variants, of which the minor allele frequencies were less than 1% in the genome aggregate database (gnomAD; https://gnomad.broadinstitute.org/) and were shared among all three affected members but were absent from the unaffected member were filtered and retained. Then we focused on variants in known cataract genes but did not find any disease causative variants in this family. Further filtering based on in-silico prediction of pathogenicity refined the candidates to three genes (PIKFYVE, NPHS1, and FPR1; Table 2). We then verified and evaluated these candidate variants in the whole family using Sanger sequencing. Among them, only the PIKFYVE variant completely segregated with the disease in the family (Figure 1A). As shown in Figure 2A, in contrast to the healthy control, the PIKFYVE gene in the cataract patients carried a G to A heterozygous substitution in the 39th exon, which leads to the replacement of a highly conserved amino acid glycine (G) by glutamate (E) at position 1943 in the PIPK domain (Figure 2B and C). To investigate the possible roles of PIKFYVE in the development of cataracts, we first confirmed its expression in human anterior lens capsules by quantitative RT-PCR (Figure 2—figure supplement 1A and B). Then to interpret how p.G1943E variant altered the function of PIKFYVE, we determined the protein stability of PIKFYVEWT and PIKFYVEG1943E by Western blot analysis of pCS2(+)-CMV-PIKFYVEWT and pCS2(+)-CMV-PIKFYVEG1943E transfected HEK293T cells at 34 and 44 hr post-transfection. As shown in Figure 2D, the expression level of PIKFYVEG1943E was comparable with that of PIKFYVEWT, suggesting that the p.G1943E variant has little or no effect on the protein stability of PIKFYVE. Recently, a middle-to-low resolution structure of PIKFYVE was resolved by cryo-EM (PDB ID:7K2V) (Lees et al., 2020). Using this structure as template, we predicted the structure of the p.G1943E variant form of PIKFYVE PIPK domain. As shown in Figure 2E and F, the p.G1943E sits in a linker connecting the N-lobe (gold) and the C-lobe (cyan) of PIPK domain. This loop (red) acts as a hinge between N-lobe and C-lobe (Figure 2F) and forms a highly restricted conformation. However, the p.G1943E variant introduces a negatively charged residue to the loop. This negatively charged residue not only changes the surface electrostatic potential of PIPK domain (Figure 2G), but also generates charge repulsions between the loop and N-lobe (D1872 and D1871) (Figure 2F), thereby potentially affecting the kinase activity of PIKFYVE.

The PIKFYVE variant identified from the congenital cataract family.
(A) Sanger sequencing chromatogram showing the cDNA sequences from a healthy control and a cataract patient. The heterozygous c.5828G>A missense variant in the patient is indicated by the red arrow. (B) A schematic diagram showing the human PIKFYVE domains. The p.G1943E variant in the PIPK domain is indicated by the red arrow. (C) Protein sequence alignment of PIKFYVE orthologs in vertebrates. The black triangle denotes the conserved glycine at position 1943. (D) Western blot analysis of PIKFYVEWT and PIKFYVEG1943E expression in HEK293T cells that were transiently transfected with either pCS2(+)-CMV-PIKFYVEWT or pCS2(+)-CMV-PIKFYVEG1943E. The protein levels were normalized by GAPDH expression. Experiments were repeated three times. (E) Predicted structure model of the p.G1943E variant form of PIKFYVE PIPK domain generated by the PHYPRE2 server (http://www.sbg.bio.ic.ac.uk/~phyre2/html/). N-lobe, C-lobe, and the hinge linker are shown in gold, cyan, and red, respectively. The variant residue E1943 is shown in sticks and labeled with green. The negatively charged residue D1872 close to E1943 side chain is also shown in sticks. (F) A schematic demonstrating the organization of PIKFYVE PIPK domain. N-lobe, C-lobe, and the hinge linker are shown in gold, cyan, and red, respectively. The position of the p.G1943E variant is labeled with a yellow star. (G) Surface electrostatic potential comparison of the PIPK domain of PIKFYVE between wild-type (WT) and p.G1943E variant. The electrostatic potentials are presented as heatmaps from red to blue, and the electrostatic potential scales are shown in the lower panel. See Figure 2—source data 1 for details.
-
Figure 2—source data 1
Raw data for intensity of bands in Figure 2D.
- https://cdn.elifesciences.org/articles/71256/elife-71256-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Raw data for the full raw unedited blots in Figure 2D.
- https://cdn.elifesciences.org/articles/71256/elife-71256-fig2-data2-v1.pdf
Candidate variants identified from whole-exome sequencing in the cataract family.
Gene | SNP ID | Chromosome position (bp; hg19) | cDNA change | Amino acid change | MAF(gnomAD) | PolyPhen | GERP | CADD |
---|---|---|---|---|---|---|---|---|
PIKFYVE | rs771244880 | chr2:209217490 | c.5828G>A | p.G1943E | 0.00002 | 0.999 | 5.09 | 26.00 |
NPHS1 | rs114849139 | chr19:36330456 | c.2869C>G | p.V957L | 0.001 | 0.987 | 4.27 | 14.34 |
FPR1 | rs78488639 | chr19:52249959 | c.289G>T | p.L97M | 0.008 | 0.795 | 2.55 | 10.70 |
-
MAF: minor allele frequency; gnomAD: genome aggregation database; PolyPhen: polymorphism phenotyping; GERP: evidence of evolutionary conservation; CADD: combined annotation dependent depletion.
To further strengthen the correlation of PIKFYVE variants with cataracts, we screened another congenital cataract family, 10 sporadic cases with congenital cataract and 200 patients with age-related or complicated cataract. In this experiment, six affected loci from seven age-related or complicated cataract patients were identified. Among them, two variants in exon 36 (c.5399A>C, p.Q1800P) and exon 37 (c.5594C>T, p.A1865V) are located in the PIP kinase domain (Figure 2—figure supplement 2, Figure 2—figure supplement 2—source data 1). These findings further suggested that genetic variants in PIKFYVE might be causal/risk factors for cataract formation.
Disruption of PIPK domain of PIKFYVE caused early onset cataract in zebrafish
Bioinformatic analysis suggests that the p.G1943E variant introduces a negatively charged residue in the loop, which potentially affects the kinase activity of PIKFYVE. To directly demonstrate that heterozygosity of the p.G1943E variant caused haploinsufficiency rather than dominant-negative inhibition of PIKFYVE activity in human patients, we generated pikfyve-deficient zebrafish mutants using the CRISPR/Cas9-directed gene editing method (Shankaran et al., 2018). To maximally mimic the p.G1943E variant in human patients, we designed single-guide RNA (sgRNA) in exon 40 to target the C terminal PIPK domain and screened out the pikfyveΔ8 allele, which harbored an 8 bp deletion and a 112 bp insertion in the cDNA of pikfyve. As shown in Figure 3A, this insertion/deletion in pikfyveΔ8 allele introduced a premature stop codon immediately downstream of the insertion site, thereby presumably generating a truncated Pikfyve protein that lacks the kinase activity. Phenotypical analysis revealed that pikfyveΔ8 homozygous mutants developed normally before 5 days post-fertilization (dpf), but later showed severe developmental defects and all died by 9 dpf (Figure 3—figure supplement 1A, B). Under stereomicroscope, we noticed that compared to siblings (sib), the lens of pikfyveΔ8 mutants was less transparent at 5 dpf (Figure 3B). To characterize this phenotype in details, we followed up the development of lens in all genotypes at different stages under differential interference contrast (DIC) microscope. Our results showed that bubble-like vacuoles first appeared in the developing lens of pikfyveΔ8 homozygous mutants at 3 dpf (Figure 3C and D). Strikingly, the number and size of vacuoles both increased drastically by 5 dpf and almost dominated the lens of mutants. Notably, compared to the wild-type (WT) control, pikfyveΔ8 heterozygous mutants also manifested significantly higher number of vacuoles in their lens (Figure 3C and D), suggesting that normal development of lens highly depends on the activity of Pikfyve and heterozygous disruption of Pikfyve is sufficient to cause cataract phenotype. Furthermore, pharmacological inhibition of PIKFYVE activity by inhibitor YM201636 also induced aberrant vacuolation in human lens epithelial cells HLEB3 (Figure 3E and F), suggesting that the function of PIKFYVE in the regulation of cataract formation is highly conserved across species and our zebrafish cataract model would potentially be an excellent system for further preclinical study.

