MCPH1 inhibits Condensin II during interphase by regulating its SMC2-Kleisin interface
- Department of Biochemistry, University of Oxford, United Kingdom
- Division of Structural Biology, The Institute of Cancer Research, United Kingdom
- The Center for Genome Architecture, Department of Molecular and Human Genetics, Baylor College of Medicine, United States
- Medical Scientist Training Program, Baylor College of Medicine, Department of Bioengineering, Rice University, United States
- Center for Theoretical Biological Physics, Rice University, United States
- Human Technopole, Italy
Figures
Figure 1 with 2 supplements
The deletion of Mcph1 in E14 cells induces condensin II-dependent chromosome condensation in both G1 and G2 phases of the cell cycle.
(A) In gel TMR-Halo detection and western blot analysis of E14 cells wild type, Ncaph2Halo/Halo and Ncaph2Halo/Halo Mcph1Δ/Δ. TMR signal detects NCAPH2-Halo tagged. The anti-NCAPH2 antibody shows …
-
Figure 1—source data 1
Raw data uncropped blots corresponding to Figure 1A.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig1-data1-v2.zip
-
Figure 1—source data 2
Raw data uncropped blots corresponding to Figure 1D.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig1-data2-v2.zip
Figure 1—figure supplement 1
The cell cycle parameters are unchanged in Mcph1-deleted cells.
FACS analysis of the cell cycle parameters of Mcph1 deleted cells compared to wild type: (A) Analysis of the DNA content using propidium Iodide (repeated twice). (B) EdU incorporation (repeated …
-
Figure 1—figure supplement 1—source data 1
Raw data uncropped blots corresponding to Figure 1A.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig1-figsupp1-data1-v2.zip
Figure 1—figure supplement 2
Chromocenters disruption in Mcph1 deleted cells.
Top: Immunofluorescence analysis of centromere clustering using CREST antibody showing that in Mcph1-deleted cells, the centromeres are scattered in the nucleus even in replicating, EdU-positive …
-
Figure 1—figure supplement 2—source data 1
Raw data of foci quantification.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig1-figsupp2-data1-v2.xlsx
Figure 2
Mcph1 deletion induces the stable binding of condensin II to the condensed chromosomes in interphase.
FRAP analysis of NCAPH2-Halo turn-over on chromatin in Mcph1wt/wt (A) and Mcph1Δ/Δ cells (B). Top row: NCAPH2-Halo signal pre-bleach, post bleach and after 70 s recovery. The region bleached …
-
Figure 2—source data 1
Microsoft excel of FRAP measurements.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig2-data1-v2.xlsx
Figure 3
CDK1 activity is not required for the condensation phenotype induced by Mcph1 deletion.
(A) Western blot analysis of CDK1 phosphorylation on tyrosine 15 in wild-type cells compared to Mcph1-deleted cells. Wild-type protein extracts were treated by λ phosphatase as a control of antibody …
-
Figure 3—source data 1
Raw data uncropped blots corresponding to Figure 3A.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig3-data1-v2.zip
Figure 4 with 1 supplement
Mcph1 deletion causes chromosome compaction and loss of chromocenters.
(A) Representative subset of interactions between chromosomes 1–7 for wild-type and Mcph1 deletion maps (wild-type below diagonal) shows loss of chromocenters in the Mcph1 deletion maps. The …
Figure 4—figure supplement 1
Mcph1 deletion decreases intra-compartment strength and does not affect looping.
(A) Pearson correlation map at 250 kB for wildtype and Mcph1 deletion maps for the intrachromosomal region of chromosome 11 (wildtype below diagonal). (B) Pearson correlation map at 250 kB for …
Figure 5 with 1 supplement
Human condensin II interaction with MCPH1.
