A recombinant protein containing influenza viral conserved epitopes and superantigen induces broad-spectrum protection
Abstract
Influenza pandemics pose public health threats annually for lacking vaccine that provides cross-protection against novel and emerging influenza viruses. Combining conserved antigens that induce cross-protective antibody responses with epitopes that activate cross-protective T cell responses might be an attractive strategy for developing a universal vaccine. In this study, we constructed a recombinant protein named NMHC that consists of influenza viral conserved epitopes and a superantigen fragment. NMHC promoted the maturation of bone marrow-derived dendritic cells and induced CD4+ T cells to differentiate into Th1, Th2, and Th17 subtypes. Mice vaccinated with NMHC produced high levels of immunoglobulins that cross-bound to HA fragments from six influenza virus subtypes with high antibody titers. Anti-NMHC serum showed potent hemagglutinin inhibition effects to highly divergent group 1 (H1 subtype) and group 2 (H3 subtype) influenza virus strains. Furthermore, purified anti-NMHC antibodies bound to multiple HAs with high affinities. NMHC vaccination effectively protected mice from infection and lung damage when exposed to two subtypes of H1N1 influenza virus. Moreover, NMHC vaccination elicited CD4+ and CD8+ T cell responses that cleared the virus from infected tissues and prevented virus spread. In conclusion, this study provides proof of concept that NMHC vaccination triggers B and T cell immune responses against multiple influenza virus infections. Therefore, NMHC might be a candidate universal broad-spectrum vaccine for the prevention and treatment of multiple influenza viruses.
Editor's evaluation
The authors provided a new concept for making a universal influenza vaccine by fusing T cell epitopes, B cell epitopes, and superantigen. They conclude that their construct is effective against broad influenza strains, and now the convincing evidence for their conclusion has been provided.
https://doi.org/10.7554/eLife.71725.sa0Introduction
Seasonal influenza viruses infect 5–15% of the global population and kill several hundred thousand people every year despite the availability of antivirals and inactivated tetravalent vaccines, which are effective for most recipients (Ellebedy et al., 2014). As a cluster of RNA viruses, influenza viruses have a segmented genome and error-prone RNA-dependent RNA polymerase, which enables influenza viruses to undergo minor antigenic changes (antigenic drift) and major antigenic changes (antigenic shift) (Wang et al., 2010). This genomic mutability of influenza viruses permits the virus to evade adaptive immune responses. The unpredictable variability of influenza A viruses causes annual epidemics in human populations, and the time-consuming methods used to develop and produce influenza vaccines have resulted in a lack of effective prevention against influenza infection (Lu et al., 2014). Moreover, currently available vaccines induce antibodies against most homologous virus strains, but do not protect against antibody-escape variants of seasonal or novel influenza viruses. Therefore, the development of a novel universal vaccine that induces broad protection against various influenza viruses is urgently required to overcome the problems caused by the annual epidemic of different types of influenza viruses. Conserved proteins or fragments of influenza A virus such as nucleoprotein (NP), matrix protein 2 ectodomain (M2e), and hemagglutinin stem (HA2) (Staneková and Varečková, 2010; El Bakkouri et al., 2011; De Filette et al., 2006), which induce cross-protective immune responses, were reported to be promising antigens for the design of a universal vaccine.
Hemagglutinin is a highly immunogenic surface protein in the influenza virus. Overall, 18 HA subtypes of influenza A viruses have been identified and can be classified into two groups (12 subtypes from group 1 including H1 and H5, and 6 subtypes from group 2 including H3 and H7) based on the phylogenetic relationships of the HA proteins. HA consists of two subunits, a membrane-distal globular domain HA1 and a conserved stalk domain HA2 linked by a single disulfide bond (Wilson et al., 1981). The epitopes of broadly neutralizing antibodies (bnAbs) in HA2 are more conserved across different influenza HA subtypes compared with the antigenic sites in HA1 (Julien et al., 2012; Ellebedy and Ahmed, 2012). The bnAbs induced by HA2 recognize diverse influenza A virus subtypes and prevent fusion of the virus and host cell membranes (Julien et al., 2012). M2, a membrane protein, forms a pH-gated proton channel incorporated into the viral lipid envelope, which is essential for the efficient release of the viral genome during virus entry (Schnell and Chou, 2008). M2e, a 23 amino acid peptide, is highly conserved in influenza A strains and is thought to be a valid and versatile vaccine candidate that can induce heterosubtypic antibody responses against various human influenza strains. NP, a conserved inner antigen of the influenza virus, is required to induce cellular immune responses after natural infection. Furthermore, NP-specific helper T cells augment protective antibody responses and promote B cells to produce HA-specific antibodies (Townsend and Skehel, 1984). Therefore, an effective vaccine against seasonal or pandemic influenza should contain conserved B-cell epitopes that prime the humoral immune system to induce a response that significantly diminishes virus replication immediately after infection, and T cell epitopes that promote cellular immune responses for overall protection (Moltedo et al., 2009; Hermesh et al., 2010).
Bacterial superantigen staphylococcal enterotoxin C2 (SEC2) can directly activate T lymphocytes without the presence of antigen-presenting cells (APCs) and stimulate bone marrow-derived dendritic cells (BMDCs) maturation (Yao et al., 2018b; Dinges et al., 2000). Thus, SEC2 can activate T cells and BMDCs to produce various cytokines such as interleukin-4 (IL-4) and interferon-gamma (IFN-γ). However, very low amounts of SEC2 can induce CD8+ cytotoxic T lymphocytes (CTLs) to specifically kill target cells such as virus-infected cells and tumor cells (Fu et al., 2020; Laidlaw et al., 2013). Furthermore, our previous study reported that SEC2 linked innate immunity and adaptive immunity by activating Toll-like receptor (TLR) downstream signaling molecules including MyD88 and NF-κB, and might be a promising adjuvant for rabies vaccines to provide efficient protection against exposure to the lethal rabies virus. Taken together, we hypothesized that SEC2 has adjuvant or adjuvant-like effects that would improve the protective efficiency of influenza vaccines (Yao et al., 2018a).
We designed a universal influenza vaccine by connecting the conserved fragments of NP (two epitopes of CTL and helper T lymphocytes), M2e, and highly conserved long α-helix regions of HA2 from group 1 (H1) and group 2 (H3 and H7) using a flexible linker (GSAGSAG) to construct a fusion protein NMH as a subunit vaccine (Figure 1A). To enhance the antigenicity of NMH, we fused SEC2 into the C-terminal of NMH to construct a conjugate vaccine NMHC. We evaluated the influenza virus-specific antibody-inducing ability of NMHC using a direct-binding ELISA. Microneutralization-hemagglutination inhibition and cytotoxic lysis assays were performed to evaluate the bnAbs and immunogens induced by NMHC. We also evaluated the universal protective efficiency of NMHC in mice infected with influenza viruses in vivo.

Design, purification, renaturation, and verification of the recombinant protein NMHC.
(A) Phylogenetic tree of the 18 hemagglutinin subtypes of influenza A viruses based on amino acid sequences. Group 1 and group 2 subtypes are listed in red and blue, respectively, and the HAs used in recombinant protein NMHC are listed in green. The amino acid distance scale bar denotes a distance of 0.1. (B) NMH consists of the conserved gene segments of NP, M2e, and HA2, which are connected by linker (GSAGSAG). NMHC consists of NMH and linker followed by SEC2. (C) NMHC, SEC2, and NMH purified and renatured from BL21(DE3) lysate. Lane 1: renatured NMHC; lane 2: marker; lane 3: purified SEC2; lane 4: renatured NMH. (D) The structure of the recombinant protein NMHC about homology modeling. The light blue, light green, and purple portions are NP, M2e, and HA2(H1, H3, H7) fragments, respectively, and red portion fragment is SEC2 domain. (E) Murine splenocytes proliferation induced by NMHC, NMH + SEC2, SEC2, NMH, and PBS were observed at 72 hr. (F) Proliferation index was quantified by MTS assay. Scale bar = 200 μm. Data are represented as mean ± SD (n = 3). *p<0.05, ns, not significant. Source files of the gel used for the qualitative analyses are available in Figure 1—source data 1.
-
Figure 1—source data 1
Source file for the gel data used for the qualitative analyses of NMHC, SEC2, and NMH purified and renatured from BL21(DE3) lysate shown in Figure 1.
This folder contains the original files of the full raw unedited gel (named original gel) and the relevant bands clearly labeled gel (named labeled gel). The information can be found in Figure 1 legend, as well as in Methods.
- https://cdn.elifesciences.org/articles/71725/elife-71725-fig1-data1-v2.zip
Results
Construction, production, and renaturation of recombinant proteins
The recombinant protein NMHC consisted of NMH at the N-terminal and SEC2 at the C-terminal, fused with a flexible linker sequence. To facilitate purification, a carboxyl-terminal His-tag reading frame was retained on the backbone of the expression vector pET-28a (+) (Figure 1B). Recombinant proteins were expressed as inclusion bodies in plasmid-harboring Escherichia coli strains and purified as a major band at 59 kDa (NMHC) and 31 kDa (NMH) by Coomassie blue-stained SDS-PAGE (Figure 1C). After renaturation by dialysis, the soluble recombinant proteins NMHC and NMH were obtained with >95% purity confirmed by SDS-PAGE. The structural modeling of NMHC in silico revealed that the fused NMH was independent of the SEC2 region (Figure 1D), which implied that the domains of NMH and SEC2 would not affect each other. To verify this hypothesis, a splenocyte proliferation assay was performed. As shown in Figure 1E, NMH did not induce proliferation compared with the phosphate buffer saline (PBS)-negative control, whereas SEC2, NMHC, and NMH + SEC2 induced obvious proliferative clusters of murine splenocytes at 72 hr. The MTS result demonstrated that the proliferation index (PI) of the NMHC group was significantly higher than that of the NMH and PBS groups (p<0.05, Figure 1F) and that there was no significant difference in these terms between the SEC2, NMH + SEC2, and NMHC groups.
The biological activity of recombinant proteins in vitro
BMDCs are potent APCs that connect the innate and adaptive immune responses. The maturation of murine BMDCs was evaluated by detecting surface markers including CD80, CD86, and MHC II. CD4+ T cell differentiation mediated by matured BMDCs was evaluated by flow cytometry. As shown in Figure 2A, the expressions of CD80, CD86, and MHC II in the NMHC, NMH + SEC2, SEC2, and NMH groups were significantly increased compared with the PBS control group, which implied that BMDC maturation was induced by these treatments. BMDCs treated with NMHC had significantly increased expressions of CD80, CD86, and MHC II compared with the NMH + SEC2 and SEC2 groups (p<0.05). Furthermore, the expressions of CD80 and CD86 in the NMHC and NMH + SEC2 groups were significantly higher than those in the NMH group (p<0.01), although no statistical difference was noted between the SEC2 and NMH + SEC2 groups (p>0.05). As shown in Figure 2B, mature BMDCs induced by NMHC, SEC2, NMH + SEC2, and NMH significantly promoted CD4+ T cells to express the Th1 cytokine IFN-γ and Th2 cytokine IL-4 compared with the PBS control group (p<0.01), and the NMHC group had higher expressions of IFN-γ, IL-4, and the Th17 cytokine IL-17 compared with the SEC2, NMH + SEC2, and NMH groups (p<0.05 or p<0.01). No statistical difference was noted in the expression of the regulatory T cell cytokine IL-10 between all groups (p>0.05). This result implied that mature BMDCs induced by NMHC promoted CD4+ T cells to differentiate into Th1, Th2, or Th17 cell subtypes but not Treg cells.

The expressions of co-stimulatory molecules CD80, CD86, and MHC II induced by recombinant proteins on BMDCs that inducted CD4+ T cell differentiation in vitro.
(A) BMDCs were treated with NMHC, NMH + SEC2, SEC2, NMH, and PBS as control for 48 hr. Then BMDCs were stained with antibodies to MHC II, CD80, CD86, and analyzed with flow cytometry. (B) Recombinant proteins-treated BMDCs (104) were co-cultured with CD4+ T cells (105) for 96 hr, and CD4+ T cells differentiations were analyzed with flow cytometry. The results were showed with gated percentage. Data are represented as mean ± SD (n = 3). *p<0.05, **p<0.01, ns, not significant.
Murine serum immunoglobulin isotyping elicited by recombinant proteins
Female BALB/c mice were immunized by a prime-boost-boost schedule with 2 weeks intervals. Serum samples were collected on days 14, 28, 42, and 100, and seven isotypes of κ immunoglobulins (accounting for 95% of immunoglobulin subtypes in mice; Pricop et al., 1994) were detected by CBA. As shown in Figure 3, at 100 days post first immunization, IgG2aκ underwent significant changes. There was no statistical change in IgG2aκ in the first 14 days. On day 28, the NMHC, NMH, and NMH + SEC2 groups exhibited significantly enhanced production of IgG2aκ compared with the SEC2 and PBS groups (p<0.05 for NMHC and NMH, and p<0.01 for NMH + SEC2), and the NMH + SEC2 treatment group had the highest level of IgG2aκ. Similar results were observed on day 42, but the highest level of IgG2aκ was in the NMHC group. Over the long term, the production of IgG2aκ returned to normal in all groups at day 100, although the NMHC group exhibited significantly enhanced IgG2aκ production compared with the PBS control group. There was no difference in IgG2aκ between the SEC2 and PBS groups at all time points tested, which suggested that IgG2aκ detected in this study was specifically induced by NMH antigen but not by SEC2. These data demonstrated that the vaccination induced immunogen-boosting IgG2a, which indicated T cell-dependent antibody production and affinity matured antivirus responses (Wang et al., 2010).