Disruption of the PIPK domain of Pikfyve in zebrafish caused early-onset cataract.
(A) A schematic diagram showing the generated pikfyveΔ8 mutant allele. The underlined base pairs are the sgRNA target. The deleted base pairs are shown in dark blue while inserted ones are shown in red. The stop codon introduced in the mutant form is shown in the grey box. (B) Representative images showing the lens of sibling and pikfyveΔ8 mutants at 5 dpf. (C) Representative differential interference contrast (DIC) images showing the lens of pikfyve+/+, pikfyve+/Δ8, and pikfyveΔ8/Δ8 embryos at 3 dpf and 5 dpf. The scale bars represent 10 μm in (B) and (C). (D) Quantification of vacuole number in the lens of pikfyve+/+, pikfyve+/Δ8, and pikfyveΔ8/Δ8 embryos at 3 dpf (n=7 for pikfyve+/+; n=10 for pikfyve+/Δ8; n=7 for pikfyveΔ8/Δ8) and 5 dpf (n=7 for pikfyve+/+; n=11 for pikfyve+/Δ8; n=6 for pikfyveΔ8/Δ8). (E) Representative images of HLEB3 cells treated with DMSO or PIKFYVE inhibitor YM201636 for 4 hr. The scale bars represent 25 μm. (F) Quantification of the vacuole numbers in (E). ****, p<0.0001, Student’s t-test. All experiments were repeated three times. See Figure 3—source data 1 for details.
-
Figure 3—source data 1
Raw data for quantification in Figure 3D and F.
- https://cdn.elifesciences.org/articles/71256/elife-71256-fig3-data1-v1.xlsx
In addition to loss of function study of Pikfyve, we also utilized a ubiquitously expressed ubiquitin (ubi) promoter to generate transgenic lines, that is, Tg(ubi:PIKFYVEWT) and Tg(ubi:PIKFYVEG1943E) to overexpress PIKFYVEWT and PIKFYVEG1943E in zebrafish, respectively (Figure 3—figure supplement 2A). As expected, both of these two zebrafish lines showed normal development of the lens during early stages (Figure 3—figure supplement 2B), suggesting that indeed haploinsufficiency, rather than dominant-negative inhibition of PIKFYVE activity by the p.G1943E variant caused cataract in human patients. Moreover, the vacuolation phenotype could be partially rescued in both pikfyveΔ8;Tg(ubi:PIKFYVEWT) and pikfyveΔ8;Tg(ubi:PIKFYVEG1943E) zebrafish (Figure 3—figure supplement 3A). However, while the vacuole numbers decreased to less than 15 in all pikfyveΔ8;Tg(ubi:PIKFYVEWT) embryos (n=6/6), about one-third of pikfyveΔ8;Tg(ubi:PIKFYVEG1943E) mutants still harbored more than 15 vacuoles (n=5/17) (Figure 3—figure supplement 3A). As whole-mount in situ hybridization (WISH) results revealed that the expression of PIKFYVE in Tg(ubi:PIKFYVEG1943E) was at least as strong as or even stronger than that of PIKFYVEWT (Figure 3—figure supplement 3B). These results indicated that the rescue effect of PIKFYVEG1943E is less efficient than that of PIKFYVEWT.
Detailed characterization of cataract phenotypes in PikfyveΔ8 mutants
To delineate the details of cataract phenotype in pikfyveΔ8 mutants, we crossed pikfyveΔ8 mutant with the reporter transgenic line Tg(cryaa:DsRed) (Nguyen-Chi et al., 2014), in which expression of DsRed was controlled by promoter of the crystalline gene cryaa, the major constitutive components of lens fibers (Runkle et al., 2002). Intriguingly, in comparison with evenly distributed DsRed signals in the lens of siblings, vacuoles in pikfyveΔ8 mutants almost occupied the surface of the lens and all of them were DsRed negative (Figure 4A), indicating that these vacuoles did not contain lens fibers. Meanwhile, hematoxylin-eosin (HE) staining, together with ZL-1 antibody and DAPI co-staining revealed that while disruption of Pikfyve seemingly had no effects on the enucleation process of lens, lens fibers in pikfyveΔ8 mutants were less organized than those in siblings (Figure 4B and C). To further characterize the vacuoles and lens structure in high resolution, we utilized transmission electron microscope (TEM) to visualize the ultrastructure of lens in both siblings and pikfyveΔ8 mutants. We could detect large vacuoles in the mutant lens at 3 dpf and 5 dpf, while only several tiny vacuoles were observed in the sibling lens (Figure 4D). Lens fiber cells of siblings were mildly edema, and their nuclei were oval with uniform chromatin. The lens fibers (white arrows) were arranged neatly and tightly. Furthermore, mitochondria (black triangles) of siblings were slightly swollen without vacuoles. In contrast, lens fiber cells of the pikfyveΔ8 mutants were obviously edematous and the nuclei were irregularly shaped. Besides, the arrangement of lens fibers was loose and deformed and lipid droplets were formed in pikfyveΔ8 mutants. Compared to the siblings, mitochondria (black triangles) of pikfyveΔ8 mutants were obviously swollen and enlarged. Mitochondrial crests were reduced, and most of them were aberrantly vacuolated. In addition, autophagic lysosomes also appeared swollen and vacuolated in pikfyveΔ8 mutants.

Detailed characterization of cataract phenotypes in pikfyveΔ8 mutants.
(A) Confocal imaging of the lens of 5-dpf siblings and pikfyveΔ8 mutants in Tg(cryaa:DsRed) transgenic background. (B) Hematoxylin-eosin (HE) staining of 5-dpf siblings and pikfyveΔ8 mutant zebrafish lens after cryostat section. (C) ZL-1 antibody and DAPI staining of 5-dpf siblings and pikfyveΔ8 mutant zebrafish lens. (D) Transmission electron microscope (TEM) images of the lens of siblings and pikfyveΔ8 mutants at 3 dpf and 5 dpf. ASS, autophagy lysosome; LD, lipid droplet; N, nucleus. All results were confirmed in three different individuals. All the scale bars represent 10 μm.
Vacuoles in PikfyveΔ8 mutants were amphisomes
To define the nature of vacuoles in the lens of pikfyveΔ8 mutants, we conducted time-lapse imaging to monitor their behaviors during zebrafish development. Our results showed that vacuoles in pikfyveΔ8 mutants were highly dynamic and small vacuoles were frequently found to be fused with each other to form larger ones (Figure 5A, white arrows). This feature, together with previous findings showing that PIKFYVE was an essential regulator of endomembrane homeostasis (Hasegawa et al., 2017), prompted us to further investigate whether vacuoles in pikfyveΔ8 mutants were virtually endocytic vesicles. To probe this issue, we generated fusion mRNAs encoding GFP and the markers of endocytic vesicles (i.e., the small GTPase Rab5c, Rab7, and Rab11a) (Langemeyer et al., 2018) and injected them into zebrafish embryos to specifically label early, late, and recycling endosomes in pikfyveΔ8 mutants. Our results showed that in pikfyveΔ8 mutants, almost all vacuoles were positive for the late endosome maker Rab7-GFP (Figure 5C, white arrows). By contrast, the early endosome marker Rab5c-GFP and recycling marker Rab11a-GFP showed no co-localization with vacuoles (Figure 5B-D). As autophagy was also closely related to the organelle membrane system and had been shown to be regulated by PIKFYVE (Vicinanza et al., 2015), we therefore checked the status of autophagosomes in pikfyveΔ8 mutants by injecting lc3b-mcherry fusion mRNA. As shown in Figure 5 and a proportion of vacuoles in pikfyveΔ8 mutants were also positive for the autophagosome marker Lc3b. Taken together, these data implied that vacuoles in pikfyveΔ8 mutants were amphisomes formed by the fusion of autophagosomes and late endosomes.

Characterization of vacuoles in pikfyveΔ8 mutants.