(A) Domain structure of MCPH1 and MBP fusion constructs that were expressed in E. coli and used in binding assays. BRCT domains are indicated in green and the central domain in yellow. (B) …
-
Figure 5—source data 1
Microsoft excel data corresponding to Figure 5F.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig5-data1-v2.xlsx
-
Figure 5—source data 2
Microsoft excel data corresponding to Figure 5G.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig5-data2-v2.xlsx
-
Figure 5—source data 3
Raw data uncropped gels corresponding to Figure 5C, D and E.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig5-data3-v2.zip
Figure 5—figure supplement 1
Condensin I does not interact with MCPH1.
(A) Strep-tag pull-down assay indicating strep tagged condensin I does not pull-down any MBP-MCPH1 construct. SDS page visualised with Coomassie stain for input samples and silver stain for resin …
-
Figure 5—figure supplement 1—source data 1
Raw data uncropped gels corresponding to Figure 5—figure supplement 1B, C.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig5-figsupp1-data1-v2.zip
-
Figure 5—figure supplement 1—source data 2
Microsoft excel data corresponding to Figure 5—figure supplement 1B.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig5-figsupp1-data2-v2.xlsx
Figure 6
MCPH1 interaction with condensin II is essential to prevent interphasic chromosome condensation.
(A) Co-immunoprecipitation of MCPH1 with NCAPH2-GFP. Nuclear extracts were prepared from wild type, Ncaph2GFP/GFP and Ncaph2GFP/GFP Mcph1Δ/Δcells. Immunoprecipitation was performed using GFP-trap …
-
Figure 6—source data 1
Raw data uncropped gels corresponding to Figure 6A.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig6-data1-v2.zip
-
Figure 6—source data 2
Raw data uncropped gels corresponding to Figure 6B.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig6-data2-v2.zip
-
Figure 6—source data 3
Raw data uncropped gels corresponding to Figure 6C.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig6-data3-v2.zip
Figure 7
MCPH1 has little effect on condensin II ATP hydrolysis and DNA binding.
(A) ATPase rate of condensin II complex in the presence of MCPH1. Q refers to condensin II with an ATPase deficient mutation in the Q-loop. Below is an SDS page gel of the completed reaction. Error …
-
Figure 7—source data 1
Microsoft excel data corresponding to the standard curve in Figure 7A.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig7-data1-v2.xlsx
-
Figure 7—source data 2
Microsoft excel data corresponding to the ATPase curve in Figure 7A.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig7-data2-v2.xlsx
-
Figure 7—source data 3
raw data uncropped gels corresponding to Figure 7.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig7-data3-v2.zip
Figure 8
MCPH1 prevents the association of condensin II with chromosomes.
(A) Cartoon summarizing the experimental procedure corresponding to panel B. (B) Wild-type mouse oocytes were injected at the GV stage with in vitro transcribed mRNA coding for H2B-mCherry alone to …
-
Figure 8—source data 1
Microsoft excel file of fluorescence measurements in Figure 8E.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig8-data1-v2.xlsx
Figure 9
The closure of the SMC2-NCAPH2 interface prevents MCPH1 inhibitory effect.
(A) Schematic representation of the protein fusion between SMC2 C-terminus and the N-terminus of NCAPH2 using a linker comprising three TEV protease cleavage sites. (B) Cartoon summarizing the …
-
Figure 9—source data 1
Microsoft excel file of fluorescence measurements in Figure 9F.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig9-data1-v2.xlsx
Figure 10 with 2 supplements
Mcph1 deletion induces the coiling of the vermicelli.
(A) Immunofluorescence analysis of the chromatin organisation in the four conditions: wild-type, ΔWapl, ΔMcph1, and ΔWapl ΔMcph1. In order to compare cells that are in G2, prophase or metaphase, …
Figure 10—figure supplement 1
Western blot analysis of the four conditions analysed in Figure 10 and Figure 11.