Murine serum immunoglobulin isotyping elicited by recombinant proteins.
Sera were taken from immunized mice on days 14, 28, 42, and 100 after immunization, and immunoglobulins were examined by Cytometric Bead Array. (A) Seven clusters of beads represented the immunoglobulins of IgG1κ, IgG2aκ, IgG2bκ, IgG3κ, IgAκ, IgMκ, and IgEκ from top to bottom when detected in FL2 (PE) and FL3 channels (PerCP). (B) The contents of immunoglobulins in different time points were represented by median fluorescence intensity. Data are represented as mean ± SD (n = 3). *p<0.05, **p<0.01, ns, not significant.
Recombinant proteins induced neutralizing antibody in mice
Because stem-directed bnAbs mediated neutralization by inhibiting membrane fusion but not by blocking the virus from binding to receptors on the host cells (Julien et al., 2012), the standard hemagglutinin inhibition assay is not fit for this study (as in Supplementary file 1a, neutralizing antibody was not detected in serum at the lowest dilution of 1:8). To evaluate the titers of neutralizing antibody induced by recombinant proteins, an optimized microneutralization-hemagglutinin inhibition assay was performed as described in Methods. As shown in Figure 4, NMHC, NMH + SEC2, and NMH induced high levels of neutralizing antibody titers after the third immunization, which prevented replication of the Bris/02(H1), Kan/14(H3), MI/45(H1), and HK/4801(H3) viruses compared with SEC2 and PBS. Furthermore, NMHC and NMH + SEC2 exhibited higher titers than NMH. This result suggested that sera from recombinant protein immunized mice had substantial heterosubtypic neutralizing activity, and that the mechanism of protection might be related to inhibiting virus-host cell membrane fusion (Okuno et al., 1994).

Recombinant proteins elicit broadly cross-reactive bnAbs in mice.
Sera were taken from immunized mice on day 42 after immunization, and the neutralization assays were performed against Bris/02(H1) (A), Kan/14(H3) (B), MI/45(H1) (C), and HK/4801(H3) (D) influenza viruses. The titers of each serum sample were defined as the reciprocal of the highest dilution. GMT, geometric mean titer. *p<0.05, **p<0.01, ***p<0.001, ns, not significant.
Recombinant proteins induced binding antibodies to a broad panel of HA subtypes
To determine whether immunization with recombinant proteins induced binding antibodies to a broad panel of HA subtypes, ELISAs were performed with four recombinant HAs and two split virions. As expected, NMHC, NMH + SEC2, and NMH induced high levels of antibodies against various HA subtypes, whereas SEC2 and PBS did not induce any effective antibodies (Figure 5A–F, Supplementary file 1b). NMHC and NMH + SEC2 had greater potency at inducing H3-, H5-, and H7-specific antibodies compared with NMH (Figure 5C–E), and NMHC had a higher induction ability for H1-specific antibodies compared with NMH + SEC2 and NMH (Figure 5A). Moreover, taking the MI/45(H1) and HK/4801(H3) strains as an example, we also measured influenza-specific IgG1 and IgG2a subclasses in antisera, which are essential for understanding B cell somatic hypermutation and subclass switching (Quan et al., 2007). The results showed that NMHC induced higher H1N1-specific IgG1 and IgG2a levels than NMH and NMH + SEC2 (Figure 5G and H), and that NMHC and NMH + SEC2 induced higher H3N2-specific IgG1 and IgG2a levels than NMH (Figure 5I and J), which was consistent with the results of the total IgG (Figure 5A and C). These data indicate that NMHC significantly induced broad binding or neutralizing antibody activity and might confer cross-subtype protection.

Breadth of the antibody response elicited by the recombinant protein was determined by ELISA of the pooled antisera against purified rHA proteins or split virion.
(A–F) Total IgG against (A) H1N1 A/Michigan/45/2015, (B) H2N2 A/Canada/720/2005, (C) H3N2 A/Hong Kong/4801/2014, (D) H5N1 A/Hubei/1/2010, (E) H7N9 A/Shanghai/2/2013, (F) H9N7 A/Hong Kong/35820/2009. (G–J) IgG1 or IgG2a specific against split virion of influenza viruses. (G) IgG1 specific against H1N1 A/Michigan/45/2015, (H) IgG2a specific against H1N1 A/Michigan/45/2015, (I) IgG1 specific against H3N2 A/Hong Kong/4801/2014, and (J) IgG2a specific against H3N2 A/Hong Kong/4801/2014.
NMHC induced antibodies with high binding affinity to various HAs
We purified the serum antibodies and evaluated their ability to form a stable complex with the NMH antigen. The results of pull-down assays showed that antibodies purified from NMHC, NMH + SEC2, and NMH antisera, but not from SEC2 and PBS antisera, bound to and pulled down NMH antigen (Figure 6—figure supplement 1). Subsequently, SPR experiments were performed to quantify the binding affinities of antibodies purified from anti-NMHC sera. NMHC-induced Abs displayed potent binding affinity to H1, H2, H3, and H5 fragments with KD values of 98, 73.9, 685, and 72.9 nM, respectively (Figure 6). This result suggests that immunization with NMHC elicited broadly cross-reactive protection against various influenza viruses.

Affinities of HAs to antibodies purified from anti-NMHC sera.
The overlays of binding kinetics of the HAs at different concentrations and the affinity of KD values determined with Biacore were shown. (A) Split virion of H1N1 A/Michigan/45/2015, (B) H2N2 A/Canada/720/2005, (C) split virion of H3N2 A/Hong Kong/4801/2014, and (D) H5N1 A/Hubei/1/2010. The KD values were calculated using a steady affinity state model by the Biacore T200 evaluation software (version 3.1). Source files of the overlays of binding kinetics used for the affinity analyses are available in Figure 6—source data 1.
-
Figure 6—source data 1
Source file for affinities data shown in Figure 6.
This folder contains the overlays of binding kinetics of antibodies to HAs (HA of H1, H2, H3, and H5) at different concentrations were detected with Biacore (individual files are named ‘the binding kinetics of antibodies to H1.txt,’ ‘the binding kinetics of antibodies to H2.txt,’ ‘the binding kinetics of antibodies to H3.txt,’ ‘the binding kinetics of antibodies to H5.txt’). The detection processes are contained in Methods.
- https://cdn.elifesciences.org/articles/71725/elife-71725-fig6-data1-v2.zip
Recombinant proteins induced ASC responses
ELISpot assays were performed to measure antigen-specific B-cell responses induced by recombinant proteins (Figure 7A). Of note, H1N1 and H3N2 viruses were components of the seasonal vaccines for the 1978–2020 influenza seasons. First, we determined the kinetics of H1N1- and H3N2-specific ASCs in pre- and post-immunized mice (Figure 7B and C). The responses indicated a positive correlation with vaccination time and peaked at day 42. At the peak of the response, the frequencies of NMH-, H1N1-, and H3N2-specific ASCs were significantly higher in the NMHC, NMH + SEC2, and NMH immunized groups than in the SEC2 and PBS-treated groups (p<0.01, Figure 7D–F), and there was no statistical difference between the SEC2 and PBS groups (p>0.05). Moreover, at the peak, the frequencies of NMH-, H1N1-, and H3N2-specific ASCs induced by NMHC were 73 ± 5.2, 48 ± 5.7, and 64 ± 2.1 per million, respectively, which were approximately 1.5-fold higher than the frequencies of those induced by NMH (p<0.05, Figure 7D–F). Of note, NHMC immunization induced higher frequencies of H1N1- and H3N2-specific ASCs compared with NMH + SEC2 immunization (p<0.05, Figure 7E and F). Interestingly, in comparison with the prime vaccination, we observed a large increase in the frequency of anti-H1N1 and H3N2 ASCs at day 100 in the NMHC-immunized group (Figure 7B and C), suggesting that NMHC induces cross-reactive memory B cells after the third immunization (Purtha et al., 2011). In summary, NMHC effectively induced antigen-specific B-cell responses and elicited serological memory that might be maintained by long-lived antibody-secreting plasma cells and reinforced by memory B cells, which can rapidly differentiate into antibody-secreting cells (ASCs) when re-exposed to the specific antigen.

The specific antibody-secreting cells’ (ASC) response to H1N1, H3N2, and NMH was measured with ELISpot assay.
Splenocytes were isolated and collected from immunized mice on days 14, 28, 42, and 100. The cells were added in ELISpot wells, which coated with the NHM proteins, H1N1 or H3N2 influenza viruses. (A) Each spot in the well represents an ASC. (B, C) The frequency of H1N1 and H3N2-specific ASC on days 0, 14, 28, 42, and 100. (D–F) Specific ASCs’ response to NMH, H1N1, and H3N2 influenza viruses the frequency of NMH-, H1N1-, and H3N2-specific ASC on day 42. Data are represented as mean ± SD (n = 3). *p<0.05, **p<0.01, ***p<0.001, ns, not significant.
Recombinant proteins induced T cell responses
We studied the vaccine-induced CD4+ and CD8+ T cell immune responses, which are potent mediators of heterosubtypic immunity against different influenza viruses. Because IFN-γ and IL-4 are typically produced by Th1 and Th2 cells, respectively (Yao et al., 2018a), ELISpot assays were performed to measure IFN-γ or IL-4-secreting cells induced by recombinant protein immunization. Immunization with NMHC and NMH + SEC2 significantly induced the upregulation of IFN-γ or IL-4-producing splenocytes (p<0.01 compared with the PBS group; Figure 8A), and there was no statistical difference compared with the SEC2 group (p>0.05). Furthermore, immunization with NMH alone did not induce any cytokine-producing splenocytes compared with the PBS group (p>0.05). In addition, IFN-γ and IL-4 as well as the Th1- and Th2-specific transcription factors T-bet and GATA3, respectively, were quantified by qPCR. The results were consistent with those from the ELISpot assay where NMHC, NMH + SEC2, and SEC2 significantly induced the upregulation of IFN-γ and IL-4 transcription compared with NMH alone and PBS (p<0.05). Similar changes were found for the T-bet and GATA3 transcription factors. To verify the antigen-specific T cell responses, we detected IL-4 and IFN-γ cytokine production after stimulating splenocytes from post-immunized mice with 1000 ng/mL NMH or 1000 ng/mL SEC2. Splenocytes from the NMHC, NMH + SEC2, and NMH immunized groups treated with NMH produced significantly higher levels of IL-4 and IFN-γ than with CK treatment (p<0.05). No significant changes were observed in the SEC2 and PBS immunized groups. This result indicated that the T cell responses induced by NMH treatment were influenza antigen-specific. However, splenocytes from all immunized groups produced high levels of IL-4 and IFN-γ after SEC2 treatment in vitro, and there were no significant differences between the five immunized groups. As a superantigen, SEC2 induced nonspecific T cell responses, leading to the massive production of cytokines. Taken together, NMHC immunization activated Th1 and Th2 cells, which are necessary for immune responses to clear virus infection.

Recombinant proteins induced CD4+ T cell responses.
(A) Splenocytes isolated from immunized mice in each group on days 42 were plated in ELISpot wells to detected IFN-γ and IL-4 cytokine-producing cells. (B) The mRNA levels of IFN-γ, IL-4, T-bet, and GATA3 were measured by qPCR. (C) IL-4 and IFN-γ produced by splenocytes treated with NMH and SEC2 respectively in vitro were detected by ELISA. PBS was served as CK. Results are expressed as the mean value ± SD (n = 3). *p<0.05, **p<0.01, ns, not significant.
The cytotoxic effects of CD8+ T cells are important for clearing virus-infected cells, and thus have important roles in the efficient control of influenza virus spread (Yao et al., 2018a). To assess whether the recombinant vaccines could augment antigen-specific CD8+ T cell responses, equal numbers of CFSEhigh target cells and CFSElow non-target control cells were mixed and injected intravenously into recipient mice for 12 hr and specific CTL were examined in vivo. First, we noted that Alexa Fluor 488-labeled NMH antigens were internalized into splenocytes isolated from naïve mice detected by LSCM (Figure 9A). Second, target cells and control cells were easily distinguished when labeled with 10 μM or 1 μM of CFSE, and the fluorescence intensity of the former was higher than the latter (Figure 9B). These results indicate that the relative number of residual target cells (CFSEhigh) isolated from recipient mice immunized with NMHC and NMH + SEC2 was markedly reduced compared with those immunized with NMH, SEC2, or PBS (p<0.01; Figure 9C). Furthermore, NMHC significantly induced perforin and granzyme expression at the transcription level, which also confirmed that NMHC induced strong antigen-specific cytotoxic responses (Figure 9D).