(A) Time-lapse imaging indicating the dynamic changes of vacuole formation in the lens of 4-dpf pikfyveΔ8 mutants. White arrows indicate the fusion process of two small vacuoles. (B) Representative images showing the lens of 3.5-dpf siblings and pikfyveΔ8 mutants injected with gfp-rab5c mRNA. (C) Representative images showing lens of 3.5-dpf siblings and pikfyveΔ8 mutants injected with gfp-rab7 mRNA. (D) Representative images showing lens of 3.5-dpf siblings and pikfyveΔ8 mutants injected with gfp-rab11a mRNA. (E) Representative images showing lens of 3.5-dpf siblings and pikfyveΔ8 mutants injected with mcherry-lc3b mRNA. All experiments were repeated three times. All the scale bars represent 10 μm.
Baf-A1 partially rescued the vacuole defect in the lens of PikfyveΔ8 mutant zebrafish
Baf-A1 is a specific inhibitor of V-ATPase. Previous work has shown that the vacuole phenotype induced by PIKFYVE deficiency in COS-7 cells could be rescued by Baf-A1 (Compton et al., 2016). We thus investigated whether the vacuolation defect in the lens of pikfyveΔ8 mutant zebrafish could also be attenuated by Baf-A1. Indeed, we found that vacuole number in the lens of Baf-A1-treated pikfyveΔ8 mutants was significantly lower than that in the control group treated with dimethyl sulfoxide (DMSO) (Figure 6A and B). To further validate that Baf-A1 could directly alleviate cataract defect, rather than just delay the phenotype, we imaged the lens of the same mutant zebrafish before and after Baf-A1 treatment. As shown in Figure 6C and D, while vacuole numbers of all the mutant embryos showed a slight increase after DMSO treatment or without treatment, we observed significant decrease of vacuole numbers in all pikfyveΔ8 mutants. On the other hand, a previous study also showed overexpression of transient receptor potential mucolipin 1 (TRPML1) could partially rescue the vacuole phenotype in PIKfyve-deficient macrophages (Krishna et al., 2016). However, in our system, ectopic expression of Trpml1 by mRNA injection failed to rescue vacuolation phenotype in pikfyveΔ8 mutants (Figure 6—figure supplement 1). Thus, V-ATPase rather than Trpml1 might be a key component for the formation or maintenance of the large vacuoles in the lens of pikfyve-deficient mutants, and inhibition of V-ATPase by Baf-A1 could directly alleviate the cataract phenotype.

Baf-A1 partially rescued the vacuole defect in the lens of pikfyveΔ8 mutant zebrafish.
(A) Representative confocal images of the lens of 4-dpf pikfyveΔ8 mutants treated with DMSO or Baf-A1 for 4.5 hr. (B) Quantification of the vacuole numbers in the lens of 4-dpf siblings and pikfyveΔ8 mutant embryos treated with DMSO or Baf-A1 (n=10 for sibling groups; n=7 for mutant groups). (C) Confocal images of the lens of 4-dpf pikfyveΔ8 mutants with no treatment or after 4.5 hr treatment with DMSO or Baf-A1. (D) Quantification of the vacuole numbers in (C) (n=6 for each group). All experiments were repeated three times. All the scale bars represent 20 μm. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001, Student’s t-test. See Figure 6—source data 1 for details.
-
Figure 6—source data 1
Raw data for quantification in Figure 6B and D.
- https://cdn.elifesciences.org/articles/71256/elife-71256-fig6-data1-v1.xlsx
Discussion
In this study, we identified a missense variant (p.G1943E) in PIKFYVE responsible for congenital cataract in a Chinese Korean family (Figures 1 and 2). This variant is very rare in the general population. In the gnomAD database, only four individuals (including three East Asians and one Latino/Admixed American) carry the p.G1943E variant, representing an extremely low allele frequency of 0.00002 (Table 2). Consistent with previous findings (Berry et al., 2020b), the degree and morphology of lens opacity in the cataract family were phenotypically heterogeneous (Table 1). While most of the patients in this family developed cataract and vision loss in their childhood, some cases were diagnosed quite late. Meanwhile, the majority of patients had nuclear pulverulent cataract, while the others had nuclear Y-sutural cataract or peripheral cortical punctate cataract (Table 1). This heterogeneity in clinical manifestations might be ascribed to interactions between genetic and environmental factors during lens development (Berry et al., 2020b).
Variants in PIKFYVE have been reported to be associated with CFD (Gee et al., 2015; Kawasaki et al., 2012; Kotoulas et al., 2011; Li et al., 2005). However, except that two of the CFD patients showed cataract formation at 66 and 58 years old, respectively, none of these PIKFYVE variants in these studies caused congenital cataract (Kotoulas et al., 2011). Interestingly, we also did not observe any corneal defect in patients with congenital cataract in this study. It is noted that all CFD-related mutations in PIKFYVE, either homozygous or heterozygous, are distributed in two regions (i.e., amino acids 667–843 and 1490–1538), corresponding to cytosolic chaperone CCTγ apical domain-like motif and SPEC domains, respectively. By contrast, the p.G1943E variant identified in this study is located in the C-terminal PIPK domain. Based on these findings, we hypothesized that different domains of PIKFYVE might exert different functions by binding with different partners. This hypothesis is further supported by other evidences. First, the predicted protein structure suggested that, instead of gross disruption of PIKFYVE protein structure, the p.G1943E variant only mildly altered the 3-D conformation of PIPK domain by changing its surface electrostatic potential and generating charge repulsions between the loop and N-lobe (Figure 2G and F). Therefore, it is reasonable to argue that this mutation in PIPK domain may specifically alter its kinase activity or change the binding surface with other proteins, while keep the N-terminal cytosolic chaperone CCTγ apical domain-like motif and SPEC domains functional intact. Second, in our pikfyveΔ8 zebrafish mutants, while the C-terminal PIPK domain was truncated in PikfyveΔ8 protein, the N-terminal cytosolic chaperone CCTγ apical domain-like motif and SPEC domains were not affected. Accordingly, we did not observe any cornea defect in the zebrafish mutants either.
Inhibition of PIKFYVE in COS-7 cells had been shown to induce large vacuoles through promoting the enlargement of both early and late endosomes (Ikonomov et al., 2006; Rutherford et al., 2006). Further studies revealed that the Ca2+ releasing channel endolysosome-localized mucolipin TRPML1 acts downstream of PIKFYVE to trigger membrane fusion/fission process (Dong et al., 2010) or promote lysosome/phagosome maturation (Dayam et al., 2015; Kim et al., 2014). Interestingly, while overexpression of TRPML1 partially alleviated the vacuole phenotype in PIKFYVE-deficient macrophages (Krishna et al., 2016), the rescue effect was not observed in the lens of pikfyveΔ8 zebrafish mutants (Figure 6—figure supplement 1), suggesting that PIKFYVE might function in a context-dependent manner. Consistent with this idea, we also noted that vacuoles in microglia (the brain-resident macrophages) and lens cells of pikfyveΔ8 mutants were differently stained by lysosome marker (Figure 5—figure supplement 1). On the other hand, vacuole formation in PIKFYVE-deficient COS-7 cells and macrophages could also be inhibited by a drug called Baf-A1 (Compton et al., 2016; Isobe et al., 2019). In this study, we found that Baf-A1 could partially rescue the vacuole defect in the lens of pikfyveΔ8 mutant zebrafish (Figure 6A–D). Baf-A1 is a macrolide antibiotic that inhibits V-ATPase, the ATP-dependent proton pump located on the membrane of organelles. The cellular acidification process mediated by V-ATPase may affect many basic biological processes, including membrane trafficking (in particular endosome maturation and fusion between autophagosomes and lysosomes; Hammond et al., 1998; Yamamoto et al., 1998), protein degradation, and autophagy (Bowman et al., 1988; Yamamoto et al., 1998; Yoshimori et al., 1991). Interestingly, several works in yeast also identified mutations in V-ATPase that did not affect proton pump function, but indeed caused defects in vacuole fusion (Strasser et al., 2011). Moreover, another study in Drosophila demonstrated that inhibition of vesicle fusion by Baf-A1 did not depend on V-ATPases, but relied on Ca2+ sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) pump, the secondary target of Baf-A1 (Mauvezin et al., 2015). Therefore, the target of Baf-A1 and underlying mechanisms still need to be further investigated. These mechanisms will finally contribute to the potential clinical application of the drug in the treatment of congenital cataract caused by PIKFYVE deficiency.