The first cell line is: Ncaph2GFP/GFP Scc1Halo/Halo WaplTevLox/Δ Mcph1wt/wt. The second cell line is: Ncaph2GFP/GFP Scc1Halo/Halo WaplTevLox/Δ Mcph1Δ/Δ. Wapl can be deleted in both cell lines after …
-
Figure 10—figure supplement 1—source data 1
Raw data uncropped blots corresponding to Figure 10—figure supplement 1.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig10-figsupp1-data1-v2.zip
Figure 10—figure supplement 2
Quantification of NCAPH2-GFP and SCC1-Halo on the chromosome axes in ΔWapl cells.
In order to address if NCAPH2-GFP was enriched on the chromosome axis of ΔWapl cells, the fluorescence of SCC1-Halo (red) and NCAPH2 GFP (green) was quantified across the axis of three different …
-
Figure 10—figure supplement 2—source data 1
Raw data of the fluorescence quantification.
- https://cdn.elifesciences.org/articles/73348/elife-73348-fig10-figsupp2-data1-v2.xlsx
Figure 11 with 1 supplement
Super-resolution 3D-SIM analysis of G2 and metaphase cells deleted for Wapl or both Mcph1 and Wapl.
(A) Cells deleted for ΔWapl or ΔWapl+ΔMcph1 in G2 or metaphase (M) were analysed by 3D-SIM. Maximum intensity projections of 16 consecutive mid sections covering 2 µm in depth. The left panel shows …
Figure 11—video 1
3D video rendering of the segmented and isolated solenoid from Figure 11 panel B.
Tables
Table 1
Peptides used in FP experiments.
| Name | Sequence |
|---|---|
| 5FAM-MCPH1 | 5FAM- CGESSYDDYFSPDNLKER |
| MCPH1 | CGESSYDDYFSPDNLKER |
| MCPH1pS417 | CGESSYDDYF{pSER}PDNLKER |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| strain, strain background (Escherichia coli) | XL1-Blue Competent Cells | Thermo-competent | Prepared in the lab | Used to prepare plasmid DNA |
| Strain, strain background (S. frugiperda) | Sf9 insect cells | Thermo Fisher | Cat# 11496015 | |
| Strain, strain background (Trichoplusia ni) | High-Five insect cells | Thermo Fisher | Cat# B85502 | |
| strain, strain background (Escherichia coli) | DH10EMBacY | Geneva biotech | ||
| genetic reagent (Mouse) | Ncaph2tm1a(EUCOMM)Wtsi, ZP3-Cre | Houlard et al., 2015 DOI:10.1038/ncb3167 | Isolation of Mouse oocytes deleted for Ncaph2 | |
| cell line (Mouse) | ES-E14 mouse embryonic stem cells | https://web.expasy.org/cellosaurus/CVCL_C320 | RRID:CVCL_C320 | |
| cell line (Mouse) | E14-Ncaph2Halo/Halo | This paper | E14 cells homozygous Halo tag Cterminal NCAPH2 | |
| cell line (Mouse) | E14-Ncaph2Halo/Halo, Mcph1Δ/Δ | This paper | E14 cells homozygous Halo tag C-terminal NCAPH2, deleted for Mcph1 | |
| cell line (Mouse) | E14-Ncaph2GFP/GFP | This paper | E14 cells homozygous GFP tag C-terminal NCAPH2 | |
| cell line (Mouse) | E14-Ncaph2GFP/GFP Mcph1Δ | This paper | E14 cells homozygous GFP tag C-terminal NCAPH2, deleted for Mcph1 | |
| cell line (Mouse) | E14- Ncaph2Halo/Halo Mcph1GFP/GFP | This paper | E14 cells homozygous GFP tag C-terminal MCPH1 and Halo tag NCAPH2, | |
| cell line (Mouse) | E14- Ncaph2Halo/Halo Mcph1ΔCENGFP/ΔCENGFP | This paper | E14 cells homozygous GFP tag C-terminal MCPH1 deleted of central domain,and Halo tag NCAPH2, | |