Effects of the recombinant protein NMHC on CD8+ T cell responses.
(A) To verify that NMH antigens can be effectively internalized into splenocytes, splenocytes from naïve BALB/c mice were co-cultured with Alexa Fluor 488-labeled NMH or NMH alone and detected by fluorescent inverted microscope. (B) Then, fresh isolated naïve splenocytes were divided into two parts. One part was pulsed with 5 μg/mL NMH, labeled with 10 μM of CFSE and termed as CFSE high target cells, the other part was loaded with BSA, labeled with 1 μM of CFSE and termed as CFSE low control cells, both of them detected by fluorescent inverted microscope and flow cytometry. (C) The equal number of two parts cells was mixed and injected into recipient mice. 12 hr later, the splenocytes from these mice were collected to examine the antigen-specific cytolytic responses. (D) The mRNA levels of perforin and granzyme of recipient mice were examined by qPCR. Statistical analyses were performed using Student’s t-test and one-way ANOVA. *p<0.05, **p<0.01, ***p<0.001, ns, not significant.
Immunized with recombinant proteins provide in vivo protection against influenza virus challenge
To evaluate whether the recombinant protein immunization conferred cross-strain protection, mice were challenged with virus strains of Bris/02(H1) or MI/45(H1) 2 weeks after the third immunization. At 6 days post-infection, the qPCR analysis of the lung tissues demonstrated that the mice immunized with NMHC exhibited up to a 4 log reduction in viral HA gene copy number compared with the PBS-treated groups (Figure 10A and B). Mice immunized with NMH + SEC2 showed similar results. During the challenge experiment, only PBS-treated groups had a reversible loss of body weight (Figure 10C and D). Histopathological analysis demonstrated no visible pathological changes in the lungs of NMHC-immunized mice at 6 days post-infection, whereas the PBS control group exhibited severe alveolar damage and interstitial inflammatory infiltration (Figure 10E and F).

Challenge test in BALB/c mice.
Mice (n = 12 per group in two separate experiments) were infected intranasally with 103 TCID50 of Bris/02(H1) or MI/45(H1) influenza viruses after 14 days of the third Immunization. (A, B) Viral copy number of Bris/02(H1) and MI/45(H1) in the lungs at days 3 and 6 post-infection was determined using qPCR. (C, D) Weight changes (%) were monitored for 14 days post-challenge. (E, F) Histopathology in pulmonary tissue (scale bar = 50 μm). Naïve mice that were untreated and unchallenged were used as the control.
We examined the lymphocyte infiltration in the lungs of mice by immunohistochemistry (IHC) to evaluate the inflammatory damage caused by influenza virus infection. As expected, the leukocyte common antigen CD45 was widely detected in the lung sections of PBS-treated mice but not in naïve mice without infection (p<0.05 for Bris/02(H1) and p<0.01 for MI/45(H1), Figure 11). Immunization with NMHC before influenza virus infection significantly decreased the intensities of lung-infiltrated CD45 leukocytes compared with PBS treatment (Figure 11B and C), indicating a reduction in inflammatory damage in the lungs.

The profile analysis of lung-infiltrating leukocytes in lung frozen sections of infected mice treated with NMHC.
(A) Lung-infiltrating leukocytes were analyzed by IHC of CD45. (B, C) The quantification of the relative infiltration intensity of biomarkers by normalizing the positive signals of the treated groups to those of the naïve group. Error bars denote mean ± SD. **p<0.01. Scale bar = 50 μm.
Furthermore, immunofluorescence analysis of lung sections with fluorescence Abs against the influenza nucleoprotein, macrophage common antigen (F4/80), and CD8 was performed to evaluate the distribution of influenza viruses, lung-infiltrating macrophages, and lung- infiltrating CD8+ CTLs (Figure 12A). As shown in Figure 12B and C, on day 6 after infection, strong pink fluorescence signals representing influenza nucleoprotein were detected in the lungs of PBS-treated mice, which indicated the extensive distribution of influenza viruses. In addition, the relative fluorescence intensities of influenza nucleoprotein in the lungs of NMHC vaccinated mice were 4.5-fold (Bris/02(H1)) and 2.5-fold (MI/45(H1)) weaker than those in the PBS-treated mice. In both infection models, NMHC immunization induced a significantly enhanced distribution of CD8+ CTLs in the lungs compared with the PBS control groups (p<0.01), which was consistent with the results of the CTL assay. After influenza virus infection, high levels of CD8+ CTLs in the lungs led to the effective clearance of virus-infected cells, which contributed to the low virus loads indicated by the nucleoprotein fluorescence signals. In contrast, the intensities of macrophagocyte staining were significantly higher in PBS-treated mice than in naïve and NMHC-immunized mice (p<0.05), which might be attributable to the increased inflammation and delayed viral clearance in PBS-treated mice (Valkenburg et al., 2014). This result demonstrated that immunization with NMHC provided robust protection against heterologous virus challenge in vivo.