Materials and methods
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Cell line (Homo sapiens) | HEK293T | Laboratory cell bank of Shenzhen PKU-HKUST Medical Center | Initially ordered from ATCC by colleagues in HKUST | |
Cell line (H. sapiens) | HLEB3 | ATCC | ATCC CRL-11421, RRID:CVCL_6367 | |
Strain, strain background (Danio rerio) | pikfyveΔ8 mutant | This paper | Maintained in Shenzhen PKU-HKUST Medical Center | |
Strain, strain background (D. rerio) | Tg(ubi:PIKFYVEWT) | This paper | Maintained in Shenzhen PKU-HKUST Medical Center | |
Strain, strain background (D. rerio) | Tg(ubi:PIKFYVEG1943E) | This paper | Maintained in Shenzhen PKU-HKUST Medical Center | |
Strain, strain background (D. rerio) | Tg(cryaa:DsRed;il-1b:GFP-F) | doi.10.1242/dmm.014498 | ||
Chemical compound, drug | YM201636 | Selleck, China | S1219 | 800 nM for 4 hr |
Chemical compound, drug | bafilomycin A1 | MedChemExpress, NJ | HY-100558 | 1 μM for 4.5 hr |
Antibody | Anti-PIKFYVE antibody (rabbit polyclonal) | Abcam, UK | Cat# ab137907 | WB (1:1000) |
Antibody | Anti-GAPDH antibody (rabbit polyclonal) | Abcam, UK | Cat# ab9485, RRID:AB_307275 | WB (1:1000) |
Antibody | Anti-Rabbit IgG H&L (goat polyclonal) | Abcam, UK | Cat# ab205718, RRID:AB_2819160 | WB (1:5000) |
Antibody | Anti-Lens Fiber Cell Marker antibody [ZL-1] (mouse monoclonal) | Abcam, UK | Cat# ab185979 | IF (1:100) |
Antibody | Anti-Mouse-555 secondary antibody (donkey polyclonal) | Thermo Fisher Scientific, USA | Cat# A-31570, RRID:AB_2536180 | IF (1:400) |
Sequence-based reagent (H. sapiens) | Human PIKFYVE genotyping fwd | This paper | PCR primer | TTTTGACCTTCTCTTGATTAGAGG |
Sequence-based reagent (H. sapiens) | Human PIKFYVE genotyping rev | This paper | PCR primer | AAATATGGCCTAGTAACCAAAGTTAAA |
Sequence-based reagent (H. sapiens) | Human PIKFYVE cDNA cloning fwd | This paper | PCR primer | ATGGCCACAGATGATAAGAC |
Sequence-based reagent (H. sapiens) | Human PIKFYVE cDNA cloning rev | This paper | PCR primer | TCAGCAATTCAGACCCAAGCCTG |
Sequence-based reagent (H. sapiens) | Human PIKFYVE qPCR fwd | This paper | PCR primer | CGTCCCCAACACTGGACTCTGC |
Sequence-based reagent (H. sapiens) | Human PIKFYVE qPCR rev | This paper | PCR primer | CCCTGGCCTCCTTCTGCTCTCTC |
Sequence-based reagent (H. sapiens) | Human GAPDH qPCR fwd | This paper | PCR primer | CGAGATCCCTCCAAAATCAA |
Sequence-based reagent (H. sapiens) | Human GAPDH qPCR rev | This paper | PCR primer | GTCTTCTGGGTGGCAGTGAT |
Sequence-based reagent (D. rerio) | Zebrafish pikfyve genotyping fwd | This paper | PCR primer | GAGAACCTGCTCAAACTGGTGC |
Sequence-based reagent (D. rerio) | Zebrafish pikfyve genotyping rev | This paper | PCR primer | AGATTTGACCACCATCTCCAGC |
Pedigree and patients
Request a detailed protocolA four-generation pedigree consisting of 31 family members (Figure 1A) was recruited from the eye clinic of Shenzhen Eye Hospital, Shenzhen, Guangdong, China. All the living family members underwent a complete ocular examination. Twelve individuals in this family were diagnosed with congenital cataract (Figure 1B, Table 1), while the other 19 individuals were unaffected. The diagnosis of congenital cataract was based on (1) lens opacity detected at birth or during the first decade of life; and (2) no known other causes (e.g., trauma, iatrogenic, or inflammatory disease) (Berry et al., 2020a). Meanwhile, we also recruited another congenital cataract family, 10 sporadic cases with congenital cataract and 200 patients with age-related cataract or complicated cataract. The ethical protocol in this study was approved by the Independent Ethics Committee of Shenzhen Eye Hospital, in accordance with the tenets of the Declaration of Helsinki (1975). Written informed consent and consent to publish were received from all study participants prior to obtaining the human tissue samples. Samples were de-identified by removing the identifiable individual information such as name and identity number before researching.
Identification of genetic variants in PIKFYVE
Request a detailed protocolWES and Sanger sequencing were used in this study to identify the p.G1943E genetic variant in the congenital cataract family. In brief, DNA was extracted from blood or hair samples from cataract patients. Exome capture was performed using a SureSelect Human All Exon V6 Capture Kit (Agilent Technologies, Santa Clara, CA). WES was performed on four selected family members (II-1, II-5, III-9, and IV-5) of Chinese Korean family. Samples were sequenced on a HiSeq 4000 next-generation sequencing system (Illumina, San Diego, CA). Sequence reads were aligned to the human reference genome (hg19) using the Burrows-Wheeler Aligner (BWA) (Li and Durbin, 2009). Sequence variants were called using the Genome Analysis Toolkit (GATK) with the Best Practices for SNP and Indel discovery in germline DNA (McKenna et al., 2010). The variants were annotated using Annotate Variation (ANNOVAR) (Wang et al., 2010) and then filtered based on the following criteria: (1) nonsynonymous SNPs or indels in the exon region or the splice site region; (2) novel or minor allele frequency <1% in gnomAD; (3) PolyPhen score >0.2; (4) genomic evolutionary rate profiling (GERP) score >2.5; and (5) combined annotation dependent depletion score (CADD) >10. Polymerase chain reaction (PCR) and Sanger sequencing were used to verify the identified mutations from WES and screen the other family members for the mutations. The primer sequences used in PCR and Sanger sequencing were: (1) forward primer: 5′-TTTTGACCTTCTCTTGATTAGAGG-3′ and (2) reverse primer: 5′-AAATATGGCCTAGTAACCAAAGTTAAA-3′.
For another congenital cataract family and 10 sporadic cases with congenital cataract, gene panel testing of ophthalmology (testing of known pathological genes in cataract and PIKFYVE) were used, while for 200 patients with age-related cataract or complicated cataract, fast-target sequencing of PIKFYVE exons were utilized to screen for other potential pathological variants in PIKFYVE. The variants were filtered based on the following criteria: (1) sorting intolerant from tolerant (SIFT) score ≤ 0.05; (2) deleterious annotation of genetic variants using neural networks (DANN) score >0.93; (3) variant effect scoring tool (VEST) score from 0 to 1, the higher score, the more likely mutation might cause a functional change; (4) ClinPred score >0.5; and (5) MutationTaster score >0.5.
Cell culture
Request a detailed protocolThe HLEB3 cells (ATCC CRL-11421) were ordered from ATCC. HEK293T cells were obtained from the Laboratory cell bank of Shenzhen PKU-HKUST Medical Center, which were initially ordered from ATCC by colleagues in HKUST. Cell culture was performed according to the instructions (Andley et al., 1994). The mycoplasma contamination was prevented by examining the integrity of cell nucleus via DAPI staining.
YM201636 treatment
Request a detailed protocolThe HLEB3 cells were plated into six-well plates and grown for 4 days. The cells were then treated with YM201636 (Selleck, China) at a working concentration of 800 nM for 4 hr before imaging. Cells only treated with DMSO were used as control.