| cell line (Mouse) | E14-SCC1Halo/Halo, Ncaph2GFP/GFP,WaplLox/Lox, Rosa26CreERT2-LoxSTOPTEV/ CreERT2-LoxSTOPTEV | This paper | See Figure 10 | |
| cell line (Mouse) | E14-SCC1Halo/Halo, Ncaph2GFP/GFP,WaplLox/Lox, Rosa26CreERT2-LoxSTOPTEV/ CreERT2-LoxSTOPTEVMcph1Δ/Δ | This paper | See Figure 10 | |
| transfected construct (mouse) | pUC19-NCAPH2 Halo TV | This paper | Targeting Halo tag C-terminal Ncaph2 | |
| transfected construct (mouse) | pUC19-NCAPH2 GFP TV | This paper | Targeting GFP tag C-terminal Ncaph2 | |
| transfected construct (mouse) | pUC19-MCPH1 GFP TV | This paper | Targeting GFP tag C-terminal MCPH1 | |
| transfected construct (mouse) | pUC19-MCPH1 ΔCEN TV | This paper | Targeting deletion of the central domain of MCPH1 | |
| transfected construct (mouse) | pUC19-SCC1 Halo TV | This paper | Targeting Halo tag C-terminal SCC1 | |
| transfected construct (mouse) | pUC19-Rosa26 STOPLoxTEV TV | This paper | Targeting the insertion of the STOP-Lox-TEV cassette at Rosa 26 | |
| transfected construct (mouse) | pUC19-WAPL TEV LOX TV | This paper | Targeting the TEV sites and the LoxP sites in Wapl | |
| antibody | NCAPH2 (rabbit polyclonal) | Produced on demand by Eurogentec | WB: (1/1000) | |
| antibody | SCC1 (mouse monoclonal) | Millipore | 53 A303 | WB: (1/1000) |
| antibody | SMC2 (rabbit monoclonal) | Cell Signaling Technology | D23C5 | WB: (1/500) |
| antibody | Lamin B1 (rabbit monoclonal) | Abcam | Ab133741 | WB: (1/1000) |
| antibody | MCPH1 (rabbit monoclonal) | Cell Signaling Technology | D38G5 | WB: (1/1000) |
| antibody | CREST (human autoantibody) | Immunovision | HCTO-100 | IF: (1/500) |
| antibody | H3PS10 (mouse monoclonal) | Millipore | 3 H10 | WB: (1/1000) IF: (1/2000) |
| antibody | ΔH2AX (mouse monoclonal) | Millipore | JBW301 | WB: (1/1000) IF: (1/500) |
| antibody | CDK1 (rabbit polyclonal) | Cell Signaling Technology | 77,055 | WB: (1/1000) |
| antibody | Phospho-CDK1 (rabbit polyclonal) | Cell Signaling Technology | 9,111 | WB: (1/1000) |
| antibody | WAPL (rabbit polyclonal) | J.M. Peters Lab | WB: (1/1000) | |
| antibody | GFP (rabbit polyclonal) | Abcam | Ab290 | WB: (1/1000) IF: (1/500) |
| antibody | PK-Tag (mouse monoclonal) | Biorad | MCA 1360 G | WB: (1/1000) |
| antibody | Cyclin B1 (rabbit monoclonal) | Cell Signaling Technology | 4138T | IF: (1/200) |
| antibody | NCAPD3 (rabbit polyclonal) | Bethyl Laboratories | A300-604A-M | WB: (1/1000) |
| antibody | AlexaFluor-488 secondary antibody anti mouse | Life Technology | A-11001 | Secondary antibody for IF |
| antibody | AlexaFluor-488 secondary antibody anti rabbit | Life Technology | A-11008 | Secondary antibody for IF |
| antibody | AlexaFluor-594 secondary antibody anti mouse | Life Technology | A-11005 | Secondary antibody for IF |
| antibody | AlexaFluor-594 secondary antibody anti rabbit | Life Technology | A-11012 | Secondary antibody for IF |
| antibody | mouse anti-CAP-D3 antibody | Santa Cruz | Sc-81597 | WB (1:1000) |
| antibody | goat DyLight 800 florescent anti-mouse secondary antibodies | Cell Signaling Technology | Cat #5,257 | WB (1:5000) |