Immunofluorescence analysis of lungs frozen sections at day 6 after infection.
(A) Distribution of influenza viruses (pink for NP), lung-infiltrating CD8+ T cells (red for CD8), and lung-infiltrating macrophages (green for F4/80). (B, C) The relative quantification of fluorescence intensity of NP, CD8, and F4/80. The relative fluorescence intensities were quantified by normalizing the fluorescent signals of the treated groups to those of the naïve group. Error bars denote mean ± SD. Scale bar = 200 μm, *p<0.05, **p<0.01, ***p<0.001.
Discussion
In this study, we constructed a recombination protein, NMHC, as a pilot study to develop a novel universal influenza vaccine. NMHC consists of two domains, an NMH domain as a universal immunogen and an SEC2 domain as an adjuvant-like molecular chaperone, fused by a flexible peptide linker. Both domains do not require post-translational modification; therefore, NMHC can be conveniently produced using an E. coli expression system. Here, we studied humoral immune responses mediated by NMHC that were involved in anti-influenza immune defense together with the contribution of cellular immunity. Our in vivo study showed that NMHC promoted B cells to differentiate into NMH-, H1N1-, and H3N2-specific ASCs or memory cells involved in humoral immune responses. NMHC induced the secretion of IgG2a and IgM, but not IgE, as the number of immunizations increased, and the antibody concentration reached a peak after the third immunization. During Th1-type immune responses, IgG2a mediates the clearance of virus and provides protection against influenza infection (Valkenburg et al., 2014). IgM is involved in the initial humoral immune response and IgE is associated with type I hypersensitivity. As expected, antiserum from NMHC-immunized mice specifically neutralized H1N1 and H3N2, preventing the viruses from replicating in MDCK cells (Figure 4). In this experiment, virus suppression by antiserum was only detected when using the MN-HI assay, but not the HI assay. A reason for this might be that stem-specific antibodies did not bind to the head region of hemagglutinin, the receptor binding site (RBS) of the influenza virus that targets cells, and therefore, did not prevent red blood cell aggregation induced by the virus (He et al., 2015; van der Lubbe et al., 2018). However, stem-specific antibodies could bind to the non-receptor binding region of HA to prevent influenza virus from fusing into the endosomal membrane by interfering with the conformational change of HA induced by a low pH, even if influenza virus had attached to the receptor and infected cells via receptor-mediated endocytosis (Figure 13; Imai et al., 1998). This procedure prevented the release of the ribonucleoprotein complex into the target cell and led to the inhibition of viral replication, so the small number of viruses could not induce red blood cell aggregation, which is directly detected by the HI assay. Next, to determine whether the antibody induced by NMHC had broad heterosubtypic binding or neutralization activity against diverse influenza A strains, we detected the binding ability of anti-NMHC sera to different HAs from group 1 (H1, H2, H5, H9) and group 2 (H3, H7) by ELISA. As expected, antiserum from NMHC-immunized mice showed a broad pattern of binding to these HA fragments with high antibody titers. Although only six types of HA were available in our experiment, we believed that the anti-NMHC serum might bind to other HA subtypes. Furthermore, the SPR assay indicated that antibodies purified from anti-NMHC serum had high binding affinities to the HAs of H1, H2, and H5, and moderate affinity to H3. Because the H3 fragment used in this study was from a split virion of H3N2 but not a commercially purified full-length fragment, we think that this relatively low affinity of antibodies to H3 might be related to the impurity of the H3 fragment. These results indicated that the antibody induced by NMHC vaccination could bind to and neutralize different influenza viruses with a high affinity and effectively prevented virus replication in target cells.
Regarding cellular immune responses, we found that NMHC promoted T lymphocyte proliferation and enhanced the functions of CD4+ and CD8+ T cells, respectively. CD4+ T cells can differentiate into Th1 and Th2 cells that have critical roles in immune responses including clearing virus infection and regulating immunoglobulin isotype switching (Snapper and Mond, 1993). Th1 cells enhance IgG2a switching by secreting IFN-γ, and Th2 cells enhance IgG1 switching by secreting IL-4. IgG2a was reported to be more effective at resisting virus infection than IgG1 (Yendo et al., 2016). CD8+ T cells enhance antiviral responses by promoting the destruction of virus-infected cells through perforin and granzyme released by CTLs. Our results indicated that immunization with NMHC significantly enhanced Th1 and Th2 immune cell responses, specifically an increase in the differentiation of IFN-γ and IL-4-producing cells and antigen-specific cytokine expression. In addition, antigen-specific CTL responses were also elevated significantly, as shown by the in vivo CTL assay, where target cells ‘infected’ with NMH, but not control cells ‘infected’ with BSA, were killed in NMHC-immunized mice. In addition, the transcription of the immune effector molecules, perforin, and granzyme was also increased.
As expected, NMHC induced the proliferation of murine splenocytes, indicating that the recombinant protein NMHC maintained the superantigen activity of SEC2. Furthermore, NMHC significantly promoted the maturation of BMDCs and increased the expressions of the co-stimulatory molecules CD80 and CD86, as well as MHC II in vitro. This effect of NMHC might be attributable to the combined effect of the NMH and SEC2 domains in the fusion protein because CD80 and CD86 expressions in BMDCs induced by NMHC were significantly higher than those induced by SEC2, NMH, and NMH + SEC2. Mature BMDCs promoted CD4+ T cells to differentiate into Th1, Th2, and Th17 subtypes as represented by IFN-γ, IL-4, and IL-17A production. Compared with NMH and NMH + SEC2, NMHC had an adjuvant-like activity associated with the fused SEC2 domain, which regulated adaptive immune responses and augmented the immunogenicity of the NMH domain. The structural modeling of NMHC in silico demonstrated that the fused SEC2 was independent of the NMH region, which allowed immune cells to recognize components of the antigenic determinants and induce specific immune responses. Limited by laboratory biosafety, we only used two attenuated strains of H1N1 separated by different times and places, but not other virulent pathogenic strains, in the mouse challenge experiment. Immunization with NMHC protected mice against infection by either of the two virus strains as demonstrated by the decreased number of viruses and reduction of inflammatory infiltration in the lungs. Although immunization with NMH + SEC2 achieved similar results to NMHC by reducing the number of virus particles in the lungs, we think that NMHC is preferable to NMH + SEC2 when the comprehensive effects of humoral immunity and cellular immunity, as well as the convenience of future applications, are considered.
In summary (Figure 13), the recombinant protein NMHC promoted B and T cell immune responses against influenza virus infection. The SEC2 domain of NMHC promoted DC maturation through the TLR/NF-κB signaling pathway (Yao et al., 2018b), and matured DCs presented antigens of the NMH domain to CD4+ T cells via MHC II and to CD8+ T cells via MHC I. This process led to the activation, proliferation, and differentiation of antigen-specific CD4+ T cells and CD8+ T cells. Activated antigen-specific CD4+ T cells then differentiated into IL-17A-producing Th17 cells, IFN-γ-producing Th1 cells, and IL-4-producing Th2 cells. Th1 and Th2 cells help B cells secrete HA2-specific antibodies that bind to the HA2 of the influenza virus and block the fusion of virus and the endosomal membranes of target cells to prevent release of the ribonucleoprotein complex into the cytoplasm of the target cells. In addition, Th1 cells promoted the differentiation of activated antigen-specific CD8+ T cells into CTL effector cells that specifically kill virus-infected cells by the exocytosis of cytolytic granules such as perforin and granzymes. Our findings suggest an innovative potential clinical strategy for influenza immunization. We propose the recombinant protein NMHC be a candidate universal broad-spectrum vaccine for the prevention and treatment of various influenza virus strains.
Materials and methods
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Escherichia coli) | BL21(DE3) | Abcam | Cat: 69450-3 | Competent cells |
Strain, strain background (influenza virus) | H1N1 A/Michigan/45/2015 | Chengda Biotechnology | Released by the WHO | |
Strain, strain background (influenza virus) | H1N1 A/Brisbane/02/2018 | Chengda Biotechnology | Released by the WHO | |
Strain, strain background (influenza virus) | H3N2 A/Kansas/14/2017 | Chengda Biotechnology | Released by the WHO | |
Strain, strain background (influenza virus) | H3N2 A/Hong Kong/4801/2014-like | Chengda Biotechnology | Released by the WHO | |
Biological sample (influenza virus) | H3N2 A/Hong Kong/4801/2014 | Chengda Biotechnology | Released by the WHO | |
Antibody | MHC II (rabbit monoclonal) | BioLegend | Clone: M5/114.15.2 | 1 μg/100 μL |
Antibody | IFN-γ (rabbit monoclonal) | BioLegend | Clone: XMG1.2;cat: 505806 | 1 μg/100 μL |
Antibody | CD80 (Armenian hamster monoclonal) | BD Biosciences | Clone: 16-10A1;cat: 553769 | 1 μg/100 μL |
Antibody | CD86 (rabbit monoclonal) | BD Biosciences | Clone: GL1;cat: 561962 | 1 μg/100 μL |
Antibody | IL-17A (rabbit monoclonal) | BioLegend | Clone: TC11-18H10.1;cat: 506907 | 1 μg/100 μL |
Antibody | IL-10 (rabbit monoclonal) | BioLegend | Clone: JES5-16E3;cat: 505005 | 1 μg/100 μL |
Antibody | IL-4 (rabbit monoclonal) | BD Biosciences | Clone: H129.19;cat: 553650 | 1 μg/100 μL |
Antibody | CD11c (Armenian hamster monoclonal) | BD Biosciences | Clone: HL3;cat: 550261 | 1 μg/100 μL |
Antibody | IgG(H + L) (goat polyclonal) | Immunoway | Cat: RS0007 | 1:10,000 |
Antibody | NP (rabbit polyclonal) | Sino Biological | Cat: 11675-T62 | 1:500 |
Peptide, recombinant protein | HA of H2N2A/Canada/720/2005 | Sino Biological | Cat: 11688-V08H | |
Peptide, recombinant protein | HA of H5N1 A/Hubei/1/2010 | Sino Biological | Cat: 40015-V08H | |
Peptide, recombinant protein | HA of H7N9A/Shanghai/2/2013 | Sino Biological | Cat: 40239-V08B | |
Peptide, recombinant protein | HA of H9N2 497A/HongKong/35820/2009 | Sino Biological | Cat: 40174-V08B | |
Commercial assay or kit | Beaver Beads Protein A/G antibody Purification Kit | Beaver | Cat: 20102-1 | |
Commercial assay or kit | Cytometric Bead Array (CBA) Mouse Immunoglobulin Isotyping Kit | GE HealthCare | Cat: 550,026 | |
Commercial assay or kit | Mouse IL-4 ELISpot PLUS (ALP) | MabTech | Cat: 3311-4APW-2 | |
Commercial assay or kit | Mouse IFN-gamma ELISpot PLUS (ALP) | MabTech | Cat: 3321-4APT-2 | |
Software | GraphPad Prism | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | Version 8.0.0 |
Software | ImageJ | ImageJ (http://imagej.nih.gov/ij/) | RRID:SCR_003070 | Version 2.0.0 |
Software | FlowJo | FlowJo (https://www.flowjo.com/) | RRID:SCR_008520 | Version 10 |
Other | Sensor Chip CM5 | GE HealthCare | Cat: BR100530 |
Animals
Female BALB/c mice (4–6 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd (Beijing, China) and maintained under specific pathogen-free conditions. Feed and water were supplied ad libitum. All animal procedures were performed in accordance with Institutional Animal Care and Use Committee (IACUC) guidelines and have been approved by the IACUC of University of Chinese Academy of Sciences.
Construction and production of recombinant NMH and NMHC proteins
Request a detailed protocolThe recombinant protein NMH consists of two fragments of NP (335-350aa, 380-393aa) (Ben-Yedidia et al., 1999), two copies of M2e (Feng et al., 2006), and three tandem fragments of HA2 (76-130aa from H1N1 A/California/04/2009, H3N2 A/Hong Kong/1/1968, and H7N7 A/Netherlands/219/2003) (Wang et al., 2010). NMHC consists of NMH at the amino terminal followed by SEC2 sequence (Xu et al., 2008) at the carboxyl terminal. A flexible linker peptide sequence (GSAGSAG) was designed between each component to avoid any stereo-hindrance effect. Then, the encoding DNA fragment of NMH was optimized according to the codon preference of E. coli and synthesized by Sangon Biotech (Shanghai, China), while the DNA fragment of NMHC was constructed via overlap polymerase chain reaction. The encoding DNA fragment were ligated into the expression vectors pET-28a (+) plasmid and transformed into E. coli BL21(DE3), and the positive clones were verified by DNA sequencing. Vector-containing E. coli strains were cultured in (Luria–Bertani) medium, and protein expression was induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside at 30°C for 8 hr. Cells were harvested and disrupted by sonication on ice bath, then supernatants and precipitates were isolated by centrifugation at 21,000 g for 15 min. SDS-PAGE electrophoresis results show that the expressed NMH and NMHC proteins were both inclusion bodies. The method of protein purification and refolding was modified from previously reported (Lu et al., 2014; Song et al., 2020). The insoluble inclusion bodies were resuspended with washing buffer (2 M urea, 50 mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, pH 8.0), followed by centrifugation at 21,000 g for 15 min. This washing step was repeated twice before the washed inclusion bodies were solubilized in a denaturation buffer (8 M urea, 100 mM NaH2PO4, 10 mM Tris-HCl, 20 mM imidazole, 1 mM DTT, pH 8.0) by votex-shaking at room temperature for 30 min. The supernatant was collected by centrifugation at 21,000 g for 15 min. The protein was purified by the Ni-saturated chelating sepharose affinity chromatography with the AKTA Fast Protein Liquid Chromatography System, eluting with a denaturation elution buffer (8 M urea, 100 mM NaH2PO4, 10 mM Tris-HCl, 250 mM imidazole, 1 mM DTT, pH 8.0). To refold the elution fractions, dialysis refolding method was used. The refolding buffer was PBS adding 0.5 M arginine, 0.2 mM oxidized glutathione, 1 mM reduced glutathione, and 4 mM EDTA supplement with 6 M, 3 M, 1.5 M, 0.75 M, and 0 M urea, respectively. The purified protein was refolded with step-wise dialysis proceeding from 6 M to 0 M urea following exchanging the refolding buffer three times with PBS.
Recombinant protein-mediated splenocytes proliferation assay
Request a detailed protocolMurine splenocytes were obtained from healthy BALB/c mice under aseptic condition as described in our previous report and maintained in RPMI 1640 medium containing 10% FBS. The freshly isolated murine splenocytes were seeded in 96-well flat-bottomed plates at 1 × 106 cells/well and stimulated for 72 hr with 3.5 μM NMHC, 3.5 μM NMH, 3.5 μM SEC2, and 3.5 μM NMH plus 3.5 μM SEC2, respectively, using PBS as negative controls. Cell proliferation was determined by MTS assay, and the PI was calculated as described previously (Zhang et al., 2016).
Recombinant protein-mediated BMDCs maturation and CD4+ T cell differentiation assay
Request a detailed protocolMurine BMDCs were prepared as previously described (Yao et al., 2018b). Briefly, mice were sacrificed by intraperitoneal administration of tribromoethanol (400 mg/kg body weight), and the femur and tibia of the hind legs were dissected, then bone marrow cavities were flushed with 10 mL cold sterile PBS. After lysing red blood cells, the bone marrow cells were cultured and differentiated into BMDCs in RMPI-1640 with 10% FBS, 20 ng/mL rmGM-CSF, 10 ng/mL rmIL-4, 100 μg/mL streptomycin, and 100 U/mL penicillin. Six days later, the purity of CD11c+ cells was >90% as determined by flow cytometry. Then, BMDCs were simulated for 24 hr with 3.5 μM NMH, 3.5 μM NMHC, 3.5 μM NMH plus 3.5 μM SEC2, and 3.5 μM SEC2, respectively, using PBS as negative control. The maturation of BMDCs was evaluated through detecting the cell surface markers including CD80, CD86, and MHC II with fluorescent labeled antibodies, respectively, followed by analyzing in a FACScalibur flow cytometer.
CD4+ T cells were sorted from freshly isolated murine splenocytes by immunomagnetic beads. For Th cells differentiation assay, the matured BMDCs were co-cultured with CD4+ T cells at a ratio of 104:105 for 96 hr. Cells were fixed and permeabilized with Transcription Factor Buffer Set according to the manufacturer’s instructions. Then cells were intracellular stained with fluorescent labeled antibodies against IL-4 (for Th2 subtype), IFN-γ (for Th1 subtype), IL-17A (for Th17 subtype), and IL-10 (for Treg subtype), respectively. The percentages of helper T cell subtypes were determined by flow cytometric.
Animal immunization
Request a detailed protocolFemale wild-type BALB/c mice were respectively immunized with an equimolar of NMHC (200 μg), NMH (100 μg), SEC2 (100 μg), NMH (100 μg) plus SEC2 (100 μg) and PBS (control) by intraperitoneal administration at days 0 (prime), 14 (boost), and 28 (boost). Serum samples were collected on days 14, 28, 42, and 100 and kept at –80°C until use. Splenocytes were harvested at day 14 after the last immunization for ELISpot assays and flow cytometric analysis.
Mouse immunoglobulin isotyping detected by cytometric bead assay
Request a detailed protocolIsotype profiles of mouse immunoglobulins including IgA, IgE, IgG1, IgG2a, IgG2b, IgG3, and IgM were detected by Cytometric Bead Array (CBA) according to the manufacture’s instruction. Shortly, for serum sample diluted 4000 times in PBS, 50 μL Mouse Ig Capture Bead Array was mixed with 50 μL standards or sera samples diluted in master buffer (1:10,000) in tube before incubation for 15 min at room temperature. Then, the beads were washed once and added with 50 μL PE/FITC detector antibody in master buffer. After incubation for 15 min at room temperature in the dark, the beads were washed once and detected by flow cytometer. The mean fluorescence intensity (MFI) of PE represented the antibody expression levels.
Microneutralization-hemagglutinin inhibition assay (MN-HI)
Request a detailed protocolFour strains of influenza virus were used for MN-HI assay to detect biological activity of serum antibody induced by recombinant protein (Fu et al., 2016). After treatment with receptor-destroying enzyme, serum samples were serially double diluted in 96-well plates and mixed with H1N1 A/Brisbane/02/2018 (Bris/02(H1)), H3N2 A/Kansas/14/2017 (Kan/14(H3)), H1N1 A/Michigan/45/2015 (MI/45(H1)), and H3N2 A/Hong Kong/4801/2014-like (HK/4801(H3)) at a final concentration of 100 TCID50 (Median Tissue Culture Infectious Doses) virus per well, respectively. After incubation for 1 hr at 37°C, 1.5 × 104 MDCK cells supplemented with 2 μg/mL trypsin and 0.5% bovine serum albumin (BSA) in DMEM media were added to each well. After infection and amplification for 72 hr at 37°C, viruses were collected and incubated with Turkey Red Blood cells in 96-well plate at room temperature for 30 min. The hemagglutination status of each well was visually determined. The titers of each serum sample were defined as the reciprocal of the highest dilution where no hemagglutination was observed.
ELISA assay
Measurement of antigen-specific IgG by ELISA
Request a detailed protocolThe 96-well microtiter plates were coated with 100 μL HAs of H2N2 A/Canada/720/2005, H5N1 A/Hubei/1/2010, H7N9 A/Shanghai/2/2013, H9N2 A/Hong Kong/35820/2009, and split viruses of MI/45(H1), HK/4801(H3) at 2 mg/mL overnight. Plates were then washed three times with washing buffer (PBS with 0.05% Tween-20, pH 7.4) and blocked with 200 μL blocking buffer (PBS with 0.05% Tween-20 and 1% BSA, pH 7.4) per well for 1 hr at room temperature. After washing three times, 100 μL pre-serially diluted serum were added to each well and incubated at room temperature for 2 hr. Plates were again washed five times before adding 100 μL secondary antibody (horse radish peroxidase-labeled anti-mouse IgG, IgG1, IgG2a, 1:10,000 diluted in blocking solution) and further incubated for 1 hr at room temperature. Then, the plates were washed four times and added with 100 μL TMB substrate per well for 10 min. Enzymatic color development was stopped with 100 μL of 2 M hydrochloric acid per well, and the plates were read at an absorbance of 450 nm. Titer was defined as the highest dilution of serum antibodies at which the mean OD450 value of the experiment group was no less than 2.1 times of the control. The experiment was repeated three times.
Detecting the antigen-specific IL-4 and IFN-γ cytokine production by ELISA
Request a detailed protocolIn brief, 2 weeks after the third immunization, splenocytes from each group were collected and treated with 1000 ng/mL SEC2 and 1000 ng/mL NMH, respectively, and PBS was served as CK. Then, the culture supernatants were harvested at 48 hr to detect the production of IL-4 and IFN-γ by ELISA following the manufacturer’s instructions.
Antibody purification and pull-down assay
Request a detailed protocolSerum antibodies were purified using the Beaver-Beads Protein A/G antibody Purification Kit according to the protocols provided by the manufacturer. The ability of purified Abs to form a stable complex with NMH was further confirmed in a pull-down assay (Mallajosyula et al., 2014). NMH and Abs were mixed together at 2:1 molar ratio and incubated for 2 hr at 4°C. The equilibrated Protein A/G beads were added to the mixture and incubated for 2 hr to bind and pull down NMH, while the unbound supernatants were separated. The antibody bound to the beads was eluted with antibody elution buffer and then neutralized with antibody neutralization buffer. The unbound and eluted fractions were subsequently analyzed by SDS-PAGE.
Binding affinity studies using SPR
Request a detailed protocolBinding affinities of the purified serum antibody with HAs of H2N2, H5N1, and split virion of H1N1, H3N2 were determined by SPR experiments performed with Biacore T200 (Fu et al., 2016). The purified Abs in PBSP buffer (PBS with 0.05% P20, pH 7.4) at 1.25 nM were captured onto CM5 chip through goat anti-mouse IgG (H + L) that immobilized (500–700 response units [RUs]) by standard amine coupling to the surface of the biosensors. The goat anti-mouse IgG (H + L) sensor channel served as a negative control for each binding interaction. Multiple concentrations of HAs were passed over each channel in a running buffer of PBS (pH 7.4) with 0.05% P20 surfactant. Both binding and dissociation events were measured at a flow rate of 30 μL/min. The sensor surface was regenerated after every binding event by repeated washing with glycine pH 2.0. Each binding curve was analyzed after correcting for nonspecific binding by subtraction of signal obtained from the negative control flow channel. The KD values were calculated using a steady affinity state model by the BIAcore T200 evaluation software (version 3.1) (Zhang et al., 2013).
ELISpot assays
Request a detailed protocolSplenocytes were freshly isolated from immunized mice of each group. Influenza-specific IgG ASCs were enumerated with ELISpot. MultiScreen HTS 96-well plates were coated with purified NMH at a concentration of 5 μg/mL in PBS to detect antigens specific ASCs, or coated with split viruses of H1N1 and H3N2 at a concentration of 5 μg/mL in PBS to detect influenza virus-specific ASCs. Wells coated with PBS served as negative controls. Plates were incubated overnight at 4°C and blocked with complete medium for 2 hr at 37°C. Then splenocytes were added into triplicate wells (500,000 cells/well) and incubated at 37°C for 20 hr. Plates were vigorously washed to remove cells, and then incubated with HRP-conjugated anti-mouse IgG overnight at 4°C. The spots representing the IgG ASCs in each well were counted by inspection. Nonspecific spots detected in the negative control (PBS) wells were subtracted from the counts of each total ASCs. Moreover, ELISpot kits were used to measure the IFN-γ or IL-4-producing splenocytes on site according to the manufacturer’s protocol.
Real-time quantitative polymerase chain reaction (qPCR)
Request a detailed protocolTo evaluate the expressions of inflammatory cytokines and transcription factors in splenocytes and to detect the virus titers in lungs of infected mice, total RNA were extracted from splenocytes or lung tissues using the RNA-extracting reagent RNAiso Plus, and 1 μg of total RNA were reverse transcribed to cDNA using a PrimeScript RT Master Kit according to the manufacturer’s instructions. Resulting cDNA was used for qPCR analysis with a SYBR Green PCR kit (Roche). β-Actin was used as reference gene. All primers are listed in Table 1. Relative transcription levels were determined using the 2-ΔΔCt analysis method (Fu et al., 2020).