Quantitative RT-PCR
Request a detailed protocolAnterior lens capsules from three individuals with cataract were obtained during the surgery. Total RNA was extracted with FastPure Cell/Tissue Total RNA Isolation Kit (RC112-01, Vazyme, China) and subjected to reverse transcription with SuperScript III First-Strand Synthesis System (18080051, Thermo Fisher Scientific, USA). Quantitative RT-PCR was conducted with iTaq Universal SYBR Green Supermix (1725124, Bio-Rad, USA) in CFX96 Real-Time PCR Detection System.
Protein detection by western blot
Request a detailed protocolTransfection of the HEK293T cells was performed with Lipofectamine RNAiMAX Reagent (13778030, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Cells were transfected with 2 µg pCS2(+)-CMV-PIKFYVEWT or pCS2(+)-CMV-PIKFYVEG1943E and harvested after 34 and 44 hr for Western blot analysis. Expression of the housekeeping gene GAPDH was used as the loading control. The ImageJ software (National Institutes of Health, Bethesda, MD, https://imagej.nih.gov/ij/) was used to measure the intensity of the bands and quantify the expression of PIKFYVE protein. The anti-PIKFYVE (ab137907, Abcam, Cambridge, UK), anti-GAPDH (ab9485, Abcam) primary antibodies, and goat anti-rabbit (ab205718, Abcam) secondary antibodies were used in this study.
Zebrafish husbandry
Request a detailed protocolZebrafish were raised and maintained according to the standard protocols (Westerfield, 1993). The WT AB strain, pikfyveΔ8mutants, and transgenic lines including Tg(cryaa:DsRed;il-1b:GFP-F) (Nguyen-Chi et al., 2014), Tg(ubi:PIKFYVEWT), and Tg(ubi:PIKFYVEG1943E) were used in this study.
Generation of zebrafish Pikfyve mutant
Request a detailed protocolThe sgRNA was designed with the online tool Crisprscan (Vejnar et al., 2016). The sgRNA was synthesized by in vitro transcription with the MEGAshortscript T7 Transcription Kit (AM1354, Ambion, Austin, TX) and purified by the MEGAclear Kit (AM1908, Ambion). The sgRNA, together with the Cas9 protein (EnGen Cas9 NLS, S. pyogenes, M0646M, NEB, Ipswich, MA), was injected into zebrafish embryos at one-cell stage. The final concentration was 100 ng/μl for each sgRNA and 800 ng/μl for Cas9 protein. Stable mutant line was screened by the T7 endonuclease 1 (T7E1) digestion and Sanger sequencing.
Generation of transgenic zebrafish lines
Request a detailed protocolThe coding sequence of WT and G1943E variant form of human PIKFYVE was placed downstream of the ubi promoter (Mosimann et al., 2011), which were cloned to a modified PBSK vector containing two arms of Tol2 elements (Kawakami et al., 2000). The plasmid and transposon mRNA were then injected into embryos at one-cell stage. Injected embryos were raised into adulthood and screened for germline transmission by PCR and WISH (Zhang and Liu, 2013) of F1 embryos.
Histology
Request a detailed protocolZebrafish embryos were fixed in 4% paraformaldehyde at 5 dpf and then dehydrated in 30% sucrose. The whole embryos were mounted in optimal cutting temperature compound and frozen in –80°C. Cryo-section was performed at 10 µM intervals in transverse planes from the head. HE staining and antibody staining were conducted according to the standard protocols. ZL-1 antibody (ab185979, Abcam) was used in this study. TEM analysis of the lens was completed by Servicebio Technology (Wuhan, China).
Imaging of zebrafish lens
Request a detailed protocolImages were taken under ZEISS LSM980 Confocal Laser Scanning Microscope (Carl Zeiss Microscopy, NY). The 63× objective (Plan-Apochromat 63×/1.40 Oil DIC M27) was used in this study. For time-lapse imaging experiment, 4-dpf zebrafish was mounted in 1.0% low-melting agarose with 0.02% tricaine. The lens was directly imaged under ZEISS Celldiscoverer 7 microscope (Carl Zeiss Microscopy). A 50× water lens (Plan-Apochromat 50×/1.2) was used and images were taken every 3 min. Images were analyzed by ImageJ (National Institutes of Health).
Detection of endosomes and autophagosomes in zebrafish lens
Request a detailed protocolCoding sequences of rab5c, rab7, or rab11a were fused with GFP sequence and cloned into the pCS2+ vector. mRNAs were synthesized in vitro using the mMESSAGE mMACHINE SP6 Kit (AM1908, Ambion). About 1–2 nl mRNA (100 ng/μl) was injected into zebrafish embryos at one-cell stage. At 3.5 dpf, embryos were mounted in 1% low-melting agarose and imaged under the confocal microscope.
Baf-A1 treatment
Request a detailed protocolBaf-A1 powder (HY-100558, MedChemExpress, NJ) was dissolved to the concentration of 1 mM in DMSO for stock, and diluted to 1 μM in egg water before use. Zebrafish embryos were treated with either 1‰ DMSO or 1 μM Baf-A1 solution at 28.5°C for 4.5 hr and washed out by egg water before confocal imaging.
Statistical analysis
Request a detailed protocolTwo-tailed Student’s t-tests were used for comparisons between two groups. Data were represented as mean ± SD. Statistical significance was shown as n.s., p>0.05, *p<0.05, ***p<0.001, and ****p<0.0001.
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Table 2.
-
Genome Aggregation DatabaseID r2_1. The genetic landscape of crystallins in congenital cataract.
References
-
Propagation and immortalization of human lens epithelial cells in cultureInvestigative Ophthalmology & Visual Science 35:3094–3102.
-
Inherited cataracts: molecular genetics, clinical features, disease mechanisms and novel therapeutic approachesThe British Journal of Ophthalmology 104:1331–1337.https://doi.org/10.1136/bjophthalmol-2019-315282
-
The genetic landscape of crystallins in congenital cataractOrphanet Journal of Rare Diseases 15:333.https://doi.org/10.1186/s13023-020-01613-3
-
Connexin mutants and cataractsFrontiers in Pharmacology 4:43.https://doi.org/10.3389/fphar.2013.00043
-
Crystallins, genes and cataractProgress in Drug Research. Fortschritte Der Arzneimittelforschung 60:205–262.https://doi.org/10.1007/978-3-0348-8012-1_7
-
Active vacuolar H+ ATPase and functional cycle of Rab5 are required for the vacuolation defect triggered by PtdIns(3,5)P2 loss under PIKfyve or Vps34 deficiencyAmerican Journal of Physiology. Cell Physiology 311:C366–C377.https://doi.org/10.1152/ajpcell.00104.2016
-
EPHA2 MUTATIONS CONTRIBUTE TO CONGENITAL CATARACT THROUGH DIVERSE MECHANISMSMolecular Vision 22:18–30.
-
Identification of novel PIKFYVE gene mutations associated with Fleck corneal dystrophyMolecular Vision 21:1093–1100.
-
Membrane potential mediates H(+)-ATPase dependence of “degradative pathway” endosomal fusionThe Journal of Membrane Biology 162:157–167.https://doi.org/10.1007/s002329900353
-
PI5P and PI(3,5)P2: Minor, but Essential PhosphoinositidesCell Structure and Function 42:49–60.https://doi.org/10.1247/csf.17003
-
Localized PtdIns 3,5-P2 synthesis to regulate early endosome dynamics and fusionAmerican Journal of Physiology-Cell Physiology 291:C393–C404.https://doi.org/10.1152/ajpcell.00019.2006
-
A novel mutation (p.Glu1389AspfsX16) of the phosphoinositide kinase, FYVE finger containing gene found in a Japanese patient with fleck corneal dystrophyMolecular Vision 18:2954–2960.
-
Pediatric cataractIndian Journal of Ophthalmology 65:1340–1349.https://doi.org/10.4103/ijo.IJO_1023_17
-
A novel PIKFYVE mutation in fleck corneal dystrophyMolecular Vision 17:2776–2781.