| recombinant DNA reagent | Mouse Ncaph2 cDNA | Origene | MC200537 | Initial cDNA used for cloning in pRNA |
| recombinant DNA reagent | Mouse Mcph1 cDNA | Dharmacon | 5697978 | Initial cDNA used for cloning in pRNA |
| recombinant DNA reagent | Mouse SMC2 cDNA | Source Bioscience | IRAV p968E12162D | Initial cDNA used for cloning in pRNA |
| recombinant DNA reagent | pRNA-NCAPH2-GFP | Houlard et al., 2015 DOI:10.1038/ncb3167 | In vitro transcription of NCAPH2 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-Mad2 | Houlard et al., 2015 DOI:10.1038/ncb3167 | In vitro transcription of Mad 2 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-H2b-mCherry | Houlard et al., 2015 DOI: 10.1038/ncb3167 | In vitro transcription of H2b-mCherry mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-MCPH1 | This paper | In vitro transcription of mouse MCPH1 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-MCPH1-Δ200 | This paper | In vitro transcription of mouse MCPH1 deleted of the N-terminal 200aa mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-Fusion SMC2-NCAPH2 | This paper | In vitro transcription of the fusion SMC2-NCAPH2 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-TEV | Houlard et al., 2015 DOI:10.1038/ncb3167 | In vitro transcription of TEV mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pSptCas9(BB)–2A-Puro | Addgene | 62,988 | Cloning of the SgRNA |
| recombinant DNA reagent | pUC19 | NEB | Cloning of the targeting construct for CRISPR/Cas9 targeting | |
| Recombinant DNA reagent | pLIB | Jan-Michael Peters lab, IMP | Addgene plasmid # 80,610 | |
| Recombinant DNA reagent | pLIB MCPH1 | Genscript | ||
| Recombinant DNA reagent | pET His6 MBP TEV LIC cloning vector | Scott Gradia lab, UC Berkeley | Addgene plasmid # 29,656 | |
| Recombinant DNA reagent | pET His6 MBP MCPH1 1–435 | This study | ||
| Recombinant DNA reagent | pET His6 MBP MCPH1 1–195 | This study | ||
| Recombinant DNA reagent | pET His6 MBP MCPH1 196–435 | This study | ||
| Recombinant DNA reagent | pET His6 MCPH1 1–435 MBP | This study | ||
| sequence-based reagent | GGTGGAAAGTAGTATATACC | This paper | Sg RNA used for: NCAPH2-GFP | |
| sequence-based reagent | GGTGGAAAGTAGTATATACC | This paper | Sg RNA used for: NCAPH2-Halo | |
| sequence-based reagent | GGTGTGCAATTCCTAGTGTG | This paper | Sg RNA used for: MCPH1 deletion Sg5' | |
| sequence-based reagent | AGCTGTTCCTTAGAACACGA | This paper | Sg RNA used for: MCPH1 deletion Sg3' | |
| sequence-based reagent | ACAGTGAGACATCTACAATG | This paper | Sg RNA used for: MCPH1-GFP | |
| sequence-based reagent | CATGGATTTCTCCGGTGAAT | This paper | Sg RNA used for: STOP-TEV | |
| sequence-based reagent | AATGGGTGCTTATAATTAGC | This paper | Sg RNA used for: WAPL-Lox-TEV Sg5' | |
| sequence-based reagent | ACAATGTCACAATGGCTCAT | This paper | Sg RNA used for: WAPL-Lox-TEV Sg3' | |
| sequence-based reagent | ATAATATGGAACCGTGGTCC | This paper | Sg RNA used for: SCC1-Halo | |