Sequences for qPCR primers.
Gene | F: forward primer (5′–3′), R: reverse primer (5′–3′) | Reference | |
---|---|---|---|
β-Actin | F: TGGAATCCTGTGGCATCCATGAAAC | Currier and Robinson, 2001 | |
R: TAAAACGCAGCTCAGTAACAGTCCG | |||
Perforin | F: GATGTGAACCCTAGGCCAGA | Currier and Robinson, 2001 | |
R: AAAGAGGTGGCCATTTTGTG | |||
Granzyme B | F: ACTTTCGATCAAGGATCAGCAR: GGCCCCCAAAGTGACATTTATT | Han et al., 2010 | |
R: GGCCCCCAAAGTGACATTTATT | |||
IFN-γ | F: AGACAATCAGGCCATCAGCA | Yao et al., 2018a | |
R: TGGACCTGTGGGTTGTTGAC | |||
IL-4 | F: GAGACTCTTTCGGGCTTTTCG | Chen et al., 2012 | |
R: CAGGAAGTCTTTCAGTGATGTGG | |||
T-bet | F: ATTGCCCGCGGGGTTG | Chen et al., 2012 | |
R: GACAGGAATGGGAACATTCGC | |||
GATA-3 | F: GGTCAAGGCAACCACGTC | Chen et al., 2012 | |
R: CATCCAGCCAGGGCAGAG | |||
H1(HA) | F: CAGATTYTGGCGATCTAYTC | ||
R: GACCCATTAGARCACATCCAG |
Cytotoxic lysis assay
Request a detailed protocolIn vivo cytotoxic lysis assay was performed as previously reported (Xie et al., 2014). Splenocytes from naïve BALB/c mice were divided into two parts. One part was pulsed with 10–6 M NMH peptides and labeled with 10 μΜ of CFSE (termed as CFSEhigh target cells). The other part was pulsed with 10–6 M BSA and labeled with 1 μM of CFSE (termed as CFSElow cells) as a non-target control. Cells from the two parts were mixed in a 1:1 ratio and injected into immunized recipient mice at 2 × 107 total cells per mouse via the tail vein on day 14 after the third immunization. Twelve hours later, splenocytes were isolated from the recipients and differential CFSE fluorescent intensities were measured with a flow cytometry. Specific lysis was calculated using the following formula: Percentage of specific lysis = (1 – [ratio unprimed/ratio primed] × 100), where ratio = percentage CFSElow/percentage CFSEhigh.
Challenge experiments
Request a detailed protocolThe challenge experiments were performed as previously reported (Meng et al., 2013). BALB/c mice were immunized with 200 μg NMHC, 100 μg NMH alone, 100 μg NMH plus 100 μg SEC2, or PBS. Two weeks after the third immunization, mice were challenged with virus. Before virus infection, 12 mice of each group were anesthetized and inoculated intranasally with 103 TCID50 of H1N1 MI/45(H1) and H1N1 Bris/02(H1) virus strains in a volume of 50 μL. To determine the viral load and the pathological damage in the infected lungs, three mice from each group were sacrificed on days 3 and 6 post-infection. As previously reported (Meng et al., 2013; Marcos et al., 2017), the right lungs were used for qPCR to assess the virus titer, while the left lungs were fixed for the histopathological analysis. Survival and weight change of the remaining mice in each group were monitored daily for 14 days after the infection.
Histological analysis
Request a detailed protocolThe mice were sacrificed on days 3 and 6 after infection with virus. The left lungs were collected and dissected for histological observation (n = 3 mice per group). After fixation in neutral-buffered fixative, the tissues were embedded in paraffin and stained with hematoxylin and eosin. The lungs were sliced into 6-μm-thick frozen sections, and the lung-infiltrating leukocytes profiles in the tissues were reflected by IHC analysis of CD45. The distribution of influenza viruses, lung-infiltrating T lymphocytes, and lung-infiltrating macrophages was respectively reflected by immunofluorescence analysis of NP, CD8, and F4/80 with Laser Scanning Confocal Microscope (LSCM).
Statistical analysis
Request a detailed protocolThe data were analyzed by Student’s t-test, one-way analysis of variance (ANOVA), and followed by a suitable post-hoc test using the SPSS 26.0 and GraphPad Prism Software (version 6.0c). Differences with p-values<0.05 were considered to be statistically significant.
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files.
References
-
Intranasal administration of peptide vaccine protects human/mouse radiation chimera from influenza infectionInternational Immunology 11:1043–1051.https://doi.org/10.1093/intimm/11.7.1043
-
Spectratype/Immunoscope Analysis of the Expressed TCR RepertoireCurrent Protocols in Immunology 38:10.https://doi.org/10.1002/0471142735.im1028s38
-
Exotoxins of Staphylococcus aureusClinical Microbiology Reviews 13:16–34.https://doi.org/10.1128/CMR.13.1.16
-
Re-engaging cross-reactive memory B cells: the influenza puzzleFrontiers in Immunology 3:53.https://doi.org/10.3389/fimmu.2012.00053
-
Structural insights into key sites of vulnerability on HIV-1 Env and influenza HAImmunological Reviews 250:180–198.https://doi.org/10.1111/imr.12005
-
Detection of influenza A, B and subtypes A (H1N1) pdm09, A (H3N2) viruses by multiple qrt-pcr in clinical samplesRevista Peruana de Medicina Experimental y Salud Publica 34:192–200.https://doi.org/10.17843/rpmesp.2017.342.2054
-
Cutting edge: stealth influenza virus replication precedes the initiation of adaptive immunityJournal of Immunology 183:3569–3573.https://doi.org/10.4049/jimmunol.0900091
-
Memory B cells, but not long-lived plasma cells, possess antigen specificities for viral escape mutantsThe Journal of Experimental Medicine 208:2599–2606.https://doi.org/10.1084/jem.20110740
-
An iRGD peptide fused superantigen mutant induced tumor-targeting and T lymphocyte infiltrating in cancer immunotherapyInternational Journal of Pharmaceutics 586:119498.https://doi.org/10.1016/j.ijpharm.2020.119498
-
The influenza A virus nucleoprotein gene controls the induction of both subtype specific and cross-reactive cytotoxic T cellsThe Journal of Experimental Medicine 160:552–563.https://doi.org/10.1084/jem.160.2.552
-
Cimetidine synergizes with Praziquantel to enhance the immune response of HBV DNA vaccine via activating cytotoxic CD8(+) T cellHuman Vaccines & Immunotherapeutics 10:1688–1699.https://doi.org/10.4161/hv.28517
-
BookResearch Advances on Immunopharmacology and Cancer Therapy of Staphylococcal Enterotoxinsresearchgate.
-
Up-regulation of granzyme B and perforin by staphylococcal enterotoxin C2 mutant induces enhanced cytotoxicity in Hepa1-6 cellsToxicology and Applied Pharmacology 313:1–9.https://doi.org/10.1016/j.taap.2016.10.009
Decision letter
-
Tomohiro KurosakiReviewing Editor; Osaka University, Japan
-
Tadatsugu TaniguchiSenior Editor; Institute of Industrial Science, The University of Tokyo, Japan
-
Tony MoodyReviewer; Duke University, United States
In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.
Decision letter after peer review:
Thank you for submitting your article "A recombinant protein containing influenza viral conserved epitopes and superantigen induces broad-spectrum protection" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Tadatsugu Taniguchi as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Tony Moody (Reviewer #3).
The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.
Essential revisions:
1) The authors have immunized mice three times every two weeks. The usual current influenza vaccine is immunized twice against mice to test its efficacy. The authors should discuss the comparison of the effectiveness of the current vaccine and theirs.
2) They conducted a cytometric bead array to calculate immunoglobulin subclasses in sera presented in Figure 3. In the control group on Day 100, the MFI of IgG2b is reduced compared to other time points. They should calculate the absolute amount of IgG2b, not MFI, by using standard.
3) The data on neutralization assays in Figure 4 is not sufficiently convincing. The authors should perform neutralization assays for H1N1 and H3N2 and other strains to prove that their vaccine candidate is effective against a wide range of influenza viruses. Also, they should conduct a statistical test to show significant differences.
4) The ELISA and Biacore assay indicate that the binding capacity of the antibodies induced by vaccination is higher against H2, H5, and H9 than H1, H3, and H7. They should discuss this.
5) Examining T cell responses is very important. The T-cell responses induced by NMHC are not different from those induced by SEC2 alone in Figure 8. Hence, the authors should verify whether the induced T cell response is indeed influenza antigen-specific or not. Specifically, cytokine production should be detected after stimulating splenocytes of post-immunized mice with influenza antigens without SEC2 and SEC2 alone.
Reviewer #1:
To make cross-protective vaccines for influenza, authors have made recombinant proteins composed of influenza conserved epitopes and super-antigen and examined. Particularly, they seemed to wish to show up the importance of fusion of super-antigen and viral antigen, although authors already demonstrated this concept in a previous paper by using another system.
Ab and T cell responses were analyzed which is good. But, every data are superficial; for instance, authors have not examined which epitopes Abs recognize, and which epitopes T cell recognize. Hence, this study does not have a significant impact.
In this study, Li and colleagues generated a novel recombinant protein NMHC as a potential candidate of universal broad-spectrum vaccine for various influenza virus prevention and therapy. The NMHC protein consisted of two domains. One is NMH domain consisting of influenza viral highly conserved long α-helix regions of HA from group 1 and group 2, NP (two epitopes of CTL and helper T lymphocytes) and M2e fragments as universal immunogen. The other is SEC2 domain as adjuvant-like molecular chaperone for enhancing the antigenicity of NMH. This vaccine strategy sounds interesting and promising and it certainly seemed that SEC2 domain increased ability of mice to protect against influenza viruses by enhancing the immune response for NMH domain. However, as shown below, in some respects, there seemed to be a lack of data and interpretation about the significance of incorporating all the elements as one domain.
I agree that the NP and M2 sequences are highly conserved across influenza virus subtypes, but it is necessary to validate the conservativeness more carefully about the peptide sequences used in NMH domain with the information of predicted binding ability to MHC (class I or II) by a tool like NetMHC. In particular, since the T epitope is greatly affected by even one amino acid difference, so please compare the typical influenza virus strains from H 1 (2009 pandemic type), H1 (Russian type or PR8), H2, H5, H3, H7, and H9 subtypes. This information seems to be important in considering the breadth of vaccine effect. If authors think HA2 element also includes conserved T cell epitopes covering various HA subtypes, please analyze together.
Probably it's being evaluated as an initial basic data, but it seems important to mention the author's interpretation about the importance of NP and Me2 elements in NMH protein. Especially, if authors think these elements also have critical role, it is necessary to show the data how NP or Me2 elements in NMHC protein work effectively for immune response by comparing with NP or Me2 elements excluded protein. In particular, these data seem to be important for considering the specific antigen for T cell-B cell interaction in Figure 7 and the antigen specificity of CD4 T cells activated by NMHC immunogen in Figure 8.
The authors mentioned that HA2 element in NMH domain is important for the induction of broadly cross-reactive neutralizing antibodies. However, antibodies or memory/GC B cells induced by NMHC immunization have not been evaluated at the single clone or single cell level. In particular, if authors think that connecting of each long α-helix region from H1, H3 and H7 HA in tandem as one domain has some advantages, for example it will increase the number of clones that can react to both grou1 and group2 strains, the experimental data is necessary. Anyway because the lacking of the data and interpretation for this point, it is difficult to evaluate the broadness of cross-reactive antibody induced by HA2 element in NMH domain. At least I would like authors to explain more carefully about this point (broadly cross reactivity at the level of single clone of antibody or single cell).
Regarding Figure 4 and 10-12. The authors mentioned in discussion part that it is very hard to use other strains except some restricted ones in your institute. However, H1N1 strains used in these figures are basically very closed to 2009 pandemic California strain used in NMH domain. If you want to show the antibodies induced recombinant proteins have broadly cross reactivity and protection, it is important to test the strains far from 2009 pandemic strains like representative laboratory strains PR8(H1N1) or RG14 (H5N1 *BSL2 strain). If it is impossible to use even these kinds of laboratory strains, authors should design the H1 α-helix regions in NMH domain from distant strains like H2, H5 or PR8(H1). On the other hand, in the case of H3N2 A/Hong Kong/4801/2014 strain, it is away from A/Hong Kong/1/1968(This HA is used in X31 laboratory strain). So it seems to be enough.
Regarding Figure 8. In this manuscript, authors did not touch the germinal center story like GC B cells or Tfh cells at all but these kinds of cells are very important in considering humoral immunity like affinity maturation of broadly cross reactive antibodies. So some information about Tfh marker like Bcl6, IL21 or interpretation about the germinal center reaction seem important at least even if it is difficult to perform detailed flow cytometry analysis.
Reviewer #2:
This paper aims to provide a novel universal influenza vaccine that could induce broad protection against various influenza viruses. For this purpose, the authors designed a new vaccine candidate who is composed of the conserved fragments of nucleoprotein (two epitopes of CTL and helper T lymphocytes), matrix protein 2, highly conserved long α-helix regions of hemagglutinin from group 1 (H1), and group 2 (H3 and H7), and superantigen Staphylococcal Enterotoxin C2, which is named NMHC. They showed that NMHC induces not only antibody production but also T-cell responses. The induced antibodies could bind broad rHA proteins and neutralize H1N1 1A/Michigan/45/2015 (group 1) and H3N2 A/Hong Kong/ 4801/2014 (group 2) viruses.
Their proposal is potentially interesting. However, the quality of the results is not sufficient enough to support their conclusion. They concluded that NMHC is a potential candidate for the universal broad-spectrum vaccine for various influenza virus prevention, whereas few data about protection against strains other than H1N1 and H3N2. In addition, there is no comparison to the effectiveness of current vaccines. Neutralization assays not only for H1N1 and H3N2 but also for other strains would strengthen their proposal. If it is difficult to use alive viruses for this purpose, it is recommended to use a simple experimental system such as pseudotyped viruses. For CD4+ T cell analysis, various cytokines were induced even in superantigen alone. The authors should show the specificity for T-cell responses against influenza antigens.
1) The authors have immunized mice three times every two weeks. The usual current influenza vaccine is immunized twice against mice to test its efficacy. The authors should discuss the comparison of the effectiveness of the current vaccine and theirs.
2) They conducted a cytometric bead array to calculate immunoglobulin subclasses in sera presented in Figure 3. In the control group on Day 100, the MFI of IgG2b is reduced compared to other time points. They should calculate the absolute amount of IgG2b, not MFI, by using standard.
3) The data on neutralization assays in Figure 4 is not sufficiently convincing. The authors should perform neutralization assays for H1N1 and H3N2 and other strains to prove that their vaccine candidate is effective against a wide range of influenza viruses. Also, they should conduct a statistical test to show significant differences.
4) The ELISA and Biacore assay indicate that the binding capacity of the antibodies induced by vaccination is higher against H2, H5, and H9 than H1, H3, and H7. They should discuss this.
5) The T-cell responses induced by NMHC are not different from those induced by SEC2 alone in Figure 8. The authors should verify whether the induced T cell response is influenza antigen-specific. Specifically, cytokine production should be detected after stimulating splenocytes of post-immunized mice with influenza antigens without SEC2.
6) Two IgG2b are shown in the Plot representing the standard in Figure 3. I guess that one of the two is IgG2a. Please correct the figure.
7) There is no match between each KD shown in Figure 6 and the KD in the text.
8) The sentence "IL-4 (for Th1 subtype), IFN-γ (for Th2 subtype)" should be corrected to "IFN-γ (for Th1 subtype), IL-4 (for Th2 subtype)" (Page 34, Line 558).
Reviewer #3:
This manuscript describes a vaccine construct comprised of multiple segments derived from influenza proteins, and in some cases conjugated to staphylococcal enterotoxin C2. There is an impressive amount of data and the workup of the immune response is quite detailed, including humoral, cellular, and protection data in mice. Overall, the impression is that this construct has the potential to move forward as a vaccine candidate. In addition, the provided data support their conclusions.
The data are clearly presented in most sections, and I am impressed that in places where multiple replicates were performed, the authors listed the number of replicates and the statistical measures.
The grammar of the manuscript needs work, and the text would benefit from copy-editing at a minimum and might even benefit from editing for length in some sections.
In some places, I would probably have presented some of the data differently. For example, I typically display bead-based antibody binding assays on a logarithmic scale which is more in line with the type of data shown. That being said, there is nothing deceptive in how the data are presented, so a change may not be necessary.
I do not recommend additional experimentation. I do think that moving this candidate forward through regulatory bodies may face significant hurdles, but that is not the problem being addressed in this paper.
Finally, I think Figure 13 is really more suited to a review article and not appropriate for this manuscript.
https://doi.org/10.7554/eLife.71725.sa1Author response
Essential revisions:
1) The authors have immunized mice three times every two weeks. The usual current influenza vaccine is immunized twice against mice to test its efficacy. The authors should discuss the comparison of the effectiveness of the current vaccine and theirs.
Thanks for your careful reading and constructive advices. In fact, in our preliminary experiment, we have optimized the dosage and immune frequency of NMHC by detecting the H1N1 and H3N2 specific IgG by ELISA. Based on the result in Author response table 1, we chose a dose of 200 μg each time and each mice for three immunizations in order to achieve a better immune effect. The main objective of this study is to evaluate the feasibility of this recombinant vaccine strategy, and three immunizations for recombinant influenza vaccine have been frequently reported by researchers such as Joan E. M (doi:10.1038/s41541-018-0063-7), Raffael Nachbagauer (doi:10.1038/npjvaccines.2016.15) and John Steel (doi: 10.1128/mBio.00018-10). As you mentioned, the usual current influenza vaccine is immunized twice against mice. Most of the usual current influenza vaccines are inactivated quadrivalent influenza vaccines (QIV) which are more immunogenic than the recombinant vaccine. So two immunizations might be enough for QIV but not for recombinant vaccine. As shown in the supplementary materials (Table S1), the neutralizing antibodies induced by QIV could be effectively detected by HI test but not induced by the recombinant vaccine.
The antibody titers in preliminary experiment.
Treatment groups(μg) | Serum antibody titer(H1N1) | Serum antibody titer(H3N2) | ||||
---|---|---|---|---|---|---|
200 NMHC 3rd | >2048 | >2048 | >2048 | 1024 | 1024 | 1024 |
100 NMHC 3rd | 1024 | >2048 | 1024 | 256 | 256 | 256 |
200 NMHC 2nd | 1024 | 1024 | 1024 | 256 | 512 | 256 |
100 NMHC 2nd | 512 | 1024 | 512 | 256 | 128 | 128 |
2) They conducted a cytometric bead array to calculate immunoglobulin subclasses in sera presented in Figure 3. In the control group on Day 100, the MFI of IgG2b is reduced compared to other time points. They should calculate the absolute amount of IgG2b, not MFI, by using standard.
Thanks for your careful reading and constructive advices. According to the instruction manual of Mouse Immunoglobulin Isotyping Kit (Cat. No.550026), we used the MFI, the original data, to represent the amount of immunoglobulins. The instruction manual of this kit did not provide how to calculate the absolute amount of each immunoglobulin. Furthermore, MFI was widely used by researchers such as Edward Morgan (doi:10.1016/j.clim.2003.11.017), Yunxiao Zhao (doi:10.1016/j.cca.2014.09.018) and Yang He (doi:10.1016/j.cca.2012.10.035) to represent the amount of immunoglobulins. As your advice, we tried to calculate the absolute amount of IgG2b by using standards, which contain 0.25 μg/ml each of IgG1 κ/λ, IgG2a κ/λ, IgG2b κ/λ, IgG3 κ/λ, IgA κ/λ, IgM κ/λ and IgE κ, and the absolute amount of IgG2b was calculated using the following equation:
MFI IgG2bκ unknown sample/MFI IgG2bκ standard * the dilution multiple *0.25μg/ml
The results showed in the following Author response table 2, the trend is similar to MFI.
The absolute amount of IgG2bκ.
NMHC | NMH | SEC2 | NMH+SEC2 | PBS | |
---|---|---|---|---|---|
day 100IgG2bκ (mg/ml) | 2.53±0.087 | 2.483±0.144 | 2.24±0.104 | 2.277±0.116 | 1.393±0.006 |
3) The data on neutralization assays in Figure 4 is not sufficiently convincing. The authors should perform neutralization assays for H1N1 and H3N2 and other strains to prove that their vaccine candidate is effective against a wide range of influenza viruses. Also, they should conduct a statistical test to show significant differences.
Thanks for your comments and constructive advices. According to your suggestion, we have supplemented neutralization assays for H1N1 A/Brisbane/02/2018 and H3N2 A/Kansas/14/2017 using the same batch of frozen serum samples which were used in neutralization assays for H1N1 A/Michigan/45/2015 and H3N2 A/Hong Kong/ 4801/2014 in our original manuscript. These four strains are all the living influenza virus strains we can obtain in current situation. We are so sorry that we have not been allowed to obtain any other living influenza virus strains to further verify the broad spectrum of NMHC. We agree that neutralization assays for these four strains were not enough to say that NMHC was effective against a wide range of influenza viruses. Therefore, we used the ELISA and Biacore assays, selected the HA fragments of representative influenza virus subtypes, to evaluate the broad binding properties of antibodies induced by NMHC. According to your advice, we reanalyzed the results of neutralization assays and conducted a statistical test to show significant differences by geometric mean titer (GMT). In our revised manuscript, the original Figure 4 has been replaced by the new Figure 4.
4) The ELISA and Biacore assay indicate that the binding capacity of the antibodies induced by vaccination is higher against H2, H5, and H9 than H1, H3, and H7. They should discuss this.
Thanks for your careful reading and comment. As described in Materials and methods part in our manuscript, in the ELISA and Biacore assays, H2, H5, H7, and H9 were commercial recombinant HA proteins, while H1 and H3 were split viruses. It might be that the complex composition and conformation of the split viruses led to the relatively lower binding capacities to H1 and H3 in the ELISA and Biacore results. As to H7, we can see from the Table S2, the ELISA endpoint titers calculated from Figure 5, showed that the titer of H7 induced by NMHC was the same with titers of H2, H5, and H9.
Theoretically, the long α-helix regions of hemagglutinin (amino acids 76–130 from the HA2) were conserved among H1, H2, H3, H5, H7, and H9 (Author response image 1), so the binding capacities of antibodies induced by NMHC to these HAs should be similar. Furthermore, we learned a lot from your advices and we really appreciate your professional comments.