-
Rab GTPase Function in Endosome and Lysosome BiogenesisTrends in Cell Biology 28:957–970.https://doi.org/10.1016/j.tcb.2018.06.007
-
Mutations in PIP5K3 are associated with François-Neetens mouchetée fleck corneal dystrophyAmerican Journal of Human Genetics 77:54–63.https://doi.org/10.1086/431346
-
Molecular genetics of congenital cataractsExperimental Eye Research 191:107872.https://doi.org/10.1016/j.exer.2019.107872
-
Transient infection of the zebrafish notochord with E. coli induces chronic inflammationDisease Models & Mechanisms 7:871–882.https://doi.org/10.1242/dmm.014498
-
A novel mutation of LIM2 causes autosomal dominant membranous cataract in a Chinese familyInternational Journal of Ophthalmology 13:1512–1520.https://doi.org/10.18240/ijo.2020.10.02
-
Sequence and spatial expression of zebrafish (Danio rerio) alphaA-crystallinMolecular Vision 8:45–50.
-
The mammalian phosphatidylinositol 3-phosphate 5-kinase (PIKfyve) regulates endosome-to-TGN retrograde transportJournal of Cell Science 119:3944–3957.https://doi.org/10.1242/jcs.03153
-
CRISPR/Cas9‐Directed Gene Editing for the Generation of Loss‐of‐Function Mutants in High‐Throughput Zebrafish F0 ScreensCurrent Protocols in Molecular Biology 119:31.https://doi.org/10.1002/cpmb.42
-
CHMP4B, a novel gene for autosomal dominant cataracts linked to chromosome 20qAmerican Journal of Human Genetics 81:596–606.https://doi.org/10.1086/519980
-
Mutations and mechanisms in congenital and age-related cataractsExperimental Eye Research 156:95–102.https://doi.org/10.1016/j.exer.2016.06.011
-
PIKfyve: Partners, significance, debates and paradoxesCell Biology International 32:591–604.https://doi.org/10.1016/j.cellbi.2008.01.006
-
Functions of the intermediate filament cytoskeleton in the eye lensThe Journal of Clinical Investigation 119:1837–1848.https://doi.org/10.1172/JCI38277
-
Optimized CRISPR–Cas9 System for Genome Editing in ZebrafishCold Spring Harbor Protocols 2016:prot086850.https://doi.org/10.1101/pdb.prot086850
-
PI(5)P regulates autophagosome biogenesisMolecular Cell 57:219–234.https://doi.org/10.1016/j.molcel.2014.12.007
-
ANNOVAR: functional annotation of genetic variants from high-throughput sequencing dataNucleic Acids Research 38:e164.https://doi.org/10.1093/nar/gkq603
-
BookThe Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Brachydanio RerioEugene: M. Westerfield.
-
Bafilomycin A1, a specific inhibitor of vacuolar-type H(+)-ATPase, inhibits acidification and protein degradation in lysosomes of cultured cellsThe Journal of Biological Chemistry 266:17707–17712.https://doi.org/10.1016/S0021-9258(19)47429-2
-
Mutation screening of crystallin genes in Chinese families with congenital cataractsMolecular Vision 25:427–437.
Decision letter
-
Audrey M BernsteinReviewing Editor; State University of New York Upstate Medical University, United States
-
Mone ZaidiSenior Editor; Icahn School of Medicine at Mount Sinai, United States
In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.
Decision letter after peer review:
Thank you for submitting your article "Mutations in PIKFYVE cause autosomal dominant congenital cataract" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Mone Zaidi as the Senior Editor. The reviewers have opted to remain anonymous.
The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.
Essential revisions:
There were a number of major strengths in the paper. Highlighted below are some essential points of revision in addition to the others listed by the reviewers.
1) A major issue is the replication of these genetic mutations in other cataract patients, even just another small family or a few more sporadic cases. There are many genetic cohorts available for cataract research. The replication would be necessary to establish the significance of the current research.
2) The rescue experiments should be further extended to characterize in detail the impact of PIKFYVE (p.G1943E) mutation (other PIKFYVE kinase domain deletions/mutations) in pikfyve-deficient zebrafish.
Reviewer #1:
Overall, the approaches and methodology used in the work is appropriate and the data are soundly interpreted. This manuscript describes a missense mutation (p.G1943E) in the human phosphoinositide kinase gene, PIKFYVE, in a family with autosomal dominant congenital cataract and examines its role in lens pathology using a zebrafish animal disease model – which is the strength of the work. However, another PIKFYVE mutation (although not in the kinase domain as described in the present work) has been previously linked to cataract in humans. This, along with the lack of assessment of the newly identified PIKFYVE (p.G1943E) mutation or other deletions/point mutations in the kinase domain's ability/inability to rescue lens defects in pikfyve-deficient zebrafish, reduces the overall novelty of these findings. Further, while Baf-A1 treatment is shown to rescue vacuole defects in pikfyve-deficient zebrafish here, certainly an encouraging finding from the therapeutic point of view, it should be noted that Baf-A1 had been previously described to rescue vacuole defects in COS-7 cells. Finally, the abstract/Discussion sections give the impression that Baf-A1 can be generally used in the treatment of congenital cataract – however, this conclusion cannot be drawn broadly because congenital cataract is a multifactorial disease.
Strengths:
The PIKFYVE mutation (p.G1943E) in the kinase domain is novel and it is described in a multi-generational family with autosomal dominant bilateral congenital cataract, with no detected impact on cornea (as previously described PIKFYVE mutations have been linked to corneal dystrophy).
The demonstration that pikfyve-deficient zebrafish exhibit lens defects is novel.
Characterization of vacuoles in pikfyve-deficient zebrafish lens to demonstrate that they are likely amphisomes (that arise from fusion of autophagosome and late endosome) is new.
Weaknesses:
Previously, the PIKFYVE mutation (p.P968Vfs23) in two individuals of a family has been described to develop "early" (albeit not congenital) cataract (PMCID: PMC3209427 – indeed, the authors acknowledge this in Discussion). However, this means that the association of a mutation in the PIKFYVE gene with cataract is not entirely novel. Thus, the novelty here principally lies in the nature of the mutation, i.e. impacting kinase domain, and the nature of the cataract, i.e. congenital cataract.
The rescue experiments should be further extended to characterize in detail the impact of PIKFYVE (p.G1943E) mutation (other PIKFYVE kinase domain deletions/mutations) in pikfyve-deficient zebrafish.
HLEB3 cells are lens epithelial in origin, and there is no discussion on their significance in modeling the defects that appear to be in the fiber cells in the lens. For example, it can be asked, how specific is the vacuole-defect with regards to the use of a particular cell line, i.e. will YM201636 induce this defect in multiple cell lines (as previously described, it does seem to have this effect in COS-7 cells) – and if so, what is the significance of these findings specifically in the context of lens cells.
While it is acknowledged that the following is challenging, identifying multiple families or multiple novel mutations in the PIKFYVE kinase domain (in human or other animal models) will serve to further strengthen the work.
Rescue assays involving the PIKFYVE (p.G1943E) mutation in pikfyve-deficient zebrafish would shed more light on the impact of the mutation. Or alternately, if the PIKFYVE (p.G1943E) mutation rescues the lens defects in pikfyve-deficient zebrafish to similar extents as the wild-type – how would this be interpreted. Similarly, rescue by other (non-kinase domain) mutations of PIKFYVE could be evaluated, this would help to strengthen the case that specific domains of PIKfyve might exert different functions and therefore are associated with different defects.
While Figure 3C, D suggest that pikfyve(delta8) heterozygote mutants exhibit higher number of vacuoles as compared to the wild-type at 5 dpf, it is not clear whether they also exhibit cataract as observed in the human cases.
There is no quantification of vacuoles in HLEB3 cells treated with YM201636 in Figure 3E.
Higher magnification images of Figure 4B, C would help evaluate the pikfyve-deficient lens defects.
Further screening in humans to increase the number/type of independent cases of PIKFYVE mutations (not necessarily PIKFYVE (p.G1943E), since that is established to be rare).
While it is acknowledged that the authors used zebrafish as a model, their claim of haploinsufficiency as the cause of pathology would be further strengthened by studies using multiple animal models. For example, a Pikfyve knockout mouse model have been generated and heterozygous animals have been shown to survive (PMCID: PMC3075686). For example, but not limited to, overexpression of PIKFYVE (p.G1943E) mutation in Pikfyve heterozygous mice could be informative in further discerning the haploinsufficiency vs. dominant negative impact of the mutation in a mammalian model.