| sequence-based reagent | cgttgaggcttcttcctatg | This paper | Sg RNA used for: DELCEN-MCPH1 | |
| sequence-based reagent | AATGGGTGCTTATAATTAGC and ACAATGTCACAATGGCTCAT | This paper | Sg RNA used for: TEV sites in Wapl | |
| peptide, recombinant protein | 5FAM-MCPH1407-422 | Genscript | ||
| peptide, recombinant protein | MCPH1407-422 | Genscript | ||
| peptide, recombinant protein | MCPH1407-422pS417 | Genscript | ||
| commercial assay or kit | Click-iT EdU Alexa Fluor 488 Imaging kit | In vitrogen | C10337 | EdU fluorescent labeling |
| commercial assay or kit | Gibson assembly | NEB | E5510S | Cloning kit |
| commercial assay or kit | GFP-trap agarose beads | Chromotek | GTA-10 | GFP tagged protein purification |
| Commercial assay or kit | HiTrap Q HP | cytiva | Cat #17–0407 | |
| Commercial assay or kit | HiTrap Heparin HP | cytiva | Cat #17–0407 | |
| Commercial assay or kit | StrepTrap HP | cytiva | Cat #28–9075 | |
| Commercial assay or kit | Superose 6 Increase 10/300 GL | cytiva | Cat #29-0915-96 | |
| Commercial assay or kit | Superdex 200 Increase 10/300 GL | cytiva | Cat # 28990944 | |
| Commercial assay or kit | HiLoad 16/60 Superdex 200 | GE Healthcare | Cat# GE28-9893-35 | |
| Commercial assay or kit | EnzChek phosphate assay kit | Invitrogen | Cat# E6 | |
| Commercial assay or kit | 4%–12% NuPAGE Bis-Tris gels | Invitrogen | Cat #NW04125 | |
| Commercial assay or kit | Color Prestained Protein Standard, Broad Range 11–245 kDa | NEB | Cat # P7719 | |
| Commercial assay or kit | Pierce Silver Stain Kit | Thermo Scientific | Cat # 24,612 | |
| Commercial assay or kit | InstantBlue Coomassie Protein Stain | Abcam | Cat #ab119211 | |
| Chemical compound, drug | cellfectin II | Gibco, Thermo Fisher | Cat #10362100 | |
| Chemical compound, drug | FBS | Gibco, Thermo fisher | Cat #10082139 | |
| Chemical compound, drug | Pierce Protease Inhibitor Tablets | Thermo Scientific | Cat #A32965 | |
| Chemical compound, drug | Benzonase | millipore | Cat #E1014 | |
| Chemical compound, drug | HisPur Ni-NTA Resin | Thermo Scientific | Cat #88,221 | |
| Chemical compound, drug | Strep-tactin Sepharose resin | Iba-lifesciences | Cat # 2-1201-002 | |
| chemical compound, drug | HALO-PROTAC | Promega | CS2072A01 | In vivo degradation of Halo-NCAPH2 |
| chemical compound, drug | Halo-TMR | Promega | G8251 | Halo tagged protein detection |
| chemical compound, drug | Halo-JFX554 | Grimm et al., 2021 DOI:10.1021/jacsau.1c00006 | Halo tag detection by fluorescence | |
| chemical compound, drug | RO-3306 | Sigma | SML0569 | CDK1 inhibitor |
| chemical compound, drug | Lipofectamine 2000 | Thermofisher | 11668030 | E14 transfection reagent |
| chemical compound, drug | Q5 DNA polymerase | NEB | M0491L | PCR amplification |
| software, algorithm | CRISPOR | http://crispor.tefor.net/crispor.py | Guide RNA design | |
| software, algorithm | EasyFRAP | http://easyfrap.vmnet.upatras.gr | FRAP data analysis | |
| software, algorithm | Fiji 2.0.0-rc-49/1.52i | NIH Image | http://fiji.sc/ | Image analysis and quantification |
| Software | Image studio | Li-Cor |