The long α-helix amino acids 76–130 from the HA2 of different hemagglutinin subtypes.
5) Examining T cell responses is very important. The T-cell responses induced by NMHC are not different from those induced by SEC2 alone in Figure 8. Hence, the authors should verify whether the induced T cell response is indeed influenza antigen-specific or not. Specifically, cytokine production should be detected after stimulating splenocytes of post-immunized mice with influenza antigens without SEC2 and SEC2 alone.
Thank you very much for your suggestion. As you mentioned, the T-cell responses in figure 8 was not antigen-specific because that the T cells had not been treated with any antigens in vitro. According to your advice, we have repeated the animal immunization experiment to detect the IL-4 and IFN-γ cytokine production after stimulating splenocytes of post-immunized mice with NMH without SEC2 and SEC2 alone. In brief, female wild-type BALB/c mice were respectively immunized with 200 μg NMHC, 100 μg NMH, 100 μg SEC2, 100 μg NMH plus 100 μg SEC2, and PBS (control) by i.p. for three times with interval of 14 days. Two weeks after the third immunization, splenocytes from each group were collected and treated with 1000 ng/mL SEC2 alone or 1000 ng/mL NMH alone, and PBS was served as CK. Then, the culture supernatants were harvested at 48 h to detect the production of IL-4 and IFNγ by ELISA following the manufacturer’s instructions. In Figure 8C the results showed that, in NMHC, NMH+SEC2 and NMH immunized groups, the productions of IL-4 and IFN-γ treated with NMH were significantly higher than CK (p < 0.05), while SEC2 and PBS immunized groups didn't show significant changes. This result verified that the T cell response induced by NMH treatment is influenza antigen-specific. However, the splenocytes from all of the immunized groups produced high levels of IL-4 and IFN-γ after SEC2 treatment in vitro, and there were no significant differences among the five immunized groups. As a superantigen, SEC2 could induce nonspecific T cell responses, leading to massive production of cytokine. According to your comment, we have added this supplementary experiment and results to our revised manuscript, and added to Figure 8C in our revised manuscript.
Reviewer #1:
To make cross-protective vaccines for influenza, authors have made recombinant proteins composed of influenza conserved epitopes and super-antigen and examined. Particularly, they seemed to wish to show up the importance of fusion of super-antigen and viral antigen, although authors already demonstrated this concept in a previous paper by using another system.
Ab and T cell responses were analyzed which is good. But, every data are superficial; for instance, authors have not examined which epitopes Abs recognize, and which epitopes T cell recognize. Hence, this study does not have a significant impact.
In this study, Li and colleagues generated a novel recombinant protein NMHC as a potential candidate of universal broad-spectrum vaccine for various influenza virus prevention and therapy. The NMHC protein consisted of two domains. One is NMH domain consisting of influenza viral highly conserved long α-helix regions of HA from group 1 and group 2, NP (two epitopes of CTL and helper T lymphocytes) and M2e fragments as universal immunogen. The other is SEC2 domain as adjuvant-like molecular chaperone for enhancing the antigenicity of NMH. This vaccine strategy sounds interesting and promising and it certainly seemed that SEC2 domain increased ability of mice to protect against influenza viruses by enhancing the immune response for NMH domain. However, as shown below, in some respects, there seemed to be a lack of data and interpretation about the significance of incorporating all the elements as one domain.
I agree that the NP and M2 sequences are highly conserved across influenza virus subtypes, but it is necessary to validate the conservativeness more carefully about the peptide sequences used in NMH domain with the information of predicted binding ability to MHC (class I or II) by a tool like NetMHC. In particular, since the T epitope is greatly affected by even one amino acid difference, so please compare the typical influenza virus strains from H 1 (2009 pandemic type), H1 (Russian type or PR8), H2, H5, H3, H7, and H9 subtypes. This information seems to be important in considering the breadth of vaccine effect. If authors think HA2 element also includes conserved T cell epitopes covering various HA subtypes, please analyze together.
It have been extensively studied that both NP and M2e fragments are conserved antigens inducing cellular or humoral immune responses (Tamar Ben-Yedidia et al., DOI: 10.1016/j.vaccine.2005.08.061, Neirynck et al. DOI: 10.1038/13484, Marina et al. DOI: 10.1016/j.vaccine.2005.08.061). In our study, NMH also contained the NP and M2e elements, and the conservativeness about the peptide sequences used in NMH domain has been validated using the online computational MHC binding prediction tool called TepiTool (http://tools.iedb.org/tepitool/.). All peptide lengths (8-14) were predicted for their binding affinity to 6 alleles of MHC I and 3 alleles of MHC II. A panel of 6 MHC I (H-2-Db, H-2-Dd, H-2-Kb, H-2-Kd, H-2-Kk, H-2-Ld) and a panel of 3 MHC II (H-2-IAb, H-2-IAd, H-2-IEd) were selected. As default recommended settings, peptide selection criterion were Cutoff of IC50 ≤ 500 nM (MHC I) and Cutoff of predicted percentile rank ≤ 10% (MHC II). The results (Author response image 2) showed that the NP and M2 sequences used in NMH domain could bind to MHC class I or II. Subsequently, we also analyzed the T cell epitopes of HA2 elements using the same methods and parameters, and the results showed that the HA2 sequences used in NMH domain could bind to MHC class I or II (Author response image 3).