Reviewer #2:
This manuscript aimed to determine and characterize the genetic causal factor of autosomal dominant congenital cataract in a large, multi-generational Chinese Korea pedigree. The authors performed whole exome sequencing followed by bioinformatics analysis in three affected and one unaffected individuals and identified a potential pathological non-synonymous variant in the PIKFYVE gene. This novel variant could affect the PIP kinase domain of the protein. The authors demonstrated that heterozygous or homozygous disruption of the PIKFYVE kinase domain, but not the overexpression of PIKFYVE G1943E, in zebrafish led to cataract defect in early stage, suggesting the mechanism of haploinsufficiency rather than dominant-negative inhibition of PIKFYVE activity. The zebrafish model with the loss of PIKFYVE function led to aberrant vacuolation – cataract related phenotype in lens cells. This aberrant vacuolation phenotype could be significantly alleviated by Baf-A1 by inhibiting V-ATPase. The authors have presented strong in vitro and in vivo evidence that mutations in the PIKFYVE kinase domain could lead to congenital cataract. Overall, the same pipeline of in vitro and in vivo genetic approach could be applied to other human genetic disorders.
Strength
This article comes with several strengths. First, the article is written clearly and easy to follow. Second, the experimental design and sample selection for whole exome sequencing is simple and clear. The bioinformatics pipeline is relatively clear, leading to the successful identification of the novel variant. Third, this study presented both in vitro cell culture and in vivo zebrafish-based functional validation to determine the pathological effect on cataract development. Fourth, the transgenic zebrafish model with the loss of kinase activity presented convincing cataract-related clinical phenotype data. Overall, this is a strong study to indicate the potential genetic cause of the identified potential pathological variant in the PIKFYVE gene.
Weakness
Despite the strength of this study, several weaknesses have been noticed as well. First, the authors need to establish the expression of PIKFYVE gene and protein in human lens capsules or lens cells. Second, the potential impact of the identified variant on the PIP kinase domain was mostly based on in silico prediction with protein structure. Additional data could be included to support the potential impact of this novel variant on the kinase activity in vitro. Third, the loss of PIP kinase activity via CRISPR needs to be confirmed using protein/mRNA expression data or kinase activity measurement in vitro. Fourth, the clinical phenotypes of transgenic zebrafish were only examined in early development and could be followed up for longer time past 7-dpf. Five, the identified rare variant has only been reported in one family. It will be more helpful to check whether other similar variants could be present in additional patients with congenital cataract.
1. Please spell the full name of PIKFYVE for the first time on page 3.
2. Please label the missing genotype information for all the individuals in the pedigree in Figure 1.
3. The identified variant should not be called "mutations" simply. The authors should follow the recommendations from ACMG to name the identified variant as "potential pathological variant".
4. It is necessary to validate the gene/protein expression of PIKFYVE in human lens tissue and cells if possible. This is necessary to provide additional support of its role in cataract.
5. Additional work/data is necessary to demonstrate the reduced or affected kinase activity related with the identified variant or the CRISPR-introduced kinase loss in zebrafish.
6, Please double check the manuscript for typos or grammar issues. For example, line 20 "affecting" should be replaced with "is located in".
https://doi.org/10.7554/eLife.71256.sa1Author response
Essential revisions:
There were a number of major strengths in the paper. Highlighted below are some essential points of revision in addition to the others listed by the reviewers.
1) A major issue is the replication of these genetic mutations in other cataract patients, even just another small family or a few more sporadic cases. There are many genetic cohorts available for cataract research. The replication would be necessary to establish the significance of the current research.
As suggested, we screened another congenital cataract family, 10 sporadic cases with congenital cataract and 200 cases of sporadic cataract patients for PIKFYVE variants by exon sequencing. Indeed, 6 affected loci in PIKFYVE from 7 patients were identified and two variants (p.Q1800P and p.A1865V) were found to be located in the PIP kinase domain of PIKFYVE (Figure 2—figure supplement 2 and Figure 2 supplement 2-source data 1). We have included these data in the result of revised manuscript (Line 129-135 on Page 7 and 8). These findings further support that PIKFYVE dysfunction is a causal/risk factor for cataract formation.
2) The rescue experiments should be further extended to characterize in detail the impact of PIKFYVE (p.G1943E) mutation (other PIKFYVE kinase domain deletions/mutations) in pikfyve-deficient zebrafish.
In the revised manuscript, we crossed the Tg(ubi:PIKFYVEG1943E) with pikfyveΔ8 mutants and compared in parallel the rescue effects of wild-type and G1943E variant form of PIKFYVE in the mutants. Although PIKFYVEG1943E could also partially rescue the lens vacuolation defects in pikfyveΔ8 mutants, the rescue effect of PIKFYVEG1943E was less efficient than that of PIKFYVEWT (Figure 3—figure supplement 3). These data have been included in the result of the revised manuscript (Line 172 to 180 on page 9 and 10). Meanwhile, as generation of stable transgenic lines are labor-intensive and time-consuming, to characterize the rescue effects of other PIKFYVE kinase domain deletions/mutations, we tried mRNA injection and utilized PIKFYVEWT as the positive control. Unfortunately, transient injection of PIKFYVEWT failed to rescue the lens vacuolation defects in pikfyveΔ8 mutants (data not shown). Therefore, it is unclear to what extent other PIKFYVE kinase domain deletions/mutations could potentially rescue the pikfyve-deficient zebrafish. However, based on the rescue result of G1943E variant, we anticipate that other deleterious deletions/mutations could either not or less efficiently rescue the lens vacuolation defects in pikfyveΔ8 mutants.
Reviewer #1:
[…]
Rescue assays involving the PIKFYVE (p.G1943E) mutation in pikfyve-deficient zebrafish would shed more light on the impact of the mutation. Or alternately, if the PIKFYVE (p.G1943E) mutation rescues the lens defects in pikfyve-deficient zebrafish to similar extents as the wild-type – how would this be interpreted. Similarly, rescue by other (non-kinase domain) mutations of PIKFYVE could be evaluated, this would help to strengthen the case that specific domains of PIKfyve might exert different functions and therefore are associated with different defects.
Thank reviewer 1# for the kind suggestions and our response to this issue can be found in the second part of Essential Revisions.
While Figure 3C, D suggest that pikfyve(delta8) heterozygote mutants exhibit higher number of vacuoles as compared to the wild-type at 5 dpf, it is not clear whether they also exhibit cataract as observed in the human cases.
In our zebrafish model, the pikfyve homozygous mutant fish show severe defects in lens development, and exhibit cataract phenotype. Meanwhile, the heterozygote fish also exhibit higher number of vacuoles as compared to the wild-type at 5 dpf. However, due to the small shape and limited number of these vacuoles as well as no obvious aggravation at later stages, it seems that these limited vacuoles in pikfyveΔ8 heterozygotes has little effect on the transparency of the lens, which is possibly due to species difference between zebrafish and human. In fact, some human congenital cataract patients with lighter opacity also will not affect the transparency of the lens.
There is no quantification of vacuoles in HLEB3 cells treated with YM201636 in Figure 3E.
We have quantified the number of vacuoles in HLEB3 cells treated with YM201636 or DMSO. These results have been included in Figure 3F.
Higher magnification images of Figure 4B, C would help evaluate the pikfyve-deficient lens defects.
The magnified images have been included in Figure 4B and 4C.
Further screening in humans to increase the number/type of independent cases of PIKFYVE mutations (not necessarily PIKFYVE (p.G1943E), since that is established to be rare).
Thank reviewer 1# for the kind suggestion. Indeed we screened another 200 sporadic cases of cataract patients for other PIKFYVE variants and uncovered two genetic variants, which are located in the PIP kinase domain of PIKFYVE (Figure 2—figure supplement 2 and Figure 2 supplement 2-source data 1). We have included these data in the result of revised manuscript (Line 129-135 on Page 7 and 8). Our response to this issue can also be found in the first part of Essential Revisions.
While it is acknowledged that the authors used zebrafish as a model, their claim of haploinsufficiency as the cause of pathology would be further strengthened by studies using multiple animal models. For example, a Pikfyve knockout mouse model have been generated and heterozygous animals have been shown to survive (PMCID: PMC3075686). For example, but not limited to, overexpression of PIKFYVE (p.G1943E) mutation in Pikfyve heterozygous mice could be informative in further discerning the haploinsufficiency vs. dominant negative impact of the mutation in a mammalian model.