The information of predicted binding ability to MHC (class I or II) for the NP and M2 peptide sequences.
(A), the sequences that were used in the binding prediction. The amino acid residues 1 to 16 were NP335–350; 17 to 30 were NP380–393; 31 to 37 were linker; 38 to 83 were 2*M2e. (B) and (C), for MHC I and MHC II, the sequence number of the source protein, start and end coordinates of the peptide within the source protein, peptide sequence, allele, IC50, and Consensus percentile rank.

The information of predicted binding ability to MHC (class I or II) for the HA2 peptide sequences.
(A), the sequences that were used in the binding prediction. The amino acid residues 1 to 55, 63 to 117, 125 to 179 respectively were HA2 of H1, H3 and H7; 56 to 62 and 118 to 124 were linker. (B) and (C), for MHC I and MHC II, the sequence number of the source protein, start and end coordinates of the peptide within the source protein, peptide sequence, allele, IC50, and Consensus percentile rank.
As we known, MHC class I molecules have a binding groove that limits the size of its ligands to roughly 8 to 11 residues in length, while Class II molecules allowed them to bind longer peptides, typically 12 to 20 residues in length. The amino acid sequence of a peptide to MHC molecule is an important factor that determines potential immunogenicity related to the breadth of vaccine effect. Therefore, we compared the NP and M2e of NMH with typical influenza virus strains from A/Arkhangelsk/CRIE-109/2016(H1N1), A/Alabama/01/2010(H1N1), A/Panama/1/66(H2N2), A/Akita/4/1993(H3N2), A/Bangladesh/3233/2011(H5N1), A/Anhui/1-DEWH730/2013(H7N9) and A/Beijing/1/2016(H9N2) subtypes. The results (Author response image 4) showed that the conservation of NP335-350, NP380-393 and M2e were 87.5%, 100% and 94.53%, respectively, indicating the high conservation of T epitopes.

The conservation of NP and M2e sequence of different influenza virus subtypes.
The sequence of H1N1, H2N2, H3N2, H5N1, H7N9, H9N2 subtypes and NMH (red frame) are listed in single amino acid code from top to bottom. Observed replacement mutations are listed beneath by single amino acid code.
Probably it's being evaluated as an initial basic data, but it seems important to mention the author's interpretation about the importance of NP and Me2 elements in NMH protein. Especially, if authors think these elements also have critical role, it is necessary to show the data how NP or Me2 elements in NMHC protein work effectively for immune response by comparing with NP or Me2 elements excluded protein. In particular, these data seem to be important for considering the specific antigen for T cell-B cell interaction in Figure 7 and the antigen specificity of CD4 T cells activated by NMHC immunogen in Figure 8.
The roles of conserved epitopes in influenza A virus, especially NP and M2e, in design of broad-spectrum influenza vaccine have been widely studied (Wang Wenling et al., doi: 10.1371/journal.pone.0052488; Raffael Nachbagauer et al., doi:10.1038/npjvaccines; Taia T. Wanga et al., DOI: 10.1073/pnas). In our manuscript, NMH and NMHC are designed based on these previous studies. We think that both NP and M2e are surely important. We are very sorry that we did not compare the results of NP or M2e excluded protein. NMHC consists of NP, M2e, three different HA2 fragments and SEC2 connected by flexible linker (GSAGSAG).
Our main aim is to explore whether the vaccine strategy is feasible. The structural modeling of NMHC in silico revealed that the elements of NP, M2e, HA2(H1, H3, H7) and SEC2 were independent from each other (Figure 1D in the manuscript), and these immunogens could play their respective functions. We are more concerned about the role of SEC2 in enhancing the protective effect induced by NMH. As showed in Figure 7 and Figure 8 in our revised manuscript, the introduction of SEC2 enhanced the T cell-B cell interaction and the antigen specificity of CD4 T cells activated by NMH. We agree that it is important to show the data how NP, M2e or HA2 elements in NMHC protein work effectively for immune responses. However, it is hard to test every element or any combination of these elements deeply in the limited time and space.
The authors mentioned that HA2 element in NMH domain is important for the induction of broadly cross-reactive neutralizing antibodies. However, antibodies or memory/GC B cells induced by NMHC immunization have not been evaluated at the single clone or single cell level. In particular, if authors think that connecting of each long α-helix region from H1, H3 and H7 HA in tandem as one domain has some advantages, for example it will increase the number of clones that can react to both grou1 and group2 strains, the experimental data is necessary. Anyway because the lacking of the data and interpretation for this point, it is difficult to evaluate the broadness of cross-reactive antibody induced by HA2 element in NMH domain. At least I would like authors to explain more carefully about this point (broadly cross reactivity at the level of single clone of antibody or single cell).
It has been widely proved that the HA2 element could induce broadly cross-reactive neutralizing antibodies. We connected the highly conserved long α-helix regions from H1, H3 and H7 HA2 in tandem in order to increase the immunogenicity. However, we don't think this combination is perfect, and the immune responses may change as the HA2 elements sequence and quantity changes. The recombinant protein NMHC is rather an example for this vaccine design strategy than a certain vaccine. The structure of NMHC must be further optimized before it become a candidate vaccine. Here, we initial studied the specific antibody secreting cells responses of HA2 (H1-H3-H7) on NMH, H1N1 and H3N2 with ELISPOT assay (Manuscript Figure 7). Furthermore, we also evaluated the broadness of cross-reactive antibody induced by HA2 element in NMH domain with the ELISA (Manuscript Figure.5) and Biacore (Manuscript Figure.6) assay. In conclusion, these results showed that the combination strategy is feasible, because HA2 elements in NMH domain could induce the broadness of cross-reactive antibody. We are so sorry that we did not supplement the single clone or single cell experiments in the limited time and space available.
Regarding Figure 4 and 10-12. The authors mentioned in discussion part that it is very hard to use other strains except some restricted ones in your institute. However, H1N1 strains used in these figures are basically very closed to 2009 pandemic California strain used in NMH domain. If you want to show the antibodies induced recombinant proteins have broadly cross reactivity and protection, it is important to test the strains far from 2009 pandemic strains like representative laboratory strains PR8(H1N1) or RG14 (H5N1 *BSL2 strain). If it is impossible to use even these kinds of laboratory strains, authors should design the H1 α-helix regions in NMH domain from distant strains like H2, H5 or PR8(H1). On the other hand, in the case of H3N2 A/Hong Kong/4801/2014 strain, it is away from A/Hong Kong/1/1968(This HA is used in X31 laboratory strain). So it seems to be enough.
Thanks for your comments and constructive advices. According to your suggestion, we have supplemented neutralization assays for H1N1 A/Brisbane/02/2018 and H3N2 A/Kansas/14/2017 using the same batch of frozen serum samples which were used in neutralization assays for H1N1 A/Michigan/45/2015 and H3N2 A/Hong Kong/ 4801/2014 in our original manuscript (Figure 4). These four strains are all the living influenza virus strains we can obtain in current situation. We are so sorry that we have not been allowed to obtain any other living influenza virus strains to further verify the broad spectrum of NMHC. We agree that neutralization assays for these four strains were not enough to say that NMHC was effective against a wide range of influenza viruses. Therefore, we used the ELISA and Biacore assay, selected the HA fragments of representative influenza virus subtypes, to evaluate the broad binding properties of antibodies induced by NMHC. In our revised manuscript, the original Figure 4 has been replaced by the new Figure 4.
Regarding Figure 8. In this manuscript, authors did not touch the germinal center story like GC B cells or Tfh cells at all but these kinds of cells are very important in considering humoral immunity like affinity maturation of broadly cross reactive antibodies. So some information about Tfh marker like Bcl6, IL21 or interpretation about the germinal center reaction seem important at least even if it is difficult to perform detailed flow cytometry analysis.
Thanks for your comments and constructive advices. In our revised manuscript, Figure 7 showed the specific antibody secreting B cells response to H1N1, H3N2 and NMH, and Figure 8 showed the specific Th cells response to NMH. As you indicated, GC B cells and Tfh cells are very important in evaluating the broadly cross-protective antibody response induced by vaccines. But this is really beyond the scope of this manuscript. As we mentioned above, the main purpose of this manuscript is to provide proof of concept for combining conserved antigens inducing cross-protective antibody response with epitopes activating crossprotective T cell response would against multiple influenza virus infection. Anyhow, we really appreciate your constructive advice. And GC B cells and Tfh cells will be focused in our future study.
Reviewer #2:
This paper aims to provide a novel universal influenza vaccine that could induce broad protection against various influenza viruses. For this purpose, the authors designed a new vaccine candidate who is composed of the conserved fragments of nucleoprotein (two epitopes of CTL and helper T lymphocytes), matrix protein 2, highly conserved long α-helix regions of hemagglutinin from group 1 (H1), and group 2 (H3 and H7), and superantigen Staphylococcal Enterotoxin C2, which is named NMHC. They showed that NMHC induces not only antibody production but also T-cell responses. The induced antibodies could bind broad rHA proteins and neutralize H1N1 1A/Michigan/45/2015 (group 1) and H3N2 A/Hong Kong/ 4801/2014 (group 2) viruses.
Their proposal is potentially interesting. However, the quality of the results is not sufficient enough to support their conclusion. They concluded that NMHC is a potential candidate for the universal broad-spectrum vaccine for various influenza virus prevention, whereas few data about protection against strains other than H1N1 and H3N2. In addition, there is no comparison to the effectiveness of current vaccines. Neutralization assays not only for H1N1 and H3N2 but also for other strains would strengthen their proposal. If it is difficult to use alive viruses for this purpose, it is recommended to use a simple experimental system such as pseudotyped viruses. For CD4+ T cell analysis, various cytokines were induced even in superantigen alone. The authors should show the specificity for T-cell responses against influenza antigens.
1) The authors have immunized mice three times every two weeks. The usual current influenza vaccine is immunized twice against mice to test its efficacy. The authors should discuss the comparison of the effectiveness of the current vaccine and theirs.
Thanks for your careful reading and constructive advices. In fact, in our preliminary experiment, we have optimized the dosage and immune frequency of NMHC by detecting the H1N1 and H3N2 specific IgG by ELISA. Based on the result in Author response table 1, we chose a dose of 200 μg each time and each mice for three immunizations in order to achieve a better immune effect. The main objective of this study is to evaluate the feasibility of this recombinant vaccine strategy, and three immunizations for recombinant influenza vaccine have been frequently reported by researchers such as Joan E. M (doi:10.1038/s41541-018-0063-7), Raffael Nachbagauer (doi:10.1038/npjvaccines.2016.15) and John Steel (doi: 10.1128/mBio.0001810). As you mentioned, the usual current influenza vaccine is immunized twice against mice.
Most of the usual current influenza vaccines are inactivated quadrivalent influenza vaccines (QIV) which are more immunogenic than the recombinant vaccine. So two immunizations might be enough for QIV but not for recombinant vaccine. As shown in the supplementary materials (Table S1), the neutralizing antibodies induced by QIV could be effectively detected by HI test but not induced by the recombinant vaccine.
2) They conducted a cytometric bead array to calculate immunoglobulin subclasses in sera presented in Figure 3. In the control group on Day 100, the MFI of IgG2b is reduced compared to other time points. They should calculate the absolute amount of IgG2b, not MFI, by using standard.
Thanks for your careful reading and constructive advices. According to the instruction manual of Mouse Immunoglobulin Isotyping Kit (Cat. No.550026), we used the MFI, the original data, to represent the amount of immunoglobulins. The instruction manual of this kit did not provide how to calculate the absolute amount of each immunoglobulin. Furthermore, MFI was widely used by researchers such as EdwardMorgan (doi:10.1016/j.clim.2003.11.017), Yunxiao Zhao (doi:10.1016/j.cca.2014.09.018) and Yang He (doi:10.1016/j.cca.2012.10.035) to represent the amount of immunoglobulins. As your advice, we tried to calculate the absolute amount of IgG2b by using standards, which contain 0.25μg/ml each of IgG1 κ/λ, IgG2a κ/λ, IgG2b κ/λ, IgG3 κ/λ, IgA κ/λ, IgM κ/λ and IgE κ, and the absolute amount of IgG2b was calculated using the following equation:
MFI IgG2bκ unknown sample / MFI IgG2bκ standard * the dilution multiple *0.25μg/ml
The results showed in the following Author response table 2, the trend is similar to MFI.
3) The data on neutralization assays in Figure 4 is not sufficiently convincing. The authors should perform neutralization assays for H1N1 and H3N2 and other strains to prove that their vaccine candidate is effective against a wide range of influenza viruses. Also, they should conduct a statistical test to show significant differences.
Thanks for your comments and constructive advices. According to your suggestion, we have supplemented neutralization assays for H1N1 A/Brisbane/02/2018 and H3N2 A/Kansas/14/2017 using the same batch of frozen serum samples which were used in neutralization assays for H1N1 A/Michigan/45/2015 and H3N2 A/Hong Kong/ 4801/2014 in our original manuscript. These four strains are all the living influenza virus strains we can obtain in current situation. We are so sorry that we have not been allowed to obtain any other living influenza virus strains to further verify the broad spectrum of NMHC. We agree that neutralization assays for these four strains were not enough to say that NMHC was effective against a wide range of influenza viruses. Therefore, we used the ELISA and Biacore assays, selected the HA fragments of representative influenza virus subtypes, to evaluate the broad binding properties of antibodies induced by NMHC. According to your advice, we reanalyzed the results of neutralization assays and conducted a statistical test to show significant differences by geometric mean titer (GMT). In our revised manuscript, the original Figure 4 has been replaced by the new Figure 4 showed.
4) The ELISA and Biacore assay indicate that the binding capacity of the antibodies induced by vaccination is higher against H2, H5, and H9 than H1, H3, and H7. They should discuss this.
Thanks for your careful reading and comment. As described in Materials and methods part in our manuscript, in the ELISA and Biacore assays, H2, H5, H7, and H9 were commercial recombinant HA proteins, while H1 and H3 were split viruses. It might be that the complex composition and conformation of the split viruses led to the relatively lower binding capacities to H1 and H3 in the ELISA and Biacore results. As to H7, we can see from the Table S2, the ELISA endpoint titers calculated from Figure 5, showed that the titer of H7 induced by NMHC was the same with titers of H2, H5, and H9.
Theoretically, the long α-helix regions of hemagglutinin (amino acids 76–130 from the HA2) were conserved among H1, H2, H3, H5, H7, and H9 (Author response image 1), so the binding capacities of antibodies induced by NMHC to these HAs should be similar. Furthermore, we learned a lot from your advices and we really appreciate your professional comments.
5) The T-cell responses induced by NMHC are not different from those induced by SEC2 alone in Figure 8. The authors should verify whether the induced T cell response is influenza antigen-specific. Specifically, cytokine production should be detected after stimulating splenocytes of post-immunized mice with influenza antigens without SEC2.
Thank you very much for your suggestion. As you mentioned, the T-cell responses in figure 8 was not antigen-specific because that the T cells had not been treated with any antigens in vitro. According to your advice, we have repeated the animal immunization experiment to detect the IL-4 and IFN-γ cytokine production after stimulating splenocytes of post-immunized mice with NMH without SEC2 and SEC2 alone. In brief, female wild-type BALB/c mice were respectively immunized with 200 μg NMHC, 100 μg NMH, 100 μg SEC2, 100 μg NMH plus 100 μg SEC2, and PBS (control) by i.p. for three times with interval of 14 days. Two weeks after the third immunization, splenocytes from each group were collected and treated with 1000 ng/mL SEC2 alone or 1000 ng/mL NMH alone, and PBS was served as CK. Then, the culture supernatants were harvested at 48 h to detect the production of IL-4 and IFNγ by ELISA following the manufacturer’s instructions. In figure 8C, the results showed that, in NMHC, NMH+SEC2 and NMH immunized groups, the productions of IL-4 and IFN-γ treated with NMH were significantly higher than CK (p < 0.05), while SEC2 and PBS immunized groups didn't show significant changes. This result verified that the T cell response induced by NMH treatment is influenza antigen-specific. However, the splenocytes from all of the immunized groups produced high levels of IL-4 and IFN-γ after SEC2 treatment in vitro, and there were no significant differences among the five immunized groups. As a superantigen, SEC2 could induce nonspecific T cell responses, leading to massive production of cytokine. According to your comment, we have added this supplementary experiment and results to our revised manuscript, and added to Figure 8C in our revised manuscript.
6) Two IgG2b are shown in the Plot representing the standard in Figure 3. I guess that one of the two is IgG2a. Please correct the figure.
Thank you for your careful checks. We are sorry for this typo. In Figure 3A, the second clusters of beads represented the immunoglobulins of IgG2aκ, from top to bottom. And we have revised the WHOLE manuscript carefully to avoid these errors.
7) There is no match between each KD shown in Figure 6 and the KD in the text.
Thank you for your careful checking. We are sorry for this miswriting. We have revised the Response Unit charts of Figure 6 C and D. The KDs of H3 and H5 are 685 nM and 72.9 nM, respectively, which is consistent with the text.
8) The sentence "IL-4 (for Th1 subtype), IFN-γ (for Th2 subtype)" should be corrected to "IFN-γ (for Th1 subtype), IL-4 (for Th2 subtype)" (Page 34, Line 558).
Thank you for your careful checks. We have revised this mistyping and check the whole manuscript carefully to avoid such errors.
Reviewer #3:
This manuscript describes a vaccine construct comprised of multiple segments derived from influenza proteins, and in some cases conjugated to staphylococcal enterotoxin C2. There is an impressive amount of data and the workup of the immune response is quite detailed, including humoral, cellular, and protection data in mice. Overall, the impression is that this construct has the potential to move forward as a vaccine candidate. In addition, the provided data support their conclusions.
The data are clearly presented in most sections, and I am impressed that in places where multiple replicates were performed, the authors listed the number of replicates and the statistical measures.
The grammar of the manuscript needs work, and the text would benefit from copy-editing at a minimum and might even benefit from editing for length in some sections.
Thank you for careful checking and constructive advice. We have revised the WHOLE manuscript carefully to avoid language errors. In addition, we have asked the Edanz Group China, a professional English editing agency, to polish our manuscript. We believe that the language is now acceptable for the review process. The following figure shows the certificate of English editing.
In some places, I would probably have presented some of the data differently. For example, I typically display bead-based antibody binding assays on a logarithmic scale which is more in line with the type of data shown. That being said, there is nothing deceptive in how the data are presented, so a change may not be necessary.
Thank you for your suggestion. We think you are referring to the results of Figure 3 in our original manuscript. According to the instruction manual of Mouse Immunoglobulin Isotyping Kit (Cat. No.550026), we used the MFI, the original data, to represent the amount of immunoglobulins. Furthermore, MFI was widely used by researchers such as Edward Morgan (doi:10.1016/j.clim.2003.11.017), Yunxiao Zhao (doi:10.1016/j.cca.2014.09.018) and Yang He (doi:10.1016/j.cca.2012.10.035) to represent the amount of immunoglobulins. Anyhow, we really appreciate your constructive advice.
I do not recommend additional experimentation. I do think that moving this candidate forward through regulatory bodies may face significant hurdles, but that is not the problem being addressed in this paper.
Thank you for your recognition of our work. The main purpose of our study is to provide proof of concept for combining conserved antigens inducing cross-protective antibody response with epitopes activating cross-protective T cell response would against multiple influenza virus infection. The recombinant protein NMHC is rather an example for this strategy than a certain vaccine. The structure of NMHC must be further optimized, and the safety evaluation and effectiveness validation are needed before it become a candidate vaccine. But this is really beyond the scope of this manuscript.
Finally, I think Figure 13 is really more suited to a review article and not appropriate for this manuscript.
Thank you very much for your suggestion. We used Figure 13 to better illustrate the anti-influenza immune response mechanisms induced by NMHC. We can delete it if you and the editor think it is not appropriate for this manuscript.
https://doi.org/10.7554/eLife.71725.sa2Article and author information
Author details
Funding
Strategic Priority Research Program of the Chinese Academy of Sciences Grant (XDA12020225)
- Mingkai Xu
Liaoning Revitalization Talents Program (XLYC1807226)
- Mingkai Xu
Science and Technology Plan Projects of Shenyang City Grants (Y17-4-003)
- Mingkai Xu
Shengyang High level Innovative Talents Program (RC190060)
- Mingkai Xu
Science and Technology Agency Livelihood Program of Liaoning Province of China (2021JH2/10300075)
- Mingkai Xu
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank J Ludovic Croxford, PhD, from Liwen Bianji (Edanz) (https://www.liwenbianji.cn) for editing the language of a draft of this manuscript.
Ethics
This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health . All animal procedures were performed according to approved Institutional Animal Care and Use Committee (IACUC) guidelines of University of Chinese Academy of Sciences (permit-number IAE.No20191010A0120). All surgery was performed under tribromoethanol anesthesia, and every effort was made to minimize suffering.
Senior Editor
- Tadatsugu Taniguchi, Institute of Industrial Science, The University of Tokyo, Japan
Reviewing Editor
- Tomohiro Kurosaki, Osaka University, Japan
Reviewer
- Tony Moody, Duke University, United States
Publication history
- Received: June 28, 2021
- Preprint posted: July 8, 2021 (view preprint)
- Accepted: November 13, 2021
- Accepted Manuscript published: November 16, 2021 (version 1)
- Version of Record published: December 1, 2021 (version 2)
Copyright
© 2021, Li et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 531
- Page views
-
- 85
- Downloads
-
- 0
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Biochemistry and Chemical Biology
- Epidemiology and Global Health
Background:
Few studies have assessed the role of individual plasma cholesterol levels in the association between egg consumption and the risk of cardiovascular diseases. This research aims to simultaneously explore the associations of self-reported egg consumption with plasma metabolic markers and these markers with the risk of cardiovascular disease (CVD).
Methods:
Totally 4778 participants (3401 CVD cases subdivided into subtypes and 1377 controls) aged 30–79 were selected based on the China Kadoorie Biobank. Targeted nuclear magnetic resonance was used to quantify 225 metabolites in baseline plasma samples. Linear regression was conducted to assess associations between self-reported egg consumption and metabolic markers, which were further compared with associations between metabolic markers and CVD risk.
Results:
Egg consumption was associated with 24 out of 225 markers, including positive associations for apolipoprotein A1, acetate, mean HDL diameter, and lipid profiles of very large and large HDL, and inverse associations for total cholesterol and cholesterol esters in small VLDL. Among these 24 markers, 14 were associated with CVD risk. In general, the associations of egg consumption with metabolic markers and of these markers with CVD risk showed opposite patterns.
Conclusions:
In the Chinese population, egg consumption is associated with several metabolic markers, which may partially explain the protective effect of moderate egg consumption on CVD.
Funding:
This work was supported by the National Natural Science Foundation of China (81973125, 81941018, 91846303, 91843302). The CKB baseline survey and the first re-survey were supported by a grant from the Kadoorie Charitable Foundation in Hong Kong. The long-term follow-up is supported by grants (2016YFC0900500, 2016YFC0900501, 2016YFC0900504, 2016YFC1303904) from the National Key R&D Program of China, National Natural Science Foundation of China (81390540, 81390541, 81390544), and Chinese Ministry of Science and Technology (2011BAI09B01). The funders had no role in the study design, data collection, data analysis and interpretation, writing of the report, or the decision to submit the article for publication.
-
- Computational and Systems Biology
- Epidemiology and Global Health
The endocannabinoid system consists mainly of 2-arachidonoylglycerol and anandamide, as well as cannabinoid receptor type 1 (CB1) and type 2 (CB2). Based on previous studies, we hypothesized that a circulating peptide previously identified as Osteogenic Growth Peptide (OGP) maintains a bone-protective CB2 tone. We tested OGP activity in mouse models and cells, and in human osteoblasts. We show that the OGP effects on osteoblast proliferation, osteoclastogenesis, and macrophage inflammation in vitro, as well as rescue of ovariectomy-induced bone loss and prevention of ear edema in vivo are all abrogated by genetic or pharmacological ablation of CB2. We also demonstrate that OGP binds at CB2 and may act as both an agonist and positive allosteric modulator in the presence of other lipophilic agonists. In premenopausal women, OGP circulating levels significantly decline with age. In adult mice, exogenous administration of OGP completely prevented age-related bone loss. Our findings suggest that OGP attenuates age-related bone loss by maintaining a skeletal CB2 tone. Importantly, they also indicate the occurrence of an endogenous peptide that signals via CB2 receptor in health and disease.