We highly agree with the reviewer’s opinion that the cause of pathology by p.G1943E variant could be further strengthened by studies with multiple animal models. We also thank the reviewer’s advice for the generation of mice model to investigate the pathogenesis of PIKfyve in cataract development. Although the Pikfyve knockout mouse has been reported in previous study and heterozygous animals have been shown to survive, due to the pandemic of COVID-19, it is difficult to import mouse strain from foreign countries to mainland China. On the other hand, generation of Pikfyve-knockout or -overexpressing mouse strains is also time-consuming and technical challenging for us. Therefore, we feel such a pity that we are unable to address the pathogenesis of PIKFYVE p.G1943E variant in mouse model at the moment.
Reviewer #2:
[…]
1. Please spell the full name of PIKFYVE for the first time on page 3.
We have added the full name in the revised manuscript (Line 56-57 on page 3).
2. Please label the missing genotype information for all the individuals in the pedigree in Figure 1.
We have labeled the genotype information in Figure 1.
3. The identified variant should not be called "mutations" simply. The authors should follow the recommendations from ACMG to name the identified variant as "potential pathological variant".
As suggested, we have changed the term “mutations” into “variants” accordingly in the revised manuscript.
4. It is necessary to validate the gene/protein expression of PIKFYVE in human lens tissue and cells if possible. This is necessary to provide additional support of its role in cataract.
We have collected the anterior lens capsules from three individuals with cataract during surgery and conducted quantitative RT-PCR to check PIKFYVE gene expression level. It showed that PIKFYVE was indeed expressed in human lens capsule (Figure 2—figure supplement 1). This data has been included in the result of the revised manuscript (Line 111-114 on page 6 and page 7).
5. Additional work/data is necessary to demonstrate the reduced or affected kinase activity related with the identified variant or the CRISPR-introduced kinase loss in zebrafish.
We fully agree with the reviewer 2#’s opinion that measurement of the kinase activity would help clarify how the variants affect the protein function. Although the method has been developed recently, it is technical-challenging and time-consuming for us to set up this platform. Meanwhile, commercial detection kits are also unavailable. Therefore, we could only make assumptions of the change of kinase activity in PIKFYVE variants based on the in-silico prediction of protein structures at the moment.
6, Please double check the manuscript for typos or grammar issues. For example, line 20 "affecting" should be replaced with "is located in".
We really apologize for the typos or grammar mistakes in the manuscript. We have checked the manuscript thoroughly and revised those typos or grammar mistakes. In particular, we have changed the term “affecting” to “is located” (Line 21 on page 2).
https://doi.org/10.7554/eLife.71256.sa2Article and author information
Author details
Funding
Science, Technology and Innovation Commission of Shenzhen Municipality (GJHZ20180420180937076)
- Jun Zhao
Science, Technology and Innovation Commission of Shenzhen Municipality (JCYJ20180228164400218)
- Jun Zhao
Sanming Project of Medicine in Shenzhen (SZSM201812090)
- Jun Zhao
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
The authors would like to thank all family members who participated in this study. The authors thank Dr. Georges Lutfalla from Institut Pasteur for providing Tg(cryaa:DsRed;il-1b:GFP-F) zebrafish. The authors also thank Dr. Keyu Chen from Shenzhen Bay Laboratory for the structure analysis on PIKFYVE. This study was supported by Science, Technology and Innovation Commission of Shenzhen Municipality Grants (GJHZ 20180420180937076 and JCYJ20180228164400218) and Sanming Project of Medicine in Shenzhen Grant (SZSM201812090).
Ethics
Ethical approval was provided by the Medical Sciences Ethics Committee at Shenzhen Eye Hospital Affiliated to Jinan University, China (No.: 20161103005). The ethical protocol in this study was approved by the Independent Ethics Committee of Shenzhen Eye Hospital, in accordance with the tenets of the Declaration of Helsinki (1975). Written informed consent and consent to publish were received from all study participants prior to obtaining the human tissue samples. Samples were de-identified by removing the identifiable individual information such as name and identity number before researching.
Senior Editor
- Mone Zaidi, Icahn School of Medicine at Mount Sinai, United States
Reviewing Editor
- Audrey M Bernstein, State University of New York Upstate Medical University, United States
Publication history
- Received: June 13, 2021
- Preprint posted: June 26, 2021 (view preprint)
- Accepted: January 3, 2022
- Version of Record published: January 13, 2022 (version 1)
Copyright
© 2022, Mei et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 577
- Page views
-
- 105
- Downloads
-
- 4
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Computational and Systems Biology
- Genetics and Genomics
Cardiometabolic diseases encompass a range of interrelated conditions that arise from underlying metabolic perturbations precipitated by genetic, environmental, and lifestyle factors. While obesity, dyslipidaemia, smoking, and insulin resistance are major risk factors for cardiometabolic diseases, individuals still present in the absence of such traditional risk factors, making it difficult to determine those at greatest risk of disease. Thus, it is crucial to elucidate the genetic, environmental, and molecular underpinnings to better understand, diagnose, and treat cardiometabolic diseases. Much of this information can be garnered using systems genetics, which takes population-based approaches to investigate how genetic variance contributes to complex traits. Despite the important advances made by human genome-wide association studies (GWAS) in this space, corroboration of these findings has been hampered by limitations including the inability to control environmental influence, limited access to pertinent metabolic tissues, and often, poor classification of diseases or phenotypes. A complementary approach to human GWAS is the utilisation of model systems such as genetically diverse mouse panels to study natural genetic and phenotypic variation in a controlled environment. Here, we review mouse genetic reference panels and the opportunities they provide for the study of cardiometabolic diseases and related traits. We discuss how the post-GWAS era has prompted a shift in focus from discovery of novel genetic variants to understanding gene function. Finally, we highlight key advantages and challenges of integrating complementary genetic and multi-omics data from human and mouse populations to advance biological discovery.
-
- Genetics and Genomics
- Medicine
Background: Causality between plasma triglyceride (TG) levels and atherosclerotic cardiovascular disease (ASCVD) risk remains controversial despite more than four decades of study and two recent landmark trials, STRENGTH and REDUCE-IT. Further unclear is the association between TG levels and non-atherosclerotic diseases across organ systems.
Methods: Here, we conducted a phenome-wide, two-sample Mendelian randomization (MR) analysis using inverse-variance weighted (IVW) regression to systematically infer the causal effects of plasma TG levels on 2,600 disease traits in the European ancestry population of UK Biobank. For replication, we externally tested 221 nominally significant associations (p < 0.05) in an independent cohort from FinnGen. To account for potential horizontal pleiotropy and the influence of invalid instrumental variables, we performed sensitivity analyses using MR-Egger regression, weighted median estimator, and MR-PRESSO. Finally, we used multivariable MR controlling for correlated lipid fractions to distinguish the independent effect of plasma TG levels.
Results: Our results identified 7 disease traits reaching Bonferroni-corrected significance in both the discovery (p < 1.92 × 10-5) and replication analyses (p < 2.26 × 10-4), suggesting a causal relationship between plasma TG levels and ASCVDs, including coronary artery disease (OR 1.33, 95% CI 1.24-1.43, p = 2.47 × 10-13). We also identified 12 disease traits that were Bonferroni-significant in the discovery or replication analysis and at least nominally significant in the other analysis (p < 0.05), identifying plasma TG levels as a novel potential risk factor for 9 non-ASCVD diseases, including uterine leiomyoma (OR 1.19, 95% CI 1.10-1.29, p = 1.17 × 10-5).
Conclusions: Taking a phenome-wide, two-sample MR approach, we identified causal associations between plasma TG levels and 19 disease traits across organ systems. Our findings suggest unrealized drug repurposing opportunities or adverse effects related to approved and emerging TG-lowering agents, as well as mechanistic insights for future studies.
Funding: RD is supported by the National Institute of General Medical Sciences of the National Institutes of Health (NIH) (R35-GM124836) and the National Heart, Lung, and Blood Institute of the NIH (R01-HL139865 and R01-HL155915).